Sample records for dependent electron transfer

  1. Conversion and origin of normal and abnormal temperature dependences of kinetic isotope effect in hydride transfer reactions.

    PubMed

    Zhu, Xiao-Qing; Li, Xiu-Tao; Han, Su-Hui; Mei, Lian-Rui

    2012-05-18

    The effects of substituents on the temperature dependences of kinetic isotope effect (KIE) for the reactions of the hydride transfer from the substituted 5-methyl-6-phenyl-5,6-dihydrophenanthridine (G-PDH) to thioxanthylium (TX(+)) in acetonitrile were examined, and the results show that the temperature dependences of KIE for the hydride transfer reactions can be converted by adjusting the nature of the substituents in the molecule of the hydride donor. In general, electron-withdrawing groups can make the KIE to have normal temperature dependence, but electron-donating groups can make the KIE to have abnormal temperature dependence. Thermodynamic analysis on the possible pathways of the hydride transfer from G-PDH to TX(+) in acetonitrile suggests that the transfers of the hydride anion in the reactions are all carried out by the concerted one-step mechanism whether the substituent is an electron-withdrawing group or an electron-donating group. But the examination of Hammett-type free energy analysis on the hydride transfer reactions supports that the concerted one-step hydride transfer is not due to an elementary chemical reaction. The experimental values of KIE at different temperatures for the hydride transfer reactions were modeled by using a kinetic equation formed according to a multistage mechanism of the hydride transfer including a returnable charge-transfer complex as the reaction intermediate; the real mechanism of the hydride transfer and the root that why the temperature dependences of KIE can be converted as the nature of the substituents are changed were discovered.

  2. A nonmonotonic dependence of standard rate constant on reorganization energy for heterogeneous electron transfer processes on electrode surface

    NASA Astrophysics Data System (ADS)

    Xu, Weilin; Li, Songtao; Zhou, Xiaochun; Xing, Wei; Huang, Mingyou; Lu, Tianhong; Liu, Changpeng

    2006-05-01

    In the present work a nonmonotonic dependence of standard rate constant (k0) on reorganization energy (λ) was discovered qualitatively from electron transfer (Marcus-Hush-Levich) theory for heterogeneous electron transfer processes on electrode surface. It was found that the nonmonotonic dependence of k0 on λ is another result, besides the disappearance of the famous Marcus inverted region, coming from the continuum of electronic states in electrode: with the increase of λ, the states for both Process I and Process II ET processes all vary from nonadiabatic to adiabatic state continuously, and the λ dependence of k0 for Process I is monotonic thoroughly, while for Process II on electrode surface the λ dependence of k0 could show a nonmonotonicity.

  3. Effect of group electronegativity on electron transfer in bis(hydrazine) radical cations.

    PubMed

    Qin, Haimei; Zhong, Xinxin; Si, Yubing; Zhang, Weiwei; Zhao, Yi

    2011-04-14

    The radical cation of 4,10-ditert-butyl-5,9-diisopropyl-4,5,9,10-tetraazatetracyclo[6.2.2.2]-tetradecane (sBI4T(+)), as well as its substituted bis(hydrazine) radical cations, is chosen for the investigation of the electronegativity dependence of its intramolecular electron transfer. To do so, two parameters, reorganization energy and electronic coupling, are calculated with several ab initio approaches. It is found that the electronic couplings decrease with the increase of the group electronegativity while the reorganization energies do not show an explicit dependency. Furthermore, Marcus formula is employed to reveal those effect on the electron transfer rates. The predicted rates of electron transfer generally decrease with increasing group electronegativity, although not monotonically.

  4. A nonmonotonic dependence of standard rate constant on reorganization energy for heterogeneous electron transfer processes on electrode surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu Weilin; Li Songtao; Zhou Xiaochun

    2006-05-07

    In the present work a nonmonotonic dependence of standard rate constant (k{sup 0}) on reorganization energy ({lambda}) was discovered qualitatively from electron transfer (Marcus-Hush-Levich) theory for heterogeneous electron transfer processes on electrode surface. It was found that the nonmonotonic dependence of k{sup 0} on {lambda} is another result, besides the disappearance of the famous Marcus inverted region, coming from the continuum of electronic states in electrode: with the increase of {lambda}, the states for both Process I and Process II ET processes all vary from nonadiabatic to adiabatic state continuously, and the {lambda} dependence of k{sup 0} for Process Imore » is monotonic thoroughly, while for Process II on electrode surface the {lambda} dependence of k{sup 0} could show a nonmonotonicity.« less

  5. The influence of dielectric relaxation on intramolecular electron transfer

    NASA Astrophysics Data System (ADS)

    Heitele, H.; Michel-Beyerle, M. E.; Finckh, P.

    1987-07-01

    An unusually strong temperature dependence on the intramolecular electron-transfer rate has been observed for bridged donor-acceptor compounds in propylene glycol solution. In the frame of recent electron-transfer theories this effect reflects the influence of dielectric relaxation dynamics on electron transfer. With increasing dielectric relaxation time a smooth transition from non-adiabatic to solvent-controlled adiabatic behaviour is observed. The electron transfer rate in the solvent-controlled adiabatic limit is dominated by an inhomogeneous distribution of relaxation times.

  6. pH-dependent electron transfer reaction and direct bioelectrocatalysis of the quinohemoprotein pyranose dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takeda, Kouta; Matsumura, Hirotoshi; Ishida, Takuya

    A pyranose dehydrogenase from Coprinopsis cinerea (CcPDH) is an extracellular quinohemoeprotein, which consists a b-type cytochrome domain, a pyrroloquinoline-quinone (PQQ) domain, and a family 1-type carbohydrate-binding module. The electron transfer reaction of CcPDH was studied using some electron acceptors and a carbon electrode at various pH levels. Phenazine methosulfate (PMS) reacted directly at the PQQ domain, whereas cytochrome c (cyt c) reacted via the cytochrome domain of intact CcPDH. Thus, electrons are transferred from reduced PQQ in the catalytic domain of CcPDH to heme b in the N-terminal cytochrome domain, which acts as a built-in mediator and transfers electron tomore » a heterogenous electron transfer protein. The optimal pH values of the PMS reduction (pH 6.5) and the cyt c reduction (pH 8.5) differ. The catalytic currents for the oxidation of L-fucose were observed within a range of pH 4.5 to 11. Bioelectrocatalysis of CcPDH based on direct electron transfer demonstrated that the pH profile of the biocatalytic current was similar to the reduction activity of cyt c characters. - Highlights: • pH dependencies of activity were different for the reduction of cyt c and DCPIP. • DET-based bioelectrocatalysis of CcPDH was observed. • The similar pH-dependent profile was found with cyt c and electrode. • The present results suggested that IET reaction of CcPDH shows pH dependence.« less

  7. Electron-transfer oxidation properties of DNA bases and DNA oligomers.

    PubMed

    Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi

    2005-04-21

    Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.

  8. Charge transfer from TiO2 into adsorbed benzene diazonium compounds

    NASA Astrophysics Data System (ADS)

    Merson, A.; Dittrich, Th.; Zidon, Y.; Rappich, J.; Shapira, Yoram

    2004-08-01

    Electron transfer from sol-gel-prepared TiO2 into adsorbed benzene diazonium compounds has been investigated using cyclic voltammetry, x-ray photoelectron spectroscopy, contact potential difference, and surface photovoltage spectroscopy. The results show that the potential of maximum electron transfer depends strongly on the dipole moment of the benzene compound. Two reactive surface sites at which electron transfer occurs have been identified.

  9. Electron quantum dynamics in atom-ion interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sabzyan, H., E-mail: sabzyan@sci.ui.ac.ir; Jenabi, M. J.

    2016-04-07

    Electron transfer (ET) process and its dependence on the system parameters are investigated by solving two-dimensional time-dependent Schrödinger equation numerically using split operator technique. Evolution of the electron wavepacket occurs from the one-electron species hydrogen atom to another bare nucleus of charge Z > 1. This evolution is quantified by partitioning the simulation box and defining regional densities belonging to the two nuclei of the system. It is found that the functional form of the time-variations of these regional densities and the extent of ET process depend strongly on the inter-nuclear distance and relative values of the nuclear charges, whichmore » define the potential energy surface governing the electron wavepacket evolution. Also, the initial electronic state of the single-electron atom has critical effect on this evolution and its consequent (partial) electron transfer depending on its spreading extent and orientation with respect to the inter-nuclear axis.« less

  10. Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

    NASA Astrophysics Data System (ADS)

    Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

    2007-12-01

    This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

  11. Photo-dynamics of roseoflavin and riboflavin in aqueous and organic solvents

    NASA Astrophysics Data System (ADS)

    Zirak, P.; Penzkofer, A.; Mathes, T.; Hegemann, P.

    2009-03-01

    Roseoflavin (8-dimethylamino-8-demethyl- D-riboflavin) and riboflavin in aqueous and organic solvents are studied by optical absorption spectroscopy, fluorescence spectroscopy, and fluorescence decay kinetics. Solvent polarity dependent absorption shifts are observed. The fluorescence quantum yields are solvent dependent. For roseoflavin the fluorescence decay shows a bi-exponential dependence (ps to sub-ps time constant, and 100 ps to a few ns time constant). The roseoflavin photo-dynamics is explained in terms of fast intra-molecular charge transfer (diabatic electron transfer) from the dimethylamino electron donor group to the pteridin carbonyl electron acceptor followed by intra-molecular charge recombination. The fast fluorescence component is due to direct locally-excited-state emission, and the slow fluorescence component is due to delayed locally-excited-state emission and charge transfer state emission. The fluorescence decay of riboflavin is mono-exponential. The S 1-state potential energy surface is determined by vibronic relaxation and solvation dynamics due to excited-state dipole moment changes (adiabatic optical electron transfer).

  12. Single-molecule interfacial electron transfer dynamics in solar energy conversion

    NASA Astrophysics Data System (ADS)

    Dhital, Bharat

    This dissertation work investigated the parameters affecting the interfacial electron transfer (ET) dynamics in dye-semiconductor nanoparticles (NPs) system by using single-molecule fluorescence spectroscopy and imaging combined with electrochemistry. The influence of the molecule-substrate electronic coupling, the molecular structure, binding geometry on the surface and the molecule-attachment surface chemistry on interfacial charge transfer processes was studied on zinc porphyrin-TiO2 NP systems. The fluorescence blinking measurement on TiO2 NP demonstrated that electronic coupling regulates dynamics of charge transfer processes at the interface depending on the conformation of molecule on the surface. Moreover, semiconductor surface charge induced electronic coupling of molecule which is electrostatically adsorbed on the semiconductor surface also predominantly alters the ET dynamics. Furthermore, interfacial electric field and electron accepting state density dependent ET dynamics has been dissected in zinc porphyrin-TiO2 NP system by observing the single-molecule fluorescence blinking dynamics and fluorescence lifetime with and without applied bias. The significant difference in fluorescence fluctuation and lifetime suggested the modulation of charge transfer dynamics at the interface with external electric field perturbation. Quasi-continuous distribution of fluorescence intensity with applied negative potential was attributed to the faster charge recombination due to reduced density of electron accepting states. The driving force and electron accepting state density ET dependent dynamics has also been probed in zinc porphyrin-TiO2 NP and zinc porphyrin-indium tin oxide (ITO) systems. Study of a molecule adsorbed on two different semiconductors (ITO and TiO2), with large difference in electron densities and distinct driving forces, allows us to observe the changes in rates of back electron transfer process reflected by the suppressed fluorescence blinking of molecule on ITO surface. Finally, the electric field effect on the interface properties has been probed by using surface-enhanced Raman spectroscopy and supported by density functional theory calculations in alizarin-TiO2 system. The perturbation, created by the external potential, has been observed to cause a shift and/or splitting interfacial bond vibrational mode, typical indicator of the coupling energy changes between alizarin and TiO2. Such splitting provides evidence for electric field-dependent electronic coupling changes that have a significant impact on the interfacial electron transfer dynamics.

  13. Application of Degenerately Doped Metal Oxides in the Study of Photoinduced Interfacial Electron Transfer.

    PubMed

    Farnum, Byron H; Morseth, Zachary A; Brennaman, M Kyle; Papanikolas, John M; Meyer, Thomas J

    2015-06-18

    Degenerately doped In2O3:Sn semiconductor nanoparticles (nanoITO) have been used to study the photoinduced interfacial electron-transfer reactivity of surface-bound [Ru(II)(bpy)2(4,4'-(PO3H2)2-bpy)](2+) (RuP(2+)) molecules as a function of driving force over a range of 1.8 eV. The metallic properties of the ITO nanoparticles, present within an interconnected mesoporous film, allowed for the driving force to be tuned by controlling their Fermi level with an external bias while their optical transparency allowed for transient absorption spectroscopy to be used to monitor electron-transfer kinetics. Photoinduced electron transfer from excited-state -RuP(2+*) molecules to nanoITO was found to be dependent on applied bias and competitive with nonradiative energy transfer to nanoITO. Back electron transfer from nanoITO to oxidized -RuP(3+) was also dependent on the applied bias but without complication from inter- or intraparticle electron diffusion in the oxide nanoparticles. Analysis of the electron injection kinetics as a function of driving force using Marcus-Gerischer theory resulted in an experimental estimate of the reorganization energy for the excited-state -RuP(3+/2+*) redox couple of λ* = 0.83 eV and an electronic coupling matrix element, arising from electronic wave function overlap between the donor orbital in the molecule and the acceptor orbital(s) in the nanoITO electrode, of Hab = 20-45 cm(-1). Similar analysis of the back electron-transfer kinetics yielded λ = 0.56 eV for the ground-state -RuP(3+/2+) redox couple and Hab = 2-4 cm(-1). The use of these wide band gap, degenerately doped materials provides a unique experimental approach for investigating single-site electron transfer at the surface of oxide nanoparticles.

  14. Size and Temperature Dependence of Electron Transfer between CdSe Quantum Dots and a TiO 2 Nanobelt

    DOE PAGES

    Tafen, De Nyago; Prezhdo, Oleg V.

    2015-02-24

    Understanding charge transfer reactions between quantum dots (QD) and metal oxides is fundamental for improving photocatalytic, photovoltaic and electronic devices. The complexity of these processes makes it difficult to find an optimum QD size with rapid charge injection and low recombination. We combine time-domain density functional theory with nonadiabatic molecular dynamics to investigate the size and temperature dependence of the experimentally studied electron transfer and charge recombination at CdSe QD-TiO 2 nanobelt (NB) interfaces. The electron injection rate shows strong dependence on the QD size, increasing for small QDs. The rate exhibits Arrhenius temperature dependence, with the activation energy ofmore » the order of millielectronvolts. The charge recombination process occurs due to coupling of the electronic subsystem to vibrational modes of the TiO 2 NB. Inelastic electron-phonon scattering happens on a picosecond time scale, with strong dependence on the QD size. Our simulations demonstrate that the electron-hole recombination rate decreases significantly as the QD size increases, in excellent agreement with experiments. The temperature dependence of the charge recombination rates can be successfully modeled within the framework of the Marcus theory through optimization of the electronic coupling and the reorganization energy. Our simulations indicate that by varying the QD size, one can modulate the photoinduced charge separation and charge recombination, fundamental aspects of the design principles for high efficiency devices.« less

  15. Experimental exploration of the Mulliken-Hush relationship for intramolecular electron transfer reactions.

    PubMed

    Mukherjee, Tamal; Ito, Naoki; Gould, Ian R

    2011-03-17

    The Mulliken-Hush (M-H) relationship provides the critical link between optical and thermal electron transfer processes, and yet very little direct experimental support for its applicability has been provided. Dicyanovinylazaadamantane (DCVA) represents a simple two-state (neutral/charge-transfer) intramolecular electron transfer system that exhibits charge-transfer absorption and emission spectra that are readily measurable in solvents with a wide range of polarities. In this regard it represents an ideal model system for studying the factors that control both optical charge separation (absorption) and recombination (emission) processes in solution. Here we explore the applicability of the M-H relation to quantitative descriptions of the optical charge-transfer processes in DCVA. For DCVA, the measured radiative rate constants exhibit a linear dependence on transition energy, and transition dipole moments exhibit an inverse dependence on transition energy, consistent with the M-H relationship.

  16. Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reslan, Randa; Lopata, Kenneth; Arntsen, Christopher

    2012-12-14

    We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene molecules. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1–LUMO of the neutral dimer, or HOMO–LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offer a word of cautionmore » for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less

  17. Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reslan, Randa; Lopata, Kenneth A.; Arntsen, Christopher D.

    2012-12-14

    We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene dimers. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1 - LUMO of the neutral dimer, or HOMO - LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offermore » a word of caution for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less

  18. The impact of symmetric modes on intramolecular electron transfer: A semi-classical approach

    NASA Astrophysics Data System (ADS)

    Coropceanu, Veaceslav; Boldyrev, Sergei I.; Risko, Chad; Brédas, Jean-Luc

    2006-07-01

    We have generalized the Hush equations developed for the analysis of intervalence charge-transfer bands by including into the model the interaction with symmetric vibrations. Our results indicate that in symmetric class-II systems the maximum of the intervalence charge-transfer band is equal to the reorganization energy λ related to the antisymmetric vibrations as is the case in the conventional Hush model. In contrast, the corresponding transition dipole moment and the activation barrier for thermal electron transfer, in addition to their dependence on λ, also depend on the reorganization energy L related to symmetric vibrational modes. We show that the interaction with symmetric vibrational modes reduces the activation barrier and that the thermal electron-transfer rates derived on the basis of a Hush-type analysis of the optical data are generally underestimated.

  19. Photoinduced charge-transfer electronic excitation of tetracyanoethylene/tetramethylethylene complex in dichloromethane

    NASA Astrophysics Data System (ADS)

    Xu, Long-Kun; Bi, Ting-Jun; Ming, Mei-Jun; Wang, Jing-Bo; Li, Xiang-Yuan

    2017-07-01

    Based on the previous work on nonequilibrium solvation model by the authors, Intermolecular charge-transfer electronic excitation of tetracyanoethylene (TCE)/tetramethylethylene (TME) π -stacked complex in dichloromethane (DCM) has been investigated. For weak interaction correction, dispersion corrected functional DFT-D3 is adopted for geometry optimization. In order to identify the excitation metric, dipole moment components of each Cartesian direction, atomic charge, charge separation and Δr index are analyzed for TCE/TME complex. Calculation shows that the calculated excitation energy is dependent on the functional choice, when conjuncted with suitable time-dependent density functional, the modified nonequilibrium expression gives satisfied results for intermolecular charge-transfer electronic excitation.

  20. Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

    PubMed

    Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

    2017-11-01

    The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

  1. Dependence of intramolecular electron-transfer rates on driving force, pH, and temperature in ammineruthenium-modified ferrocytochromes c

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wishart, J.F.; Sun, J.; Su, C.

    1997-01-23

    Several ruthenium ammine complexes were used to modify horse-heart cytochrome c at histidine-33, creating a series of (NH{sub 3}){sub 4}(L)Ru-Cyt c derivatives (L = H{sub 2}O/OH{sup -}, ammonia, 4-ethylpyridine, 3,5-lutidine, pyridine, isonicotinamide, N-methylpyrazinium) with a wide range of driving forces for Fe-to-Ru electron transfer (-{Delta}G{degree} = -0.125 to +0.46 eV). Electron-transfer rates and activation parameters were measured by pulse radiolysis using azide or carbonate radicals. The driving-force dependence of electron-transfer rates between redox centers of the same charge types obeys Marcus-Hush theory. The activationless rate limit for all of the ruthenium derivatives except the N-methylpyrazinium complex is 3.9x10{sup 5} s{supmore » -1}. Thermodynamic parameters obtained from nonisothermal differential pulse voltammetry show that the electron-transfer reactions are entropy-driven. The thermodynamic and kinetic effects of phosphate ion binding to the ruthenium center are examined. The rate of intramolecular electron transfer in (NH{sub 3}){sub 4}(isn)Ru{sup III}-Cyt c{sup II} decreases at high pH, with a midpoint at pH 9.1. 28 refs., 4 figs., 3 tabs.« less

  2. Theoretical study of electronic transfer current rate at dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    AL-Agealy, Hadi J. M.; AlMaadhede, Taif Saad; Hassooni, Mohsin A.; Sadoon, Abbas K.; Ashweik, Ahmed M.; Mahdi, Hind Abdlmajeed; Ghadhban, Rawnaq Qays

    2018-05-01

    In this research, we present a theoretical study of electronic transfer kinetics rate in N719/TiO2 and N719/ZnO dye-sensitized solar cells (DSSC) systems using a simple model depending on the postulate of quantum mechanics theory. The evaluation of the electronic transition current rate in DSSC systems are function of many parameters such that; the reorientation transition energies ΛSe m D y e , the transition coupling parameter ℂT(0), potential exponential effect e-(E/C-EF ) kBT , unit cell volume VSem, and temperature T. Furthermore, the analysis of electronic transfer current rate in N719/TiO2 and N719/ZnO systems show that the rate upon dye-sensitization solar cell increases with increases of transition coupling parameter, decreasing potential that building at interface a results of different material in this devices and increasing with reorientation transition energy. On the other hand, we can find the electronic transfer behavior is dependent of the dye absorption spectrum and mainly depending on the reorientation of transition energy. The replacement of the solvents in both DSSC system caused increasing of current rates dramatically depending on polarity of solvent in subset devices. This change in current rate of electron transfer were attributed to much more available of recombination sites introduced by the solvents medium. The electronic transfer current dynamics are shown to occurs in N719/TiO2 system faster many time compare to ocuures at N719/ZnO system, this indicate that TiO2 a is a good and active material compare with ZnO to using in dye sensitized solar cell devices. In contrast, the large current rate in N719/TiO2 comparing to ZnO of N719/ZnO systems indicate that using TiO2 with N719 dye lead to increasing the efficiency of DSSC.

  3. Supramolecular networks with electron transfer in two dimensions

    DOEpatents

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.; Tayi, Alok S.; Sue, Chi-Hau; Narayanan, Ashwin

    2016-09-13

    Organic charge-transfer (CT) co-crystals in a crossed stack system are disclosed. The co-crystals exhibit bidirectional charge transfer interactions where one donor molecule shares electrons with two different acceptors, one acceptor face-to-face and the other edge-to-face. The assembly and charge transfer interaction results in a pleochroic material whereby the optical absorption continuously changes depending on the polarization angle of incident light.

  4. Redox-dependent complex formation by an ATP-dependent activator of the corrinoid/iron-sulfur protein

    PubMed Central

    Hennig, Sandra E.; Jeoung, Jae-Hun; Goetzl, Sebastian; Dobbek, Holger

    2012-01-01

    Movement, cell division, protein biosynthesis, electron transfer against an electrochemical gradient, and many more processes depend on energy conversions coupled to the hydrolysis of ATP. The reduction of metal sites with low reduction potentials (E0′ < -500 mV) is possible by connecting an energetical uphill electron transfer with the hydrolysis of ATP. The corrinoid-iron/sulfur protein (CoFeSP) operates within the reductive acetyl-CoA pathway by transferring a methyl group from methyltetrahydrofolate bound to a methyltransferase to the [Ni-Ni-Fe4S4] cluster of acetyl-CoA synthase. Methylation of CoFeSP only occurs in the low-potential Co(I) state, which can be sporadically oxidized to the inactive Co(II) state, making its reductive reactivation necessary. Here we show that an open-reading frame proximal to the structural genes of CoFeSP encodes an ATP-dependent reductive activator of CoFeSP. Our biochemical and structural analysis uncovers a unique type of reductive activator distinct from the electron-transferring ATPases found to reduce the MoFe-nitrogenase and 2-hydroxyacyl-CoA dehydratases. The CoFeSP activator contains an ASKHA domain (acetate and sugar kinases, Hsp70, and actin) harboring the ATP-binding site, which is also present in the activator of 2-hydroxyacyl-CoA dehydratases and a ferredoxin-like [2Fe-2S] cluster domain acting as electron donor. Complex formation between CoFeSP and its activator depends on the oxidation state of CoFeSP, which provides evidence for a unique strategy to achieve unidirectional electron transfer between two redox proteins. PMID:22431597

  5. Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

    PubMed

    Diller, David J

    2017-01-10

    Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

  6. Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems

    NASA Astrophysics Data System (ADS)

    Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen

    2002-09-01

    Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.

  7. Sensitization of ultra-long-range excited-state electron transfer by energy transfer in a polymerized film

    PubMed Central

    Ito, Akitaka; Stewart, David J.; Fang, Zhen; Brennaman, M. Kyle; Meyer, Thomas J.

    2012-01-01

    Distance-dependent energy transfer occurs from the Metal-to-Ligand Charge Transfer (MLCT) excited state to an anthracene-acrylate derivative (Acr-An) incorporated into the polymer network of a semirigid poly(ethyleneglycol)dimethacrylate monolith. Following excitation, to Acr-An triplet energy transfer occurs followed by long-range, Acr-3An—Acr-An → Acr-An—Acr-3An, energy migration. With methyl viologen dication (MV2+) added as a trap, Acr-3An + MV2+ → Acr-An+ + MV+ electron transfer results in sensitized electron transfer quenching over a distance of approximately 90 Å. PMID:22949698

  8. Three-dimensional representations of photo-induced electron transfer rates in pyrene-(CH2)n-N,N'-dimethylaniline systems obtained by three electron transfer theories.

    PubMed

    Rujkorakarn, Rong; Tanaka, Fumio

    2009-01-01

    The observed rates of photo-induced electron transfer (ET) from N,N'-dimethylaniline (DMA) to the excited pyrene (Py) in confined systems of pyrene-(CH(2))(n)-N,N'- dimethylaniline (PnD: n=1-3) were studied by molecular dynamic simulation (MD) and three kinds of electron transfer theories. ET parameters contained in Marcus theory (M theory), Bixon and Jortner theory (BJ theory) and Kakitani and Mataga theory (KM theory) were determined so as to fit the calculated fluorescence intensities with those obtained by the observed ET rates, according to a non-linear least squares method. Three-dimensional profiles of logarithm of calculated ET rates depending on two of three ET parameters, R, epsilon(0) and -DeltaG degrees were systematically examined with best-fit ET parameters of P1D. Bell shape dependencies of ET rate were predicted on R and on epsilon(0), and on -DeltaG degrees as well, by M theory and KM theory. The profiles of logarithm of ET rate calculated by BJ theory exhibited oscillatory dependencies not only on -DeltaG degrees , but also on R and on epsilon(0). Relationship between ET state and charge transfer complex was discussed with BJ theory.

  9. Bidirectional Photoinduced Electron Transfer in Ruthenium(II)-Tris-bipyridyl-Modified PpcA, a Multi-heme c -Type Cytochrome from Geobacter sulfurreducens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kokhan, Oleksandr; Ponomarenko, Nina S.; Pokkuluri, P. Raj

    PpcA, a tri-heme cytochrome c7 from Geobacter sulfurreducens was investigated as a model for photosensitizer-initiated electron transfer within a multi-heme "molecular wire" protein architecture. E. coli expression of PpcA was found to be tolerant of cysteine site-directed mutagenesis, demonstrated by the successful expression of natively folded proteins bearing cysteine mutations at a series of sites selected to vary characteristically with respect to the three -CXXCH- heme binding domains. A preliminary survey of 5 selected mutants found that the introduced cysteines can be readily covalently linked to a Ru(II)-(2,2'-bpy)2(4-bromomethyl-4’-methyl-2,2'-bpy) photosensitizer (where bpy = bipyridine), and that the linked constructs support bothmore » photo-oxidative and photo-reductive quenching of the photosensitizer excited-state, depending upon the initial heme redox state. For photo-oxidative electron transfer, apparent heme reduction risetimes were found to vary from 7 x 10-12 s to 5 x 10-8 s, depending upon the site of photosensitizer linking. The excited-state electron transfers are about 103-fold faster than any previously reported photosensitizer-redox protein covalently linked construct. Preliminary conformational analysis using molecular dynamics simulations shows that rates for electron transfer track both the distance and pathways for electron transfer. Two mutants with the fastest charge transfer rates, A23C and K29C, showed a significant role of specific paths for electron transfer. While K29C labeled mutant was expected to have approximately 0.8Å greater donor-acceptor distance, it showed 20-fold faster charge separation rate. Clear evidence for inter-heme electron transfer within the multi-heme protein is not detected within the lifetimes of the charge separated states. These results demonstrate an opportunity to develop multi-heme c-cytochromes for investigation of electron transfer in protein "molecular wires" and to serve as frameworks for metalloprotein designs that support multiple electron transfer redox chemistry.« less

  10. Time-dependent view of an isotope effect in electron-nuclear nonequilibrium dynamics with applications to N2.

    PubMed

    Ajay, Jayanth S; Komarova, Ksenia G; Remacle, Francoise; Levine, R D

    2018-06-05

    Isotopic fractionation in the photodissociation of N 2 could explain the considerable variation in the 14 N/ 15 N ratio in different regions of our galaxy. We previously proposed that such an isotope effect is due to coupling of photoexcited bound valence and Rydberg electronic states in the frequency range where there is strong state mixing. We here identify features of the role of the mass in the dynamics through a time-dependent quantum-mechanical simulation. The photoexcitation of N 2 is by an ultrashort pulse so that the process has a sharply defined origin in time and so that we can monitor the isolated molecule dynamics in time. An ultrafast pulse is necessarily broad in frequency and spans several excited electronic states. Each excited molecule is therefore not in a given electronic state but in a superposition state. A short time after excitation, there is a fairly sharp onset of a mass-dependent large population transfer when wave packets on two different electronic states in the same molecule overlap. This coherent overlap of the wave packets on different electronic states in the region of strong coupling allows an effective transfer of population that is very mass dependent. The extent of the transfer depends on the product of the populations on the two different electronic states and on their relative phase. It is as if two molecules collide but the process occurs within one molecule, a molecule that is simultaneously in both states. An analytical toy model recovers the (strong) mass and energy dependence.

  11. Distance dependence in photo-induced intramolecular electron transfer

    NASA Astrophysics Data System (ADS)

    Larsson, Sven; Volosov, Andrey

    1986-09-01

    The distance dependence of the rate of photo-induced electron transfer reactions is studied. A quantum mechanical method CNDO/S is applied to a series of molecules recently investigated by Hush et al. experimentally. The calculations show a large interaction through the saturated bridge which connects the two chromophores. The electronic matrix element HAB decreases a factor 10 in about 4 Å. There is also a decrease of the rate due to less exothermicity for the longer molecule. The results are in fair agreement with the experimental results.

  12. Photon-momentum transfer in molecular photoionization

    NASA Astrophysics Data System (ADS)

    Chelkowski, Szczepan; Bandrauk, André D.

    2018-05-01

    In most models and theoretical calculations describing multiphoton ionization by infrared light, the dipole approximation is used. This is equivalent to setting the very small photon momentum to zero. Using numerical solutions of the (nondipole) three-dimensional time-dependent Schrödinger equation for one electron in a H2+ molecular ion we investigate the effect the photon-momentum transfer to the photoelectron in an H2+ ion in various regimes. We find that the photon-momentum transfer in a molecule is very different from the transfer in atoms due to two-center interference effects. The photon-momentum transfer is very sensitive to the symmetry of the initial electronic state and is strongly dependent on the internuclear distance and on the ellipticity of the laser.

  13. Distance dependence in photoinduced intramolecular electron transfer. Additional remarks and calculations

    NASA Astrophysics Data System (ADS)

    Larsson, Sven; Volosov, Andrey

    1987-12-01

    Rate constants for photoinduced intramolecular electron transfer are calculated for four of the molecules studied by Hush et al. The electronic factor is obtained in quantum chemical calculations using the CNDO/S method. The results agree reasonably well with experiments for the forward reaction. Possible reasons for the disagreement for the charge recombination process are offered.

  14. Bimolecular Rate Constants for FAD-Dependent Glucose Dehydrogenase from Aspergillus terreus and Organic Electron Acceptors.

    PubMed

    Tsuruoka, Nozomu; Sadakane, Takuya; Hayashi, Rika; Tsujimura, Seiya

    2017-03-10

    The flavin adenine dinucleotide-dependent glucose dehydrogenase (FAD-GDH) from Aspergillus species require suitable redox mediators to transfer electrons from the enzyme to the electrode surface for the application of bioelectrical devices. Although several mediators for FAD-GDH are already in use, they are still far from optimum in view of potential, kinetics, sustainability, and cost-effectiveness. Herein, we investigated the efficiency of various phenothiazines and quinones in the electrochemical oxidation of FAD-GDH from Aspergillus terreus . At pH 7.0, the logarithm of the bimolecular oxidation rate constants appeared to depend on the redox potentials of all the mediators tested. Notably, the rate constant of each molecule for FAD-GDH was approximately 2.5 orders of magnitude higher than that for glucose oxidase from Aspergillus sp. The results suggest that the electron transfer kinetics is mainly determined by the formal potential of the mediator, the driving force of electron transfer, and the electron transfer distance between the redox active site of the mediator and the FAD, affected by the steric or chemical interactions. Higher k ₂ values were found for ortho-quinones than for para-quinones in the reactions with FAD-GDH and glucose oxidase, which was likely due to less steric hindrance in the active site in the case of the ortho-quinones.

  15. Enzymatic cellulose oxidation is linked to lignin by long-range electron transfer

    PubMed Central

    Westereng, Bjørge; Cannella, David; Wittrup Agger, Jane; Jørgensen, Henning; Larsen Andersen, Mogens; Eijsink, Vincent G.H.; Felby, Claus

    2015-01-01

    Enzymatic oxidation of cell wall polysaccharides by lytic polysaccharide monooxygenases (LPMOs) plays a pivotal role in the degradation of plant biomass. While experiments have shown that LPMOs are copper dependent enzymes requiring an electron donor, the mechanism and origin of the electron supply in biological systems are only partly understood. We show here that insoluble high molecular weight lignin functions as a reservoir of electrons facilitating LPMO activity. The electrons are donated to the enzyme by long-range electron transfer involving soluble low molecular weight lignins present in plant cell walls. Electron transfer was confirmed by electron paramagnetic resonance spectroscopy showing that LPMO activity on cellulose changes the level of unpaired electrons in the lignin. The discovery of a long-range electron transfer mechanism links the biodegradation of cellulose and lignin and sheds new light on how oxidative enzymes present in plant degraders may act in concert. PMID:26686263

  16. Energy-resolved coherent diffraction from laser-driven electronic motion in atoms

    NASA Astrophysics Data System (ADS)

    Shao, Hua-Chieh; Starace, Anthony F.

    2017-10-01

    We investigate theoretically the use of energy-resolved ultrafast electron diffraction to image laser-driven electronic motion in atoms. A chirped laser pulse is used to transfer the valence electron of the lithium atom from the ground state to the first excited state. During this process, the electronic motion is imaged by 100-fs and 1-fs electron pulses in energy-resolved diffraction measurements. Simulations show that the angle-resolved spectra reveal the time evolution of the energy content and symmetry of the electronic state. The time-dependent diffraction patterns are further interpreted in terms of the momentum transfer. For the case of incident 1-fs electron pulses, the rapid 2 s -2 p quantum beat motion of the target electron is imaged as a time-dependent asymmetric oscillation of the diffraction pattern.

  17. Numerically exact full counting statistics of the nonequilibrium Anderson impurity model

    NASA Astrophysics Data System (ADS)

    Ridley, Michael; Singh, Viveka N.; Gull, Emanuel; Cohen, Guy

    2018-03-01

    The time-dependent full counting statistics of charge transport through an interacting quantum junction is evaluated from its generating function, controllably computed with the inchworm Monte Carlo method. Exact noninteracting results are reproduced; then, we continue to explore the effect of electron-electron interactions on the time-dependent charge cumulants, first-passage time distributions, and n -electron transfer distributions. We observe a crossover in the noise from Coulomb blockade to Kondo-dominated physics as the temperature is decreased. In addition, we uncover long-tailed spin distributions in the Kondo regime and analyze queuing behavior caused by correlations between single-electron transfer events.

  18. Numerically exact full counting statistics of the nonequilibrium Anderson impurity model

    DOE PAGES

    Ridley, Michael; Singh, Viveka N.; Gull, Emanuel; ...

    2018-03-06

    The time-dependent full counting statistics of charge transport through an interacting quantum junction is evaluated from its generating function, controllably computed with the inchworm Monte Carlo method. Exact noninteracting results are reproduced; then, we continue to explore the effect of electron-electron interactions on the time-dependent charge cumulants, first-passage time distributions, and n-electron transfer distributions. We observe a crossover in the noise from Coulomb blockade to Kondo-dominated physics as the temperature is decreased. In addition, we uncover long-tailed spin distributions in the Kondo regime and analyze queuing behavior caused by correlations between single-electron transfer events

  19. Numerically exact full counting statistics of the nonequilibrium Anderson impurity model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ridley, Michael; Singh, Viveka N.; Gull, Emanuel

    The time-dependent full counting statistics of charge transport through an interacting quantum junction is evaluated from its generating function, controllably computed with the inchworm Monte Carlo method. Exact noninteracting results are reproduced; then, we continue to explore the effect of electron-electron interactions on the time-dependent charge cumulants, first-passage time distributions, and n-electron transfer distributions. We observe a crossover in the noise from Coulomb blockade to Kondo-dominated physics as the temperature is decreased. In addition, we uncover long-tailed spin distributions in the Kondo regime and analyze queuing behavior caused by correlations between single-electron transfer events

  20. Electronic-structure and quantum dynamical study of the photochromism of the aromatic Schiff base salicylideneaniline

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortiz-Sanchez, Juan Manuel; Gelabert, Ricard; Moreno, Miquel

    2008-12-07

    The ultrafast proton transfer dynamics of salicylideneaniline has been theoretically analyzed in the ground and first singlet excited electronic states using density functional theory (DFT) and time-dependent DFT calculations, which predict a ({pi},{pi}*) barrierless excited state intramolecular proton transfer (ESIPT). In addition to this, the photochemistry of salicylideneaniline is experimentally known to present fast depopulation processes of the photoexcited species before and after the proton transfer reaction. Such processes are explained by means of conical intersections between the ground and first singlet ({pi},{pi}*) excited electronic states. The electronic energies obtained by the time-dependent density functional theory formalism have been fittedmore » to a monodimensional potential energy surface in order to perform quantum dynamics study of the processes. Our results show that the proton transfer and deactivation of the photoexcited species before the ESIPT processes are completed within 49.6 and 37.7 fs, respectively, which is in remarkable good agreement with experiments.« less

  1. Marcus Bell-Shaped Electron Transfer Kinetics Observed in an Arrhenius Plot.

    PubMed

    Waskasi, Morteza M; Kodis, Gerdenis; Moore, Ana L; Moore, Thomas A; Gust, Devens; Matyushov, Dmitry V

    2016-07-27

    The Marcus theory of electron transfer predicts a bell-shaped dependence of the reaction rate on the reaction free energy. The top of the "inverted parabola" corresponds to zero activation barrier when the electron-transfer reorganization energy and the reaction free energy add up to zero. Although this point has traditionally been reached by altering the chemical structures of donors and acceptors, the theory suggests that it can also be reached by varying other parameters of the system including temperature. We find here dramatic evidence of this phenomenon from experiments on a fullerene-porphyrin dyad. Following photoinduced electron transfer, the rate of charge recombination shows a bell-shaped dependence on the inverse temperature, first increasing with cooling and then decreasing at still lower temperatures. This non-Arrhenius rate law is a result of a strong, approximately hyperbolic temperature variation of the reorganization energy and the reaction free energy. Our results provide potentially the cleanest confirmation of the Marcus energy gap law so far since no modification of the chemical structure is involved.

  2. Experimental insights on the electron transfer and energy transfer processes between Ce{sup 3+}-Yb{sup 3+} and Ce{sup 3+}-Tb{sup 3+} in borate glass

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sontakke, Atul D., E-mail: sontakke.atul.55a@st.kyoto-u.ac.jp; Katayama, Yumiko; Tanabe, Setsuhisa

    2015-03-30

    A facile method to describe the electron transfer and energy transfer processes among lanthanide ions is presented based on the temperature dependent donor luminescence decay kinetics. The electron transfer process in Ce{sup 3+}-Yb{sup 3+} exhibits a steady rise with temperature, whereas the Ce{sup 3+}-Tb{sup 3+} energy transfer remains nearly unaffected. This feature has been investigated using the rate equation modeling and a methodology for the quantitative estimation of interaction parameters is presented. Moreover, the overall consequences of electron transfer and energy transfer process on donor-acceptor luminescence behavior, quantum efficiency, and donor luminescence decay kinetics are discussed in borate glass host.more » The results in this study propose a straight forward approach to distinguish the electron transfer and energy transfer processes between lanthanide ions in dielectric hosts, which is highly advantageous in view of the recent developments on lanthanide doped materials for spectral conversion, persistent luminescence, and related applications.« less

  3. Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles

    PubMed Central

    Tvrdy, Kevin; Frantsuzov, Pavel A.; Kamat, Prashant V.

    2011-01-01

    Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO2, TiO2, and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO2) were not the same as those which showed the highest photocurrent (TiO2). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency. PMID:21149685

  4. Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles.

    PubMed

    Tvrdy, Kevin; Frantsuzov, Pavel A; Kamat, Prashant V

    2011-01-04

    Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO(2), TiO(2), and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO(2)) were not the same as those which showed the highest photocurrent (TiO(2)). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency.

  5. On the theory of nonadiabatic bridge-mediated electron transfer. Influence of structural and energetic disorder

    NASA Astrophysics Data System (ADS)

    Bade, L.; Petrov, E. G.; May, V.

    2003-10-01

    Effects of structural and energetic disorder on nonadiabatic electron transfer (ET) reactions are discussed theoretically. To account for the sequential as well as the superexchange mechanism of ET our recent approach is used presented in J. Phys. Chem. A 105, 10176 (2001). The overall charge motion is characterized by the numerical solution of rate equations for the electronic state populations and an averaging with respect to the disorder configurations. Introducing a single effective transfer rate which can be deduced from the experiment the dependence of this rate is discussed on the geometry of the ET system as well as on the disorder model. The theory is applied to donor acceptor complexes connected by oligomers of the amino acid proline. In particular, a pronounced dependence is found of the effective transfer rate on disorder with respect to the reorganization energy.

  6. Hydrated Electron Transfer to Nucleobases in Aqueous Solutions Revealed by Ab Initio Molecular Dynamics Simulations.

    PubMed

    Zhao, Jing; Wang, Mei; Fu, Aiyun; Yang, Hongfang; Bu, Yuxiang

    2015-08-03

    We present an ab initio molecular dynamics (AIMD) simulation study into the transfer dynamics of an excess electron from its cavity-shaped hydrated electron state to a hydrated nucleobase (NB)-bound state. In contrast to the traditional view that electron localization at NBs (G/A/C/T), which is the first step for electron-induced DNA damage, is related only to dry or prehydrated electrons, and a fully hydrated electron no longer transfers to NBs, our AIMD simulations indicate that a fully hydrated electron can still transfer to NBs. We monitored the transfer dynamics of fully hydrated electrons towards hydrated NBs in aqueous solutions by using AIMD simulations and found that due to solution-structure fluctuation and attraction of NBs, a fully hydrated electron can transfer to a NB gradually over time. Concurrently, the hydrated electron cavity gradually reorganizes, distorts, and even breaks. The transfer could be completed in about 120-200 fs in four aqueous NB solutions, depending on the electron-binding ability of hydrated NBs and the structural fluctuation of the solution. The transferring electron resides in the π*-type lowest unoccupied molecular orbital of the NB, which leads to a hydrated NB anion. Clearly, the observed transfer of hydrated electrons can be attributed to the strong electron-binding ability of hydrated NBs over the hydrated electron cavity, which is the driving force, and the transfer dynamics is structure-fluctuation controlled. This work provides new insights into the evolution dynamics of hydrated electrons and provides some helpful information for understanding the DNA-damage mechanism in solution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Radiationless Electronic Excitation Energy Transfer Between Monolayers of J-Aggregates

    NASA Astrophysics Data System (ADS)

    Chmereva, T. M.; Kucherenko, M. G.

    2018-06-01

    Radiationless electronic excitation energy transfer between monolayers of cyanine dye molecules forming J-aggregates by means of surface plasmons of the metal film of nanometer thickness inserted between the monolayers is theoretically investigated. A dependence of the rate of energy transfer on the geometrical and electrodynamic parameters of the system is established. It is demonstrated that the energy transfer between the monolayers is more effective in the presence of the metal film than in a nonconductive medium.

  8. Studying electron transfer through alkanethiol self-assembled monolayers on a hanging mercury drop electrode using potentiometric measurements.

    PubMed

    Cohen-Atiya, Meirav; Mandler, Daniel

    2006-10-14

    A new approach based on measuring the change of the open-circuit potential (OCP) of a hanging mercury drop electrode (HMDE), modified with alkanethiols of different chain length conducted in a solution containing a mixture of Ru(NH3)6(2+) and Ru(NH3)6(3+) is used for studying electron transfer across the monolayer. Following the time dependence of the OCP allowed the extraction of the kinetic parameters, such as the charge transfer resistance (R(ct)) and the electron transfer rate constant (k(et)), for different alkanethiol monolayers. An electron tunneling coefficient, beta, of 0.9 A(-1) was calculated for the monolayers on Hg.

  9. Quantum dynamical simulation of photoinduced electron transfer processes in dye-semiconductor systems: theory and application to coumarin 343 at TiO₂.

    PubMed

    Li, Jingrui; Kondov, Ivan; Wang, Haobin; Thoss, Michael

    2015-04-10

    A recently developed methodology to simulate photoinduced electron transfer processes at dye-semiconductor interfaces is outlined. The methodology employs a first-principles-based model Hamiltonian and accurate quantum dynamics simulations using the multilayer multiconfiguration time-dependent Hartree approach. This method is applied to study electron injection in the dye-semiconductor system coumarin 343-TiO2. Specifically, the influence of electronic-vibrational coupling is analyzed. Extending previous work, we consider the influence of Dushinsky rotation of the normal modes as well as anharmonicities of the potential energy surfaces on the electron transfer dynamics.

  10. Time-resolved measurement of intramolecular photoinduced electron transfer processes in perylene diimides (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Döring, Robin Carl; Baal, Eduard; Sundermeyer, Jörg; Chatterjee, Sangam

    2017-02-01

    Perylene-3,4,9,10-tetracarboxylic acid (PTCDA) and respective derivatives (e.g. perylene diimide - PDI) are widely used as dyes but also for device applications such as organic field effect transistors or in organic photovoltaics. Due to their intrinsically high quantum efficiencies they are also used as spectroscopic standards. One major drawback of these materials is their low solubility in organic solvents which can be addressed by long alkyl substitutions. When introducing a tertiary amine into the molecule a mechanism known as photoinduced electron transfer (PET) can occur. Here, following an optically excited HOMO-LUMO transition of the core, an electron from the electron lone pair of the amine is transferred to the HOMO of the perylene core. Hence, radiative recombination is disallowed and photoluminescence effectively quenched. Here, we perform a systematic study of the distance dependence of the PET by introducing alkyle groups as spacer units between PDI core and the tertiary amine. Dynamics of the PET are extracted from ultrafast time-resolved photoluminescence measurement data. A rate equation model, simulating a three level system, reveals rate constant of the back electron transfer, otherwise not accessible with our experimental methods. Assuming a Marcus model of electron transfer, electronic coupling strength between the electronic states involved in the respective transitions can be calculated. In addition to the distance dependence, the effects of protonation and methylation of the the tertiary amine units are studied.

  11. Quantum state transfer in double-quantum-well devices

    NASA Technical Reports Server (NTRS)

    Jakumeit, Jurgen; Tutt, Marcel; Pavlidis, Dimitris

    1994-01-01

    A Monte Carlo simulation of double-quantum-well (DQW) devices is presented in view of analyzing the quantum state transfer (QST) effect. Different structures, based on the AlGaAs/GaAs system, were simulated at 77 and 300 K and optimized in terms of electron transfer and device speed. The analysis revealed the dominant role of the impurity scattering for the QST. Different approaches were used for the optimization of QST devices and basic physical limitations were found in the electron transfer between the QWs. The maximum transfer of electrons from a high to a low mobility well was at best 20%. Negative differential resistance is hampered by the almost linear rather than threshold dependent relation of electron transfer on electric field. By optimizing the doping profile the operation frequency limit could be extended to 260 GHz.

  12. Fabrication and single-electron-transfer operation of a triple-dot single-electron transistor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jo, Mingyu, E-mail: mingyujo@eis.hokudai.ac.jp; Uchida, Takafumi; Tsurumaki-Fukuchi, Atsushi

    2015-12-07

    A triple-dot single-electron transistor was fabricated on silicon-on-insulator wafer using pattern-dependent oxidation. A specially designed one-dimensional silicon wire having small constrictions at both ends was converted to a triple-dot single-electron transistor by means of pattern-dependent oxidation. The fabrication of the center dot involved quantum size effects and stress-induced band gap reduction, whereas that of the two side dots involved thickness modulation because of the complex edge structure of two-dimensional silicon. Single-electron turnstile operation was confirmed at 8 K when a 100-mV, 1-MHz square wave was applied. Monte Carlo simulations indicated that such a device with inhomogeneous tunnel and gate capacitances canmore » exhibit single-electron transfer.« less

  13. Effect of dynamic disorder on charge transport along a pentacene chain

    NASA Astrophysics Data System (ADS)

    Böhlin, J.; Linares, M.; Stafström, S.

    2011-02-01

    The lattice equation of motion and a numerical solution of the time-dependent Schrödinger equation provide us with a microscopic picture of charge transport in highly ordered molecular crystals. We have chosen the pentacene single crystal as a model system, and we study charge transport as a function of phonon-mode time-dependent fluctuations in the intermolecular electron transfer integral. For comparison, we include similar fluctuations also in the intramolecular potentials. The variance in these energy quantities is closely related to the temperature of the system. The pentacene system is shown to be very sensitive to fluctuation in the intermolecular transfer integral, revealing a transition from adiabatic to nonadiabatic polaron transport for increasing temperatures. The extension of the polaron at temperatures above 200 K is limited by the electron localization length rather than the interplay between the electron transfer integral and the electron-phonon coupling strength.

  14. Adsorbate hopping via vibrational-mode coupling induced by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Ueba, H.; Hayashi, M.; Paulsson, M.; Persson, B. N. J.

    2008-09-01

    We study the heat transfer from femtosecond laser-heated hot electrons in a metal to adsorbates in the presence of vibrational-mode coupling. The theory is successfully applied to the experimental result of atomic oxygen hopping on a vicinal Pt(111) surface. The effective friction coupling between hot electrons and the vibrational mode relevant to the hopping motion depends on the transient temperature of the partner mode excited by hot electrons. The calculated two-pulse correlation and fluence dependence of the hopping probability reproduce the experimental results, which were previously analyzed using the hot-electron temperature (Te) -dependent friction ηa(Te) in a conventional heat transfer equation. A possible elementary process behind such a hypothetic modeling using ηa(Te) is discussed in terms of an indirect heating of the vibrational mode for hopping at the surface.

  15. Role of protein fluctuation correlations in electron transfer in photosynthetic complexes.

    PubMed

    Nesterov, Alexander I; Berman, Gennady P

    2015-04-01

    We consider the dependence of the electron transfer in photosynthetic complexes on correlation properties of random fluctuations of the protein environment. The electron subsystem is modeled by a finite network of connected electron (exciton) sites. The fluctuations of the protein environment are modeled by random telegraph processes, which act either collectively (correlated) or independently (uncorrelated) on the electron sites. We derived an exact closed system of first-order linear differential equations with constant coefficients, for the average density matrix elements and for their first moments. Under some conditions, we obtained analytic expressions for the electron transfer rates and found the range of parameters for their applicability by comparing with the exact numerical simulations. We also compared the correlated and uncorrelated regimes and demonstrated numerically that the uncorrelated fluctuations of the protein environment can, under some conditions, either increase or decrease the electron transfer rates.

  16. Quantum Calculations of Electron Tunneling in Respiratory Complex III.

    PubMed

    Hagras, Muhammad A; Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

    2015-11-19

    The most detailed and comprehensive to date study of electron transfer reactions in the respiratory complex III of aerobic cells, also known as bc1 complex, is reported. In the framework of the tunneling current theory, electron tunneling rates and atomistic tunneling pathways between different redox centers were investigated for all electron transfer reactions comprising different stages of the proton-motive Q-cycle. The calculations reveal that complex III is a smart nanomachine, which under certain conditions undergoes conformational changes gating electron transfer, or channeling electrons to specific pathways. One-electron tunneling approximation was adopted in the tunneling calculations, which were performed using hybrid Broken-Symmetry (BS) unrestricted DFT/ZINDO levels of theory. The tunneling orbitals were determined using an exact biorthogonalization scheme that uniquely separates pairs of tunneling orbitals with small overlaps out of the remaining Franck-Condon orbitals with significant overlap. Electron transfer rates in different redox pairs show exponential distance dependence, in agreement with the reported experimental data; some reactions involve coupled proton transfer. Proper treatment of a concerted two-electron bifurcated tunneling reaction at the Q(o) site is given.

  17. Atomic and electronic structure of trilayer graphene/SiC(0001): Evidence of Strong Dependence on Stacking Sequence and charge transfer.

    PubMed

    Pierucci, Debora; Brumme, Thomas; Girard, Jean-Christophe; Calandra, Matteo; Silly, Mathieu G; Sirotti, Fausto; Barbier, Antoine; Mauri, Francesco; Ouerghi, Abdelkarim

    2016-09-15

    The transport properties of few-layer graphene are the directly result of a peculiar band structure near the Dirac point. Here, for epitaxial graphene grown on SiC, we determine the effect of charge transfer from the SiC substrate on the local density of states (LDOS) of trilayer graphene using scaning tunneling microscopy/spectroscopy and angle resolved photoemission spectroscopy (ARPES). Different spectra are observed and are attributed to the existence of two stable polytypes of trilayer: Bernal (ABA) and rhomboedreal (ABC) staking. Their electronic properties strongly depend on the charge transfer from the substrate. We show that the LDOS of ABC stacking shows an additional peak located above the Dirac point in comparison with the LDOS of ABA stacking. The observed LDOS features, reflecting the underlying symmetry of the two polytypes, were reproduced by explicit calculations within density functional theory (DFT) including the charge transfer from the substrate. These findings demonstrate the pronounced effect of stacking order and charge transfer on the electronic structure of trilayer or few layer graphene. Our approach represents a significant step toward understand the electronic properties of graphene layer under electrical field.

  18. Electron transfer and conformational change in complexes of trimethylamine dehydrogenase and electron transferring flavoprotein.

    PubMed

    Jones, Matthew; Talfournier, Francois; Bobrov, Anton; Grossmann, J Günter; Vekshin, Nikolai; Sutcliffe, Michael J; Scrutton, Nigel S

    2002-03-08

    The trimethylamine dehydrogenase-electron transferring flavoprotein (TMADH.ETF) electron transfer complex has been studied by fluorescence and absorption spectroscopies. These studies indicate that a series of conformational changes occur during the assembly of the TMADH.ETF electron transfer complex and that the kinetics of assembly observed with mutant TMADH (Y442F/L/G) or ETF (alpha R237A) complexes are much slower than are the corresponding rates of electron transfer in these complexes. This suggests that electron transfer does not occur in the thermodynamically most favorable state (which takes too long to form), but that one or more metastable states (which are formed more rapidly) are competent in transferring electrons from TMADH to ETF. Additionally, fluorescence spectroscopy studies of the TMADH.ETF complex indicate that ETF undergoes a stable conformational change (termed structural imprinting) when it interacts transiently with TMADH to form a second, distinct, structural form. The mutant complexes compromise imprinting of ETF, indicating a dependence on the native interactions present in the wild-type complex. The imprinted form of semiquinone ETF exhibits an enhanced rate of electron transfer to the artificial electron acceptor, ferricenium. Overall molecular conformations as probed by small-angle x-ray scattering studies are indistinguishable for imprinted and non-imprinted ETF, suggesting that changes in structure likely involve confined reorganizations within the vicinity of the FAD. Our results indicate a series of conformational events occur during the assembly of the TMADH.ETF electron transfer complex, and that the properties of electron transfer proteins can be affected lastingly by transient interaction with their physiological redox partners. This may have significant implications for our understanding of biological electron transfer reactions in vivo, because ETF encounters TMADH at all times in the cell. Our studies suggest that caution needs to be exercised in extrapolating the properties of in vitro interprotein electron transfer reactions to those occurring in vivo.

  19. The electrochemical behavior of a FAD dependent glucose dehydrogenase with direct electron transfer subunit by immobilization on self-assembled monolayers.

    PubMed

    Lee, Inyoung; Loew, Noya; Tsugawa, Wakako; Lin, Chi-En; Probst, David; La Belle, Jeffrey T; Sode, Koji

    2018-06-01

    Continuous glucose monitoring (CGM) is a vital technology for diabetes patients by providing tight glycemic control. Currently, many commercially available CGM sensors use glucose oxidase (GOD) as sensor element, but this enzyme is not able to transfer electrons directly to the electrode without oxygen or an electronic mediator. We previously reported a mutated FAD dependent glucose dehydrogenase complex (FADGDH) capable of direct electron transfer (DET) via an electron transfer subunit without involving oxygen or a mediator. In this study, we investigated the electrochemical response of DET by controlling the immobilization of DET-FADGDH using 3 types of self-assembled monolayers (SAMs) with varying lengths. With the employment of DET-FADGDH and SAM, high current densities were achieved without being affected by interfering substances such as acetaminophen and ascorbic acid. Additionally, the current generated from DET-FADGDH electrodes decreased with increasing length of SAM, suggesting that the DET ability can be affected by the distance between the enzyme and the electrode. These results indicate the feasibility of controlling the immobilization state of the enzymes on the electrode surface. Copyright © 2017. Published by Elsevier B.V.

  20. Electron transfer complex between nitrous oxide reductase and cytochrome c552 from Pseudomonas nautica: kinetic, nuclear magnetic resonance, and docking studies.

    PubMed

    Dell'acqua, Simone; Pauleta, Sofia R; Monzani, Enrico; Pereira, Alice S; Casella, Luigi; Moura, José J G; Moura, Isabel

    2008-10-14

    The multicopper enzyme nitrous oxide reductase (N 2OR) catalyzes the final step of denitrification, the two-electron reduction of N 2O to N 2. This enzyme is a functional homodimer containing two different multicopper sites: CuA and CuZ. CuA is a binuclear copper site that transfers electrons to the tetranuclear copper sulfide CuZ, the catalytic site. In this study, Pseudomonas nautica cytochrome c 552 was identified as the physiological electron donor. The kinetic data show differences when physiological and artificial electron donors are compared [cytochrome vs methylviologen (MV)]. In the presence of cytochrome c 552, the reaction rate is dependent on the ET reaction and independent of the N 2O concentration. With MV, electron donation is faster than substrate reduction. From the study of cytochrome c 552 concentration dependence, we estimate the following kinetic parameters: K m c 552 = 50.2 +/- 9.0 muM and V max c 552 = 1.8 +/- 0.6 units/mg. The N 2O concentration dependence indicates a K mN 2 O of 14.0 +/- 2.9 muM using MV as the electron donor. The pH effect on the kinetic parameters is different when MV or cytochrome c 552 is used as the electron donor (p K a = 6.6 or 8.3, respectively). The kinetic study also revealed the hydrophobic nature of the interaction, and direct electron transfer studies showed that CuA is the center that receives electrons from the physiological electron donor. The formation of the electron transfer complex was observed by (1)H NMR protein-protein titrations and was modeled with a molecular docking program (BiGGER). The proposed docked complexes corroborated the ET studies giving a large number of solutions in which cytochrome c 552 is placed near a hydrophobic patch located around the CuA center.

  1. Quantum electron tunneling in respiratory complex I.

    PubMed

    Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

    2011-05-12

    We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. While the one-electron tunneling approximation is found to hold in electron tunneling between the antiferromagnetic binuclear and tetranuclear Fe/S clusters without major orbital or spin rearrangement of the core electrons, induced polarization of the core electrons contributes significantly to decrease the electron transfer rates to 19-56 %. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of the electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A signature of the wave properties of electrons is observed as distinct quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included is in good agreement with a reported phenomenological relation.

  2. Coupled sensitizer-catalyst dyads: electron-transfer reactions in a perylene-polyoxometalate conjugate.

    PubMed

    Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony

    2009-01-01

    Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide.

  3. Ponderomotive phase plate for transmission electron microscopes

    DOEpatents

    Reed, Bryan W [Livermore, CA

    2012-07-10

    A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.

  4. Production of vibrationally excited N 2 by electron impact

    NASA Astrophysics Data System (ADS)

    Campbell, L.; Brunger, M. J.; Cartwright, D. C.; Teubner, P. J. O.

    2004-08-01

    Energy transfer from electrons to neutral gases and ions is one of the dominant electron cooling processes in the ionosphere, and the role of vibrationally excited N 2 in this is particularly significant. We report here the results from a new calculation of electron energy transfer rates ( Q) for vibrational excitation of N 2, as a function of the electron temperature Te. The present study was motivated by the development of a new cross-section compilation for vibrational excitation processes in N 2 which supercedes those used in the earlier calculations of the electron energy transfer rates. We show that the energy dependence and magnitude of these cross sections, particularly in the region of the well-known 2Π g resonance in N 2, significantly affect the calculated values of Q. A detailed comparison between the current and previous calculated electron energy transfer rates is made and coefficients are provided so that these rates for transitions from level 0 to levels 1-10 can be calculated for electron temperatures less than 6000 K.

  5. Tumor cell membrane-targeting pH-dependent electron donor-acceptor fluorescence systems with low background signals.

    PubMed

    Han, Liang; Liu, Mingming; Ye, Deyong; Zhang, Ning; Lim, Ed; Lu, Jing; Jiang, Chen

    2014-03-01

    Minimizing the background signal is crucial for developing tumor-imaging techniques with sufficient specificity and sensitivity. Here we use pH difference between healthy tissues and tumor and tumor targeting delivery to achieve this goal. We synthesize fluorophore-dopamine conjugate as pH-dependent electron donor-acceptor fluorescence system. Fluorophores are highly sensitive to electron-transfer processes, which can alter their optical properties. The intrinsic redox properties of dopamine are oxidation of hydroquinone to quinone at basic pH and reduction of quinone to hydroquinone at acidic pH. Quinone can accept electron then quench fluorescence. We design tumor cell membrane-targeting carrier for delivery. We demonstrate quenched fluorophore-quinone can be specially transferred to tumor extracellular environment and tumor-accumulated fluorophore can be activated by acidic pH. These tumor-targeting pH-dependent electron donor-acceptor fluorescence systems may offer new opportunity for developing tumor-imaging techniques. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. What Controls the Rate of Ultrafast Charge Transfer and Charge Separation Efficiency in Organic Photovoltaic Blends.

    PubMed

    Jakowetz, Andreas C; Böhm, Marcus L; Zhang, Jiangbin; Sadhanala, Aditya; Huettner, Sven; Bakulin, Artem A; Rao, Akshay; Friend, Richard H

    2016-09-14

    In solar energy harvesting devices based on molecular semiconductors, such as organic photovoltaics (OPVs) and artificial photosynthetic systems, Frenkel excitons must be dissociated via charge transfer at heterojunctions to yield free charges. What controls the rate and efficiency of charge transfer and charge separation is an important question, as it determines the overall power conversion efficiency (PCE) of these systems. In bulk heterojunctions between polymer donor and fullerene acceptors, which provide a model system to understand the fundamental dynamics of electron transfer in molecular systems, it has been established that the first step of photoinduced electron transfer can be fast, of order 100 fs. But here we report the first study which correlates differences in the electron transfer rate with electronic structure and morphology, achieved with sub-20 fs time resolution pump-probe spectroscopy. We vary both the fullerene substitution and donor/fullerene ratio which allow us to control both aggregate size and the energetic driving force for charge transfer. We observe a range of electron transfer times from polymer to fullerene, from 240 fs to as short as 37 fs. Using ultrafast electro-optical pump-push-photocurrent spectroscopy, we find the yield of free versus bound charges to be weakly dependent on the energetic driving force, but to be very strongly dependent on fullerene aggregate size and packing. Our results point toward the importance of state accessibility and charge delocalization and suggest that energetic offsets between donor and acceptor levels are not an important criterion for efficient charge generation. This provides design rules for next-generation materials to minimize losses related to driving energy and boost PCE.

  7. Monte-Carlo modelling of nano-material photocatalysis: bridging photocatalytic activity and microscopic charge kinetics.

    PubMed

    Liu, Baoshun

    2016-04-28

    In photocatalysis, it is known that light intensity, organic concentration, and temperature affect the photocatalytic activity by changing the microscopic kinetics of holes and electrons. However, how the microscopic kinetics of holes and electrons relates to the photocatalytic activity was not well known. In the present research, we developed a Monte-Carlo random walking model that involved all of the charge kinetics, including the photo-generation, the recombination, the transport, and the interfacial transfer of holes and electrons, to simulate the overall photocatalytic reaction, which we called a "computer experiment" of photocatalysis. By using this model, we simulated the effect of light intensity, temperature, and organic surface coverage on the photocatalytic activity and the density of the free electrons that accumulate in the simulated system. It was seen that the increase of light intensity increases the electron density and its mobility, which increases the probability for a hole/electron to find an electron/hole for recombination, and consequently led to an apparent kinetics that the quantum yield (QY) decreases with the increase of light intensity. It was also seen that the increase of organic surface coverage could increase the rate of hole interfacial transfer and result in the decrease of the probability for an electron to recombine with a hole. Moreover, the increase of organic coverage on the nano-material surface can also increase the accumulation of electrons, which enhances the mobility for electrons to undergo interfacial transfer, and finally leads to the increase of photocatalytic activity. The simulation showed that the temperature had a more complicated effect, as it can simultaneously change the activation of electrons, the interfacial transfer of holes, and the interfacial transfer of electrons. It was shown that the interfacial transfer of holes might play a main role at low temperature, with the temperature-dependence of QY conforming to the Arrhenius model. The activation of electrons from the traps to the conduction band might become important at high temperature, which accelerates the electron movement for recombination and leads to a temperature dependence of QY that deviates from the Arrhenius model.

  8. Ultrafast forward and backward electron transfer dynamics of coumarin 337 in hydrogen-bonded anilines as studied with femtosecond UV-pump/IR-probe spectroscopy.

    PubMed

    Ghosh, Hirendra N; Verma, Sandeep; Nibbering, Erik T J

    2011-02-10

    Femtosecond infrared spectroscopy is used to study both forward and backward electron transfer (ET) dynamics between coumarin 337 (C337) and the aromatic amine solvents aniline (AN), N-methylaniline (MAN), and N,N-dimethylaniline (DMAN), where all the aniline solvents can donate an electron but only AN and MAN can form hydrogen bonds with C337. The formation of a hydrogen bond with AN and MAN is confirmed with steady state FT-IR spectroscopy, where the C═O stretching vibration is a direct marker mode for hydrogen bond formation. Transient IR absorption measurements in all solvents show an absorption band at 2166 cm(-1), which has been attributed to the C≡N stretching vibration of the C337 radical anion formed after ET. Forward electron transfer dynamics is found to be biexponential with time constants τ(ET)(1) = 500 fs, τ(ET)(2) = 7 ps in all solvents. Despite the presence of hydrogen bonds of C337 with the solvents AN and MAN, no effect has been found on the forward electron transfer step. Because of the absence of an H/D isotope effect on the forward electron transfer reaction of C337 in AN, hydrogen bonds are understood to play a minor role in mediating electron transfer. In contrast, direct π-orbital overlap between C337 and the aromatic amine solvents causes ultrafast forward electron transfer dynamics. Backward electron transfer dynamics, in contrast, is dependent on the solvent used. Standard Marcus theory explains the observed backward electron transfer rates.

  9. Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

    PubMed Central

    Boll, Rebecca; Erk, Benjamin; Coffee, Ryan; Trippel, Sebastian; Kierspel, Thomas; Bomme, Cédric; Bozek, John D.; Burkett, Mitchell; Carron, Sebastian; Ferguson, Ken R.; Foucar, Lutz; Küpper, Jochen; Marchenko, Tatiana; Miron, Catalin; Patanen, Minna; Osipov, Timur; Schorb, Sebastian; Simon, Marc; Swiggers, Michelle; Techert, Simone; Ueda, Kiyoshi; Bostedt, Christoph; Rolles, Daniel; Rudenko, Artem

    2016-01-01

    Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse. PMID:27051675

  10. Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Boning; Liang, Min; Zmich, Nicole

    Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

  11. Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

    DOE PAGES

    Wu, Boning; Liang, Min; Zmich, Nicole; ...

    2018-01-29

    Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

  12. Modeling ultrafast solvated electronic dynamics using time-dependent density functional theory and polarizable continuum model.

    PubMed

    Liang, Wenkel; Chapman, Craig T; Ding, Feizhi; Li, Xiaosong

    2012-03-01

    A first-principles solvated electronic dynamics method is introduced. Solvent electronic degrees of freedom are coupled to the time-dependent electronic density of a solute molecule by means of the implicit reaction field method, and the entire electronic system is propagated in time. This real-time time-dependent approach, incorporating the polarizable continuum solvation model, is shown to be very effective in describing the dynamical solvation effect in the charge transfer process and yields a consistent absorption spectrum in comparison to the conventional linear response results in solution. © 2012 American Chemical Society

  13. Dexter energy transfer pathways

    PubMed Central

    Skourtis, Spiros S.; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M.; Beratan, David N.

    2016-01-01

    Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor–acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways. PMID:27382185

  14. Dexter energy transfer pathways.

    PubMed

    Skourtis, Spiros S; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M; Beratan, David N

    2016-07-19

    Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor-acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways.

  15. Energy gap law of electron transfer in nonpolar solvents.

    PubMed

    Tachiya, M; Seki, Kazuhiko

    2007-09-27

    We investigate the energy gap law of electron transfer in nonpolar solvents for charge separation and charge recombination reactions. In polar solvents, the reaction coordinate is given in terms of the electrostatic potentials from solvent permanent dipoles at solutes. In nonpolar solvents, the energy fluctuation due to solvent polarization is absent, but the energy of the ion pair state changes significantly with the distance between the ions as a result of the unscreened strong Coulomb potential. The electron transfer occurs when the final state energy coincides with the initial state energy. For charge separation reactions, the initial state is a neutral pair state, and its energy changes little with the distance between the reactants, whereas the final state is an ion pair state and its energy changes significantly with the mutual distance; for charge recombination reactions, vice versa. We show that the energy gap law of electron-transfer rates in nonpolar solvents significantly depends on the type of electron transfer.

  16. Multicomponent Time-Dependent Density Functional Theory: Proton and Electron Excitation Energies.

    PubMed

    Yang, Yang; Culpitt, Tanner; Hammes-Schiffer, Sharon

    2018-04-05

    The quantum mechanical treatment of both electrons and protons in the calculation of excited state properties is critical for describing nonadiabatic processes such as photoinduced proton-coupled electron transfer. Multicomponent density functional theory enables the consistent quantum mechanical treatment of more than one type of particle and has been implemented previously for studying ground state molecular properties within the nuclear-electronic orbital (NEO) framework, where all electrons and specified protons are treated quantum mechanically. To enable the study of excited state molecular properties, herein the linear response multicomponent time-dependent density functional theory (TDDFT) is derived and implemented within the NEO framework. Initial applications to FHF - and HCN illustrate that NEO-TDDFT provides accurate proton and electron excitation energies within a single calculation. As its computational cost is similar to that of conventional electronic TDDFT, the NEO-TDDFT approach is promising for diverse applications, particularly nonadiabatic proton transfer reactions, which may exhibit mixed electron-proton vibronic excitations.

  17. Interfacial Electron Transfer at Sensitized Nanocrystalline TiO2 Electrolyte Interfaces: Influence of Surface Electric Fields and Lewis-Acidic Cations

    NASA Astrophysics Data System (ADS)

    Barr, Timothy J.

    Interfacial electron transfer reactions facilitate charge separation and recombination in dye-sensitized solar cells (DSSCs). Understanding what controls these electron transfer reactions is necessary to develop efficient DSSCs. Gerischer proposed a theory for interfacial electron transfer where the rate constant was related to the energetic overlap between the donor and acceptor states. The present work focuses on understanding how the composition of the CH3CN electrolyte influenced this overlap. It was found that the identity of the electrolyte cation tuned the energetic position of TiO2 electron acceptor states, similar to how pH influences the flatband potential of bulk semiconductors in aqueous electrolytes. For example, the onset for absorption changes, that were attributed to electrons in the TiO2 thin film, were 0.5 V more positive in Mg2+ containing electrolyte than TBA+, where TBA+ is tetrabutylammonium. Similar studies performed on mesoporous, nanocrystalline SnO2 thin films reported a similar cation dependence, but also found evidence for electrons that did not absorb in the visible region that were termed ‘phantom electrons.’. Electron injection is known to generate surface electric fields on the order of 2 MV/cm. The rearrangement of cations in response to surface electric fields, termed screening, was investigated. It was found that magnitude of the electric field and the screening dynamics were dependent on the identity of the electrolyte cation. The rate of charge recombination to the anionic iodide/triiodide redox mediator correlated with the screening ability of the cation, and was initially thought to control charge recombination. However, it was difficult to determine whether electron diffusion or driving force were also cation dependent. Therefore, a in-lab built apparatus, termed STRiVE, was constructed that could disentangle the influence electron diffusion, driving force, and electric fields had on charge recombination. It was found that electron diffusion was independent of the electrolyte cation. Furthermore, charge recombination displayed the same cation-sensitivity using both anionic and cationic redox mediators, indicating electric fields did not cause the cation-dependence of charge recombination. Instead, it was found that the electrolyte cation tuned the energetic position of the TiO2 acceptor states and modulated the driving force for charge recombination.

  18. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE PAGES

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...

    2016-03-22

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  19. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  20. Nodeless vibrational amplitudes and quantum nonadiabatic dynamics in the nested funnel for a pseudo Jahn-Teller molecule or homodimer

    NASA Astrophysics Data System (ADS)

    Peters, William K.; Tiwari, Vivek; Jonas, David M.

    2017-11-01

    The nonadiabatic states and dynamics are investigated for a linear vibronic coupling Hamiltonian with a static electronic splitting and weak off-diagonal Jahn-Teller coupling through a single vibration with a vibrational-electronic resonance. With a transformation of the electronic basis, this Hamiltonian is also applicable to the anti-correlated vibration in a symmetric homodimer with marginally strong constant off-diagonal coupling, where the non-adiabatic states and dynamics model electronic excitation energy transfer or self-exchange electron transfer. For parameters modeling a free-base naphthalocyanine, the nonadiabatic couplings are deeply quantum mechanical and depend on wavepacket width; scalar couplings are as important as the derivative couplings that are usually interpreted to depend on vibrational velocity in semiclassical curve crossing or surface hopping theories. A colored visualization scheme that fully characterizes the non-adiabatic states using the exact factorization is developed. The nonadiabatic states in this nested funnel have nodeless vibrational factors with strongly avoided zeroes in their vibrational probability densities. Vibronic dynamics are visualized through the vibrational coordinate dependent density of the time-dependent dipole moment in free induction decay. Vibrational motion is amplified by the nonadiabatic couplings, with asymmetric and anisotropic motions that depend upon the excitation polarization in the molecular frame and can be reversed by a change in polarization. This generates a vibrational quantum beat anisotropy in excess of 2/5. The amplitude of vibrational motion can be larger than that on the uncoupled potentials, and the electronic population transfer is maximized within one vibrational period. Most of these dynamics are missed by the adiabatic approximation, and some electronic and vibrational motions are completely suppressed by the Condon approximation of a coordinate-independent transition dipole between adiabatic states. For all initial conditions investigated, the initial nonadiabatic electronic motion is driven towards the lower adiabatic state, and criteria for this directed motion are discussed.

  1. Nodeless vibrational amplitudes and quantum nonadiabatic dynamics in the nested funnel for a pseudo Jahn-Teller molecule or homodimer.

    PubMed

    Peters, William K; Tiwari, Vivek; Jonas, David M

    2017-11-21

    The nonadiabatic states and dynamics are investigated for a linear vibronic coupling Hamiltonian with a static electronic splitting and weak off-diagonal Jahn-Teller coupling through a single vibration with a vibrational-electronic resonance. With a transformation of the electronic basis, this Hamiltonian is also applicable to the anti-correlated vibration in a symmetric homodimer with marginally strong constant off-diagonal coupling, where the non-adiabatic states and dynamics model electronic excitation energy transfer or self-exchange electron transfer. For parameters modeling a free-base naphthalocyanine, the nonadiabatic couplings are deeply quantum mechanical and depend on wavepacket width; scalar couplings are as important as the derivative couplings that are usually interpreted to depend on vibrational velocity in semiclassical curve crossing or surface hopping theories. A colored visualization scheme that fully characterizes the non-adiabatic states using the exact factorization is developed. The nonadiabatic states in this nested funnel have nodeless vibrational factors with strongly avoided zeroes in their vibrational probability densities. Vibronic dynamics are visualized through the vibrational coordinate dependent density of the time-dependent dipole moment in free induction decay. Vibrational motion is amplified by the nonadiabatic couplings, with asymmetric and anisotropic motions that depend upon the excitation polarization in the molecular frame and can be reversed by a change in polarization. This generates a vibrational quantum beat anisotropy in excess of 2/5. The amplitude of vibrational motion can be larger than that on the uncoupled potentials, and the electronic population transfer is maximized within one vibrational period. Most of these dynamics are missed by the adiabatic approximation, and some electronic and vibrational motions are completely suppressed by the Condon approximation of a coordinate-independent transition dipole between adiabatic states. For all initial conditions investigated, the initial nonadiabatic electronic motion is driven towards the lower adiabatic state, and criteria for this directed motion are discussed.

  2. A Combined Theoretical and Experimental Study of Dissociation of Charge Transfer States at the Donor-Acceptor Interface of Organic Solar Cells.

    PubMed

    Tscheuschner, Steffen; Bässler, Heinz; Huber, Katja; Köhler, Anna

    2015-08-13

    The observation that in efficient organic solar cells almost all electron-hole pairs generated at the donor-acceptor interface escape from their mutual coulomb potential remains to be a conceptual challenge. It has been argued that it is the excess energy dissipated in the course of electron or hole transfer at the interface that assists this escape process. The current work demonstrates that this concept is unnecessary to explain the field dependence of electron-hole dissociation. It is based upon the formalism developed by Arkhipov and co-workers as well as Baranovskii and co-workers. The key idea is that the binding energy of the dissociating "cold" charge-transfer state is reduced by delocalization of the hole along the polymer chain, quantified in terms of an "effective mass", as well as the fractional strength of dipoles existent at the interface in the dark. By covering a broad parameter space, we determine the conditions for efficient electron-hole dissociation. Spectroscopy of the charge-transfer state on bilayer solar cells as well as measurements of the field dependence of the dissociation yield over a broad temperature range support the theoretical predictions.

  3. A simple model of solvent-induced symmetry-breaking charge transfer in excited quadrupolar molecules

    NASA Astrophysics Data System (ADS)

    Ivanov, Anatoly I.; Dereka, Bogdan; Vauthey, Eric

    2017-04-01

    A simple model has been developed to describe the symmetry-breaking of the electronic distribution of AL-D-AR type molecules in the excited state, where D is an electron donor and AL and AR are identical acceptors. The origin of this process is usually associated with the interaction between the molecule and the solvent polarization that stabilizes an asymmetric and dipolar state, with a larger charge transfer on one side than on the other. An additional symmetry-breaking mechanism involving the direct Coulomb interaction of the charges on the acceptors is proposed. At the same time, the electronic coupling between the two degenerate states, which correspond to the transferred charge being localised either on AL or AR, favours a quadrupolar excited state with equal amount of charge-transfer on both sides. Because of these counteracting effects, symmetry breaking is only feasible when the electronic coupling remains below a threshold value, which depends on the solvation energy and the Coulomb repulsion energy between the charges located on AL and AR. This model allows reproducing the solvent polarity dependence of the symmetry-breaking reported recently using time-resolved infrared spectroscopy.

  4. Ultrafast Electron Transfer across a Nanocapsular Wall: Coumarins as Donors, Viologen as Acceptor, and Octa Acid Capsule as the Mediator.

    PubMed

    Chuang, Chi-Hung; Porel, Mintu; Choudhury, Rajib; Burda, Clemens; Ramamurthy, V

    2018-01-11

    Results of our study on ultrafast electron transfer (eT) dynamics from coumarins (coumarin-1, coumarin-480, and coumarin-153) incarcerated within octa acid (OA) capsules as electron donors to methyl viologen dissolved in water as acceptor are presented. Upon photoexcitation, coumarin inside the OA capsule transfers an electron to the acceptor electrostatically attached to the capsule leading to a long-lived radical-ion pair separated by the OA capsular wall. This charge-separated state returns to the neutral ground state via back electron transfer on the nanosecond time scale. This system allows for ultrafast electron transfer processes through a molecular wall from the apolar capsular interior to the highly polar (aqueous) environment on the femtosecond time scale. Employing femtosecond transient absorption spectroscopy, distinct rates of both forward (1-25 ps) and backward eT (700-1200 ps) processes were measured. Further understanding of the energetics is provided using Rehm-Weller analysis for the investigated photoinduced eT reactions. The results provide the rates of the eT across a molecular wall, akin to an isotropic solution, depending on the standard free energy of the reaction. The insights from this work could be utilized in the future design of efficient electron transfer processes across interfaces separating apolar and polar environments.

  5. Molecular design of light-harvesting photosensitizers: effect of varied linker conjugation on interfacial electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Jianbing; Swierk, John R.; Hedstrom, Svante

    2016-06-30

    Here, interfacial electron transfer dynamics of a series of photosensitizers bound to TiO 2 via linkers of varying conjugation strength are explored by spectroscopic and computational techniques. Injection and recombination depend on the extent of conjugation in the linker, where the LUMO delocalization determines the injection dynamics but both the HOMO and HOMO–1 are involved in recombination.

  6. Membraneless enzymatic ethanol/O2 fuel cell: Transitioning from an air-breathing Pt-based cathode to a bilirubin oxidase-based biocathode

    NASA Astrophysics Data System (ADS)

    Aquino Neto, Sidney; Milton, Ross D.; Hickey, David P.; De Andrade, Adalgisa R.; Minteer, Shelley D.

    2016-08-01

    The bioelectrooxidation of ethanol was investigated in a fully enzymatic membraneless ethanol/O2 biofuel cell assembly using hybrid bioanodes containing multi-walled carbon nanotube (MWCNT)-decorated gold metallic nanoparticles with either a pyrroloquinoline quinone (PQQ)-dependent alcohol dehydrogenase (ADH) enzyme or a nicotinamide adenine dinucleotide (NAD+)-dependent ADH enzyme. The biofuel cell anode was prepared with the PQQ-dependent enzyme and designed using either a direct electron transfer (DET) architecture or via a mediated electron transfer (MET) configuration through a redox polymer, 1,1‧-dimethylferrocene-modified linear polyethyleneimine (FcMe2-C3-LPEI). In the case of the bioanode containing the NAD+-dependent enzyme, only the mediated electron transfer mechanism was employed using an electropolymerized methylene green film to regenerate the NAD+ cofactor. Regardless of the enzyme being employed at the anode, a bilirubin oxidase-based biocathode prepared within a DET architecture afforded efficient electrocatalytic oxygen reduction in an ethanol/O2 biofuel cell. The power curves showed that DET-based bioanodes via the PQQ-dependent ADH still lack high current densities, whereas the MET architecture furnished maximum power density values as high as 226 ± 21 μW cm-2. Considering the complete membraneless enzymatic biofuel cell with the NAD+-dependent ADH-based bioanode, power densities as high as 111 ± 14 μW cm-2 were obtained. This shows the advantage of PQQ-dependent ADH for membraneless ethanol/O2 biofuel cell applications.

  7. Selective Electrocatalytic Reduction of Nitrite to Dinitrogen Based on Decoupled Proton-Electron Transfer.

    PubMed

    He, Daoping; Li, Yamei; Ooka, Hideshi; Go, Yoo Kyung; Jin, Fangming; Kim, Sun Hee; Nakamura, Ryuhei

    2018-02-14

    The development of denitrification catalysts which can reduce nitrate and nitrite to dinitrogen is critical for sustaining the nitrogen cycle. However, regulating the selectivity has proven to be a challenge, due to the difficulty of controlling complex multielectron/proton reactions. Here we report that utilizing sequential proton-electron transfer (SPET) pathways is a viable strategy to enhance the selectivity of electrochemical reactions. The selectivity of an oxo-molybdenum sulfide electrocatalyst toward nitrite reduction to dinitrogen exhibited a volcano-type pH dependence with a maximum at pH 5. The pH-dependent formation of the intermediate species (distorted Mo(V) oxo species) identified using operando electron paramagnetic resonance (EPR) and Raman spectroscopy was in accord with a mathematical prediction that the pK a of the reaction intermediates determines the pH-dependence of the SPET-derived product. By utilizing this acute pH dependence, we achieved a Faradaic efficiency of 13.5% for nitrite reduction to dinitrogen, which is the highest value reported to date under neutral conditions.

  8. I-V characterization of a quantum well infrared photodetector with stepped and graded barriers

    NASA Astrophysics Data System (ADS)

    Nutku, F.; Erol, A.; Gunes, M.; Buklu, L. B.; Ergun, Y.; Arikan, M. C.

    2012-09-01

    I-V characterization of an n-type quantum well infrared photodetector which consists of stepped and graded barriers has been done under dark at temperatures between 20-300 K. Different current transport mechanisms and transition between them have been observed at temperature around 47 K. Activation energies of the electrons at various bias voltages have been obtained from the temperature dependent I-V measurements. Activation energy at zero bias has been calculated by extrapolating the bias dependence of the activation energies. Ground state energies and barrier heights of the four different quantum wells have been calculated by using an iterative technique, which depends on experimentally obtained activation energy. Ground state energies also have been calculated with transfer matrix technique and compared with iteration results. Incorporating the effect of high electron density induced electron exchange interaction on ground state energies; more consistent results with theoretical transfer matrix calculations have been obtained.

  9. Evidence of short-range electron transfer of a redox enzyme on graphene oxide electrodes.

    PubMed

    Martins, Marccus V A; Pereira, Andressa R; Luz, Roberto A S; Iost, Rodrigo M; Crespilho, Frank N

    2014-09-07

    Direct electron transfer (DET) between redox enzymes and electrode surfaces is of growing interest and an important strategy in the development of biofuel cells and biosensors. Among the nanomaterials utilized at electrode/enzyme interfaces to enhance the electronic communication, graphene oxide (GO) has been identified as a highly promising candidate. It is postulated that GO layers decrease the distance between the flavin cofactor (FAD/FADH2) of the glucose oxidase enzyme (GOx) and the electrode surface, though experimental evidence concerning the distance dependence of the rate constant for heterogeneous electron-transfer (k(het)) has not yet been observed. In this work, we report the experimentally observed DET of the GOx enzyme adsorbed on flexible carbon fiber (FCF) electrodes modified with GO (FCF-GO), where the k(het) between GO and electroactive GOx has been measured at a structurally well-defined interface. The curves obtained from the Marcus theory were used to obtain k(het), by using the model proposed by Chidsey. In agreement with experimental data, this model proved to be useful to systematically probe the dependence of electron transfer rates on distance, in order to provide an empirical basis to understand the origin of interfacial DET between GO and GOx. We also demonstrate that the presence of GO at the enzyme/electrode interface diminishes the activation energy by decreasing the distance between the electrode surface and FAD/FADH2.

  10. The microbe electric: conversion of organic matter to electricity.

    PubMed

    Lovley, Derek R

    2008-12-01

    Broad application of microbial fuel cells will require substantial increases in current density. A better understanding of the microbiology of these systems may help. Recent studies have greatly expanded the range of microorganisms known to function either as electrode-reducing microorganisms at the anode or as electrode-oxidizing microorganisms at the cathode. Microorganisms that can completely oxidize organic compounds with an electrode serving as the sole electron acceptor are expected to be the primary contributors to power production. Several mechanisms for electron transfer to anodes have been proposed including: direct electron transfer via outer-surface c-type cytochromes, long-range electron transfer via microbial nanowires, electron flow through a conductive biofilm matrix containing cytochromes, and soluble electron shuttles. Which mechanisms are most important depend on the microorganisms and the thickness of the anode biofilm. Emerging systems biology approaches to the study, design, and evolution of microorganisms interacting with electrodes are expected to contribute to improved microbial fuel cells.

  11. Electron transfer capacity dependence of quinone-mediated Fe(III) reduction and current generation by Klebsiella pneumoniae L17.

    PubMed

    Li, Xiaomin; Liu, Liang; Liu, Tongxu; Yuan, Tian; Zhang, Wei; Li, Fangbai; Zhou, Shungui; Li, Yongtao

    2013-06-01

    Quinone groups in exogenous electron shuttles can accelerate extracellular electron transfer (EET) from bacteria to insoluble terminal electron acceptors, such as Fe(III) oxides and electrodes, which are important in biogeochemical redox processes and microbial electricity generation. However, the relationship between quinone-mediated EET performance and electron-shuttling properties of the quinones remains incompletely characterized. This study investigates the effects of a series of synthetic quinones (SQs) on goethite reduction and current generation by a fermenting bacterium Klebsiella pneumoniae L17. In addition, the voltammetric behavior and electron transfer capacities (ETCs) of SQ, including electron accepting (EAC) and donating (EDC) capacities, is also examined using electrochemical methods. The results showed that SQ can significantly increase both the Fe(III) reduction rates and current outputs of L17. Each tested SQ reversibly accepted and donated electrons as indicated by the cyclic voltammograms. The EAC and EDC results showed that Carmine and Alizarin had low relative capacities of electron transfer, whereas 9,10-anthraquinone-2,6-disulfonic acid (AQDS), 2-hydroxy-1,4-naphthoquinone (2-HNQ), and 5-hydroxy-1,4-naphthoquinone (5-HNQ) showed stronger relative ETC, and 9,10-anthraquinone-2-carboxylic acid (AQC) and 9,10-anthraquinone-2-sulfonic acid (AQS) had high relative ETC. Enhancement of microbial goethite reduction kinetics and current outputs by SQ had a good linear relationship with their ETC, indicating that the effectiveness of quinone-mediated EET may be strongly dependent on the ETC of the quinones. Therefore, the presence of quinone compounds and fermenting microorganisms may increase the diversity of microbial populations that contribute to element transformation in natural environments. Moreover, ETC determination of different SQ would help to evaluate their performance for microbial EET under anoxic conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Dynamical simulation of electron transfer processes in self-assembled monolayers at metal surfaces using a density matrix approach.

    PubMed

    Prucker, V; Bockstedte, M; Thoss, M; Coto, P B

    2018-03-28

    A single-particle density matrix approach is introduced to simulate the dynamics of heterogeneous electron transfer (ET) processes at interfaces. The characterization of the systems is based on a model Hamiltonian parametrized by electronic structure calculations and a partitioning method. The method is applied to investigate ET in a series of nitrile-substituted (poly)(p-phenylene)thiolate self-assembled monolayers adsorbed at the Au(111) surface. The results show a significant dependence of the ET on the orbital symmetry of the donor state and on the molecular and electronic structure of the spacer.

  13. Density functional theory of electron transfer beyond the Born-Oppenheimer approximation: Case study of LiF

    NASA Astrophysics Data System (ADS)

    Li, Chen; Requist, Ryan; Gross, E. K. U.

    2018-02-01

    We perform model calculations for a stretched LiF molecule, demonstrating that nonadiabatic charge transfer effects can be accurately and seamlessly described within a density functional framework. In alkali halides like LiF, there is an abrupt change in the ground state electronic distribution due to an electron transfer at a critical bond length R = Rc, where an avoided crossing of the lowest adiabatic potential energy surfaces calls the validity of the Born-Oppenheimer approximation into doubt. Modeling the R-dependent electronic structure of LiF within a two-site Hubbard model, we find that nonadiabatic electron-nuclear coupling produces a sizable elongation of the critical Rc by 0.5 bohr. This effect is very accurately captured by a simple and rigorously derived correction, with an M-1 prefactor, to the exchange-correlation potential in density functional theory, M = reduced nuclear mass. Since this nonadiabatic term depends on gradients of the nuclear wave function and conditional electronic density, ∇Rχ(R) and ∇Rn(r, R), it couples the Kohn-Sham equations at neighboring R points. Motivated by an observed localization of nonadiabatic effects in nuclear configuration space, we propose a local conditional density approximation—an approximation that reduces the search for nonadiabatic density functionals to the search for a single function y(n).

  14. Localized electron transfer rates and microelectrode-based enrichment of microbial communities within a phototrophic microbial mat.

    PubMed

    Babauta, Jerome T; Atci, Erhan; Ha, Phuc T; Lindemann, Stephen R; Ewing, Timothy; Call, Douglas R; Fredrickson, James K; Beyenal, Haluk

    2014-01-01

    Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell was light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode-associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1-V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community.

  15. Localized electron transfer rates and microelectrode-based enrichment of microbial communities within a phototrophic microbial mat

    PubMed Central

    Babauta, Jerome T.; Atci, Erhan; Ha, Phuc T.; Lindemann, Stephen R.; Ewing, Timothy; Call, Douglas R.; Fredrickson, James K.; Beyenal, Haluk

    2014-01-01

    Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell was light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode-associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1–V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community. PMID:24478768

  16. Localized electron transfer rates and microelectrode-based enrichment of microbial communities within a phototrophic microbial mat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Babauta, Jerome T.; Atci, Erhan; Ha, Phuc T.

    2014-01-01

    Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell wasmore » light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode- associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1-V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community.« less

  17. An Fe-S cluster in the conserved Cys-rich region in the catalytic subunit of FAD-dependent dehydrogenase complexes.

    PubMed

    Shiota, Masaki; Yamazaki, Tomohiko; Yoshimatsu, Keiichi; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

    2016-12-01

    Several bacterial flavin adenine dinucleotide (FAD)-harboring dehydrogenase complexes comprise three distinct subunits: a catalytic subunit with FAD, a cytochrome c subunit containing three hemes, and a small subunit. Owing to the cytochrome c subunit, these dehydrogenase complexes have the potential to transfer electrons directly to an electrode. Despite various electrochemical applications and engineering studies of FAD-dependent dehydrogenase complexes, the intra/inter-molecular electron transfer pathway has not yet been revealed. In this study, we focused on the conserved Cys-rich region in the catalytic subunits using the catalytic subunit of FAD dependent glucose dehydrogenase complex (FADGDH) as a model, and site-directed mutagenesis and electron paramagnetic resonance (EPR) were performed. By co-expressing a hitch-hiker protein (γ-subunit) and a catalytic subunit (α-subunit), FADGDH γα complexes were prepared, and the properties of the catalytic subunit of both wild type and mutant FADGDHs were investigated. Substitution of the conserved Cys residues with Ser resulted in the loss of dye-mediated glucose dehydrogenase activity. ICP-AEM and EPR analyses of the wild-type FADGDH catalytic subunit revealed the presence of a 3Fe-4S-type iron-sulfur cluster, whereas none of the Ser-substituted mutants showed the EPR spectrum characteristic for this cluster. The results suggested that three Cys residues in the Cys-rich region constitute an iron-sulfur cluster that may play an important role in the electron transfer from FAD (intra-molecular) to the multi-heme cytochrome c subunit (inter-molecular) electron transfer pathway. These features appear to be conserved in the other three-subunit dehydrogenases having an FAD cofactor. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Intramolecular electron-transfer rates in mixed-valence triarylamines: measurement by variable-temperature ESR spectroscopy and comparison with optical data.

    PubMed

    Lancaster, Kelly; Odom, Susan A; Jones, Simon C; Thayumanavan, S; Marder, Seth R; Brédas, Jean-Luc; Coropceanu, Veaceslav; Barlow, Stephen

    2009-02-11

    The electron spin resonance spectra of the radical cations of 4,4'-bis[di(4-methoxyphenyl)amino]tolane, E-4,4'-bis[di(4-methoxyphenyl)amino]stilbene, and E,E-1,4-bis{4-[di(4-methoxyphenyl)amino]styryl}benzene in dichloromethane exhibit five lines over a wide temperature range due to equivalent coupling to two 14N nuclei, indicating either delocalization between both nitrogen atoms or rapid intramolecular electron transfer on the electron spin resonance time scale. In contrast, those of the radical cations of 1,4-bis{4-[di(4-methoxyphenyl)amino]phenylethynyl}benzene and E,E-1,4-bis{4-[di(4-n-butoxyphenyl)amino]styryl}-2,5-dicyanobenzene exhibit line shapes that vary strongly with temperature, displaying five lines at room temperature and only three lines at ca. 190 K, indicative of slow electron transfer on the electron spin resonance time scale at low temperatures. The rates of intramolecular electron transfer in the latter compounds were obtained by simulation of the electron spin resonance spectra and display an Arrhenius temperature dependence. The activation barriers obtained from Arrhenius plots are significantly less than anticipated from Hush analyses of the intervalence bands when the diabatic electron-transfer distance, R, is equated to the N[symbol: see text]N distance. Comparison of optical and electron spin resonance data suggests that R is in fact only ca. 40% of the N[symbol: see text]N distance, while the Arrhenius prefactor indicates that the electron transfer falls in the adiabatic regime.

  19. Feasibility study of electron transfer quantum well infrared photodetectors for spectral tuning in the long-wave infrared band

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jolley, Greg; Dehdashti Akhavan, Nima; Umana-Membreno, Gilberto

    An electron transfer quantum well infrared photodetector (QWIP) consisting of repeating units of two coupled quantum wells (QWs) is capable of exhibiting a two color voltage dependent spectral response. However, significant electron transfer between the coupled QWs is required for spectral tuning, which may require the application of relatively high electric fields. Also, the band structure of coupled quantum wells is more complicated in comparison to a regular quantum well and, therefore, it is not always obvious if an electron transfer QWIP can be designed such that it meets specific performance characteristics. This paper presents a feasibility study of themore » electron transfer QWIP and its suitability for spectral tuning. Self consistent calculations have been performed of the bandstructure and the electric field that results from electron population within the quantum wells, from which the optical characteristics have been obtained. The band structure, spectral response, and the resonant final state energy locations have been compared with standard QWIPs. It is shown that spectral tuning in the long-wave infrared band can be achieved over a wide wavelength range of several microns while maintaining a relatively narrow spectral response FWHM. However, the total absorption strength is more limited in comparison to a standard QWIP, since the higher QW doping densities require much higher electric fields for electron transfer.« less

  20. Electron Tunneling in Lithium Ammonia Solutions Probed by Frequency-Dependent Electron-Spin Relaxation Studies

    PubMed Central

    Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.

    2012-01-01

    Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866

  1. Ab initio quantum chemical study of electron transfer in carboranes

    NASA Astrophysics Data System (ADS)

    Pati, Ranjit; Pineda, Andrew C.; Pandey, Ravindra; Karna, Shashi P.

    2005-05-01

    The electron transfer (ET) properties of 10- and 12-vertex carboranes are investigated by the ab initio Hartree-Fock method within the Marcus-Hush (MH) two-state model and the Koopman theorem (KT) approach. The calculated value of the ET coupling matrix element, VAB, is consistently higher in the KT approach than in the MH two-state model. For the carborane molecules functionalized by -CH 2 groups at C-vertices, VAB strongly depends on the relative orientation of the planes containing the terminal -CH 2 groups. The predicted conformation dependence of VAB offers a molecular mechanism to control ET between two active centers in molecular systems.

  2. Mulliken Hush elucidation of the encounter (precursor) complex in intermolecular electron transfer via self-exchange of tetracyanoethylene anion-radical

    NASA Astrophysics Data System (ADS)

    Rosokha, S. V.; Newton, M. D.; Head-Gordon, M.; Kochi, J. K.

    2006-05-01

    The paramagnetic [1:1] encounter complex (TCNE)2-rad is established as the important precursor in the kinetics and mechanism of electron-transfer for the self-exchange between tetracyanoethylene acceptor ( TCNE) and its radical-anion as the donor. Spectroscopic observation of the dimeric complex (TCNE)2-rad by its intervalence absorption band at the solvent-dependent wavelength of λIV ˜ 1500 nm facilitates the application of Mulliken-Hush theory which reveals the significant electronic interaction extant between the pair of cofacial TCNE moieties with the sizable coupling of HDA = 1000 cm -1. The transient existence of such an encounter complex provides the critical link in the electron-transfer kinetics by lowering the classical Marcus reorganization barrier by the amount of HDA in this strongly adiabatic system. Ab initio quantum-mechanical methods as applied to independent theoretical computations of both the reorganization energy ( λ) and the electronic coupling element ( HDA) confirm the essential correctness of the Mulliken-Hush formalism for fast electron transfer via strongly coupled donor/acceptor encounter complexes.

  3. Molecular basis of intramolecular electron transfer in proteins during radical-mediated oxidations: Computer simulation studies in model tyrosine-cysteine peptides in solution

    PubMed Central

    Petruk, Ariel A.; Bartesaghi, Silvina; Trujillo, Madia; Estrin, Darío A.; Murgida, Daniel; Kalyanaraman, Balaraman; Marti, Marcelo A.; Radi, Rafael

    2012-01-01

    Experimental studies in hemeproteins and model Tyr/Cys-containing peptides exposed to oxidizing and nitrating species suggest that intramolecular electron transfer (IET) between tyrosyl radicals (Tyr-O●) and Cys residues controls oxidative modification yields. The molecular basis of this IET process is not sufficiently understood with structural atomic detail. Herein, we analyzed using molecular dynamics and quantum mechanics-based computational calculations, mechanistic possibilities for the radical transfer reaction in Tyr/Cys-containing peptides in solution and correlated them with existing experimental data. Our results support that Tyr-O● to Cys radical transfer is mediated by an acid/base equilibrium that involves deprotonation of Cys to form the thiolate, followed by a likely rate-limiting transfer process to yield cysteinyl radical and a Tyr phenolate; proton uptake by Tyr completes the reaction. Both, the pKa values of the Tyr phenol and Cys thiol groups and the energetic and kinetics of the reversible IET are revealed as key physico-chemical factors. The proposed mechanism constitutes a case of sequential, acid/base equilibrium-dependent and solvent-mediated, proton-coupled electron transfer and explains the dependency of oxidative yields in Tyr/Cys peptides as a function of the number of alanine spacers. These findings contribute to explain oxidative modifications in proteins that contain sequence and/or spatially close Tyr-Cys residues. PMID:22640642

  4. A unified diabatic description for electron transfer reactions, isomerization reactions, proton transfer reactions, and aromaticity.

    PubMed

    Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S

    2015-10-14

    While diabatic approaches are ubiquitous for the understanding of electron-transfer reactions and have been mooted as being of general relevance, alternate applications have not been able to unify the same wide range of observed spectroscopic and kinetic properties. The cause of this is identified as the fundamentally different orbital configurations involved: charge-transfer phenomena involve typically either 1 or 3 electrons in two orbitals whereas most reactions are typically closed shell. As a result, two vibrationally coupled electronic states depict charge-transfer scenarios whereas three coupled states arise for closed-shell reactions of non-degenerate molecules and seven states for the reactions implicated in the aromaticity of benzene. Previous diabatic treatments of closed-shell processes have considered only two arbitrarily chosen states as being critical, mapping these states to those for electron transfer. We show that such effective two-state diabatic models are feasible but involve renormalized electronic coupling and vibrational coupling parameters, with this renormalization being property dependent. With this caveat, diabatic models are shown to provide excellent descriptions of the spectroscopy and kinetics of the ammonia inversion reaction, proton transfer in N2H7(+), and aromaticity in benzene. This allows for the development of a single simple theory that can semi-quantitatively describe all of these chemical phenomena, as well as of course electron-transfer reactions. It forms a basis for understanding many technologically relevant aspects of chemical reactions, condensed-matter physics, chemical quantum entanglement, nanotechnology, and natural or artificial solar energy capture and conversion.

  5. Quantum Electron Tunneling in Respiratory Complex I1

    PubMed Central

    Hayashi, Tomoyuki; Stuchebrukhov, Alexei A.

    2014-01-01

    We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. One-electron tunneling approximation is found to hold in electron tunneling between the anti-ferromagnetic binuclear and tetranuclear Fe/S clusters with moderate induced polarization of the core electrons. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A distinct signature of the wave properties of electrons is observed as quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included are in good agreement with a reported phenomenological relation. PMID:21495666

  6. Transfer doping of single isolated nanodiamonds, studied by scanning probe microscopy techniques.

    PubMed

    Bolker, Asaf; Saguy, Cecile; Kalish, Rafi

    2014-09-26

    The transfer doping of diamond surfaces has been applied in various novel two-dimensional electronic devices. Its extension to nanodiamonds (ND) is essential for ND-based applications in many fields. In particular, understanding the influence of the crystallite size on transfer doping is desirable. Here, we report the results of a detailed study of the electronic energetic band structure of single, isolated transfer-doped nanodiamonds with nanometric resolution using a combination of scanning tunneling spectroscopy and Kelvin force microscopy measurements. The results show how the band gap, the valence band maximum, the electron affinity and the work function all depend on the ND's size and nanoparticle surface properties. The present analysis, which combines information from both scanning tunneling spectroscopy and Kelvin force microscopy, should be applicable to any nanoparticle or surface that can be measured with scanning probe techniques.

  7. Fractional conductance oscillations in quantum rings: wave packet picture of transport in a few-electron system.

    PubMed

    Chwiej, T; Szafran, B

    2013-04-17

    We study electron transfer across a two-terminal quantum ring using a time-dependent description of the scattering process. For the considered scattering event the quantum ring is initially charged with one or two electrons, with another electron incident to the ring from the input channel. We study the electron transfer probability (T) as a function of the external magnetic field. We determine the periodicity of T for a varied number of electrons confined within the ring. For that purpose we develop a method to describe the wave packet dynamics for a few electrons participating in the scattering process, taking into full account the electron-electron correlations. We find that electron transfer across the quantum ring initially charged by a single electron acquires a distinct periodicity of half of the magnetic flux quantum (Φ0/2), corresponding to the formation of a transient two-electron state inside the ring. In the case of a three-electron scattering problem with two electrons initially occupying the ring, a period of Φ0/3 for T is formed in the limit of thin channels. The effect of disorder present in the confinement potential of the ring is also discussed.

  8. Equilibrium and ultrafast kinetic studies manipulating electron transfer: A short-lived flavin semiquinone is not sufficient for electron bifurcation

    DOE PAGES

    Hoben, John P.; Lubner, Carolyn E.; Ratzloff, Michael W.; ...

    2017-06-14

    Flavin-based electron transfer bifurcation is emerging as a fundamental and powerful mechanism for conservation and deployment of electrochemical energy in enzymatic systems. In this process, a pair of electrons is acquired at intermediate reduction potential (i.e. intermediate reducing power) and each electron is passed to a different acceptor, one with lower and the other with higher reducing power, leading to 'bifurcation'. It is believed that a strongly reducing semiquinone species is essential for this process, and it is expected that this species should be kinetically short-lived. We now demonstrate that presence of a short-lived anionic flavin semiquinone (ASQ) is notmore » sufficient to infer existence of bifurcating activity, although such a species may be necessary for the process. We have used transient absorption spectroscopy to compare the rates and mechanisms of decay of ASQ generated photochemically in bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase and the non-bifurcating flavoproteins nitroreductase, NADH oxidase and flavodoxin. We found that different mechanisms dominate ASQ decay in the different protein environments, producing lifetimes ranging over two orders of magnitude. Capacity for electron transfer among redox cofactors vs. charge recombination with nearby donors can explain the range of ASQ lifetimes we observe. In conclusion, our results support a model wherein efficient electron propagation can explain the short lifetime of the ASQ of bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase I, and can be an indication of capacity for electron bifurcation.« less

  9. Equilibrium and ultrafast kinetic studies manipulating electron transfer: A short-lived flavin semiquinone is not sufficient for electron bifurcation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoben, John P.; Lubner, Carolyn E.; Ratzloff, Michael W.

    Flavin-based electron transfer bifurcation is emerging as a fundamental and powerful mechanism for conservation and deployment of electrochemical energy in enzymatic systems. In this process, a pair of electrons is acquired at intermediate reduction potential (i.e. intermediate reducing power) and each electron is passed to a different acceptor, one with lower and the other with higher reducing power, leading to 'bifurcation'. It is believed that a strongly reducing semiquinone species is essential for this process, and it is expected that this species should be kinetically short-lived. We now demonstrate that presence of a short-lived anionic flavin semiquinone (ASQ) is notmore » sufficient to infer existence of bifurcating activity, although such a species may be necessary for the process. We have used transient absorption spectroscopy to compare the rates and mechanisms of decay of ASQ generated photochemically in bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase and the non-bifurcating flavoproteins nitroreductase, NADH oxidase and flavodoxin. We found that different mechanisms dominate ASQ decay in the different protein environments, producing lifetimes ranging over two orders of magnitude. Capacity for electron transfer among redox cofactors vs. charge recombination with nearby donors can explain the range of ASQ lifetimes we observe. In conclusion, our results support a model wherein efficient electron propagation can explain the short lifetime of the ASQ of bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase I, and can be an indication of capacity for electron bifurcation.« less

  10. Equilibrium and ultrafast kinetic studies manipulating electron transfer: A short-lived flavin semiquinone is not sufficient for electron bifurcation.

    PubMed

    Hoben, John P; Lubner, Carolyn E; Ratzloff, Michael W; Schut, Gerrit J; Nguyen, Diep M N; Hempel, Karl W; Adams, Michael W W; King, Paul W; Miller, Anne-Frances

    2017-08-25

    Flavin-based electron transfer bifurcation is emerging as a fundamental and powerful mechanism for conservation and deployment of electrochemical energy in enzymatic systems. In this process, a pair of electrons is acquired at intermediate reduction potential ( i.e. intermediate reducing power), and each electron is passed to a different acceptor, one with lower and the other with higher reducing power, leading to "bifurcation." It is believed that a strongly reducing semiquinone species is essential for this process, and it is expected that this species should be kinetically short-lived. We now demonstrate that the presence of a short-lived anionic flavin semiquinone (ASQ) is not sufficient to infer the existence of bifurcating activity, although such a species may be necessary for the process. We have used transient absorption spectroscopy to compare the rates and mechanisms of decay of ASQ generated photochemically in bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase and the non-bifurcating flavoproteins nitroreductase, NADH oxidase, and flavodoxin. We found that different mechanisms dominate ASQ decay in the different protein environments, producing lifetimes ranging over 2 orders of magnitude. Capacity for electron transfer among redox cofactors versus charge recombination with nearby donors can explain the range of ASQ lifetimes that we observe. Our results support a model wherein efficient electron propagation can explain the short lifetime of the ASQ of bifurcating NADH-dependent ferredoxin-NADP + oxidoreductase I and can be an indication of capacity for electron bifurcation.

  11. Interdomain electron transfer in cellobiose dehydrogenase is governed by surface electrostatics.

    PubMed

    Kadek, Alan; Kavan, Daniel; Marcoux, Julien; Stojko, Johann; Felice, Alfons K G; Cianférani, Sarah; Ludwig, Roland; Halada, Petr; Man, Petr

    2017-02-01

    Cellobiose dehydrogenase (CDH) is a fungal extracellular oxidoreductase which fuels lytic polysaccharide monooxygenase with electrons during cellulose degradation. Interdomain electron transfer between the flavin and cytochrome domain in CDH, preceding the electron flow to lytic polysaccharide monooxygenase, is known to be pH dependent, but the exact mechanism of this regulation has not been experimentally proven so far. To investigate the structural aspects underlying the domain interaction in CDH, hydrogen/deuterium exchange (HDX-MS) with improved proteolytic setup (combination of nepenthesin-1 with rhizopuspepsin), native mass spectrometry with ion mobility and electrostatics calculations were used. HDX-MS revealed pH-dependent changes in solvent accessibility and hydrogen bonding at the interdomain interface. Electrostatics calculations identified these differences to result from charge neutralization by protonation and together with ion mobility pointed at higher electrostatic repulsion between CDH domains at neutral pH. In addition, we uncovered extensive O-glycosylation in the linker region and identified the long-unknown exact cleavage point in papain-mediated domain separation. Transition of CDH between its inactive (open) and interdomain electron transfer-capable (closed) state is shown to be governed by changes in the protein surface electrostatics at the domain interface. Our study confirms that the interdomain electrostatic repulsion is the key factor modulating the functioning of CDH. The results presented in this paper provide experimental evidence for the role of charge repulsion in the interdomain electron transfer in cellobiose dehydrogenases, which is relevant for exploiting their biotechnological potential in biosensors and biofuel cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Ultrafast fluorescence quenching dynamics of Atto655 in the presence of N-acetyltyrosine and N-acetyltryptophan in aqueous solution: proton-coupled electron transfer versus electron transfer.

    PubMed

    Zhang, Ying; Yuan, Shuwei; Lu, Rong; Yu, Anchi

    2013-06-20

    We studied the ultrafast fluorescence quenching dynamics of Atto655 in the presence of N-acetyltyrosine (AcTyr) and N-acetyltryptophan (AcTrp) in aqueous solution with femtosecond transient absorption spectroscopy. We found that the charge-transfer rate between Atto655 and AcTyr is about 240 times smaller than that between Atto655 and AcTrp. The pH value and D2O dependences of the excited-state decay kinetics of Atto655 in the presence of AcTyr and AcTrp reveal that the quenching of Atto655 fluorescence by AcTyr in aqueous solution is via a proton-coupled electron-transfer (PCET) process and that the quenching of Atto655 fluorescence by AcTrp in aqueous solution is via an electron-transfer process. With the version of the semiclassical Marcus ET theory, we derived that the electronic coupling constant for the PCET reaction between Atto655 and AcTyr in aqueous solution is 8.3 cm(-1), indicating that the PCET reaction between Atto655 and AcTyr in aqueous solution is nonadiabatic.

  13. Charge transfer in model peptides: obtaining Marcus parameters from molecular simulation.

    PubMed

    Heck, Alexander; Woiczikowski, P Benjamin; Kubař, Tomáš; Giese, Bernd; Elstner, Marcus; Steinbrecher, Thomas B

    2012-02-23

    Charge transfer within and between biomolecules remains a highly active field of biophysics. Due to the complexities of real systems, model compounds are a useful alternative to study the mechanistic fundamentals of charge transfer. In recent years, such model experiments have been underpinned by molecular simulation methods as well. In this work, we study electron hole transfer in helical model peptides by means of molecular dynamics simulations. A theoretical framework to extract Marcus parameters of charge transfer from simulations is presented. We find that the peptides form stable helical structures with sequence dependent small deviations from ideal PPII helices. We identify direct exposure of charged side chains to solvent as a cause of high reorganization energies, significantly larger than typical for electron transfer in proteins. This, together with small direct couplings, makes long-range superexchange electron transport in this system very slow. In good agreement with experiment, direct transfer between the terminal amino acid side chains can be dicounted in favor of a two-step hopping process if appropriate bridging groups exist. © 2012 American Chemical Society

  14. Imaging the Ultrafast Photoelectron Transfer Process in Alizarin-TiO2.

    PubMed

    Gomez, Tatiana; Hermann, Gunter; Zarate, Ximena; Pérez-Torres, Jhon Fredy; Tremblay, Jean Christophe

    2015-07-30

    In this work, we adopt a quantum mechanical approach based on time-dependent density functional theory (TDDFT) to study the optical and electronic properties of alizarin supported on TiO2 nano-crystallites, as a prototypical dye-sensitized solar cell. To ensure proper alignment of the donor (alizarin) and acceptor (TiO2 nano-crystallite) levels, static optical excitation spectra are simulated using time-dependent density functional theory in response. The ultrafast photoelectron transfer from the dye to the cluster is simulated using an explicitly time-dependent, one-electron TDDFT ansatz. The model considers the δ-pulse excitation of a single active electron localized in the dye to the complete set of energetically accessible, delocalized molecular orbitals of the dye/nano-crystallite complex. A set of quantum mechanical tools derived from the transition electronic flux density is introduced to visualize and analyze the process in real time. The evolution of the created wave packet subject to absorbing boundary conditions at the borders of the cluster reveal that, while the electrons of the aromatic rings of alizarin are heavily involved in an ultrafast charge redistribution between the carbonyl groups of the dye molecule, they do not contribute positively to the electron injection and, overall, they delay the process.

  15. Electronic structure evolution of fullerene on CH 3NH 3PbI 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Chenggong; Wang, Congcong; Liu, Xiaoliang

    2015-03-19

    The thickness dependence of fullerene on CH 3NH 3PbI 3 perovskitefilm surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy(XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskitefilm to fullerene molecules. Further deposition of fullerene forms C 60 solid, accompaniedmore » by the reduction of the electron transfer. As a result, the strongest electron transfer happened at 1/4 monolayer of fullerene.« less

  16. Electronic structure evolution of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Chenggong; Wang, Congcong; Kauppi, John

    2015-03-16

    The thickness dependence of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3} perovskite film surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy (XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. Further deposition of fullerene forms C{submore » 60} solid, accompanied by the reduction of the electron transfer. The strongest electron transfer happened at 1/4 monolayer of fullerene.« less

  17. Photoreactions of biacetyl, benzophenone, and benzil with electron-rich alkenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gersdorf, J.; Mattay, J.; Goerner, H.

    1987-02-18

    The rate constants (k/sub q/) for fluorescence and phosphorescence quenching of biacetyl by electron-rich alkenes were measured in acetonitrile solution at room temperature. A weak dependence of log k/sub q/ on the free enthalpy change (..delta..G/sub 2/) for electron transfer in the triplet state in the range 0 < ..delta..G/sub 2/ < 1.0 eV indicates formation of a polar exciplex. The strong enhancement of k/sub q/ for 0 > ..delta..G/sub 2/ > -0.70 eV points to electron-transfer processes in singlet and triplet states. Quenching of the phosphorescence and the T-T absorption of benzophenone reveals larger (smaller) k/sub q/ values inmore » the endergonic (exergonic) region, as compared to the Rehm-Weller correlation. The slope of the plot of log k/sub q/ vs. ..delta..G/sub 2/ is similar to that of biacetyl in the endergonic region. The latter indicates that electron transfer in this instance is not the primary step. For benzil the plot of log k/sub q/ vs ..delta..G/sub 2/ resembles more closely that of biacetyl, pointing to a similar mechanism. In the exergonic region electron transfer is observed for benzil (major process) and benzophenone (minor process) by detection of the radical anion with use of nanosecond laser flash photolysis. The yield and half-life of the radical anion depend on the nature of the electron donor and the ketone, the solvent polarity, and the additives (e.g., LiClO/sub 4/, special salt effect). The solvent effect on the photoproducts (oxetanes) is correlated with the free enthalpies of radical ion pair formation.« less

  18. Density functional theory of electron transfer beyond the Born-Oppenheimer approximation: Case study of LiF.

    PubMed

    Li, Chen; Requist, Ryan; Gross, E K U

    2018-02-28

    We perform model calculations for a stretched LiF molecule, demonstrating that nonadiabatic charge transfer effects can be accurately and seamlessly described within a density functional framework. In alkali halides like LiF, there is an abrupt change in the ground state electronic distribution due to an electron transfer at a critical bond length R = R c , where an avoided crossing of the lowest adiabatic potential energy surfaces calls the validity of the Born-Oppenheimer approximation into doubt. Modeling the R-dependent electronic structure of LiF within a two-site Hubbard model, we find that nonadiabatic electron-nuclear coupling produces a sizable elongation of the critical R c by 0.5 bohr. This effect is very accurately captured by a simple and rigorously derived correction, with an M -1 prefactor, to the exchange-correlation potential in density functional theory, M = reduced nuclear mass. Since this nonadiabatic term depends on gradients of the nuclear wave function and conditional electronic density, ∇ R χ(R) and ∇ R n(r, R), it couples the Kohn-Sham equations at neighboring R points. Motivated by an observed localization of nonadiabatic effects in nuclear configuration space, we propose a local conditional density approximation-an approximation that reduces the search for nonadiabatic density functionals to the search for a single function y(n).

  19. Kinetics of photoinduced electron transfer between DNA bases and triplet 3,3',4,4'-benzophenone tetracarboxylic acid in aqueous solution of different pH's: proton-coupled electron transfer?

    PubMed

    Nguyen, Truong X; Kattnig, Daniel; Mansha, Asim; Grampp, Günter; Yurkovskaya, Alexandra V; Lukzen, Nikita

    2012-11-08

    The kinetics of triplet state quenching of 3,3',4,4'-benzophenone tetracarboxylic acid (BPTC) by DNA bases adenine, adenosine, thymine, and thymidine has been investigated in aqueous solution using time-resolved laser flash photolysis. The observation of the BPTC ketyl radical anion at λ(max) = 630 nm indicates that one electron transfer is involved in the quenching reactions. The pH-dependence of the quenching rate constants is measured in detail. As a result, the chemical reactivity of the reactants is assigned. The bimolecular rate constants of the quenching reactions between triplet BPTC and adenine, adenosine, thymine, and thymidine are k(q) = 2.3 × 10(9) (4.7 < pH < 9.9), k(q) = 4.0 × 10(9) (3.5 < pH < 4.7), k(q) = 1.0 × 10(9) (4.7 < pH < 9.9), and k(q) = 4.0 × 10(8) M(-1) s(-1) (4.7 < pH < 9.8), respectively. Moreover, it reveals that in strong basic medium (pH = 12.0) a keto-enol tautomerism of thymine inhibits its reaction with triplet BPTC. Such a behavior is not possible for thymidine because of its deoxyribose group. In addition, the pH-dependence of the apparent electrochemical standard potential of thymine in aqueous solution was investigated by cyclic voltammetry. The ΔE/ΔpH ≈ -59 mV/pH result is characteristic of proton-coupled electron transfer. This behavior, together with the kinetic analysis, leads to the conclusion that the quenching reactions between triplet BPTC and thymine involve one proton-coupled electron transfer.

  20. Kinetics of Photoinduced Electron Transfer between DNA Bases and Triplet 3,3′,4,4′-Benzophenone Tetracarboxylic Acid in Aqueous Solution of Different pH's: Proton-Coupled Electron Transfer?

    PubMed Central

    2012-01-01

    The kinetics of triplet state quenching of 3,3′,4,4′-benzophenone tetracarboxylic acid (BPTC) by DNA bases adenine, adenosine, thymine, and thymidine has been investigated in aqueous solution using time-resolved laser flash photolysis. The observation of the BPTC ketyl radical anion at λmax = 630 nm indicates that one electron transfer is involved in the quenching reactions. The pH-dependence of the quenching rate constants is measured in detail. As a result, the chemical reactivity of the reactants is assigned. The bimolecular rate constants of the quenching reactions between triplet BPTC and adenine, adenosine, thymine, and thymidine are kq = 2.3 × 109 (4.7 < pH < 9.9), kq = 4.0 × 109 (3.5 < pH < 4.7), kq = 1.0 × 109 (4.7 < pH < 9.9), and kq = 4.0 × 108 M–1 s–1 (4.7 < pH < 9.8), respectively. Moreover, it reveals that in strong basic medium (pH = 12.0) a keto–enol tautomerism of thymine inhibits its reaction with triplet BPTC. Such a behavior is not possible for thymidine because of its deoxyribose group. In addition, the pH-dependence of the apparent electrochemical standard potential of thymine in aqueous solution was investigated by cyclic voltammetry. The ΔE/ΔpH ≈ −59 mV/pH result is characteristic of proton-coupled electron transfer. This behavior, together with the kinetic analysis, leads to the conclusion that the quenching reactions between triplet BPTC and thymine involve one proton-coupled electron transfer. PMID:23038981

  1. Experimental study of low-energy charge transfer in nitrogen

    NASA Technical Reports Server (NTRS)

    Smith, A.

    1979-01-01

    Total charge transfer cross sections were obtained for the N2(+)-N2 system with relative translational ion energies between 9 and 441 eV. Data were obtained to examine the dependence of total cross section on ion energy. The effect of ion excitation on the cross sections was studied by varying the electron ionization energy in the mass spectrometer ion source over an electron energy range between 14.5 and 32.1 eV. The dependence of total cross section on the neutralization chamber gas pressure was examined by obtaining data at pressure values from 9.9 to 0.000199 torr. Cross section values obtained were compared with experimental and theoretical results of other investigations.

  2. Biological photovoltaics: intra- and extra-cellular electron transport by cyanobacteria.

    PubMed

    Bradley, Robert W; Bombelli, Paolo; Rowden, Stephen J L; Howe, Christopher J

    2012-12-01

    A large variety of new energy-generating technologies are being developed in an effort to reduce global dependence on fossil fuels, and to reduce the carbon footprint of energy generation. The term 'biological photovoltaic system' encompasses a broad range of technologies which all employ biological material that can harness light energy to split water, and then transfer the resulting electrons to an anode for power generation or electrosynthesis. The use of whole cyanobacterial cells is a good compromise between the requirements of the biological material to be simply organized and transfer electrons efficiently to the anode, and also to be robust and able to self-assemble and self-repair. The principle that photosynthetic bacteria can generate and transfer electrons directly or indirectly to an anode has been demonstrated by a number of groups, although the power output obtained from these devices is too low for biological photovoltaic devices to be useful outside the laboratory. Understanding how photosynthetically generated electrons are transferred through and out of the organism is key to improving power output, and investigations on this aspect of the technology are the main focus of the present review.

  3. Theory of electron transfer and molecular state in DNA

    NASA Astrophysics Data System (ADS)

    Endres, Robert Gunter

    2002-09-01

    In this thesis, a mechanism for long-range electron transfer in DNA and a systematic search for high conductance DNA are developed. DNA is well known for containing the genetic code of all living species. On the other hand, there are some experimental indications that DNA can mediate effectively long-range electron transfer leading to the concept of chemistry at a distance. This can be important for DNA damage and healing. In the first part of the thesis, a possible mechanism for long-range electron transfer is introduced. The weak distance dependent electron transfer was experimentally observed using transition metal intercalators for donor and acceptor. In our model calculations, the transfer is mediated by the molecular analogue of a Kondo bound state well known from solid state physics of mixed-valence rare-earth compounds. We believe this is quite realistic, since localized d orbitals of the transition metal ions could function as an Anderson impurity embedded in a reservoir of rather delocalized molecular orbitals of the intercalator ligands and DNA pi orbitals. The effective Anderson model is solved with a physically intuitive variational ansatz as well as with the essentially exact DMRG method. The electronic transition matrix element, which is important because it contains the donor-acceptor distance dependence, is obtained with the Mulliken-Hush algorithm as well as from Born-Oppenheimer potential energy surfaces. Our possible explanation of long-range electron transfer is put in context to other more conventional mechanisms which also could lead to similar behavior. Another important issue of DNA is its possible use for nano-technology. Although DNA's mechanical properties are excellent, the question whether it can be conducting and be used for nano-wires is highly controversial. Experimentally, DNA shows conducting, semi-conducting and insulating properties. Motivated by these wide ranging experimental results on the conductivity of DNA, we have embarked on a theoretical effort to ascertain what conditions might induce such remarkable behavior. We use a combination of an ab initio density functional theory method and a parameterized Huckel-Slater-Koster model. Our focus here is to examine whether any likely DNA structures or environments can yield reduced activation gaps to conduction or enhanced electronic overlaps. In particular, we study a hypothetical stretched ribbon structure, A-, and B-form DNA, and the effects of counterions and humidity. Unlike solids, DNA and other molecules are considered soft condensed matter. Hence, we study the influence of vibrations upon the electronic structure of DNA. We calculate parameters for charge transfer rates between adjacent bases. We find good agreement between our estimated rates and recent experimental data assuming that torsional vibrations limit the charge transfer most significantly.

  4. Interplay between barrier width and height in electron tunneling: photoinduced electron transfer in porphyrin-based donor-bridge-acceptor systems.

    PubMed

    Pettersson, Karin; Wiberg, Joanna; Ljungdahl, Thomas; Mårtensson, Jerker; Albinsson, Bo

    2006-01-12

    The rate of electron tunneling in molecular donor-bridge-acceptor (D-B-A) systems is determined both by the tunneling barrier width and height, that is, both by the distance between the donor and acceptor as well as by the energy gap between the donor and bridge moieties. These factors are therefore important to control when designing functional electron transfer systems, such as constructs for photovoltaics, artificial photosynthesis, and molecular scale electronics. In this paper we have investigated a set of D-B-A systems in which the distance and the energy difference between the donor and bridge states (DeltaEDB) are systematically varied. Zinc(II) and gold(III) porphyrins were chosen as electron donor and acceptor because of their suitable driving force for photoinduced electron transfer (-0.9 eV in butyronitrile) and well-characterized photophysics. We have previously shown, in accordance with the superexchange mechanism for electron transfer, that the electron transfer rate is proportional to the inverse of DeltaEDB in a series of zinc/gold porphyrin D-B-A systems with bridges of constant edge to edge distance (19.6 A) and varying DeltaEDB (3900-17 600 cm(-1)). Here, we use the same donor and acceptor but the bridge is shortened or extended giving a set of oligo-p-phenyleneethynylene bridges (OPE) with four different edge to edge distances ranging from 12.7 to 33.4 A. These two sets of D-B-A systems-ZnP-RB-AuP+ and ZnP-nB-AuP+-have one bridge in common, and hence, for the first time both the distance and DeltaEDB dependence of electron transfer can be studied simultaneously in a systematic way.

  5. Resonant electronic excitation energy transfer by Dexter mechanism in the quantum dot system

    NASA Astrophysics Data System (ADS)

    Samosvat, D. M.; Chikalova-Luzina, O. P.; Vyatkin, V. M.; Zegrya, G. G.

    2016-11-01

    In present work the energy transfer between quantum dots by the exchange (Dexter) mechanism is analysed. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same compound A3B5 and embedded in the matrix of other material creating potential barriers for electron and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found using the Kane model that provides the most adequate description spectra of semiconductors A3B5. Numerical calculations show that the rate of the energy transfer by Dexter mechanism is comparable to the rate of the energy transfer by electrostatic mechanism at the distances approaching to the contact ones.

  6. Structural and electronic properties of AlN(0001) surface under partial N coverage as determined by ab initio approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strak, Pawel; Sakowski, Konrad; Kempisty, Pawel

    2015-09-07

    Properties of bare and nitrogen-covered Al-terminated AlN(0001) surface were determined using density functional theory (DFT) calculations. At a low nitrogen coverage, the Fermi level is pinned by Al broken bond states located below conduction band minimum. Adsorption of nitrogen is dissociative with an energy gain of 6.05 eV/molecule at a H3 site creating an overlap with states of three neighboring Al surface atoms. During this adsorption, electrons are transferred from Al broken bond to topmost N adatom states. Accompanying charge transfer depends on the Fermi level. In accordance with electron counting rule (ECR), the DFT results confirm the Fermi levelmore » is not pinned at the critical value of nitrogen coverage θ{sub N}(1) = 1/4 monolayer (ML), but it is shifted from an Al-broken bond state to Np{sub z} state. The equilibrium thermodynamic potential of nitrogen in vapor depends drastically on the Fermi level pinning being shifted by about 4 eV for an ECR state at 1/4 ML coverage. For coverage above 1/4 ML, adsorption is molecular with an energy gain of 1.5 eV at a skewed on-top position above an Al surface atom. Electronic states of the admolecule are occupied as in the free molecule, no electron transfer occurs and adsorption of a N{sub 2} molecule does not depend on the Fermi level. The equilibrium pressure of molecular nitrogen above an AlN(0001) surface depends critically on the Fermi level position, being very low and very high for low and high coverage, respectively. From this fact, one can conclude that at typical growth conditions, the Fermi level is not pinned, and the adsorption and incorporation of impurities depend on the position of Fermi level in the bulk.« less

  7. Interlayer‐State‐Coupling Dependent Ultrafast Charge Transfer in MoS2/WS2 Bilayers

    PubMed Central

    Zhang, Jin; Hong, Hao; Lian, Chao; Ma, Wei; Xu, Xiaozhi; Zhou, Xu; Fu, Huixia

    2017-01-01

    Light‐induced interlayer ultrafast charge transfer in 2D heterostructures provides a new platform for optoelectronic and photovoltaic applications. The charge separation process is generally hypothesized to be dependent on the interlayer stackings and interactions, however, the quantitative characteristic and detailed mechanism remain elusive. Here, a systematical study on the interlayer charge transfer in model MoS2/WS2 bilayer system with variable stacking configurations by time‐dependent density functional theory methods is demonstrated. The results show that the slight change of interlayer geometry can significantly modulate the charge transfer time from 100 fs to 1 ps scale. Detailed analysis further reveals that the transfer rate in MoS2/WS2 bilayers is governed by the electronic coupling between specific interlayer states, rather than the interlayer distances, and follows a universal dependence on the state‐coupling strength. The results establish the interlayer stacking as an effective freedom to control ultrafast charge transfer dynamics in 2D heterostructures and facilitate their future applications in optoelectronics and light harvesting. PMID:28932669

  8. Transfer doping of single isolated nanodiamonds, studied by scanning probe microscopy techniques

    NASA Astrophysics Data System (ADS)

    Bolker, Asaf; Saguy, Cecile; Kalish, Rafi

    2014-09-01

    The transfer doping of diamond surfaces has been applied in various novel two-dimensional electronic devices. Its extension to nanodiamonds (ND) is essential for ND-based applications in many fields. In particular, understanding the influence of the crystallite size on transfer doping is desirable. Here, we report the results of a detailed study of the electronic energetic band structure of single, isolated transfer-doped nanodiamonds with nanometric resolution using a combination of scanning tunneling spectroscopy and Kelvin force microscopy measurements. The results show how the band gap, the valence band maximum, the electron affinity and the work function all depend on the ND’s size and nanoparticle surface properties. The present analysis, which combines information from both scanning tunneling spectroscopy and Kelvin force microscopy, should be applicable to any nanoparticle or surface that can be measured with scanning probe techniques.

  9. Theoretical analysis of the unusual temperature dependence of the kinetic isotope effect in quinol oxidation.

    PubMed

    Ludlow, Michelle K; Soudackov, Alexander V; Hammes-Schiffer, Sharon

    2009-05-27

    In this paper we present theoretical calculations on model biomimetic systems for quinol oxidation. In these model systems, an excited-state [Ru(bpy)(2)(pbim)](+) complex (bpy = 2,2'-dipyridyl, pbim = 2-(2-pyridyl)benzimidazolate) oxidizes a ubiquinol or plastoquinol analogue in acetonitrile. The charge transfer reaction occurs via a proton-coupled electron transfer (PCET) mechanism, in which an electron is transferred from the quinol to the Ru and a proton is transferred from the quinol to the pbim(-) ligand. The experimentally measured average kinetic isotope effects (KIEs) at 296 K are 1.87 and 3.45 for the ubiquinol and plastoquinol analogues, respectively, and the KIE decreases with temperature for plastoquinol but increases with temperature for ubiquinol. The present calculations provide a possible explanation for the differences in magnitudes and temperature dependences of the KIEs for the two systems and, in particular, an explanation for the unusual inverse temperature dependence of the KIE for the ubiquinol analogue. These calculations are based on a general theoretical formulation for PCET reactions that includes quantum mechanical effects of the electrons and transferring proton, as well as the solvent reorganization and proton donor-acceptor motion. The physical properties of the system that enable the inverse temperature dependence of the KIE are a stiff hydrogen bond, which corresponds to a high-frequency proton donor-acceptor motion, and small inner-sphere and solvent reorganization energies. The inverse temperature dependence of the KIE may be observed if the 0/0 pair of reactant/product vibronic states is in the inverted Marcus region, while the 0/1 pair of reactant/product vibronic states is in the normal Marcus region and is the dominant contributor to the overall rate. In this case, the free energy barrier for the dominant transition is lower for deuterium than for hydrogen because of the smaller splittings between the vibronic energy levels for deuterium, and the KIE increases with increasing temperature. The temperature dependence of the KIE is found to be very sensitive to the interplay among the driving force, the reorganization energy, and the vibronic coupling in this regime.

  10. Electron Mobility and Trapping in Ferrihydrite Nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soltis, Jennifer A.; Schwartzberg, Adam M.; Zarzycki, Piotr

    Iron is the most abundant transition metal in the Earth's crust, and naturally occurring iron oxide minerals play a commanding role in environmental redox reactions. Although iron oxide redox reactions are well studied, their precise mechanisms are not fully understood. Recent work has shown that these involve electron transfer pathways within the solid, suggesting that overall reaction rates could be dependent on electron mobility. Initial ultrafast spectroscopy studies of iron oxide nanoparticles sensitized by fluorescein derivatives supported a model for electron mobility based on polaronic hopping of electron charge carriers between iron sites, but the constitutive relationships between hopping mobilitiesmore » and interfacial charge transfer processes has remained obscured. We developed a coarse-grained lattice Monte Carlo model to simulate the collective mobilities and lifetimes of these photoinjected electrons with respect to recombination with adsorbed dye molecules for the essential nanophase ferrihydrite, and tested predictions made by the simulations using pump-probe spectroscopy. We acquired optical transient absorption spectra as a function of particle size and under a variety of solution conditions, and used cryogenic transmission electron microscopy to determine the aggregation state of the nanoparticles. We observed biphasic electron recombination kinetics over timescales that spanned picoseconds to microseconds, the slower regime of which was fit with a stretched exponential decay function. The recombination rates were weakly affected by nanoparticle size and aggregation state, suspension pH, and the injection of multiple electrons per nanoparticle. We conclude that electron mobility indeed limits the rate of interfacial electron transfer in these systems with the slowest processes relating to escape from deep traps, the presence of which outweighs the influence of environmental factors such as pH-dependent surface charge.« less

  11. Electron Mobility and Trapping in Ferrihydrite Nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soltis, Jennifer A.; Schwartzberg, Adam M.; Zarzycki, Piotr

    Iron is the most abundant transition metal in the Earth’s crust, and naturally occurring iron oxide minerals play a commanding role in environmental redox reactions. Although iron oxide redox reactions are well-studied, their precise mechanisms are not fully understood. Recent work has shown that these involve electron transfer pathways within the solid, suggesting that overall reaction rates could be dependent upon electron mobility. Initial ultrafast spectroscopy studies of iron oxide nanoparticles sensitized by fluorescein derivatives supported a model for electron mobility based on polaronic hopping of electron charge carriers between iron sites, but the constitutive relationships between hopping mobilities andmore » interfacial charge transfer processes has remained obscured. In this paper, we developed a coarse-grained lattice Monte Carlo model to simulate the collective mobilities and lifetimes of these photoinjected electrons with respect to recombination with adsorbed dye molecules for essential nanophase ferrihydrite and tested predictions made by the simulations using pump–probe spectroscopy. We acquired optical transient absorption spectra as a function of the particle size and under a variety of solution conditions and used cryogenic transmission electron microscopy to determine the aggregation state of the nanoparticles. We observed biphasic electron recombination kinetics over time scales that spanned from picoseconds to microseconds, the slower regime of which was fit with a stretched exponential decay function. The recombination rates were weakly affected by the nanoparticle size and aggregation state, suspension pH, and injection of multiple electrons per nanoparticle. Finally, we conclude that electron mobility indeed limits the rate of interfacial electron transfer in these systems, with the slowest processes relating to escape from deep traps, the presence of which outweighs the influence of environmental factors, such as pH-dependent surface charge.« less

  12. Electron Mobility and Trapping in Ferrihydrite Nanoparticles

    DOE PAGES

    Soltis, Jennifer A.; Schwartzberg, Adam M.; Zarzycki, Piotr; ...

    2017-05-18

    Iron is the most abundant transition metal in the Earth’s crust, and naturally occurring iron oxide minerals play a commanding role in environmental redox reactions. Although iron oxide redox reactions are well-studied, their precise mechanisms are not fully understood. Recent work has shown that these involve electron transfer pathways within the solid, suggesting that overall reaction rates could be dependent upon electron mobility. Initial ultrafast spectroscopy studies of iron oxide nanoparticles sensitized by fluorescein derivatives supported a model for electron mobility based on polaronic hopping of electron charge carriers between iron sites, but the constitutive relationships between hopping mobilities andmore » interfacial charge transfer processes has remained obscured. In this paper, we developed a coarse-grained lattice Monte Carlo model to simulate the collective mobilities and lifetimes of these photoinjected electrons with respect to recombination with adsorbed dye molecules for essential nanophase ferrihydrite and tested predictions made by the simulations using pump–probe spectroscopy. We acquired optical transient absorption spectra as a function of the particle size and under a variety of solution conditions and used cryogenic transmission electron microscopy to determine the aggregation state of the nanoparticles. We observed biphasic electron recombination kinetics over time scales that spanned from picoseconds to microseconds, the slower regime of which was fit with a stretched exponential decay function. The recombination rates were weakly affected by the nanoparticle size and aggregation state, suspension pH, and injection of multiple electrons per nanoparticle. Finally, we conclude that electron mobility indeed limits the rate of interfacial electron transfer in these systems, with the slowest processes relating to escape from deep traps, the presence of which outweighs the influence of environmental factors, such as pH-dependent surface charge.« less

  13. MD studies of electron transfer at ambient and elevated pressures

    NASA Astrophysics Data System (ADS)

    Giles, Alex; Spooner, Jacob; Weinberg, Noham

    2013-06-01

    The effect of pressure on the rate constants of outer-sphere electron transfer reactions has often been described using the Marcus-Hush theory. This theory agrees well with experiment when internal reorganization of the ionic system is negligible, however it does not offer a recipe for calculation of the effects that result from significant solute restructuring. We have recently developed a molecular dynamics technique that accurately describes structural dependence of molecular volumes in non-polar and weakly polar systems. We are now extending this approach to the case of highly polar ionic systems where both solvent and solute restructuring components are important. For this purpose we construct pressure-dependent two-dimensional surfaces for electron transfer reactions in coordinate system composed of interionic distance and Marcus-type solvent polarization coordinate, and use these surfaces to describe pressure effects on reaction kinetics. R.A. Marcus. J. Chem. Phys. 24, 966 (1956); 24, 979 (1956); 26, 867 (1957). Discuss. Faraday Soc. 29, 21 (1960). Faraday Discuss. Chem. Soc. 74, 7 (1982); N.S. Hush. Trans. Faraday Soc. 57, 557 (1961).

  14. Concentration-dependent photophysical switching in mixed self-assembled monolayers of pentacene and perylenediimide on gold nanoclusters.

    PubMed

    Kato, Daiki; Sakai, Hayato; Araki, Yasuyuki; Wada, Takehiko; Tkachenko, Nikolai V; Hasobe, Taku

    2018-03-28

    Photophysical control and switching on organic-inorganic hybrid interfaces are of great interest in diverse fundamental and applicative research areas. 6,13-Bis(triisopropylsilylethynyl)pentacene (TP) is well-known to exhibit efficient singlet fission (SF) for generation of high-yield triplet excited states in aggregated forms, whereas perylenediimide (PDI) ensembles show the characteristic excimer formation. Additionally, a combination of pentacene (electron donor: D) and PDI (electron acceptor: A) is expected to undergo an efficient photoinduced electron transfer (PET), and absorption of two chromophores combined covers the entire visible region. Therefore, the concentration-dependent mixed self-assembled monolayers (SAMs) composed of two chromophores enable us to control and switch the photophysical processes on a surface. In this work, a series of mixed SAMs composed of TP and PDI units on gold nanoclusters (GNCs) were newly synthesized by changing the relative molecular concentration ratios. Structural control of mixed SAMs on a gold surface based on the concentration ratios was successfully achieved. Time-resolved femtosecond and nanosecond transient absorption measurements clearly demonstrate photophysical control and switching of the above competitive reactions such as SF, electron transfer (ET) and excimer formation. The maximum quantum yields of triplet states (ΦT = ∼170%) and electron transfer (ΦET = ∼95%) were quantitatively evaluated by changing the concentration ratios. The rate constants of SF and excimer processes are largely dependent on the concentration ratios, whereas the rate constants of ET processes approximately remain constant. These findings are also discussed based on the statistical framework of the assembly of chromophores on the gold surface.

  15. a Time-Dependent Many-Electron Approach to Atomic and Molecular Interactions

    NASA Astrophysics Data System (ADS)

    Runge, Keith

    A new methodology is developed for the description of electronic rearrangement in atomic and molecular collisions. Using the eikonal representation of the total wavefunction, time -dependent equations are derived for the electronic densities within the time-dependent Hartree-Fock approximation. An averaged effective potential which ensures time reversal invariance is used to describe the effect of the fast electronic transitions on the slower nuclear motions. Electron translation factors (ETF) are introduced to eliminate spurious asymptotic couplings, and a local ETF is incorporated into a basis of traveling atomic orbitals. A reference density is used to describe local electronic relaxation and to account for the time propagation of fast and slow motions, and is shown to lead to an efficient integration scheme. Expressions for time-dependent electronic populations and polarization parameters are given. Electronic integrals over Gaussians including ETFs are derived to extend electronic state calculations to dynamical phenomena. Results of the method are in good agreement with experimental data for charge transfer integral cross sections over a projectile energy range of three orders of magnitude in the proton-Hydrogen atom system. The more demanding calculations of integral alignment, state-to-state integral cross sections, and differential cross sections are found to agree well with experimental data provided care is taken to include ETFs in the calculation of electronic integrals and to choose the appropriate effective potential. The method is found to be in good agreement with experimental data for the calculation of charge transfer integral cross sections and state-to-state integral cross sections in the one-electron heteronuclear Helium(2+)-Hydrogen atom system and in the two-electron system, Hydrogen atom-Hydrogen atom. Time-dependent electronic populations are seen to oscillate rapidly in the midst of collision event. In particular, multiple exchanges of the electron are seen to occur in the proton-Hydrogen atom system at low collision energies. The concepts and results derived from the approach provide new insight into the dynamics of nuclear screening and electronic rearrangement in atomic collisions.

  16. Spin Polarization Transfer from a Photogenerated Radical Ion Pair to a Stable Radical Controlled by Charge Recombination.

    PubMed

    Horwitz, Noah E; Phelan, Brian T; Nelson, Jordan N; Mauck, Catherine M; Krzyaniak, Matthew D; Wasielewski, Michael R

    2017-06-15

    Photoexcitation of electron donor-acceptor molecules frequently produces radical ion pairs with well-defined initial spin-polarized states that have attracted significant interest for spintronics. Transfer of this initial spin polarization to a stable radical is predicted to depend on the rates of the radical ion pair recombination reactions, but this prediction has not been tested experimentally. In this study, a stable radical/electron donor/chromophore/electron acceptor molecule, BDPA • -mPD-ANI-NDI, where BDPA • is α,γ-bisdiphenylene-β-phenylallyl, mPD is m-phenylenediamine, ANI is 4-aminonaphthalene-1,8-dicarboximide, and NDI is naphthalene-1,4:5,8-bis(dicarboximide), was synthesized. Photoexcitation of ANI produces the triradical BDPA • -mPD +• -ANI-NDI -• in which the mPD +• -ANI-NDI -• radical ion pair is spin coupled to the BDPA • stable radical. BDPA • -mPD +• -ANI-NDI -• and its counterpart lacking the stable radical are found to exhibit spin-selective charge recombination in which the triplet radical ion pair 3 (mPD +• -ANI-NDI -• ) is in equilibrium with the 3 *NDI charge recombination product. Time-resolved EPR measurements show that this process is associated with an inversion of the sign of the polarization transferred to BDPA • over time. The polarization transfer rates are found to be strongly solvent dependent, as shifts in this equilibrium affect the spin dynamics. These results demonstrate that even small changes in electron transfer dynamics can have a large effect on the spin dynamics of photogenerated multispin systems.

  17. Photoinduced reactions of dibenzoyl peroxide as studied by EPR and spin-trapping

    NASA Astrophysics Data System (ADS)

    Rosenthal, Ionel; Mossoba, Magdi M.; Riesz, Peter

    The photochemical reactions of dibenzoyl peroxide with some organic compounds were found by EPR and spin-trapping to generate free radicals in dimethyl sulfoxide solutions at room temperature. Two reaction mechanisms occur which determine the structures of the radicals generated. The first involves a one-electron oxidation and the second a hydrogen atom transfer. The prevailing mechanism is primarily dependent on the structure of the substrate. With carboxylic acids the one-electron oxidation occurs exclusively, leading to the loss of the carboxyl group and to formation of the alkyl radical. For alcohols both alkoxy radicals and hydrogen-abstraction α-carbon radicals were spin trapped. The alkoxy radicals were generated by the electron transfer mechanism. Finally pyrimidine bases such as thymine and cytosine yielded C(5)-centered radicals which could also be explained by an electron transfer mechanism. These observations are of interest because of the recently observed skin tumor-promoting activity of dibenzoyl peroxide.

  18. Alternative Pathway of Metronidazole Activation in Trichomonas vaginalis Hydrogenosomes

    PubMed Central

    Hrdý, Ivan; Cammack, Richard; Stopka, Pavel; Kulda, Jaroslav; Tachezy, Jan

    2005-01-01

    Metronidazole and related 5-nitroimidazoles are the only available drugs in the treatment of human urogenital trichomoniasis caused by the protozoan parasite Trichomonas vaginalis. The drugs are activated to cytotoxic anion radicals by their reduction within the hydrogenosomes. It has been established that electrons required for metronidazole activation are released from pyruvate by the activity of pyruvate:ferredoxin oxidoreductase and transferred to the drug by a low-redox-potential carrier, ferredoxin. Here we describe a novel pathway involved in the drug activation within the hydrogenosome. The source of electrons is malate, another major hydrogenosomal substrate, which is oxidatively decarboxylated to pyruvate and CO2 by NAD-dependent malic enzyme. The electrons released during this reaction are transferred from NADH to ferredoxin by NADH dehydrogenase homologous to the catalytic module of mitochondrial complex I, which uses ferredoxin as electron acceptor. Trichomonads acquire high-level metronidazole resistance only after both pyruvate- and malate-dependent pathways of metronidazole activation are eliminated from the hydrogenosomes. PMID:16304169

  19. Mechanisms of transport and electron transfer at conductive polymer/liquid interfaces

    NASA Astrophysics Data System (ADS)

    Ratcliff, Erin

    Organic semiconductors (OSCs) have incredible prospects for next-generation, flexible electronic devices including bioelectronics, thermoelectrics, opto-electronics, and energy storage and conversion devices. Yet many fundamental challenges still exist. First, solution processing prohibits definitive control over microstructure, which is fundamental for controlling electrical, ionic, and thermal transport properties. Second, OSCs generally suffer from poor electrical conductivities due to a combination of low carriers and low mobility. Third, polymeric semiconductors have potential-dependent, dynamically evolving electronic and chemical states, leading to complex interfacial charge transfer properties in contact with liquids. This talk will focus on the use of alternative synthetic strategies of oxidative chemical vapor deposition and electrochemical deposition to control physical, electronic, and chemical structure. We couple our synthetic efforts with energy-, time-, and spatially resolved spectroelectrochemical and microscopy techniques to understand the critical interfacial chemistry-microstructure-property relationships: first at the macroscale, and then moving towards the nanoscale. In particular, approaches to better understand electron transfer events at polymer/liquid interfaces as a function of: 1.) chemical composition; 2.) electronic density of states (DOS); and 3.) crystallinity and microstructure will be discussed.

  20. Effect of the δ-potential on spin-dependent electron tunneling in double barrier semiconductor heterostructure

    NASA Astrophysics Data System (ADS)

    Chandrasekar, L. Bruno; Gnanasekar, K.; Karunakaran, M.

    2018-06-01

    The effect of δ-potential was studied in GaAs/Ga0.6Al0·4As double barrier heterostructure with Dresselhaus spin-orbit interaction. The role of barrier height and position of the δ- potential in the well region was analysed on spin-dependent electron tunneling using transfer matrix method. The spin-separation between spin-resonances on energy scale depends on both height and position of the δ- potential, whereas the tunneling life time of electrons highly influenced by the position of the δ- potential and not on the height. These results might be helpful for the fabrication of spin-filters.

  1. Robust Stacking-Independent Ultrafast Charge Transfer in MoS2/WS2 Bilayers.

    PubMed

    Ji, Ziheng; Hong, Hao; Zhang, Jin; Zhang, Qi; Huang, Wei; Cao, Ting; Qiao, Ruixi; Liu, Can; Liang, Jing; Jin, Chuanhong; Jiao, Liying; Shi, Kebin; Meng, Sheng; Liu, Kaihui

    2017-12-26

    Van der Waals-coupled two-dimensional (2D) heterostructures have attracted great attention recently due to their high potential in the next-generation photodetectors and solar cells. The understanding of charge-transfer process between adjacent atomic layers is the key to design optimal devices as it directly determines the fundamental response speed and photon-electron conversion efficiency. However, general belief and theoretical studies have shown that the charge transfer behavior depends sensitively on interlayer configurations, which is difficult to control accurately, bringing great uncertainties in device designing. Here we investigate the ultrafast dynamics of interlayer charge transfer in a prototype heterostructure, the MoS 2 /WS 2 bilayer with various stacking configurations, by optical two-color ultrafast pump-probe spectroscopy. Surprisingly, we found that the charge transfer is robust against varying interlayer twist angles and interlayer coupling strength, in time scale of ∼90 fs. Our observation, together with atomic-resolved transmission electron characterization and time-dependent density functional theory simulations, reveals that the robust ultrafast charge transfer is attributed to the heterogeneous interlayer stretching/sliding, which provides additional channels for efficient charge transfer previously unknown. Our results elucidate the origin of transfer rate robustness against interlayer stacking configurations in optical devices based on 2D heterostructures, facilitating their applications in ultrafast and high-efficient optoelectronic and photovoltaic devices in the near future.

  2. Probing and Exploiting the Interplay between Nuclear and Electronic Motion in Charge Transfer Processes.

    PubMed

    Delor, Milan; Sazanovich, Igor V; Towrie, Michael; Weinstein, Julia A

    2015-04-21

    The Born-Oppenheimer approximation refers to the assumption that the nuclear and electronic wave functions describing a molecular system evolve and can be determined independently. It is now well-known that this approximation often breaks down and that nuclear-electronic (vibronic) coupling contributes greatly to the ultrafast photophysics and photochemistry observed in many systems ranging from simple molecules to biological organisms. In order to probe vibronic coupling in a time-dependent manner, one must use spectroscopic tools capable of correlating the motions of electrons and nuclei on an ultrafast time scale. Recent developments in nonlinear multidimensional electronic and vibrational spectroscopies allow monitoring both electronic and structural factors with unprecedented time and spatial resolution. In this Account, we present recent studies from our group that make use of different variants of frequency-domain transient two-dimensional infrared (T-2DIR) spectroscopy, a pulse sequence combining electronic and vibrational excitations in the form of a UV-visible pump, a narrowband (12 cm(-1)) IR pump, and a broadband (400 cm(-1)) IR probe. In the first example, T-2DIR is used to directly compare vibrational dynamics in the ground and relaxed electronic excited states of Re(Cl)(CO)3(4,4'-diethylester-2,2'-bipyridine) and Ru(4,4'-diethylester-2,2'-bipyridine)2(NCS)2, prototypical charge transfer complexes used in photocatalytic CO2 reduction and electron injection in dye-sensitized solar cells. The experiments show that intramolecular vibrational redistribution (IVR) and vibrational energy transfer (VET) are up to an order of magnitude faster in the triplet charge transfer excited state than in the ground state. These results show the influence of electronic arrangement on vibrational coupling patterns, with direct implications for vibronic coupling mechanisms in charge transfer excited states. In the second example, we show unambiguously that electronic and vibrational movement are coupled in a donor-bridge-acceptor complex based on a Pt(II) trans-acetylide design motif. Time-resolved IR (TRIR) spectroscopy reveals that the rate of electron transfer (ET) is highly dependent on the amount of excess energy localized on the bridge following electronic excitation. Using an adaptation of T-2DIR, we are able to selectively perturb bridge-localized vibrational modes during charge separation, resulting in the donor-acceptor charge separation pathway being completely switched off, with all excess energy redirected toward the formation of a long-lived intraligand triplet state. A series of control experiments reveal that this effect is mode specific: it is only when the high-frequency bridging C≡C stretching mode is pumped that radical changes in photoproduct yields are observed. These experiments therefore suggest that one may perturb electronic movement by stimulating structural motion along the reaction coordinate using IR light. These studies add to a growing body of evidence suggesting that controlling the pathways and efficiency of charge transfer may be achieved through synthetic and perturbative approaches aiming to modulate vibronic coupling. Achieving such control would represent a breakthrough for charge transfer-based applications such as solar energy conversion and molecular electronics.

  3. Binding and Energetics of Electron Transfer between an Artificial Four-Helix Mn-Protein and Reaction Centers from Rhodobacter sphaeroides.

    PubMed

    Espiritu, Eduardo; Olson, Tien L; Williams, JoAnn C; Allen, James P

    2017-12-12

    The ability of an artificial four-helix bundle Mn-protein, P1, to bind and transfer an electron to photosynthetic reaction centers from the purple bacterium Rhodobacter sphaeroides was characterized using optical spectroscopy. Upon illumination of reaction centers, an electron is transferred from P, the bacteriochlorophyll dimer, to Q A , the primary electron acceptor. The P1 Mn-protein can bind to the reaction center and reduce the oxidized bacteriochlorophyll dimer, P + , with a dissociation constant of 1.2 μM at pH 9.4, comparable to the binding constant of c-type cytochromes. Amino acid substitutions of surface residues on the Mn-protein resulted in increases in the dissociation constant to 8.3 μM. The extent of reduction of P + by the P1 Mn-protein was dependent on the P/P + midpoint potential and the pH. Analysis of the free energy difference yielded a midpoint potential of approximately 635 mV at pH 9.4 for the Mn cofactor of the P1 Mn-protein, a value similar to those found for other Mn cofactors in proteins. The linear dependence of -56 mV/pH is consistent with one proton being released upon Mn oxidation, allowing the complex to maintain overall charge neutrality. These outcomes demonstrate the feasibility of designing four-helix bundles and other artificial metalloproteins to bind and transfer electrons to bacterial reaction centers and establish the usefulness of this system as a platform for designing sites to bind novel metal cofactors capable of performing complex oxidation-reduction reactions.

  4. The isotopic effects of electron transfer: An explanation for Fe isotope fractionation in nature

    NASA Astrophysics Data System (ADS)

    Kavner, Abby; Bonet, François; Shahar, Anat; Simon, Justin; Young, Edward

    2005-06-01

    Isotope fractionation of electroplated Fe was measured as a function of applied electrochemical potential. As plating voltage was varied from -0.9 V to 2.0 V, the isotopic signature of the electroplated iron became depleted in heavy Fe, with δ 56Fe values (relative to IRMM-14) ranging from -0.18(±0.02) to -2.290(±0.006) ‰, and corresponding δ 57Fe values of -0.247(±0.014) and -3.354(±0.019) ‰. This study demonstrates that there is a voltage-dependent isotope fractionation associated with the reduction of iron. We show that Marcus's theory for the kinetics of electron transfer can be extended to include the isotope effects of electron transfer, and that the extended theory accounts for the voltage dependence of Fe isotope fractionation. The magnitude of the electrochemically-induced fractionation is similar to that of Fe reduction by certain bacteria, suggesting that similar electrochemical processes may be responsible for biogeochemical Fe isotope effects. Charge transfer is a fundamental physicochemical process involving Fe as well as other transition metals with multiple isotopes. Partitioning of isotopes among elements with varying redox states holds promise as a tool in a wide range of the Earth and environmental sciences, biology, and industry.

  5. Photocurrent generation by direct electron transfer using photosynthetic reaction centres

    NASA Astrophysics Data System (ADS)

    Mahmoudzadeh, A.; Saer, R.; Jun, D.; Mirvakili, S. M.; Takshi, A.; Iranpour, B.; Ouellet, E.; Lagally, E. T.; Madden, J. D. W.; Beatty, J. T.

    2011-09-01

    Photosynthetic reaction centres (RCs) convert light into separated charges with nearly perfect quantum efficiency, and have been used to generate photocurrent. Previous work has shown that electron tunnelling rates between redox centres in proteins depend exponentially on the tunnelling distance. In this work the RC from Rhodobacter sphaeroides was genetically modified with the aim of achieving the shortest tunnelling distances yet demonstrated between the RC's electron-accepting P site and underlying graphite and gold electrodes, and between the electron donor Q site and graphite electrodes. Opposite charges are carried to counter electrodes using mobile mediators, as in dye-sensitised solar cells. Native RCs are bound to graphite surfaces through N-(1-pyrene)iodoacetamide. Although the linker's length is only 4 Å, the electron transfer pathway between the Q electron donor site on the RC and the electrode surface is still too large for current to be significant. A mutant version with the electron acceptor P side close to the graphite surface produced currents of 15 nA cm-2 upon illumination. Direct binding of RCs to a gold surface is shown, resulting in currents of 5 nA cm-2. In both cases the current was unaffected by mediator concentration but increased with illumination, suggesting that direct electron transfer was achieved. The engineering of an RC to achieve direct electron transfer will help with long term efforts to demonstrate RC-based photovoltaic devices.

  6. pH-dependent reduction potentials and proton-coupled electron transfer mechanisms in hydrogen-producing nickel molecular electrocatalysts.

    PubMed

    Horvath, Samantha; Fernandez, Laura E; Appel, Aaron M; Hammes-Schiffer, Sharon

    2013-04-01

    The nickel-based P2(Ph)N2(Bn) electrocatalysts comprised of a nickel atom and two 1,5-dibenzyl-3,7-diphenyl-1,5-diaza-3,7-diphosphacyclooctane ligands catalyze H2 production in acetonitrile. Recent electrochemical experiments revealed a linear dependence of the Ni(II/I) reduction potential on pH with a slope of 57 mV/pH unit, implicating a proton-coupled electron transfer (PCET) process with the same number of electrons and protons transferred. The combined theoretical and experimental studies herein provide an explanation for this pH dependence in the context of the overall proposed catalytic mechanism. In the proposed mechanisms, the catalytic cycle begins with a series of intermolecular proton transfers from an acid to the pendant amine ligand and electrochemical electron transfers to the nickel center to produce the doubly protonated Ni(0) species, a precursor to H2 evolution. The calculated Ni(II/I) reduction potentials of the doubly protonated species are in excellent agreement with the experimentally observed reduction potential in the presence of strong acid, suggesting that the catalytically active species leading to the peak observed in these cyclic voltammetry (CV) experiments is doubly protonated. The Ni(I/0) reduction potential was found to be slightly more positive than the Ni(II/I) reduction potential, indicating that the Ni(I/0) reduction occurs spontaneously after the Ni(II/I) reduction, as implied by the experimental observation of a single CV peak. These results suggest that the PCET process observed in the CV experiments is a two-electron/two-proton process corresponding to an initial double protonation followed by two reductions. On the basis of the experimental and theoretical data, the complete thermodynamic scheme and the Pourbaix diagram were generated for this catalyst. The Pourbaix diagram, which identifies the most thermodynamically stable species at each reduction potential and pH value, illustrates that this catalyst undergoes different types of PCET processes for various pH ranges. These thermodynamic insights will aid in the design of more effective molecular catalysts for H2 production.

  7. Atomic bonding effects in annular dark field scanning transmission electron microscopy. I. Computational predictions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Odlyzko, Michael L.; Mkhoyan, K. Andre, E-mail: mkhoyan@umn.edu; Himmetoglu, Burak

    2016-07-15

    Annular dark field scanning transmission electron microscopy (ADF-STEM) image simulations were performed for zone-axis-oriented light-element single crystals, using a multislice method adapted to include charge redistribution due to chemical bonding. Examination of these image simulations alongside calculations of the propagation of the focused electron probe reveal that the evolution of the probe intensity with thickness exhibits significant sensitivity to interatomic charge transfer, accounting for observed thickness-dependent bonding sensitivity of contrast in all ADF-STEM imaging conditions. Because changes in image contrast relative to conventional neutral atom simulations scale directly with the net interatomic charge transfer, the strongest effects are seen inmore » crystals with highly polar bonding, while no effects are seen for nonpolar bonding. Although the bonding dependence of ADF-STEM image contrast varies with detector geometry, imaging parameters, and material temperature, these simulations predict the bonding effects to be experimentally measureable.« less

  8. Phase-coherent engineering of electronic heat currents with a Josephson modulator

    NASA Astrophysics Data System (ADS)

    Fornieri, Antonio; Blanc, Christophe; Bosisio, Riccardo; D'Ambrosio, Sophie; Giazotto, Francesco

    In this contribution we report the realization of the first balanced Josephson heat modulator designed to offer full control at the nanoscale over the phase-coherent component of electronic thermal currents. The ability to master the amount of heat transferred through two tunnel-coupled superconductors by tuning their phase difference is the core of coherent caloritronics, and is expected to be a key tool in a number of nanoscience fields, including solid state cooling, thermal isolation, radiation detection, quantum information and thermal logic. Our device provides magnetic-flux-dependent temperature modulations up to 40 mK in amplitude with a maximum of the flux-to-temperature transfer coefficient reaching 200 mK per flux quantum at a bath temperature of 25 mK. Foremost, it demonstrates the exact correspondence in the phase-engineering of charge and heat currents, breaking ground for advanced caloritronic nanodevices such as thermal splitters, heat pumps and time-dependent electronic engines.

  9. Ultrafast electron transfer at organic semiconductor interfaces: Importance of molecular orientation

    DOE PAGES

    Ayzner, Alexander L.; Nordlund, Dennis; Kim, Do -Hwan; ...

    2014-12-04

    Much is known about the rate of photoexcited charge generation in at organic donor/acceptor (D/A) heterojunctions overaged over all relative arrangements. However, there has been very little experimental work investigating how the photoexcited electron transfer (ET) rate depends on the precise relative molecular orientation between D and A in thin solid films. This is the question that we address in this work. We find that the ET rate depends strongly on the relative molecular arrangement: The interface where the model donor compound copper phthalocyanine is oriented face-on with respect to the fullerene C 60 acceptor yields a rate that ismore » approximately 4 times faster than that of the edge-on oriented interface. Our results suggest that the D/A electronic coupling is significantly enhanced in the face-on case, which agrees well with theoretical predictions, underscoring the importance of controlling the relative interfacial molecular orientation.« less

  10. Structural basis for cellobiose dehydrogenase action during oxidative cellulose degradation

    NASA Astrophysics Data System (ADS)

    Tan, Tien-Chye; Kracher, Daniel; Gandini, Rosaria; Sygmund, Christoph; Kittl, Roman; Haltrich, Dietmar; Hällberg, B. Martin; Ludwig, Roland; Divne, Christina

    2015-07-01

    A new paradigm for cellulose depolymerization by fungi focuses on an oxidative mechanism involving cellobiose dehydrogenases (CDH) and copper-dependent lytic polysaccharide monooxygenases (LPMO); however, mechanistic studies have been hampered by the lack of structural information regarding CDH. CDH contains a haem-binding cytochrome (CYT) connected via a flexible linker to a flavin-dependent dehydrogenase (DH). Electrons are generated from cellobiose oxidation catalysed by DH and shuttled via CYT to LPMO. Here we present structural analyses that provide a comprehensive picture of CDH conformers, which govern the electron transfer between redox centres. Using structure-based site-directed mutagenesis, rapid kinetics analysis and molecular docking, we demonstrate that flavin-to-haem interdomain electron transfer (IET) is enabled by a haem propionate group and that rapid IET requires a closed CDH state in which the propionate is tightly enfolded by DH. Following haem reduction, CYT reduces LPMO to initiate oxygen activation at the copper centre and subsequent cellulose depolymerization.

  11. Electron Transfer Dissociation: Effects of Cation Charge State on Product Partitioning in Ion/Ion Electron Transfer to Multiply Protonated Polypeptides

    PubMed Central

    Liu, Jian; McLuckey, Scott A.

    2012-01-01

    The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749

  12. Syntrophic anaerobic photosynthesis via direct interspecies electron transfer

    DOE PAGES

    Ha, Phuc T.; Lindemann, Stephen R.; Shi, Liang; ...

    2017-01-09

    Microbial phototrophs, key primary producers on Earth, use H 2O, H 2, H 2S and other reduced inorganic compounds as electron donors. Here we describe a form of metabolism linking anoxygenic photosynthesis to anaerobic respiration that we call ‘syntrophic anaerobic photosynthesis’. We show that photoautotrophy in the green sulfur bacterium Prosthecochloris aestaurii can be driven by either electrons from a solid electrode or acetate oxidation via direct interspecies electron transfer from a heterotrophic partner bacterium, Geobacter sulfurreducens. Photosynthetic growth of P. aestuarii using reductant provided by either an electrode or syntrophy is robust and light-dependent. In contrast, P. aestuarii doesmore » not grow in co-culture with a G. sulfurreducens mutant lacking a trans-outer membrane porin-cytochrome protein complex required for direct intercellular electron transfer. Syntrophic anaerobic photosynthesis is therefore a carbon cycling process that could take place in anoxic environments. Lastly, this process could be exploited for biotechnological applications, such as waste treatment and bioenergy production, using engineered phototrophic microbial communities.« less

  13. Activation Thermodynamics and H/D Kinetic Isotope Effect of the Hox to HredH+ Transition in [FeFe] Hydrogenase.

    PubMed

    Ratzloff, Michael W; Wilker, Molly B; Mulder, David W; Lubner, Carolyn E; Hamby, Hayden; Brown, Katherine A; Dukovic, Gordana; King, Paul W

    2017-09-20

    Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox →H red H + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ∼2.5-fold kinetic isotope effect. Overall, these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox →H red H + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.

  14. Projectile-charge dependence of the differential cross section for the ionization of argon atoms at 1 keV

    NASA Astrophysics Data System (ADS)

    Purohit, G.; Kato, D.

    2017-10-01

    The single ionization triple differential cross sections (TDCS) of the Ar (3 p ) atoms are reported for the positron and electron impact at 1 keV. The calculated cross sections have been obtained using distorted wave Born approximation (DWBA) approach for the average ejected electron energies 13 and 26 eV at different momentum transfer conditions. The present attempt is helpful to probe the information on the TDCS trends for the particle-matter and antiparticle-matter interactions and to analyze the recent measurements [Phy. Rev. A 95, 062703 (2017), 10.1103/PhysRevA.95.062703]. The binary electron emission is enhanced while the recoil emission is decreased for the positron impact relative to the electron impact in the DWBA calculation results. Systematic shift of peaks, shifting away from the momentum transfer direction for positron impact and shifting towards each other for electron impact, is observed with increasing momentum transfer.

  15. Syntrophic anaerobic photosynthesis via direct interspecies electron transfer

    PubMed Central

    Ha, Phuc T.; Lindemann, Stephen R.; Shi, Liang; Dohnalkova, Alice C.; Fredrickson, James K.; Madigan, Michael T.; Beyenal, Haluk

    2017-01-01

    Microbial phototrophs, key primary producers on Earth, use H2O, H2, H2S and other reduced inorganic compounds as electron donors. Here we describe a form of metabolism linking anoxygenic photosynthesis to anaerobic respiration that we call ‘syntrophic anaerobic photosynthesis'. We show that photoautotrophy in the green sulfur bacterium Prosthecochloris aestaurii can be driven by either electrons from a solid electrode or acetate oxidation via direct interspecies electron transfer from a heterotrophic partner bacterium, Geobacter sulfurreducens. Photosynthetic growth of P. aestuarii using reductant provided by either an electrode or syntrophy is robust and light-dependent. In contrast, P. aestuarii does not grow in co-culture with a G. sulfurreducens mutant lacking a trans-outer membrane porin-cytochrome protein complex required for direct intercellular electron transfer. Syntrophic anaerobic photosynthesis is therefore a carbon cycling process that could take place in anoxic environments. This process could be exploited for biotechnological applications, such as waste treatment and bioenergy production, using engineered phototrophic microbial communities. PMID:28067226

  16. Timing of electron and proton transfer in the ba(3) cytochrome c oxidase from Thermus thermophilus.

    PubMed

    von Ballmoos, Christoph; Lachmann, Peter; Gennis, Robert B; Ädelroth, Pia; Brzezinski, Peter

    2012-06-05

    Heme-copper oxidases are membrane-bound proteins that catalyze the reduction of O(2) to H(2)O, a highly exergonic reaction. Part of the free energy of this reaction is used for pumping of protons across the membrane. The ba(3) oxidase from Thermus thermophilus presumably uses a single proton pathway for the transfer of substrate protons used during O(2) reduction as well as for the transfer of the protons that are pumped across the membrane. The pumping stoichiometry (0.5 H(+)/electron) is lower than that of most other (mitochondrial-like) oxidases characterized to date (1 H(+)/electron). We studied the pH dependence and deuterium isotope effect of the kinetics of electron and proton transfer reactions in the ba(3) oxidase. The results from these studies suggest that the movement of protons to the catalytic site and movement to a site located some distance from the catalytic site [proposed to be a "proton-loading site" (PLS) for pumped protons] are separated in time, which allows individual investigation of these reactions. A scenario in which the uptake and release of a pumped proton occurs upon every second transfer of an electron to the catalytic site would explain the decreased proton pumping stoichiometry compared to that of mitochondrial-like oxidases.

  17. Effects of the Electronic Spin-Orbit Interaction on the Anomalous Asymmetric Scattering of the Spin-Polarized He+ Beam with Paramagnetic Target Materials II. Partial Wave Representation

    NASA Astrophysics Data System (ADS)

    Sakai, Osamu; Suzuki, Taku T.

    2018-05-01

    The scattering of an electron-spin-polarized 4He+ beam on paramagnetic materials has an anomalously large asymmetric scattering component (ASC) around 10%, which is 104 times that expected from the spin-orbit coupling for the potential of the target nucleus. The scattering angle (θ) dependence of the ASC has been measured. It changes sign near 90° for some materials (for example, Au and Pt), while it does not change sign for other materials (for example, Pb and Bi). It has been noted that the spin-orbit interaction of electrons on the target in the electron-transfer intermediate state causes the ASC of He nucleus motion, and it has also been predicted that the sign change in the θ dependence occurs when the d electron transfer is dominant. This seems to correspond to the cases of Au and Pt, but not to the cases of Pb and Bi. The previous approach is refined on the basis of the partial wave representation, which can give a more correct estimation of the ASC. It is shown that the sign change appears in the weak-resonance domain in the case of d electron excitation, whereas the sign change disappears in the strong-resonance domain. Our calculated results qualitatively agree with the material dependence of the ASC observed experimentally.

  18. Length-dependence of intramolecular electron transfer in σ-bonded rigid molecular rods: an ab initio molecular orbital study

    NASA Astrophysics Data System (ADS)

    Pati, Ranjit; Karna, Shashi P.

    2002-01-01

    The dependence of electron transfer (ET) coupling element, VAB, on the length of rigid-rod-like systems consisting of bicyclo[1.1.1]pentane (BCP), cubane (CUB), and bicyclo[2.2.2]octane (BCO) monomers, has been investigated with the use of ab initio Hartree-Fock (HF) method employing Marcus-Hush two-state (TS) model. The value of VAB decreases exponentially with increase in the number of the cage units of the σ-bonded molecules. The calculated decay constant, β, shows good agreement with previously reported data. For molecular length⩾15 Å, the value of VAB becomes negligibly small, suggesting complete suppression of the through bond direct tunneling contribution to ET process.

  19. Utilizing Electrical Characteristics of Individual Nanotube Devices to Study the Charge Transfer between CdSe Quantum Dots and Double-Walled Nanotubes

    DOE PAGES

    Zhu, Yuqi; Zhou, Ruiping; Wang, Lei; ...

    2017-03-02

    To study the charge transfer between cadmium selenide (CdSe) quantum dots (QDs) and double-walled nanotubes (DWNTs), various sizes of CdSe-ligand-DWNT structures are synthesized, and field-effect transistors (FETs) from individual functionalized DWNTs rather than networks of the same are fabricated. From the electrical measurements, two distinct electron transfer mechanisms from the QD system to the nanotube are identified. By the formation of the CdSe-ligand-DWNT heterostructure, an effectively n-doped nanotube is created due to the smaller work function of CdSe as compared with the nanotube. In addition, once the QD-DWNT system is exposed to laser light, further electron transfer from the QDmore » through the ligand, i.e. 4-mercaptophenol (MTH), to the nanotube occurs and a clear QD-size dependent tunneling process is observed. Furthermore, the detailed analysis of a large set of devices and the particular methodology employed here for the first time allowed for extracting a wavelength and quantum dot size dependent charge transfer efficiency – a quantity that is evaluated for the first time through electrical measurement.« less

  20. Utilizing Electrical Characteristics of Individual Nanotube Devices to Study the Charge Transfer between CdSe Quantum Dots and Double-Walled Nanotubes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yuqi; Zhou, Ruiping; Wang, Lei

    To study the charge transfer between cadmium selenide (CdSe) quantum dots (QDs) and double-walled nanotubes (DWNTs), various sizes of CdSe-ligand-DWNT structures are synthesized, and field-effect transistors (FETs) from individual functionalized DWNTs rather than networks of the same are fabricated. From the electrical measurements, two distinct electron transfer mechanisms from the QD system to the nanotube are identified. By the formation of the CdSe-ligand-DWNT heterostructure, an effectively n-doped nanotube is created due to the smaller work function of CdSe as compared with the nanotube. In addition, once the QD-DWNT system is exposed to laser light, further electron transfer from the QDmore » through the ligand, i.e. 4-mercaptophenol (MTH), to the nanotube occurs and a clear QD-size dependent tunneling process is observed. Furthermore, the detailed analysis of a large set of devices and the particular methodology employed here for the first time allowed for extracting a wavelength and quantum dot size dependent charge transfer efficiency – a quantity that is evaluated for the first time through electrical measurement.« less

  1. Angular dependence of spin-orbit spin-transfer torques

    NASA Astrophysics Data System (ADS)

    Lee, Ki-Seung; Go, Dongwook; Manchon, Aurélien; Haney, Paul M.; Stiles, M. D.; Lee, Hyun-Woo; Lee, Kyung-Jin

    2015-04-01

    In ferromagnet/heavy-metal bilayers, an in-plane current gives rise to spin-orbit spin-transfer torque, which is usually decomposed into fieldlike and dampinglike torques. For two-dimensional free-electron and tight-binding models with Rashba spin-orbit coupling, the fieldlike torque acquires nontrivial dependence on the magnetization direction when the Rashba spin-orbit coupling becomes comparable to the exchange interaction. This nontrivial angular dependence of the fieldlike torque is related to the Fermi surface distortion, determined by the ratio of the Rashba spin-orbit coupling to the exchange interaction. On the other hand, the dampinglike torque acquires nontrivial angular dependence when the Rashba spin-orbit coupling is comparable to or stronger than the exchange interaction. It is related to the combined effects of the Fermi surface distortion and the Fermi sea contribution. The angular dependence is consistent with experimental observations and can be important to understand magnetization dynamics induced by spin-orbit spin-transfer torques.

  2. Proton-coupled electron transfer and the role of water molecules in proton pumping by cytochrome c oxidase

    PubMed Central

    Sharma, Vivek; Enkavi, Giray; Vattulainen, Ilpo; Róg, Tomasz; Wikström, Mårten

    2015-01-01

    Molecular oxygen acts as the terminal electron sink in the respiratory chains of aerobic organisms. Cytochrome c oxidase in the inner membrane of mitochondria and the plasma membrane of bacteria catalyzes the reduction of oxygen to water, and couples the free energy of the reaction to proton pumping across the membrane. The proton-pumping activity contributes to the proton electrochemical gradient, which drives the synthesis of ATP. Based on kinetic experiments on the O–O bond splitting transition of the catalytic cycle (A → PR), it has been proposed that the electron transfer to the binuclear iron–copper center of O2 reduction initiates the proton pump mechanism. This key electron transfer event is coupled to an internal proton transfer from a conserved glutamic acid to the proton-loading site of the pump. However, the proton may instead be transferred to the binuclear center to complete the oxygen reduction chemistry, which would constitute a short-circuit. Based on atomistic molecular dynamics simulations of cytochrome c oxidase in an explicit membrane–solvent environment, complemented by related free-energy calculations, we propose that this short-circuit is effectively prevented by a redox-state–dependent organization of water molecules within the protein structure that gates the proton transfer pathway. PMID:25646428

  3. UVA radiation induced ultrafast electron transfer from a food carcinogen benzo[a]pyrene to organic molecules, biological macromolecules, and inorganic nano structures.

    PubMed

    Banerjee, Soma; Sarkar, Soumik; Lakshman, Karthik; Dutta, Joydeep; Pal, Samir Kumar

    2013-04-11

    Reactions involving electron transfer (ET) and reactive oxygen species (ROS) play a pivotal role in carcinogenesis and cancer biochemistry. Our present study emphasizes UVA radiation induced ET reaction as one of the key aspects of a potential carcinogen, benzo[a]pyrene (BP), in the presence of a wide variety of molecules covering organic p-benzoquinone (BQ), biological macromolecules like calf-thymus DNA (CT-DNA), human serum albumin (HSA) protein, and inorganic zinc oxide (ZnO) nanorods (NRs). Steady-state and picosecond-resolved fluorescence spectroscopy have been used to monitor such ET reactions. Physical consequences of BP association with CT-DNA have been investigated through temperature-dependent circular dichroism (CD) spectroscopy. The temperature-dependent steady-state, picosecond-resolved fluorescence lifetime and anisotropy studies reveal the effect of temperature on the perturbation of such ET reactions from BP to biological macromolecules, highlighting their temperature-dependent association. Furthermore, the electron-donating property of BP has been corroborated by measuring wavelength-dependent photocurrent in a BP-anchored ZnO NR-based photodevice, offering new physical insights for the carcinogenic study of BP.

  4. Exploring Step‐by‐Step Assembly of Nanoparticle:Cytochrome Biohybrid Photoanodes

    PubMed Central

    Hwang, Ee Taek; Orchard, Katherine L.; Hojo, Daisuke; Beton, Joseph; Lockwood, Colin W. J.; Adschiri, Tadafumi

    2017-01-01

    Abstract Coupling light‐harvesting semiconducting nanoparticles (NPs) with redox enzymes has been shown to create artificial photosynthetic systems that hold promise for the synthesis of solar fuels. High quantum yields require efficient electron transfer from the nanoparticle to the redox protein, a property that can be difficult to control. Here, we have compared binding and electron transfer between dye‐sensitized TiO2 nanocrystals or CdS quantum dots and two decaheme cytochromes on photoanodes. The effect of NP surface chemistry was assessed by preparing NPs capped with amine or carboxylic acid functionalities. For the TiO2 nanocrystals, binding to the cytochromes was optimal when capped with a carboxylic acid ligand, whereas for the CdS QDs, better adhesion was observed for amine capped ligand shells. When using TiO2 nanocrystals, dye‐sensitized with a phosphonated bipyridine Ru(II) dye, photocurrents are observed that are dependent on the redox state of the decaheme, confirming that electrons are transferred from the TiO2 nanocrystals to the surface via the decaheme conduit. In contrast, when CdS NPs are used, photocurrents are not dependent on the redox state of the decaheme, consistent with a model in which electron transfer from CdS to the photoanode bypasses the decaheme protein. These results illustrate that although the organic shell of NPs nanoparticles crucially affects coupling with proteinaceous material, the coupling can be difficult to predict or engineer. PMID:28920010

  5. Role of Na/sub 2/S in anoxygenic photosynthesis and H/sub 2/ production in the cyanobacterium Nostoc Muscorum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fry, I.; Robinson, A.E.; Spath, S.

    1984-09-28

    Na/sub 2/S is known to support anoxygenic photosynthesis in some strains of cyanobacteria and to stimulate H/sub 2/ production in N/sub 2/ fixing filaments of Nostoc muscorum. We have shown electron transfer between Na/sub 2/S and Photosystem I to be dependent on cytochrome b/sub 559/ which was detected only in vegetative cells. An electron mediator was required to support Na/sub 2/S driven nitrogenase activity in isolated heterocysts. Na/sub 2/S was also found to deplete the ATP pool, probably by inhibiting electron transfer from Photosystem I. 14 references, 4 figures.

  6. Sex-dependent accumulation and maternal transfer of Dechlorane Plus flame retardant in fish from an electronic waste recycling site in South China.

    PubMed

    Wu, Jiang-Ping; She, Ya-Zhe; Zhang, Ying; Peng, Ying; Mo, Ling; Luo, Xiao-Jun; Mai, Bi-Xian

    2013-06-01

    Knowledge is limited on sex-related accumulation and maternal transfer of Dechlorane Plus (DP) flame retardant in wildlife. In the present study, DP isomers were examined in liver and eggs of two fish species, northern snakehead and crucian carp, from an electronic waste recycling site in China. Hepatic ∑DP (sum of syn- and anti-DP) concentrations ranged 260-1920 ng/g lipid in northern snakehead and 340-1670 ng/g in crucian carp, with significantly higher levels in males relative to females. ∑DP concentrations ranged 4.6-310 ng/g lipid in the eggs, demonstrating their maternal transfer in the female fish. The mean eggs to liver concentration ratios (E/L ratios) were 0.03 and 0.03 in northern snakehead, and 0.26 and 0.25 in crucian carp, for syn- and anti-DP, respectively. A significantly negative correlation between the E/L ratios and the hepatic DP concentrations was observed, indicating a dose-dependent maternal transfer of DP isomers in the fish. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Investigation of the redox-dependent modulation of structure and dynamics in human cytochrome c.

    PubMed

    Imai, Mizue; Saio, Tomohide; Kumeta, Hiroyuki; Uchida, Takeshi; Inagaki, Fuyuhiko; Ishimori, Koichiro

    2016-01-22

    Redox-dependent changes in the structure and dynamics of human cytochrome c (Cyt c) were investigated by solution NMR. We found significant structural changes in several regions, including residues 23-28 (loop 3), which were further corroborated by chemical shift differences between the reduced and oxidized states of Cyt c. These differences are essential for discriminating redox states in Cyt c by cytochrome c oxidase (CcO) during electron transfer reactions. Carr-Purcell-Meiboom-Gill (CPMG) relaxation dispersion experiments identified that the region around His33 undergoes conformational exchanges on the μs-ms timescale, indicating significant redox-dependent structural changes. Because His33 is not part of the interaction site for CcO, our data suggest that the dynamic properties of the region, which is far from the interaction site for CcO, contribute to conformational changes during electron transfer to CcO. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Biochar as an electron shuttle for reductive dechlorination of pentachlorophenol by Geobacter sulfurreducens

    PubMed Central

    Yu, Linpeng; Yuan, Yong; Tang, Jia; Wang, Yueqiang; Zhou, Shungui

    2015-01-01

    The reductive dechlorination of pentachlorophenol (PCP) by Geobacter sulfurreducens in the presence of different biochars was investigated to understand how biochars affect the bioreduction of environmental contaminants. The results indicated that biochars significantly accelerate electron transfer from cells to PCP, thus enhancing reductive dechlorination. The promotion effects of biochar (as high as 24-fold) in this process depend on its electron exchange capacity (EEC) and electrical conductivity (EC). A kinetic model revealed that the surface redox-active moieties (RAMs) and EC of biochar (900 °C) contributed to 56% and 41% of the biodegradation rate, respectively. This work demonstrates that biochars are efficient electron mediators for the dechlorination of PCP and that both the EC and RAMs of biochars play important roles in the electron transfer process. PMID:26592958

  9. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

    2014-03-01

    Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

  10. Catalysis by Methylamine Dehydrogenase and Electron Transfer to Amicyanin and Cytochrome C(551I) from Paracoccus Denitrificans.

    NASA Astrophysics Data System (ADS)

    Brooks, Harold Burns

    1995-01-01

    The quinoprotein methylamine dehydrogenase (MADH), a type I copper protein, amicyanin, and cytochrome c _{55li} form a physiologic ternary complex (Chen et al. (1994) Science 264, 86-90) in which electrons are transferred from tryptophan tryptophylquinone to copper to heme. The reduction of MADH by rm H_3- and rm D_3 -methylamine, the reoxidation of MADH by amicyanin, and the reduction of cytochrome c_{55li } by reduced amicyanin in the presence of MADH have been studied by stopped-flow spectroscopy. When rm CD_3NH_2 was used as a substrate for MADH a deuterium kinetic isotope effect of 17.2 was measured for the hydrogen abstraction step. The maximum deuterium kinetic isotope effect that was measured in steady-state kinetic experiments was 3.0. The temperature dependencies of the rate constants for the reaction of methylamine with MADH were also determined. An iminosemiquinone intermediate for the oxidation of substrate-reduced MADH by amicyanin was detected using stopped-flow spectroscopy, and the presence of the substrate derived nitrogen was confirmed by electron spin echo envelope modulation (ESEEM) spectroscopy. Marcus theory, which was used to analyze the electron transfer reaction between the dithionite-generated redox forms of MADH and amicyanin, gave values of 218 kJ rm mol^{ -1} (2.3 eV) for the reorganizational energy (lambda ) and 11.6 rm cm^{-1} for the coupling rm (H_{AB}). In contrast, the oxidation of substrate-reduced MADH by amicyanin was a gated electron transfer reaction with values for DeltaH* of 76 kJ rm mol^ {-1} and DeltaS* of -41 J rm mol^{ -1} ^circ K^ {-1}. These studies are consistent with the formation of transient unstable intermediates preceeding electron transfer between MADH and amicyanin. Preliminary investigations of the ternary complex of MADH, amicyanin, and cytochrome c_{55li } suggest two distinct cytochrome c _{55li} binding sites on amicyanin. This conclusion is supported by the biphasic nature of the stopped -flow trace, the inhibition of the rm k^ {fast}_{obs} by MADH, and the ionic strength dependence of the two phases. The slow phase had a rate of 3.1 rm s^ {-1} which is consistent with electron transfer between amicyanin and cytochrome c_ {55li} within the ternary complex. The fast phase does not exhibit saturation behavior, must have an electron transfer rate greater than 1000 rm s^{-1}, and likely involves a complex of amicyanin and cytochrome c_{55li } near the hydrophobic patch of amicyanin.

  11. Evidence for Direct Electron Transfer by a Gram-Positive Bacterium Isolated from a Microbial Fuel Cell▿†

    PubMed Central

    Wrighton, K. C.; Thrash, J. C.; Melnyk, R. A.; Bigi, J. P.; Byrne-Bailey, K. G.; Remis, J. P.; Schichnes, D.; Auer, M.; Chang, C. J.; Coates, J. D.

    2011-01-01

    Despite their importance in iron redox cycles and bioenergy production, the underlying physiological, genetic, and biochemical mechanisms of extracellular electron transfer by Gram-positive bacteria remain insufficiently understood. In this work, we investigated respiration by Thermincola potens strain JR, a Gram-positive isolate obtained from the anode surface of a microbial fuel cell, using insoluble electron acceptors. We found no evidence that soluble redox-active components were secreted into the surrounding medium on the basis of physiological experiments and cyclic voltammetry measurements. Confocal microscopy revealed highly stratified biofilms in which cells contacting the electrode surface were disproportionately viable relative to the rest of the biofilm. Furthermore, there was no correlation between biofilm thickness and power production, suggesting that cells in contact with the electrode were primarily responsible for current generation. These data, along with cryo-electron microscopy experiments, support contact-dependent electron transfer by T. potens strain JR from the cell membrane across the 37-nm cell envelope to the cell surface. Furthermore, we present physiological and genomic evidence that c-type cytochromes play a role in charge transfer across the Gram-positive bacterial cell envelope during metal reduction. PMID:21908627

  12. Tuning electronic properties of graphene nanoflake polyaromatic hydrocarbon through molecular charge-transfer interactions

    NASA Astrophysics Data System (ADS)

    Sharma, Vaishali; Dabhi, Shweta D.; Shinde, Satyam; Jha, Prafulla K.

    2018-05-01

    By means of first principles calculation we have tuned the electronic properties of graphene nanoflake polyaromatic hydrocarbon via molecular charge transfer. Acceptor/donor Tetracyanoquinodimethane (TCNQ) and Tetrathiafulvalene (TTF) organic molecules are adsorbed on polyaromatic hydrocarbons (PAH) in order to introduce the charge transfer. The substrate's n- or p- type nature depends on the accepting/donating behavior of dopant molecules. Two different classes of PAH (extended form of triangulene) namely Bow-tie graphene nanoflake (BTGNF) and triangular zigzag graphene nanoflake (TZGNF). It is revealed that all the TCNQ and TTF modified graphene nanoflakes exhibit significant changes in HOMO-LUMO gap in range from 0.58 eV to 0.64 eV and 0.01 eV to 0.05 eV respectively. The adsorption energies are in the range of -0.05 kcal/mol to -2.6 kcal/mol. The change in work function is also calculated and discussed, the maximum charge transfer is for TCNQ adsorbed BTGNF. These alluring findings in the tuning of electronic properties will be advantageous for promoting graphene nanoflake polyaromatic hydrocarbon for their applications in electronic devices.

  13. Dynamics of intramolecular electron transfer reaction of FAD studied by magnetic field effects on transient absorption spectra.

    PubMed

    Murakami, Masaaki; Maeda, Kiminori; Arai, Tatsuo

    2005-07-07

    The kinetics of intermediates generated from intramolecular electron-transfer reaction by photo irradiation of the flavin adenine dinucleotide (FAD) molecule was studied by a magnetic field effect (MFE) on transient absorption (TA) spectra. Existence time of MFE and MFE action spectra have a strong dependence on the pH of solutions. The MFE action spectra have indicated the existence of interconversion between the radical pair and the cation form of the triplet excited state of flavin part. All rate constants of the triplet and the radical pair were determined by analysis of the MFE action spectra and decay kinetics of TA. The obtained values for the interconversion indicate that the formation of cation radical promotes the back electron-transfer reaction to the triplet excited state. Further, rate constants of spin relaxation and recombination have been studied by the time profiles of MFE at various pH. The drastic change of those two factors has been obtained and can be explained by SOC (spin-orbit coupling) induced back electron-transfer promoted by the formation of a stacking conformation at pH > 2.5.

  14. Probing the coupling between proton and electron transfer in Photosystem II core complexes containing a 3-fluorotyrosine

    PubMed Central

    Rappaport, Fabrice; Boussac, Alain; Force, Dee Ann; Peloquin, Jeffrey; Brynda, Marcin; Sugiura, Miwa; Un, Sun; Britt, R. David; Diner, Bruce A.

    2009-01-01

    The catalytic cycle of numerous enzymes involves the coupling between proton transfer and electron transfer. Yet, the understanding of this coordinated transfer in biological systems remains limited, likely because its characterization relies on the controlled but experimentally challenging modifications of the free energy changes associated with either the electron or proton transfer. We have performed such a study here in Photosystem II. The driving force for electron transfer from TyrZ to P680•+ has been decreased by ~ 80 meV by mutating the axial ligand of P680, and that for proton transfer upon oxidation of TyrZ by substituting a 3-fluorotyrosine (3F-TyrZ) for TyrZ. In Mn-depleted Photosystem II, the dependence upon pH of the oxidation rates of TyrZ and 3F-TyrZ were found to be similar. However, in the pH range where the phenolic hydroxyl of TyrZ is involved in a H-bond with a proton acceptor, the activation energy of the oxidation of 3F-TyrZ is decreased by 110 meV, a value which correlates with the in vitro finding of a 90 meV stabilization energy to the phenolate form of 3F-Tyr when compared to Tyr (Seyedsayamdost et al., 2006, JACS 128:1569–79). Thus, when the phenol of YZ acts as a H-bond-donor, its oxidation by P680•+ is controlled by its prior deprotonation. This contrasts with the situation prevailing at lower pH, where the proton acceptor is protonated and therefore unavailable, in which the oxidation-induced proton transfer from the phenolic hydroxyl of TyrZ has been proposed to occur concertedly with the electron transfer to P680•+. This suggests a switch between a concerted proton/electron transfer at pHs < 7.5 to a sequential one at pHs > 7.5 and illustrates the roles of the H-bond and of the likely salt-bridge existing between the phenolate and the nearby proton acceptor in determining the coupling between proton and electron transfer. PMID:19265377

  15. Excited-state dynamics of size-dependent colloidal TiO2-Au nanocomposites

    NASA Astrophysics Data System (ADS)

    Karam, Tony E.; Khoury, Rami A.; Haber, Louis H.

    2016-03-01

    The ultrafast excited-state dynamics of size-dependent TiO2-Au nanocomposites synthesized by reducing gold nanoclusters to the surface of colloidal TiO2 nanoparticles are studied using pump-probe transient absorption spectroscopy with 400 nm excitation pulses. The results show that the relaxation processes of the plasmon depletion band, which are described by electron-phonon and phonon-phonon scattering lifetimes, are independent of the gold nanocluster shell size surrounding the TiO2 nanoparticle core. The dynamics corresponding to interfacial electron transfer between the gold nanoclusters and the TiO2 bandgap are observed to spectrally overlap with the gold interband transition signal, and the electron transfer lifetimes are shown to significantly decrease as the nanocluster shell size increases. Additionally, size-dependent periodic oscillations are observed and are attributed to acoustic phonons of a porous shell composed of aggregated gold nanoclusters around the TiO2 core, with frequencies that decrease and damping times that remain constant as the nanocluster shell size increases. These results are important for the development of improved catalytic nanomaterial applications.

  16. Real-Time Quantum Dynamics of Long-Range Electronic Excitation Transfer in Plasmonic Nanoantennas.

    PubMed

    Ilawe, Niranjan V; Oviedo, M Belén; Wong, Bryan M

    2017-08-08

    Using large-scale, real-time, quantum dynamics calculations, we present a detailed analysis of electronic excitation transfer (EET) mechanisms in a multiparticle plasmonic nanoantenna system. Specifically, we utilize real-time, time-dependent, density functional tight binding (RT-TDDFTB) to provide a quantum-mechanical description (at an electronic/atomistic level of detail) for characterizing and analyzing these systems, without recourse to classical approximations. We also demonstrate highly long-range electronic couplings in these complex systems and find that the range of these couplings is more than twice the conventional cutoff limit considered by Förster resonance energy transfer (FRET)-based approaches. Furthermore, we attribute these unusually long-ranged electronic couplings to the coherent oscillations of conduction electrons in plasmonic nanoparticles. This long-range nature of plasmonic interactions has important ramifications for EET; in particular, we show that the commonly used "nearest-neighbor" FRET model is inadequate for accurately characterizing EET even in simple plasmonic antenna systems. These findings provide a real-time, quantum-mechanical perspective for understanding EET mechanisms and provide guidance in enhancing plasmonic properties in artificial light-harvesting systems.

  17. Effects of G-Quadruplex Topology on Electronic Transfer Integrals

    PubMed Central

    Sun, Wenming; Varsano, Daniele; Di Felice, Rosa

    2016-01-01

    G-quadruplex is a quadruple helical form of nucleic acids that can appear in guanine-rich parts of the genome. The basic unit is the G-tetrad, a planar assembly of four guanines connected by eight hydrogen bonds. Its rich topology and its possible relevance as a drug target for a number of diseases have stimulated several structural studies. The superior stiffness and electronic π-π overlap between consecutive G-tetrads suggest exploitation for nanotechnologies. Here we inspect the intimate link between the structure and the electronic properties, with focus on charge transfer parameters. We show that the electronic couplings between stacked G-tetrads strongly depend on the three-dimensional atomic structure. Furthermore, we reveal a remarkable correlation with the topology: a topology characterized by the absence of syn-anti G-G sequences can better support electronic charge transfer. On the other hand, there is no obvious correlation of the electronic coupling with usual descriptors of the helix shape. We establish a procedure to maximize the correlation with a global helix shape descriptor. PMID:28335314

  18. Spatio-temporal analysis of the electron power absorption in electropositive capacitive RF plasmas based on moments of the Boltzmann equation

    NASA Astrophysics Data System (ADS)

    Schulze, J.; Donkó, Z.; Lafleur, T.; Wilczek, S.; Brinkmann, R. P.

    2018-05-01

    Power absorption by electrons from the space- and time-dependent electric field represents the basic sustaining mechanism of all radio-frequency driven plasmas. This complex phenomenon has attracted significant attention. However, most theories and models are, so far, only able to account for part of the relevant mechanisms. The aim of this work is to present an in-depth analysis of the power absorption by electrons, via the use of a moment analysis of the Boltzmann equation without any ad-hoc assumptions. This analysis, for which the input quantities are taken from kinetic, particle based simulations, allows the identification of all physical mechanisms involved and an accurate quantification of their contributions. The perfect agreement between the sum of these contributions and the simulation results verifies the completeness of the model. We study the relative importance of these mechanisms as a function of pressure, with high spatial and temporal resolution, in an electropositive argon discharge. In contrast to some widely accepted previous models we find that high space- and time-dependent ambipolar electric fields outside the sheaths play a key role for electron power absorption. This ambipolar field is time-dependent within the RF period and temporally asymmetric, i.e., the sheath expansion is not a ‘mirror image’ of the sheath collapse. We demonstrate that this time-dependence is mainly caused by a time modulation of the electron temperature resulting from the energy transfer to electrons by the ambipolar field itself during sheath expansion. We provide a theoretical proof that this ambipolar electron power absorption would vanish completely, if the electron temperature was constant in time. This mechanism of electron power absorption is based on a time modulated electron temperature, markedly different from the Hard Wall Model, of key importance for energy transfer to electrons on time average and, thus, essential for the generation of capacitively coupled plasmas.

  19. Evaluation of Bulk Charging in Geostationary Transfer Orbit and Earth Escape Trajectories Using the Numit 1-D Charging Model

    NASA Technical Reports Server (NTRS)

    Minow, Joseph I.; Coffey, Victoria N.; Parker, Linda N.; Blackwell, William C., Jr.; Jun, Insoo; Garrett, Henry B.

    2007-01-01

    The NUMIT 1-dimensional bulk charging model is used as a screening to ol for evaluating time-dependent bulk internal or deep dielectric) ch arging of dielectrics exposed to penetrating electron environments. T he code is modified to accept time dependent electron flux time serie s along satellite orbits for the electron environment inputs instead of using the static electron flux environment input originally used b y the code and widely adopted in bulk charging models. Application of the screening technique ts demonstrated for three cases of spacecraf t exposure within the Earth's radiation belts including a geostationa ry transfer orbit and an Earth-Moon transit trajectory for a range of orbit inclinations. Electric fields and charge densities are compute d for dielectric materials with varying electrical properties exposed to relativistic electron environments along the orbits. Our objectiv e is to demonstrate a preliminary application of the time-dependent e nvironments input to the NUMIT code for evaluating charging risks to exposed dielectrics used on spacecraft when exposed to the Earth's ra diation belts. The results demonstrate that the NUMIT electric field values in GTO orbits with multiple encounters with the Earth's radiat ion belts are consistent with previous studies of charging in GTO orb its and that potential threat conditions for electrostatic discharge exist on lunar transit trajectories depending on the electrical proper ties of the materials exposed to the radiation environment.

  20. Spectroscopic study of active phase-support interactions on a RhO{sub x}/CeO{sub 2} catalyst: Evidence for electronic interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinez-Arias, A.; Soria, J.; Conesa, J.C.

    The effects of thermal treatments under vacuum, used as a way to generate reduced centers on Rh{sub 2}O{sub 3} and RhO{sub x}/CeO{sub 2}, have been studied by ESR and FTIR, using respectively oxygen and carbon monoxide as probe molecules. The results obtained for the outgassed samples reveal the presence of ceria-rhodia interactions favoring the stabilization of paramagnetic Rh{sup 2+} cations in rhodium oxide clusters on the ceria surface. Subsequent O{sub 2} adsorption leads to the formation of different oxygen-related paramagnetic species located on ceria, on rhodium oxide clusters and at the boundary between both oxides; their contribution to the spectramore » depends on outgassing conditions and O{sub 2} adsorption temperature. The unexpected absence of O{sub 2}{sup -}-Ce{sup 4+} species after O{sub 2} contact at 77 K with RhO{sub x}/CeO{sub 2} outgassed above 573 K evidences the existence of electronic interactions between the RhO{sub x}, and CeO{sub 2} phases, being explained on the basis of electron transfer to the mixed valence RhO{sub x}, phase from the surface-reduced ceria, leading to electron depletion of the latter. This effect is inhibited by CO adsorption, showing the dependence between the electron-accepting properties of the rhodia clusters and the presence of vacant coordination sites at the surface Rh ions. An effect of similar kind may be responsible for shifts observed in the IR bands of rhodium dicarbonyls formed in the RhO{sub x}/CeO{sub 2} system. The latter results suggest the possibility that thermal enhancement of surface reactions in complex systems could depend on electron transfer between adjacent phases and that adsorption on one phase may influence the surface reactivity of another phase by affecting to the electron transfer between them. 34 refs., 8 figs., 2 tabs.« less

  1. Molecular Basis for Electron Flow Within Metal-and Electrode-Reducing Biofilms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bond, Daniel R.

    2016-11-01

    Electrochemical, spectral, genetic, and biochemical techniques were developed to reveal that a diverse suite of redox proteins and structural macromolecules outside the cell work together to move electrons long distances between Geobacter cells to metals and electrodes. In this project, we greatly expanded the known participants in the electron transfer pathway of Geobacter. For example, in addition to well-studied pili, polysaccharides contribute to anchoring, different cytochromes are required under different conditions, strategies change with redox potential, and the localization of these components can change depending on where cells are located in a biofilm. By inventing new electrodes compatible with real-timemore » spectral measurements, we were able to visualize the redox status of biofilms in action, leading to a hypothesis that long-distance electron transfer is ultimately limiting in these systems and redox potentials change within biofilms. The goals of this project were met, as we were able to 1) identify new elements crucial to the expression, assembly and function of the extracellular electron transfer phenotype 2) expand spectral and electrochemical techniques to define the mechanism and route of electron transfer through the matrix, and 3) combine this knowledge to build the next generation of genetic tools for study of this complex process.« less

  2. Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

    PubMed

    Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

    2005-01-27

    Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

  3. Design and engineering of a man-made diffusive electron-transport protein.

    PubMed

    Fry, Bryan A; Solomon, Lee A; Leslie Dutton, P; Moser, Christopher C

    2016-05-01

    Maquettes are man-made cofactor-binding oxidoreductases designed from first principles with minimal reference to natural protein sequences. Here we focus on water-soluble maquettes designed and engineered to perform diffusive electron transport of the kind typically carried out by cytochromes, ferredoxins and flavodoxins and other small proteins in photosynthetic and respiratory energy conversion and oxido-reductive metabolism. Our designs were tested by analysis of electron transfer between heme maquettes and the well-known natural electron transporter, cytochrome c. Electron-transfer kinetics were measured from seconds to milliseconds by stopped-flow, while sub-millisecond resolution was achieved through laser photolysis of the carbon monoxide maquette heme complex. These measurements demonstrate electron transfer from the maquette to cytochrome c, reproducing the timescales and charge complementarity modulation observed in natural systems. The ionic strength dependence of inter-protein electron transfer from 9.7×10(6) M(-1) s(-1) to 1.2×10(9) M(-1) s(-1) follows a simple Debye-Hückel model for attraction between +8 net charged oxidized cytochrome c and -19 net charged heme maquette, with no indication of significant protein dipole moment steering. Successfully recreating essential components of energy conversion and downstream metabolism in man-made proteins holds promise for in vivo clinical intervention and for the production of fuel or other industrial products. This article is part of a Special Issue entitled Biodesign for Bioenergetics--the design and engineering of electronic transfer cofactors, proteins and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Towards Efficient and Accurate Description of Many-Electron Problems: Developments of Static and Time-Dependent Electronic Structure Methods

    NASA Astrophysics Data System (ADS)

    Ding, Feizhi

    Understanding electronic behavior in molecular and nano-scale systems is fundamental to the development and design of novel technologies and materials for application in a variety of scientific contexts from fundamental research to energy conversion. This dissertation aims to provide insights into this goal by developing novel methods and applications of first-principle electronic structure theory. Specifically, we will present new methods and applications of excited state multi-electron dynamics based on the real-time (RT) time-dependent Hartree-Fock (TDHF) and time-dependent density functional theory (TDDFT) formalism, and new development of the multi-configuration self-consist field theory (MCSCF) for modeling ground-state electronic structure. The RT-TDHF/TDDFT based developments and applications can be categorized into three broad and coherently integrated research areas: (1) modeling of the interaction between moleculars and external electromagnetic perturbations. In this part we will first prove both analytically and numerically the gauge invariance of the TDHF/TDDFT formalisms, then we will present a novel, efficient method for calculating molecular nonlinear optical properties, and last we will study quantum coherent plasmon in metal namowires using RT-TDDFT; (2) modeling of excited-state charge transfer in molecules. In this part, we will investigate the mechanisms of bridge-mediated electron transfer, and then we will introduce a newly developed non-equilibrium quantum/continuum embedding method for studying charge transfer dynamics in solution; (3) developments of first-principles spin-dependent many-electron dynamics. In this part, we will present an ab initio non-relativistic spin dynamics method based on the two-component generalized Hartree-Fock approach, and then we will generalized it to the two-component TDDFT framework and combine it with the Ehrenfest molecular dynamics approach for modeling the interaction between electron spins and nuclear motion. All these developments and applications will open up new computational and theoretical tools to be applied to the development and understanding of chemical reactions, nonlinear optics, electromagnetism, and spintronics. Lastly, we present a new algorithm for large-scale MCSCF calculations that can utilize massively parallel machines while still maintaining optimal performance for each single processor. This will great improve the efficiency in the MCSCF calculations for studying chemical dissociation and high-accuracy quantum-mechanical simulations.

  5. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely reconciles the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors.

  6. Genome-scale stoichiometry analysis to elucidate the innate capability of the cyanobacterium Synechocystis for electricity generation.

    PubMed

    Mao, Longfei; Verwoerd, Wynand S

    2013-10-01

    Synechocystis sp. PCC 6803 has been considered as a promising biocatalyst for electricity generation in recent microbial fuel cell research. However, the innate maximum current production potential and underlying metabolic pathways supporting the high current output are still unknown. This is mainly due to the fact that the high-current production cell phenotype results from the interaction among hundreds of reactions in the metabolism and it is impossible for reductionist methods to characterize the pathway selection in such a metabolic state. In this study, we employed computational metabolic techniques, flux balance analysis, and flux variability analysis, to exploit the maximum current outputs of Synechocystis sp. PCC 6803, in five electron transfer cases, namely, ferredoxin- and plastoquinol-dependent electron transfers under photoautotrophic cultivation, and NADH-dependent mediated electron transfer under photoautotrophic, heterotrophic, and mixotrophic conditions. In these five modes, the maximum current outputs were computed as 0.198, 0.7918, 0.198, 0.4652, and 0.4424 A gDW⁻¹, respectively. Comparison of the five operational modes suggests that plastoquinol-/c-type cytochrome-targeted electricity generation had an advantage of liberating the highest current output achievable for Synechocystis sp. PCC 6803. On the other hand, the analysis indicates that the currency metabolite, NADH-, dependent electricity generation can rely on a number of reactions from different pathways, and is thus more robust against environmental perturbations.

  7. Quantitative Probes of Electron-Phonon Coupling in an Organic Charge-Transfer Material

    NASA Astrophysics Data System (ADS)

    Rury, Aaron; Sorenson, Shayne; Driscoll, Eric; Dawlaty, Jahan

    While organic charge transfer (CT) materials may provide alternatives to inorganic materials in electronics and photonics applications, properties central to applications remain understudied in these organic materials. Specifically, electron-phonon coupling plays a pivotal role in electronic applications yet this coupling in CT materials remains difficult to directly characterize. To better understand the suitability of organic CT materials for electronic applications, we have devised an experimental technique that can directly assess electron-phonon coupling in a model organic CT material. Upon non-resonant interaction with an ultrafast laser pulse, we show that coherent excitation of Raman-active lattice vibrations of quinhydrone, a 1:1 co-crystal of the hydroquinone and p-benzoquinone, modulates the energies of electronic transitions probed by a white light pulse. Using a well-established theoretical framework of vibrational quantum beat spectra across the probe bandwidth, we quantitatively extract the parameters describing these electronic transitions to characterize electron-phonon coupling in this material. In conjunction with temperature-dependent resonance Raman measurements, we assess the hypothesis that several sharp transitions in the near-IR correspond to previously unknown excitonic states of this material. These results and their interpretation set the foundation for further elucidation of the one of the most important parameters in the application of organic charge-transfer materials to electronics and photonics.

  8. Exciplex formation in bimolecular photoinduced electron-transfer investigated by ultrafast time-resolved infrared spectroscopy.

    PubMed

    Koch, Marius; Letrun, Romain; Vauthey, Eric

    2014-03-12

    The dynamics of bimolecular photoinduced electron-transfer reactions has been investigated with three donor/acceptor (D/A) pairs in tetrahydrofuran (THF) and acetonitrile (ACN) using a combination of ultrafast spectroscopic techniques, including time-resolved infrared absorption. For the D/A pairs with the highest driving force of electron transfer, all transient spectroscopic features can be unambiguously assigned to the excited reactant and the ionic products. For the pair with the lowest driving force, three additional transient infrared bands, more intense in THF than in ACN, with a time dependence that differs from those of the other bands are observed. From their frequency and solvent dependence, these bands can be assigned to an exciplex. Moreover, polarization-resolved measurements point to a relatively well-defined mutual orientation of the constituents and to a slower reorientational time compared to those of the individual reactants. Thanks to the minimal overlap of the infrared signature of all transient species in THF, a detailed reaction scheme including the relevant kinetic and thermodynamic parameters could be deduced for this pair. This analysis reveals that the formation and recombination of the ion pair occur almost exclusively via the exciplex.

  9. Redox chemistry at liquid/liquid interfaces

    NASA Technical Reports Server (NTRS)

    Volkov, A. G.; Deamer, D. W.

    1997-01-01

    The interface between two immiscible liquids with immobilized photosynthetic pigments can serve as the simplest model of a biological membrane convenient for the investigation of photoprocesses accompanied by spatial separation of charges. As it follows from thermodynamics, if the resolvation energies of substrates and products are very different, the interface between two immiscible liquids may act as a catalyst. Theoretical aspects of charge transfer reactions at oil/water interfaces are discussed. Conditions under which the free energy of activation of the interfacial reaction of electron transfer decreases are established. The activation energy of electron transfer depends on the charges of the reactants and dielectric permittivity of the non-aqueous phase. This can be useful when choosing a pair of immiscible solvents to decrease the activation energy of the reaction in question or to inhibit an undesired process. Experimental interfacial catalytic systems are discussed. Amphiphilic molecules such as chlorophyll or porphyrins were studied as catalysts of electron transfer reactions at the oil/water interface.

  10. Pathways of energy transfer in LHCII revealed by room-temperature 2D electronic spectroscopy.

    PubMed

    Wells, Kym L; Lambrev, Petar H; Zhang, Zhengyang; Garab, Gyözö; Tan, Howe-Siang

    2014-06-21

    We present here the first room-temperature 2D electronic spectroscopy study of energy transfer in the plant light-harvesting complex II, LHCII. Two-dimensional electronic spectroscopy has been used to study energy transfer dynamics in LHCII trimers from the chlorophyll b Qy band to the chlorophyll a Qy band. Observing cross-peak regions corresponding to couplings between different excitonic states reveals partially resolved fine structure at the exciton level that cannot be isolated by pump-probe or linear spectroscopy measurements alone. Global analysis of the data has been performed to identify the pathways and time constants of energy transfer. The measured waiting time (Tw) dependent 2D spectra are found to be composed of 2D decay-associated spectra with three timescales (0.3 ps, 2.3 ps and >20 ps). Direct and multistep cascading pathways from the high-energy chlorophyll b states to the lowest-energy chlorophyll a states have been resolved occurring on time scales of hundreds of femtoseconds to picoseconds.

  11. Spectrophotometric and spectroscopic studies of charge transfer complex of 1-Naphthylamine as an electron donor with picric acid as an electron acceptor in different polar solvents

    NASA Astrophysics Data System (ADS)

    Singh, Neeti; Ahmad, Afaq

    2010-08-01

    The charge transfer complex of 1-Naphthylamine as a donor with π-acceptor picric acid has been studied spectrophotometrically in different solvents at room temperature. The results indicate that the formation of charge transfer complex is high in less polar solvent. The stoichiometry of the complex was found to be 1:1 by straight line method. The data are analysed in terms of formation constant ( KCT), molar extinction coefficient ( ɛCT), standard free energy (Δ G o), oscillator strength ( ƒ), transition dipole moment ( μ EN), resonance energy ( R N) and ionization potential ( I D). It is concluded that the formation constant ( KCT) of the complex is found to be depends upon the nature of both electron acceptor and donor and also on the polarity of solvents. Further the charge transfer molecular complex between picric acid and 1-Naphthylamine is stabilized by hydrogen bonding.

  12. Laser-induced electron dynamics including photoionization: A heuristic model within time-dependent configuration interaction theory.

    PubMed

    Klinkusch, Stefan; Saalfrank, Peter; Klamroth, Tillmann

    2009-09-21

    We report simulations of laser-pulse driven many-electron dynamics by means of a simple, heuristic extension of the time-dependent configuration interaction singles (TD-CIS) approach. The extension allows for the treatment of ionizing states as nonstationary states with a finite, energy-dependent lifetime to account for above-threshold ionization losses in laser-driven many-electron dynamics. The extended TD-CIS method is applied to the following specific examples: (i) state-to-state transitions in the LiCN molecule which correspond to intramolecular charge transfer, (ii) creation of electronic wave packets in LiCN including wave packet analysis by pump-probe spectroscopy, and, finally, (iii) the effect of ionization on the dynamic polarizability of H(2) when calculated nonperturbatively by TD-CIS.

  13. Electronic structural dependence of the photophysical properties of fluorescent heteroditopic ligands - implications in designing molecular fluorescent indicators.

    PubMed

    Younes, Ali H; Zhang, Lu; Clark, Ronald J; Davidson, Michael W; Zhu, Lei

    2010-12-07

    Two fluorescent heteroditopic ligands (2a and 2b) for zinc ion were synthesized and studied. The efficiencies of two photophysical processes, intramolecular charge transfer (ICT) and photoinduced electron transfer (PET), determine the magnitudes of emission bathochromic shift and enhancement, respectively, when a heteroditopic ligand forms mono- or dizinc complexes. The electron-rich 2b is characterized by a high degree of ICT in the excited state with little propensity for PET, which is manifested in a large bathochromic shift of emission upon Zn(2+) coordination without enhancement in fluorescence quantum yield. The electron-poor 2a displays the opposite photophysical consequence where Zn(2+) binding results in greatly enhanced emission without significant spectral shift. The electronic structural effects on the relative efficiencies of ICT and PET in 2a and 2b as well as the impact of Zn(2+)-coordination are probed using experimental and computational approaches. This study reveals that the delicate balance between various photophysical pathways (e.g. ICT and PET) engineered in a heteroditopic ligand is sensitively dependent on the electronic structure of the ligand, i.e. whether the fluorophore is electron-rich or poor, whether it possesses a donor-acceptor type of structure, and where the metal binding occurs.

  14. Oxidation of the FAD cofactor to the 8-formyl-derivative in human electron-transferring flavoprotein

    PubMed Central

    Augustin, Peter; Toplak, Marina; Fuchs, Katharina; Gerstmann, Eva Christine; Prassl, Ruth; Winkler, Andreas; Macheroux, Peter

    2018-01-01

    The heterodimeric human (h) electron-transferring flavoprotein (ETF) transfers electrons from at least 13 different flavin dehydrogenases to the mitochondrial respiratory chain through a non-covalently bound FAD cofactor. Here, we describe the discovery of an irreversible and pH-dependent oxidation of the 8α-methyl group to 8-formyl-FAD (8f-FAD), which represents a unique chemical modification of a flavin cofactor in the human flavoproteome. Furthermore, a set of hETF variants revealed that several conserved amino acid residues in the FAD-binding pocket of electron-transferring flavoproteins are required for the conversion to the formyl group. Two of the variants generated in our study, namely αR249C and αT266M, cause glutaric aciduria type II, a severe inherited disease. Both of the variants showed impaired formation of 8f-FAD shedding new light on the potential molecular cause of disease development. Interestingly, the conversion of FAD to 8f-FAD yields a very stable flavin semiquinone that exhibited slightly lower rates of electron transfer in an artificial assay system than hETF containing FAD. In contrast, the formation of 8f-FAD enhanced the affinity to human dimethylglycine dehydrogenase 5-fold, indicating that formation of 8f-FAD modulates the interaction of hETF with client enzymes in the mitochondrial matrix. Thus, we hypothesize that the FAD cofactor bound to hETF is subject to oxidation in the alkaline (pH 8) environment of the mitochondrial matrix, which may modulate electron transport between client dehydrogenases and the respiratory chain. This discovery challenges the current concepts of electron transfer processes in mitochondria. PMID:29301933

  15. The flash-quench technique in protein-DNA electron transfer: reduction of the guanine radical by ferrocytochrome c.

    PubMed

    Stemp, E D; Barton, J K

    2000-08-21

    Electron transfer from a protein to oxidatively damaged DNA, specifically from ferrocytochrome c to the guanine radical, was examined using the flash-quench technique. Ru(phen)2dppz2+ (dppz = dipyridophenazine) was employed as the photosensitive intercalator, and ferricytochrome c (Fe3+ cyt c), as the oxidative quencher. Using transient absorption and time-resolved luminescence spectroscopies, we examined the electron-transfer reactions following photoexcitation of the ruthenium complex in the presence of poly(dA-dT) or poly(dG-dC). The luminescence-quenching titrations of excited Ru(phen)2dppz2+ by Fe3+ cyt c are nearly identical for the two DNA polymers. However, the spectral characteristics of the long-lived transient produced by the quenching depend strongly upon the DNA. For poly(dA-dT), the transient has a spectrum consistent with formation of a [Ru(phen)2dppz3+, Fe2+ cyt c] intermediate, indicating that the system regenerates itself via electron transfer from the protein to the Ru(III) metallointercalator for this polymer. For poly(dG-dC), however, the transient has the characteristics expected for an intermediate of Fe2+ cyt c and the neutral guanine radical. The characteristics of the transient formed with the GC polymer are consistent with rapid oxidation of guanine by the Ru(III) complex, followed by slow electron transfer from Fe2+ cyt c to the guanine radical. These experiments show that electron holes on DNA can be repaired by protein and demonstrate how the flash-quench technique can be used generally in studying electron transfer from proteins to guanine radicals in duplex DNA.

  16. Design and engineering of a man-made diffusive electron-transport protein

    PubMed Central

    Fry, Bryan A.; Solomon, Lee A.; Dutton, P. Leslie

    2016-01-01

    Maquettes are man-made cofactor-binding oxidoreductases designed from first principles with minimal reference to natural protein sequences. Here we focus on water-soluble maquettes designed and engineered to perform diffusive electron transport of the kind typically carried out by cytochromes, ferredoxins and flavodoxins and other small proteins in photosynthetic and respiratory energy conversion and oxido-reductive metabolism. Our designs were tested by analysis of electron transfer between heme maquettes and the well-known natural electron transporter, cytochrome c. Electron-transfer kinetics were measured from seconds to milliseconds by stopped-flow, while sub-millisecond resolution was achieved through laser photolysis of the carbon monoxide maquette heme complex. These measurements demonstrate electron transfer from the maquette to cytochrome c, reproducing the timescales and charge complementarity modulation observed in natural systems. The ionic strength dependence of inter-protein electron transfer from 9.7 × 106 M−1s−1 to 1.2 × 109 M−1s−1 follows a simple Debye-Hückel model for attraction between +8 net charged oxidized cytochrome c and −19 net charged heme maquette, with no indication of significant protein dipole moment steering. Successfully recreating essential components of energy conversion and downstream metabolism in man-made proteins holds promise for in vivo clinical intervention and for the production of fuel or other industrial products. PMID:26423266

  17. First-principles simulation for strong and ultra-short laser pulse propagation in dielectrics

    NASA Astrophysics Data System (ADS)

    Yabana, K.

    2016-05-01

    We develop a computational approach for interaction between strong laser pulse and dielectrics based on time-dependent density functional theory (TDDFT). In this approach, a key ingredient is a solver to simulate electron dynamics in a unit cell of solids under a time-varying electric field that is a time-dependent extension of the static band calculation. This calculation can be regarded as a constitutive relation, providing macroscopic electric current for a given electric field applied to the medium. Combining the solver with Maxwell equations for electromagnetic fields of the laser pulse, we describe propagation of laser pulses in dielectrics without any empirical parameters. An important output from the coupled Maxwell+TDDFT simulation is the energy transfer from the laser pulse to electrons in the medium. We have found an abrupt increase of the energy transfer at certain laser intensity close to damage threshold. We also estimate damage threshold by comparing the transferred energy with melting and cohesive energies. It shows reasonable agreement with measurements.

  18. Hydrogen-bonding effect on spin-center transfer of tetrathiafulvalene-linked 6-oxophenalenoxyl evaluated using temperature-dependent cyclic voltammetry and theoretical calculations.

    PubMed

    Nishida, Shinsuke; Fukui, Kozo; Morita, Yasushi

    2014-02-01

    The stable tetrathiafulvalene (TTF)-linked 6-oxophenalenoxyl neutral radical exhibits a spin-center transfer with a continuous color change in solution caused by an intramolecular electron transfer, which is dependent on solvent and temperature. Cyclic voltammetry measurements showed that addition of 2,2,2-trifluoroethanol (TFE) to a benzonitrile solution of the neutral radical induces a redox potential shift that is favorable for the spin-center transfer. Temperature-dependent cyclic voltammetry of the neutral radical using a novel low-temperature electrochemical cell demonstrated that the redox potentials change with decreasing temperature in a 199:1 CH2Cl2/TFE mixed solvent. Furthermore, theoretical calculation revealed that the energy levels of the frontier molecular orbitals involved in the spin-center transfer are lowered by the hydrogen-bonding interaction of TFE with the neutral radical. These results indicate that the hydrogen-bonding effect is a key factor for the occurrence of the spin-center transfer of TTF-linked 6-oxophenalenoxyl. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Long-range electron transfer in a model for DNA

    NASA Astrophysics Data System (ADS)

    Endres, R. G.; Cox, D. L.

    2001-03-01

    Long-range electron transfer (ET) between well separated donor (D) and acceptor (A) sites through quantum mechanical tunneling is essential to many biological processes like respiration, photosynthesis and possibly DNA repair and damage. We are investigating the distance dependence of the electronic transition matrix element H_DA and hence of the electron transfer rate in a model for DNA. Fluorescence quenching in DNA at D-A distances of 40 Åand more suggests ET with an unusually high decay length β-1 of order 10 Å (S.O.Kelley and J.K.Barton, in:Metal Ions in Biological Systems), A.Sigel and H.Sigel, Eds., Marcel Dekker, New York, Vol.36, 1999. Assuming strong electron interactions on the D complex and suitable energetics, this could be explained by formation of a many electron Kondo boundstate. We obtain H_DA from the splitting between the two lowest adiabatic electronic eigenenergies, which constitute the potential energy surfaces (PES) of the nuclear motion in lowest order Born-Oppenheimer approximation. The PES are constructed by coupling D and A to local breathing modes and by making a semi-analytical variational ansatz for the adiabatic eigenstates. The results from the PES are compared with results from the Mulliken-Hush algorithm.

  20. A molecularly based theory for electron transfer reorganization energy.

    PubMed

    Zhuang, Bilin; Wang, Zhen-Gang

    2015-12-14

    Using field-theoretic techniques, we develop a molecularly based dipolar self-consistent-field theory (DSCFT) for charge solvation in pure solvents under equilibrium and nonequilibrium conditions and apply it to the reorganization energy of electron transfer reactions. The DSCFT uses a set of molecular parameters, such as the solvent molecule's permanent dipole moment and polarizability, thus avoiding approximations that are inherent in treating the solvent as a linear dielectric medium. A simple, analytical expression for the free energy is obtained in terms of the equilibrium and nonequilibrium electrostatic potential profiles and electric susceptibilities, which are obtained by solving a set of self-consistent equations. With no adjustable parameters, the DSCFT predicts activation energies and reorganization energies in good agreement with previous experiments and calculations for the electron transfer between metallic ions. Because the DSCFT is able to describe the properties of the solvent in the immediate vicinity of the charges, it is unnecessary to distinguish between the inner-sphere and outer-sphere solvent molecules in the calculation of the reorganization energy as in previous work. Furthermore, examining the nonequilibrium free energy surfaces of electron transfer, we find that the nonequilibrium free energy is well approximated by a double parabola for self-exchange reactions, but the curvature of the nonequilibrium free energy surface depends on the charges of the electron-transferring species, contrary to the prediction by the linear dielectric theory.

  1. Effect of Molecular Coupling on Ultrafast Electron-Transfer and Charge-Recombination Dynamics in a Wide-Gap ZnS Nanoaggregate Sensitized by Triphenyl Methane Dyes.

    PubMed

    Debnath, Tushar; Maity, Partha; Dana, Jayanta; Ghosh, Hirendra N

    2016-03-03

    Wide-band-gap ZnS nanocrystals (NCs) were synthesized, and after sensitizing the NCs with series of triphenyl methane (TPM) dyes, ultrafast charge-transfer dynamics was demonstrated. HRTEM images of ZnS NCs show the formation of aggregate crystals with a flower-like structure. Exciton absorption and lumimescence, due to quantum confinement of the ZnS NCs, appear at approximately 310 and 340 nm, respectively. Interestingly, all the TPM dyes (pyrogallol red, bromopyrogallol red, and aurin tricarboxylic acid) form charge-transfer complexes with the ZnS NCs, with the appearance of a red-shifted band. Electron injection from the photoexcited TPM dyes into the conduction band of the ZnS NCs is shown to be a thermodynamically viable process, as confirmed by steady-state and time-resolved emission studies. To unravel charge-transfer (both electron injection and charge recombination) dynamics and the effect of molecular coupling, femtosecond transient absorption studies were carried out in TPM-sensitized ZnS NCs. The electron-injection dynamics is pulse-width-limited in all the ZnS/TPM dye systems, however, the back electron transfer differs, depending on the molecular coupling of the sensitizers (TPM dyes). The detailed mechanisms for the above-mentioned processes are discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Four-electron model for singlet and triplet excitation energy transfers with inclusion of coherence memory, inelastic tunneling and nuclear quantum effects

    NASA Astrophysics Data System (ADS)

    Suzuki, Yosuke; Ebina, Kuniyoshi; Tanaka, Shigenori

    2016-08-01

    A computational scheme to describe the coherent dynamics of excitation energy transfer (EET) in molecular systems is proposed on the basis of generalized master equations with memory kernels. This formalism takes into account those physical effects in electron-bath coupling system such as the spin symmetry of excitons, the inelastic electron tunneling and the quantum features of nuclear motions, thus providing a theoretical framework to perform an ab initio description of EET through molecular simulations for evaluating the spectral density and the temporal correlation function of electronic coupling. Some test calculations have then been carried out to investigate the dependence of exciton population dynamics on coherence memory, inelastic tunneling correlation time, magnitude of electronic coupling, quantum correction to temporal correlation function, reorganization energy and energy gap.

  3. Mechanically Controlled Electron Transfer in a Single-Polypeptide Transistor

    NASA Astrophysics Data System (ADS)

    Sheu, Sheh-Yi; Yang, Dah-Yen

    2017-01-01

    Proteins are of interest in nano-bio electronic devices due to their versatile structures, exquisite functionality and specificity. However, quantum transport measurements produce conflicting results due to technical limitations whereby it is difficult to precisely determine molecular orientation, the nature of the moieties, the presence of the surroundings and the temperature; in such circumstances a better understanding of the protein electron transfer (ET) pathway and the mechanism remains a considerable challenge. Here, we report an approach to mechanically drive polypeptide flip-flop motion to achieve a logic gate with ON and OFF states during protein ET. We have calculated the transmission spectra of the peptide-based molecular junctions and observed the hallmarks of electrical current and conductance. The results indicate that peptide ET follows an NC asymmetric process and depends on the amino acid chirality and α-helical handedness. Electron transmission decreases as the number of water molecules increases, and the ET efficiency and its pathway depend on the type of water-bridged H-bonds. Our results provide a rational mechanism for peptide ET and new perspectives on polypeptides as potential candidates in logic nano devices.

  4. Graphene-ferromagnet interfaces: hybridization, magnetization and charge transfer.

    PubMed

    Abtew, Tesfaye; Shih, Bi-Ching; Banerjee, Sarbajit; Zhang, Peihong

    2013-03-07

    Electronic and magnetic properties of graphene-ferromagnet interfaces are investigated using first-principles electronic structure methods in which a single layer graphene is adsorbed on Ni(111) and Co(111) surfaces. Due to the symmetry matching and orbital overlap, the hybridization between graphene pπ and Ni (or Co) d(z(2)) states is very strong. This pd hybridization, which is both spin and k dependent, greatly affects the electronic and magnetic properties of the interface, resulting in a significantly reduced (by about 20% for Ni and 10% for Co) local magnetic moment of the top ferromagnetic layer at the interface and an induced spin polarization on the graphene layer. The calculated induced magnetic moment on the graphene layer agrees well with a recent experiment. In addition, a substantial charge transfer across the graphene-ferromagnet interfaces is observed. We also investigate the effects of thickness of the ferromagnet slab on the calculated electronic and magnetic properties of the interface. The strength of the pd hybridization and the thickness-dependent interfacial properties may be exploited to design structures with desirable magnetic and transport properties for spintronic applications.

  5. Triple differential cross section measurements for the outer valence molecular orbitals (1t2) of a methane molecule at 250 eV electron impact

    NASA Astrophysics Data System (ADS)

    Işık, N.; Doğan, M.; Bahçeli, S.

    2016-03-01

    In this study, detailed experimental research of triple differential cross section (TDCS) measurements is performed to investigate single ionization dynamics for the 1t2 orbital of methane molecule by 250 eV electron impact. In our experiments, the outgoing electrons are simultaneously measured in coincidence in a coplanar asymmetric geometry with the scattering angles of 10° and 20°. Therefore, TDCS measurements are performed for two different values of momentum transfer (K ≈ 0.9 au and 1.5 au). A detailed analysis of the dependence of the TDCS versus the momentum transfer is reported here.

  6. Covalent electron transfer chemistry of graphene with diazonium salts.

    PubMed

    Paulus, Geraldine L C; Wang, Qing Hua; Strano, Michael S

    2013-01-15

    Graphene is an atomically thin, two-dimensional allotrope of carbon with exceptionally high carrier mobilities, thermal conductivity, and mechanical strength. From a chemist's perspective, graphene can be regarded as a large polycyclic aromatic molecule and as a surface without a bulk contribution. Consequently, chemistries typically performed on organic molecules and surfaces have been used as starting points for the chemical functionalization of graphene. The motivations for chemical modification of graphene include changing its doping level, opening an electronic band gap, charge storage, chemical and biological sensing, making new composite materials, and the scale-up of solution-processable graphene. In this Account, we focus on graphene functionalization via electron transfer chemistries, in particular via reactions with aryl diazonium salts. Because electron transfer chemistries depend on the Fermi energy of graphene and the density of states of the reagents, the resulting reaction rate depends on the number of graphene layers, edge states, defects, atomic structure, and the electrostatic environment. We limit our Account to focus on pristine graphene over graphene oxide, because free electrons in the latter are already bound to oxygen-containing functionalities and the resulting chemistries are dominated by localized reactivity and defects. We describe the reaction mechanism of diazonium functionalization of graphene and show that the reaction conditions determine the relative degrees of chemisorption and physisorption, which allows for controlled modulation of the electronic properties of graphene. Finally we discuss different applications for graphene modified by this chemistry, including as an additive in polymer matrices, as biosensors when coupled with cells and biomolecules, and as catalysts when combined with nanoparticles.

  7. Electron transfer of quinone self-assembled monolayers on a gold electrode.

    PubMed

    Nagata, Morio; Kondo, Masaharu; Suemori, Yoshiharu; Ochiai, Tsuyoshi; Dewa, Takehisa; Ohtsuka, Toshiaki; Nango, Mamoru

    2008-06-15

    Dialkyl disulfide-linked naphthoquinone, (NQ-Cn-S)2, and anthraquinone, (AQ-Cn-S)2, derivatives with different spacer alkyl chains (Cn: n=2, 6, 12) were synthesized and these quinone derivatives were self-assembled on a gold electrode. The formation of self-assembled monolayers (SAMs) of these derivatives on a gold electrode was confirmed by infrared reflection-absorption spectroscopy (IR-RAS). Electron transfer between the derivatives and the gold electrode was studied by cyclic voltammetry. On the cyclic voltammogram a reversible redox reaction between quinone (Q) and hydroquinone (QH2) was clearly observed under an aqueous condition. The formal potentials for NQ and AQ derivatives were -0.48 and -0.58 V, respectively, that did not depend on the spacer length. The oxidation and reduction peak currents were strongly dependent on the spacer alkyl chain length. The redox behavior of quinone derivatives depended on the pH condition of the buffer solution. The pH dependence was in agreement with a theoretical value of E 1/2 (mV)=E'-59pH for 2H+/2e(-) process in the pH range 3-11. In the range higher than pH 11, the value was estimated with E 1/2 (mV)=E'-30pH , which may correspond to H+/2e(-) process. The tunneling barrier coefficients (beta) for NQ and AQ SAMs were determined to be 0.12 and 0.73 per methylene group (CH2), respectively. Comparison of the structures and the alkyl chain length of quinones derivatives on these electron transfers on the electrode is made.

  8. Cysteine-Accelerated Methanogenic Propionate Degradation in Paddy Soil Enrichment.

    PubMed

    Zhuang, Li; Ma, Jinlian; Tang, Jia; Tang, Ziyang; Zhou, Shungui

    2017-05-01

    Propionate degradation is a critical step during the conversion of complex organic matter under methanogenic conditions, and it requires a syntrophic cooperation between propionate-oxidizing bacteria and methanogenic archaea. Increasing evidences suggest that interspecies electron transfer for syntrophic metabolism is not limited to the reducing equivalents of hydrogen and formate. This study tested the ability of an electron shuttle to mediate interspecies electron transfer in syntrophic methanogenesis. We found that cysteine supplementation (100, 400, and 800 μM) accelerated CH 4 production from propionate in paddy soil enrichments. Of the concentrations tested, 100 μM cysteine was the most effective at enhancing propionate degradation to CH 4 , and the rates of CH 4 production and propionate degradation were increased by 109 and 79%, respectively, compared with the cysteine-free control incubations. We eliminated the possibility that the stimulatory effect of cysteine on methanogenesis was attributable to the function of cysteine as a methanogenic substrate in the presence of propionate. The potential catalytic effect involved cysteine serving as an electron carrier to mediate interspecies electron transfer in syntrophic propionate oxidization. The redox potential of cystine/cysteine, which is dependent on the concentration, might be more suitable to facilitate interspecies electron transfer between syntrophic partners at a concentration of 100 μM. Pelotomaculum, obligately syntrophic, propionate-oxidizing bacteria, and hydrogenotrophic methanogens of the family Methanobacteriaceae are predominant in cysteine-mediated methanogenic propionate degradation. The stimulatory effect of cysteine on syntrophic methanogenesis offers remarkable potential for improving the performance of anaerobic digestion and conceptually broaden strategies for interspecies electron transfer in syntrophic metabolism.

  9. The dipole moment of the electron carrier adrenodoxin is not critical for redox partner interaction and electron transfer.

    PubMed

    Hannemann, Frank; Guyot, Arnaud; Zöllner, Andy; Müller, Jürgen J; Heinemann, Udo; Bernhardt, Rita

    2009-07-01

    Dipole moments of proteins arise from helical dipoles, hydrogen bond networks and charged groups at the protein surface. High protein dipole moments were suggested to contribute to the electrostatic steering between redox partners in electron transport chains of respiration, photosynthesis and steroid biosynthesis, although so far experimental evidence for this hypothesis was missing. In order to probe this assumption, we changed the dipole moment of the electron transfer protein adrenodoxin and investigated the influence of this on protein-protein interactions and electron transfer. In bovine adrenodoxin, the [2Fe-2S] ferredoxin of the adrenal glands, a dipole moment of 803 Debye was calculated for a full-length adrenodoxin model based on the Adx(4-108) and the wild type adrenodoxin crystal structures. Large distances and asymmetric distribution of the charged residues in the molecule mainly determine the observed high value. In order to analyse the influence of the resulting inhomogeneous electric field on the biological function of this electron carrier the molecular dipole moment was systematically changed. Five recombinant adrenodoxin mutants with successively reduced dipole moment (from 600 to 200 Debye) were analysed for their redox properties, their binding affinities to the redox partner proteins and for their function during electron transfer-dependent steroid hydroxylation. None of the mutants, not even the quadruple mutant K6E/K22Q/K24Q/K98E with a dipole moment reduced by about 70% showed significant changes in the protein function as compared with the unmodified adrenodoxin demonstrating that neither the formation of the transient complex nor the biological activity of the electron transfer chain of the endocrine glands was affected. This is the first experimental evidence that the high dipole moment observed in electron transfer proteins is not involved in electrostatic steering among the proteins in the redox chain.

  10. Charge-transfer mobility and electrical conductivity of PANI as conjugated organic semiconductors

    NASA Astrophysics Data System (ADS)

    Zhang, Yahong; Duan, Yuping; Song, Lulu; Zheng, Daoyuan; Zhang, Mingxing; Zhao, Guangjiu

    2017-09-01

    The intramolecular charge transfer properties of a phenyl-end-capped aniline tetramer (ANIH) and a chloro-substituted derivative (ANICl) as organic semiconductors were theoretically studied through the first-principles calculation based on the Marcus-Hush theory. The reorganization energies, intermolecular electronic couplings, angular resolution anisotropic mobilities, and density of states of the two crystals were evaluated. The calculated results demonstrate that both ANIH and ANICl crystals show the higher electron transfer mobilities than the hole-transfer mobilities, which means that the two crystals should prefer to function as n-type organic semiconductors. Furthermore, the angle dependence mobilities of the two crystals show remarkable anisotropic character. The maximum mobility μmax of ANIH and ANICl crystals is 1.3893 and 0.0272 cm2 V-1 s-1, which appear at the orientation angles near 176°/356° and 119°/299° of a conducting channel on the a-b reference plane. It is synthetically evaluated that the ANIH crystal possesses relatively lower reorganization energy, higher electronic coupling, and electron transfer mobility, which means that the ANIH crystal may be the more ideal candidate as a high performance n-type organic semiconductor material. The systematic theoretical studies on organic crystals should be conducive to evaluating the charge-transport properties and designing higher performance organic semiconductor materials.

  11. Charge-transfer mobility and electrical conductivity of PANI as conjugated organic semiconductors.

    PubMed

    Zhang, Yahong; Duan, Yuping; Song, Lulu; Zheng, Daoyuan; Zhang, Mingxing; Zhao, Guangjiu

    2017-09-21

    The intramolecular charge transfer properties of a phenyl-end-capped aniline tetramer (ANIH) and a chloro-substituted derivative (ANICl) as organic semiconductors were theoretically studied through the first-principles calculation based on the Marcus-Hush theory. The reorganization energies, intermolecular electronic couplings, angular resolution anisotropic mobilities, and density of states of the two crystals were evaluated. The calculated results demonstrate that both ANIH and ANICl crystals show the higher electron transfer mobilities than the hole-transfer mobilities, which means that the two crystals should prefer to function as n-type organic semiconductors. Furthermore, the angle dependence mobilities of the two crystals show remarkable anisotropic character. The maximum mobility μ max of ANIH and ANICl crystals is 1.3893 and 0.0272 cm 2 V -1 s -1 , which appear at the orientation angles near 176°/356° and 119°/299° of a conducting channel on the a-b reference plane. It is synthetically evaluated that the ANIH crystal possesses relatively lower reorganization energy, higher electronic coupling, and electron transfer mobility, which means that the ANIH crystal may be the more ideal candidate as a high performance n-type organic semiconductor material. The systematic theoretical studies on organic crystals should be conducive to evaluating the charge-transport properties and designing higher performance organic semiconductor materials.

  12. Crystal Structure and Catalytic Mechanism of 7-Hydroxymethyl Chlorophyll a Reductase*

    PubMed Central

    Wang, Xiao; Liu, Lin

    2016-01-01

    7-Hydroxymethyl chlorophyll a reductase (HCAR) catalyzes the second half-reaction in chlorophyll b to chlorophyll a conversion. HCAR is required for the degradation of light-harvesting complexes and is necessary for efficient photosynthesis by balancing the chlorophyll a/b ratio. Reduction of the hydroxymethyl group uses redox cofactors [4Fe-4S] cluster and FAD to transfer electrons and is difficult because of the strong carbon-oxygen bond. Here, we report the crystal structure of Arabidopsis HCAR at 2.7-Å resolution and reveal that two [4Fe-4S]clusters and one FAD within a very short distance form a consecutive electron pathway to the substrate pocket. In vitro kinetic analysis confirms the ferredoxin-dependent electron transport chain, thus supporting a proton-activated electron transfer mechanism. HCAR resembles a partial reconstruction of an archaeal F420-reducing [NiFe] hydrogenase, which suggests a common mode of efficient proton-coupled electron transfer through conserved cofactor arrangements. Furthermore, the trimeric form of HCAR provides a biological clue of its interaction with light-harvesting complex II. PMID:27072131

  13. Activation Thermodynamics and H/D Kinetic Isotope Effect of the H ox to H red H + Transition in [FeFe] Hydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ratzloff, Michael W.; Wilker, Molly B.; Mulder, David W.

    Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here in this paper we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox→H redH + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ~2.5-foldmore » kinetic isotope effect. Overall these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox→H redH + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.« less

  14. Activation Thermodynamics and H/D Kinetic Isotope Effect of the H ox to H red H + Transition in [FeFe] Hydrogenase

    DOE PAGES

    Ratzloff, Michael W.; Wilker, Molly B.; Mulder, David W.; ...

    2017-08-29

    Molecular complexes between CdSe nanocrystals and Clostridium acetobutylicum [FeFe] hydrogenase I (CaI) enabled light-driven control of electron transfer for spectroscopic detection of redox intermediates during catalytic proton reduction. Here in this paper we address the route of electron transfer from CdSe→CaI and activation thermodynamics of the initial step of proton reduction in CaI. The electron paramagnetic spectroscopy of illuminated CdSe:CaI showed how the CaI accessory FeS cluster chain (F-clusters) functions in electron transfer with CdSe. The H ox→H redH + reduction step measured by Fourier-transform infrared spectroscopy showed an enthalpy of activation of 19 kJ mol -1 and a ~2.5-foldmore » kinetic isotope effect. Overall these results support electron injection from CdSe into CaI involving F-clusters, and that the H ox→H redH + step of catalytic proton reduction in CaI proceeds by a proton-dependent process.« less

  15. Insights into electron flux through manipulation of fermentation conditions and assessment of protein expression profiles in Clostridium thermocellum.

    PubMed

    Rydzak, Thomas; Grigoryan, Marina; Cunningham, Zack J; Krokhin, Oleg V; Ezzati, Peyman; Cicek, Nazim; Levin, David B; Wilkins, John A; Sparling, Richard

    2014-01-01

    While annotation of the genome sequence of Clostridium thermocellum has allowed predictions of pathways catabolizing cellobiose to end products, ambiguities have persisted with respect to the role of various proteins involved in electron transfer reactions. A combination of growth studies modulating carbon and electron flow and multiple reaction monitoring (MRM) mass spectrometry measurements of proteins involved in central metabolism and electron transfer was used to determine the key enzymes involved in channeling electrons toward fermentation end products. Specifically, peptides belonging to subunits of ferredoxin-dependent hydrogenase and NADH:ferredoxin oxidoreductase (NFOR) were low or below MRM detection limits when compared to most central metabolic proteins measured. The significant increase in H2 versus ethanol synthesis in response to either co-metabolism of pyruvate and cellobiose or hypophosphite mediated pyruvate:formate lyase inhibition, in conjunction with low levels of ferredoxin-dependent hydrogenase and NFOR, suggest that highly expressed putative bifurcating hydrogenases play a substantial role in reoxidizing both reduced ferredoxin and NADH simultaneously. However, product balances also suggest that some of the additional reduced ferredoxin generated through increased flux through pyruvate:ferredoxin oxidoreductase must be ultimately converted into NAD(P)H either directly via NADH-dependent reduced ferredoxin:NADP(+) oxidoreductase (NfnAB) or indirectly via NADPH-dependent hydrogenase. While inhibition of hydrogenases with carbon monoxide decreased H2 production 6-fold and redirected flux from pyruvate:ferredoxin oxidoreductase to pyruvate:formate lyase, the decrease in CO2 was only 20 % of that of the decrease in H2, further suggesting that an alternative redox system coupling ferredoxin and NAD(P)H is active in C. thermocellum in lieu of poorly expressed ferredoxin-dependent hydrogenase and NFOR.

  16. Electric-field-driven electron-transfer in mixed-valence molecules.

    PubMed

    Blair, Enrique P; Corcelli, Steven A; Lent, Craig S

    2016-07-07

    Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate the electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.

  17. Optical properties, excitation energy and primary charge transfer in photosystem II: theory meets experiment.

    PubMed

    Renger, Thomas; Schlodder, Eberhard

    2011-01-01

    In this review we discuss structure-function relationships of the core complex of photosystem II, as uncovered from analysis of optical spectra of the complex and its subunits. Based on descriptions of optical difference spectra including site directed mutagenesis we propose a revision of the multimer model of the symmetrically arranged reaction center pigments, described by an asymmetric exciton Hamiltonian. Evidence is provided for the location of the triplet state, the identity of the primary electron donor, the localization of the cation and the secondary electron transfer pathway in the reaction center. We also discuss the stationary and time-dependent optical properties of the CP43 and CP47 subunits and the excitation energy transfer and trapping-by-charge-transfer kinetics in the core complex. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Electronic Delocalization, Vibrational Dynamics and Energy Transfer in Organic Chromophores

    DOE PAGES

    Nelson, Tammie Renee; Fernandez Alberti, Sebastian; Roitberg, Adrian; ...

    2017-06-12

    The efficiency of materials developed for solar energy and technological applications depends on the interplay between molecular architecture and light-induced electronic energy redistribution. The spatial localization of electronic excitations is very sensitive to molecular distortions. Vibrational nuclear motions can couple to electronic dynamics driving changes in localization. The electronic energy transfer among multiple chromophores arises from several distinct mechanisms that can give rise to experimentally measured signals. Atomistic simulations of coupled electron-vibrational dynamics can help uncover the nuclear motions directing energy flow. Through careful analysis of excited state wave function evolution and a useful fragmenting of multichromophore systems, through-bond transportmore » and exciton hopping (through-space) mechanisms can be distinguished. Such insights are crucial in the interpretation of fluorescence anisotropy measurements and can aid materials design. Finally, this Perspective highlights the interconnected vibrational and electronic motions at the foundation of nonadiabatic dynamics where nuclear motions, including torsional rotations and bond vibrations, drive electronic transitions.« less

  19. The nitric-oxide reductase from Paracoccus denitrificans uses a single specific proton pathway.

    PubMed

    ter Beek, Josy; Krause, Nils; Reimann, Joachim; Lachmann, Peter; Ädelroth, Pia

    2013-10-18

    The NO reductase from Paracoccus denitrificans reduces NO to N2O (2NO + 2H(+) + 2e(-) → N2O + H2O) with electrons donated by periplasmic cytochrome c (cytochrome c-dependent NO reductase; cNOR). cNORs are members of the heme-copper oxidase superfamily of integral membrane proteins, comprising the O2-reducing, proton-pumping respiratory enzymes. In contrast, although NO reduction is as exergonic as O2 reduction, there are no protons pumped in cNOR, and in addition, protons needed for NO reduction are derived from the periplasmic solution (no contribution to the electrochemical gradient is made). cNOR thus only needs to transport protons from the periplasm into the active site without the requirement to control the timing of opening and closing (gating) of proton pathways as is needed in a proton pump. Based on the crystal structure of a closely related cNOR and molecular dynamics simulations, several proton transfer pathways were suggested, and in principle, these could all be functional. In this work, we show that residues in one of the suggested pathways (denoted pathway 1) are sensitive to site-directed mutation, whereas residues in the other proposed pathways (pathways 2 and 3) could be exchanged without severe effects on turnover activity with either NO or O2. We further show that electron transfer during single-turnover reduction of O2 is limited by proton transfer and can thus be used to study alterations in proton transfer rates. The exchange of residues along pathway 1 showed specific slowing of this proton-coupled electron transfer as well as changes in its pH dependence. Our results indicate that only pathway 1 is used to transfer protons in cNOR.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eich, F. G.; Agostini, Federica, E-mail: agostini@mpi-halle.mpg.de

    We propose a procedure to analyze the relation between the exact factorization of the electron-nuclear wave function and the Born-Oppenheimer approximation. We define the adiabatic limit as the limit of infinite nuclear mass. To this end, we introduce a unit system that singles out the dependence on the electron-nuclear mass ratio of each term appearing in the equations of the exact factorization. We observe how non-adiabatic effects induced by the coupling to the nuclear motion affect electronic properties and we analyze the leading term, connecting it to the classical nuclear momentum. Its dependence on the mass ratio is tested numericallymore » on a model of proton-coupled electron transfer in different non-adiabatic regimes.« less

  1. Selectivity of photoelectrochemical CO2 reduction modulated with electron transfer from size-tunable quantized energy states of CdSe nanocrystals

    NASA Astrophysics Data System (ADS)

    Cho, Hyunjin; Kim, Whi Dong; Lee, Kangha; Lee, Seokwon; Kang, Gil-Seong; Joh, Han-Ik; Lee, Doh C.

    2018-01-01

    We investigate the product selectivity of CO2 reduction using NiO photocathodes decorated with CdSe quantum dots (QDs) of varying size in a photoelectrochemical (PEC) cell. Size-tunable and quantized energy states of conduction band in CdSe QDs enable systematic control of electron transfer kinetics from CdSe QDs to NiO. It turns out that different size of CdSe QDs results in variation in product selectivity for CO2 reduction. The energy gap between conduction band edge and redox potential of each reduction product (e.g., CO and CH4) correlates with their production rate. The size dependence of the electron transfer rate estimated from the energy gap is in agreement with the selectivity of CO2 reduction products for all reduction products but CO. The deviation in the case of CO is attributed to sequential conversion of CO into CH4 with CO adsorbed on electrode surface. Based on a premise that the CdSe QDs would exhibit similar surface configuration regardless of QD size, it is concluded that the electron transfer kinetics proves to alter the selectivity of CO2 reduction.

  2. Redox reaction characteristics of riboflavin: a fluorescence spectroelectrochemical analysis and density functional theory calculation.

    PubMed

    Chen, Wei; Chen, Jie-Jie; Lu, Rui; Qian, Chen; Li, Wen-Wei; Yu, Han-Qing

    2014-08-01

    Riboflavin (RF), the primary redox active component of flavin, is involved in many redox processes in biogeochemical systems. Despite of its wide distribution and important roles in environmental remediation, its redox behaviors and reaction mechanisms in hydrophobic sites remain unclear yet. In this study, spectroelectrochemical analysis and density functional theory (DFT) calculation were integrated to explore the redox behaviors of RF in dimethyl sulfoxide (DMSO), which was used to create a hydrophobic environment. Specifically, cyclic voltafluorometry (CVF) and derivative cyclic voltafluorometry (DCVF) were employed to track the RF concentration changing profiles. It was found that the reduction contained a series of proton-coupled electron transfers dependent of potential driving force. In addition to the electron transfer-chemical reaction-electron transfer process, a disproportionation (DISP1) process was also identified to be involved in the reduction. The redox potential and free energy of each step obtained from the DFT calculations further confirmed the mechanisms proposed based on the experimental results. The combination of experimental and theoretical approaches yields a deep insight into the characteristics of RF in environmental remediation and better understanding about the proton-coupled electron transfer mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. How the oxygen tolerance of a [NiFe]-hydrogenase depends on quaternary structure.

    PubMed

    Wulff, Philip; Thomas, Claudia; Sargent, Frank; Armstrong, Fraser A

    2016-03-01

    'Oxygen-tolerant' [NiFe]-hydrogenases can catalyze H2 oxidation under aerobic conditions, avoiding oxygenation and destruction of the active site. In one mechanism accounting for this special property, membrane-bound [NiFe]-hydrogenases accommodate a pool of electrons that allows an O2 molecule attacking the active site to be converted rapidly to harmless water. An important advantage may stem from having a dimeric or higher-order quaternary structure in which the electron-transfer relay chain of one partner is electronically coupled to that in the other. Hydrogenase-1 from E. coli has a dimeric structure in which the distal [4Fe-4S] clusters in each monomer are located approximately 12 Å apart, a distance conducive to fast electron tunneling. Such an arrangement can ensure that electrons from H2 oxidation released at the active site of one partner are immediately transferred to its counterpart when an O2 molecule attacks. This paper addresses the role of long-range, inter-domain electron transfer in the mechanism of O2-tolerance by comparing the properties of monomeric and dimeric forms of Hydrogenase-1. The results reveal a further interesting advantage that quaternary structure affords to proteins.

  4. Electron transfer and atom exchange between aqueous Fe(II) and structural Fe(III) in clays. Role in U and Hg(II) transformations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scherer, Michelle

    2016-08-31

    During this project, we investigated Fe electron transfer and atom exchange between aqueous Fe(II) and structural Fe(III) in clay minerals. We used selective chemical extractions, enriched Fe isotope tracer experiments, computational molecular modeling, and Mössbauer spectroscopy. Our findings indicate that structural Fe(III) in clay minerals is reduced by aqueous Fe(II) and that electron transfer occurs when Fe(II) is sorbed to either basal planes and edge OH-groups of clay mineral. Findings from highly enriched isotope experiments suggest that up to 30 % of the Fe atoms in the structure of some clay minerals exhanges with aqueous Fe(II). First principles calculations usingmore » a small polaron hopping approach suggest surprisingly fast electron mobility at room temperature in a nontronite clay mineral and are consistent with temperature dependent Mössbauer data Fast electron mobility suggests that electrons may be able to conduct through the mineral fast enough to enable exchange of Fe between the aqueous phase and clay mineral structure. over the time periods we observed. Our findings suggest that Fe in clay minerals is not as stable as previously thought.« less

  5. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  6. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE PAGES

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

    2016-09-09

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  7. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  8. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

    PubMed

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

    2016-10-11

    In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

  9. Nanoscale inhomogeneity and photoacid generation dynamics in extreme ultraviolet resist materials

    NASA Astrophysics Data System (ADS)

    Wu, Ping-Jui; Wang, Yu-Fu; Chen, Wei-Chi; Wang, Chien-Wei; Cheng, Joy; Chang, Vencent; Chang, Ching-Yu; Lin, John; Cheng, Yuan-Chung

    2018-03-01

    The development of extreme ultraviolet (EUV) lithography towards the 22 nm node and beyond depends critically on the availability of resist materials that meet stringent control requirements in resolution, line edge roughness, and sensitivity. However, the molecular mechanisms that govern the structure-function relationships in current EUV resist systems are not well understood. In particular, the nanoscale structures of the polymer base and the distributions of photoacid generators (PAGs) should play a critical roles in the performance of a resist system, yet currently available models for photochemical reactions in EUV resist systems are exclusively based on homogeneous bulk models that ignore molecular-level details of solid resist films. In this work, we investigate how microscopic molecular organizations in EUV resist affect photoacid generations in a bottom-up approach that describes structure-dependent electron-transfer dynamics in a solid film model. To this end, molecular dynamics simulations and stimulated annealing are used to obtain structures of a large simulation box containing poly(4-hydroxystyrene) (PHS) base polymers and triphenylsulfonium based PAGs. Our calculations reveal that ion-pair interactions govern the microscopic distributions of the polymer base and PAG molecules, resulting in a highly inhomogeneous system with nonuniform nanoscale chemical domains. Furthermore, the theoretical structures were used in combination of quantum chemical calculations and the Marcus theory to evaluate electron transfer rates between molecular sites, and then kinetic Monte Carlo simulations were carried out to model electron transfer dynamics with molecular structure details taken into consideration. As a result, the portion of thermalized electrons that are absorbed by the PAGs and the nanoscale spatial distribution of generated acids can be estimated. Our data reveal that the nanoscale inhomogeneous distributions of base polymers and PAGs strongly affect the electron transfer and the performance of the resist system. The implications to the performances of EUV resists and key engineering requirements for improved resist systems will also be discussed in this work. Our results shed light on the fundamental structure dependence of photoacid generation and the control of the nanoscale structures as well as base polymer-PAG interactions in EVU resist systems, and we expect these knowledge will be useful for the future development of improved EUV resist systems.

  10. Experimental studies of fundamental issues in electron transfer through nanometer scale devices

    NASA Astrophysics Data System (ADS)

    Yamamoto, Hiromichi

    Electron transfer reactions constitute many of the primary events in materials science, chemistry, physics, and biochemistry, e.g. the electron transport properties and photoexcited processes in solids and molecules, chemical reactions, corrosion, photosynthesis, respiration, and so forth. A self-assembled monolayer (SAM) film provides us with a unique environment not only to understand and manipulate the surface electronic properties of a solid, but also to control electron transfer processes at the interface. The first topic in this thesis describes the structure and electron tunneling characterization of alkanethiol SAMs on InP(100). Angle-resolved X-ray photoelectron spectroscopy was used to characterize the bonding of alkanethiols to n-InP surfaces and to measure the monolayer thickness. The results showed that the sulfur binds to In atoms on the surface, and provided film thicknesses of 6.4 A for C8H17SH, 11.1 A for C12H25SH, and 14.9 A for C16H 33SH, resulting in an average tilt angle of 55°. The analysis indicated that super-exchange coupling between the alkane chains plays an important role in defining electron tunneling barriers, especially for highly tilted chains. The second topic describes studies of cytochrome c bound to pure and mixed SAMs of o-terminated alkanethiol (terminated with pyridine, imidazole or nitrile groups) and alkanethiol on gold. Electrochemical methods are used to determine electron transfer rate constants of cytochrome c, and scanning tunneling microscopy to observe the cytochrome c on the SAM. Detailed analysis revealed direct association of the heme of cytochrome c with the terminal groups of the SAMs and a 'turning-over' of the electron transfer of cytochrome c from adiabatic to non-adiabatic regime. The third topic describes studies of oxidation and reduction of cytochrome c in solution through eleven different self-assembled monolayers (SAMs) on gold electrodes by cyclic voltammetry. Electron transfer rate constants of cytochrome c through the eleven SAMs ranged from ≤10-4 to ˜10-1 cm/sec. A strong correlation between the electron transfer rate constants and the hydrogen bonding ability of the SAM is identified. This correlation is discussed in terms of the dependence of the rate constant on the outer-sphere reorganization energy and the electronic coupling between the cytochrome and the differently terminated monolayer films.

  11. Fragment-orbital tunneling currents and electronic couplings for analysis of molecular charge-transfer systems.

    PubMed

    Hwang, Sang-Yeon; Kim, Jaewook; Kim, Woo Youn

    2018-04-04

    In theoretical charge-transfer research, calculation of the electronic coupling element is crucial for examining the degree of the electronic donor-acceptor interaction. The tunneling current (TC), representing the magnitudes and directions of electron flow, provides a way of evaluating electronic couplings, along with the ability of visualizing how electrons flow in systems. Here, we applied the TC theory to π-conjugated organic dimer systems, in the form of our fragment-orbital tunneling current (FOTC) method, which uses the frontier molecular-orbitals of system fragments as diabatic states. For a comprehensive test of FOTC, we assessed how reasonable the computed electronic couplings and the corresponding TC densities are for the hole- and electron-transfer databases HAB11 and HAB7. FOTC gave 12.5% mean relative unsigned error with regard to the high-level ab initio reference. The shown performance is comparable with that of fragment-orbital density functional theory, which gave the same error by 20.6% or 13.9% depending on the formulation. In the test of a set of nucleobase π stacks, we showed that the original TC expression is also applicable to nondegenerate cases under the condition that the overlap between the charge distributions of diabatic states is small enough to offset the energy difference. Lastly, we carried out visual analysis on the FOTC densities of thiophene dimers with different intermolecular alignments. The result depicts an intimate topological connection between the system geometry and electron flow. Our work provides quantitative and qualitative grounds for FOTC, showing it to be a versatile tool in characterization of molecular charge-transfer systems.

  12. Charge-transfer photodissociation of adsorbed molecules via electron image states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, E. T.

    The 248 and 193 nm photodissociations of submonolayer quantities of CH{sub 3}Br and CH{sub 3}I adsorbed on thin layers of n-hexane indicate that the dissociation is caused by dissociative electron attachment from subvacuum level photoelectrons created in the copper substrate. The characteristics of this photodissociation-translation energy distributions and coverage dependences show that the dissociation is mediated by an image potential state which temporarily traps the photoelectrons near the n-hexane-vacuum interface, and then the charge transfers from this image state to the affinity level of a coadsorbed halomethane which then dissociates.

  13. Interface-Dependent Effective Mobility in Graphene Field-Effect Transistors

    NASA Astrophysics Data System (ADS)

    Ahlberg, Patrik; Hinnemo, Malkolm; Zhang, Shi-Li; Olsson, Jörgen

    2018-03-01

    By pretreating the substrate of a graphene field-effect transistor (G-FET), a stable unipolar transfer characteristic, instead of the typical V-shape ambipolar behavior, has been demonstrated. This behavior is achieved through functionalization of the SiO2/Si substrate that changes the SiO2 surface from hydrophilic to hydrophobic, in combination with postdeposition of an Al2O3 film by atomic layer deposition (ALD). Consequently, the back-gated G-FET is found to have increased apparent hole mobility and suppressed apparent electron mobility. Furthermore, with addition of a top-gate electrode, the G-FET is in a double-gate configuration with independent top- or back-gate control. The observed difference in mobility is shown to also be dependent on the top-gate bias, with more pronounced effect at higher electric field. Thus, the combination of top and bottom gates allows control of the G-FET's electron and hole mobilities, i.e., of the transfer behavior. Based on these observations, it is proposed that polar ligands are introduced during the ALD step and, depending on their polarization, result in an apparent increase of the effective hole mobility and an apparent suppressed effective electron mobility.

  14. Surface Redox Chemistry of Immobilized Nanodiamond: Effects of Particle Size and Electrochemical Environment

    NASA Astrophysics Data System (ADS)

    Gupta, S.; McDonald, B.; Carrizosa, S. B.

    2017-07-01

    The size of the diamond particle is tailored to nanoscale (nanodiamond, ND), and the ND surface is engineered targeting specific (electrochemical and biological) applications. In this work, we investigated the complex surface redox chemistry of immobilized ND layer on conductive boron-doped diamond electrode with a broad experimental parameter space such as particle size (nano versus micron), scan rate, pH (cationic/acidic versus anionic/basic), electrolyte KCl concentration (four orders of magnitude), and redox agents (neutral and ionic). We reported on the significant enhancement of ionic currents while recording reversible oxidation of neutral ferrocene methanol (FcMeOH) by almost one order of magnitude than traditional potassium ferricyanide (K3Fe(CN)6) redox agent. The current enhancement is inversely related to ND particle diameter in the following order: 1 μm << 1000 nm < 100 nm < 10 nm ≤ 5 nm < 2 nm. We attribute the current enhancement to concurrent electrocatalytic processes, i.e. the electron transfer between redox probes and electroactive surface functional (e.g. hydroxyl, carboxyl, epoxy) moieties and the electron transfer mediated by adsorbed FcMeOH+ (or Fe(CN) 6 3+ ) ions onto ND surface. The first process is pH dependent since it depends upon ND surface functionalities for which the electron transfer is coupled to proton transfer. The adsorption mediated process is observed most apparently at slower scan rates owing to self-exchange between adsorbed FcMeOH+ ions and FcMeOH redox agent molecules in diffusion-limited bulk electrolyte solution. Alternatively, it is hypothesized that the surface functionality and defect sites ( sp 2-bonded C shell and unsaturated bonds) give rise to surface electronic states with energies within the band gap (midgap states) in undoped ND. These surface states serve as electron donors (and acceptors) depending upon their bonding (and antibonding) character and, therefore, they can support electrocatalytic redox processes in the presence of specific redox-active molecules via feedback mechanism. Apparently, FcMeOH+ tended to have electrostatic affinity for negatively charged ND surface functionalities, corroborated by present experiments. We also attempted to study biocatalytic process using model metalloprotein (cytochrome c; Cyt c) immobilized on ND particles for investigating interfacial electron transfer kinetics and compared with those of functionalized graphene (graphene oxide; GO and reduced GO). The findings are discussed in terms of interplay of sp 3-bonded C (ND core) and sp 2-bonded C (ND shell and graphene-based systems).

  15. Ultra high energy electrons powered by pulsar rotation.

    PubMed

    Mahajan, Swadesh; Machabeli, George; Osmanov, Zaza; Chkheidze, Nino

    2013-01-01

    A new mechanism of particle acceleration, driven by the rotational slow down of the Crab pulsar, is explored. The rotation, through the time dependent centrifugal force, can efficiently excite unstable Langmuir waves in the electron-positron (hereafter e(±)) plasma of the star magnetosphere. These waves, then, Landau damp on electrons accelerating them in the process. The net transfer of energy is optimal when the wave growth and the Landau damping times are comparable and are both very short compared to the star rotation time. We show, by detailed calculations, that these are precisely the conditions for the parameters of the Crab pulsar. This highly efficient route for energy transfer allows the electrons in the primary beam to be catapulted to multiple TeV (~ 100 TeV) and even PeV energy domain. It is expected that the proposed mechanism may, unravel the puzzle of the origin of ultra high energy cosmic ray electrons.

  16. Understanding the Role of Electron-driven Processes in Atmospheric Behaviour

    NASA Astrophysics Data System (ADS)

    Brunger, M. J.; Campbell, L.; Jones, D. B.; Cartwright, D. C.

    2004-12-01

    Electron-impact excitation plays a major role in emission from aurora and a less significant but nonetheless crucial role in the dayglow and nightglow. For some molecules, such as N2, O2 and NO, electron-impact excitation can be followed by radiative cascade through many different sets of energy levels, producing emission with a large number of lines. We review the application of our statistical equilibrium program to predict this rich spectrum of radiation, and we compare results we have obtained against available independent measurements. In addition, we also review the calculation of energy transfer rates from electrons to N2, O2 and NO in the thermosphere. Energy transfer from electrons to neutral gases and ions is one of the dominant electron cooling processes in the ionosphere, and the role of vibrationally excited N2 and O2 in this is particularly significant. The importance of the energy dependence and magnitude of the electron-impact vibrational cross sections in the calculation of these rates is assessed.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemec, Patrik, E-mail: patrik.nemec@fstroj.uniza.sk; Malcho, Milan, E-mail: milan.malcho@fstroj.uniza.sk

    This work deal with experimental evaluation of cooling efficiency of cooling device capable transfer high heat fluxes from electric elements to the surrounding. The work contain description of cooling device, working principle of cooling device, construction of cooling device. Experimental part describe the measuring method of device cooling efficiency evaluation. The work results are presented in graphic visualization of temperature dependence of the contact area surface between cooling device evaporator and electronic components on the loaded heat of electronic components in range from 250 to 740 W and temperature dependence of the loop thermosiphon condenser surface on the loaded heatmore » of electronic components in range from 250 to 740 W.« less

  18. Semiclassical study of quantum coherence and isotope effects in ultrafast electron transfer reactions coupled to a proton and a phonon bath.

    PubMed

    Venkataraman, Charulatha

    2011-11-28

    The linearized semiclassical initial value representation is employed to describe ultrafast electron transfer processes coupled to a phonon bath and weakly coupled to a proton mode. The goal of our theoretical investigation is to understand the influence of the proton on the electronic dynamics in various bath relaxation regimes. More specifically, we study the impact of the proton on coherences and analyze if the coupling to the proton is revealed in the form of an isotope effect. This will be important in distinguishing reactions in which the proton does not undergo significant rearrangement from those in which the electron transfer is accompanied by proton transfer. Unlike other methodologies widely employed to describe nonadiabatic electron transfer, this approach treats the electronic and nuclear degrees of freedom consistently. However, due to the linearized approximation, quantum interference effects are not captured accurately. Our study shows that at small phonon bath reorganization energies, coherent oscillations and isotope effect are observed in both slow and fast bath regimes. The coherences are more substantially damped by deuterium in comparison to the proton. Further, in contrast to the dynamics of the spin-boson model, the coherences are not long-lived. At large bath reorganization energies, the decay is incoherent in the slow and fast bath regimes. In this case, the extent of the isotope effect depends on the relative relaxation timescales of the proton mode and the phonon bath. The isotope effect is magnified for baths that relax on picosecond timescales in contrast to baths that relax in femtoseconds.

  19. Studies on photoinduced H-atom and electron transfer reactions of o-naphthoquinones by laser flash photolysis.

    PubMed

    Pan, Yang; Fu, Yao; Liu, Shaoxiong; Yu, Haizhu; Gao, Yuhe; Guo, Qingxiang; Yu, Shuqin

    2006-06-15

    The quenching of the triplets of 1,2-naphthoquinone (NQ) and 1,2-naphthoquinone-4-sulfonic acid sodium salt (NQS) by various electron and H-atom donors was investigated by laser flash photolysis measurement in acetonitrile and benzene. The results showed that the reactivities and configurations of 3NQ* (3NQS*) are governed by solvent polarity. All the quenching rate constants (kq) measured in benzene are larger than those in acetonitrile. The SO3Na substituent at the C-4 position of NQS makes 3NQS* more reactive than 3NQ* in electron/H-atom transfer reactions. Large differences of kq values were discovered in H-atom transfer reactions for alcohols and phenols, which can be explained by different H-abstraction mechanisms. Detection of radical cations of amines/anilines in time-resolved transient absorption spectra confirms an electron transfer mechanism. Triplets are identified as precursors of formed radical anions of NQ and NQS in photoinduced reactions. The dependence of electron transfer rate constants on the free energy changes (DeltaG) was treated by using the Rehm-Weller equation. For the four anilines with different substituents on the para or meta position of amidocyanogen, good correlation between log kq values with Hammett sigma constants testifies the correctness of empirical Hammett equation. Charge density distributions, adiabatic ionization/affinity potentials and redox potentials of NQ (NQS) and some quenchers were studied by quantum chemistry calculation.

  20. Simulation of solution phase electron transfer in a compact donor-acceptor dyad.

    PubMed

    Kowalczyk, Tim; Wang, Lee-Ping; Van Voorhis, Troy

    2011-10-27

    Charge separation (CS) and charge recombination (CR) rates in photosynthetic architectures are difficult to control, yet their ratio can make or break photon-to-current conversion efficiencies. A rational design approach to the enhancement of CS over CR requires a mechanistic understanding of the underlying electron-transfer (ET) process, including the role of the environment. Toward this goal, we introduce a QM/MM protocol for ET simulations and use it to characterize CR in the formanilide-anthraquinone dyad (FAAQ). Our simulations predict fast recombination of the charge-transfer excited state, in agreement with recent experiments. The computed electronic couplings show an electronic state dependence and are weaker in solution than in the gas phase. We explore the role of cis-trans isomerization on the CR kinetics, and we find strong correlation between the vertical energy gaps of the full simulations and a collective solvent polarization coordinate. Our approach relies on constrained density functional theory to obtain accurate diabatic electronic states on the fly for molecular dynamics simulations, while orientational and electronic polarization of the solvent is captured by a polarizable force field based on a Drude oscillator model. The method offers a unified approach to the characterization of driving forces, reorganization energies, electronic couplings, and nonlinear solvent effects in light-harvesting systems.

  1. Function of CN group in organic sensitizers: The first principle study.

    PubMed

    Liu, Yun; Shao, Di; Bai, Xiaohui; Yang, Zhenqing; Lin, Chundan; Shao, Changjin

    2017-05-15

    The cyano group (CN) of the acceptor in organic sensitizers plays an important role for highly efficient dye-sensitized solar cells. In this paper, three 5, 6-difluoro-2,1,3-benzothiadiazole (DFBTD) organic molecules with different number of CN units, named ME15, ME16 and ME17, were investigated by the density functional theory (DFT) and time-dependent DFT (TDDFT). We analyzed the CNs effects on the electronic structures, optical properties, adsorption modes and electron transfer and injection. The result shows that ME17 has the largest maximum absorption wavelength (λ max ) among these new designed dyes due to the strong electron withdrawing ability of two CNs. In addition, CN greatly influence the adsorption modes of dye/TiO 2 and electron injection mechanism. ME16 with one CN also has good optical absorption properties and its acceptor has the strongest coupling strength with the TiO 2 semiconductor which is favorable for electron transfer and injection. Thus, we believe that the number of CN groups in acceptor should be moderate and one CN in D-A-π-A structure dyes may be the more appropriate focusing on the light harvesting ability, electron transfer and electron injection. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Using Hyperfine Electron Paramagnetic Resonance Spectroscopy to Define the Proton-Coupled Electron Transfer Reaction at Fe-S Cluster N2 in Respiratory Complex I.

    PubMed

    Le Breton, Nolwenn; Wright, John J; Jones, Andrew J Y; Salvadori, Enrico; Bridges, Hannah R; Hirst, Judy; Roessler, Maxie M

    2017-11-15

    Energy-transducing respiratory complex I (NADH:ubiquinone oxidoreductase) is one of the largest and most complicated enzymes in mammalian cells. Here, we used hyperfine electron paramagnetic resonance (EPR) spectroscopic methods, combined with site-directed mutagenesis, to determine the mechanism of a single proton-coupled electron transfer reaction at one of eight iron-sulfur clusters in complex I, [4Fe-4S] cluster N2. N2 is the terminal cluster of the enzyme's intramolecular electron-transfer chain and the electron donor to ubiquinone. Because of its position and pH-dependent reduction potential, N2 has long been considered a candidate for the elusive "energy-coupling" site in complex I at which energy generated by the redox reaction is used to initiate proton translocation. Here, we used hyperfine sublevel correlation (HYSCORE) spectroscopy, including relaxation-filtered hyperfine and single-matched resonance transfer (SMART) HYSCORE, to detect two weakly coupled exchangeable protons near N2. We assign the larger coupling with A( 1 H) = [-3.0, -3.0, 8.7] MHz to the exchangeable proton of a conserved histidine and conclude that the histidine is hydrogen-bonded to N2, tuning its reduction potential. The histidine protonation state responds to the cluster oxidation state, but the two are not coupled sufficiently strongly to catalyze a stoichiometric and efficient energy transduction reaction. We thus exclude cluster N2, despite its proton-coupled electron transfer chemistry, as the energy-coupling site in complex I. Our work demonstrates the capability of pulse EPR methods for providing detailed information on the properties of individual protons in even the most challenging of energy-converting enzymes.

  3. Role of the photosynthetic electron transfer chain in electrogenic activity of cyanobacteria.

    PubMed

    Pisciotta, John M; Zou, Yongjin; Baskakov, Ilia V

    2011-07-01

    Certain anaerobic bacteria, termed electrogens, produce an electric current when electrons from oxidized organic molecules are deposited to extracellular metal oxide acceptors. In these heterotrophic "metal breathers", the respiratory electron transport chain (R-ETC) works in concert with membrane-bound cytochrome oxidases to transfer electrons to the extracellular acceptors. The diversity of bacteria able to generate an electric current appears more widespread than previously thought, and aerobic phototrophs, including cyanobacteria, possess electrogenic activity. However, unlike heterotrophs, cyanobacteria electrogenic activity is light dependent, which suggests that a novel pathway could exist. To elucidate the electrogenic mechanism of cyanobacteria, the current studies used site-specific inhibitors to target components of the photosynthetic electron transport chain (P-ETC) and cytochrome oxidases. Here, we show that (1) P-ETC and, particularly, water photolysed by photosystem II (PSII) is the source of electrons discharged to the environment by illuminated cyanobacteria, and (2) water-derived electrons are transmitted from PSII to extracellular electron acceptors via plastoquinone and cytochrome bd quinol oxidase. Two cyanobacterial genera (Lyngbya and Nostoc) displayed very similar electrogenic responses when treated with P-ETC site-specific inhibitors, suggesting a conserved electrogenic pathway. We propose that in cyanobacteria, electrogenic activity may represent a form of overflow metabolism to protect cells under high-intensity light. This study offers insight into electron transfer between phototrophic microorganisms and the environment and expands our knowledge into biologically based mechanisms for harnessing solar energy.

  4. Structure and Electronic Spectra of Purine-Methyl Viologen Charge Transfer Complexes

    PubMed Central

    Jalilov, Almaz S.; Patwardhan, Sameer; Singh, Arunoday; Simeon, Tomekia; Sarjeant, Amy A.; Schatz, George C.; Lewis, Frederick D.

    2014-01-01

    The structure and properties of the electron donor-acceptor complexes formed between methyl viologen (MV) and purine nucleosides and nucleotides in water and the solid state have been investigated using a combination of experimental and theoretical methods. Solution studies were performed using UV-vis and 1H NMR spectroscopy. Theoretical calculations were performed within the framework of density functional theory (DFT). Energy decomposition analysis indicates that dispersion and induction (charge-transfer) interactions dominate the total binding energy, whereas electrostatic interactions are largely repulsive. The appearance of charge transfer bands in the absorption spectra of the complexes are well described by time-dependent (TD) DFT and are further explained in terms of the redox properties of purine monomers and solvation effects. Crystal structures are reported for complexes of methyl viologen with the purines 2′-deoxyguanosine 3′-monophosphate GMP (DAD′DAD′ type) and 7-deazaguanosine zG (DAD′ADAD′ type). Comparison of the structures determined in the solid state and by theoretical methods in solution provides valuable insights into the nature of charge-transfer interactions involving purine bases as electron donors. PMID:24294996

  5. Treatment of delocalized electron transfer in periodic and embedded cluster DFT calculations: The case of Cu on ZnO (10(1)0).

    PubMed

    Hellström, Matti; Spångberg, Daniel; Hermansson, Kersti

    2015-12-15

    We assess the consequences of the interface model-embedded-cluster or periodic-slab model-on the ability of DFT calculations to describe charge transfer (CT) in a particularly challenging case where periodic-slab calculations indicate a delocalized charge-transfer state. Our example is Cu atom adsorption on ZnO(10(1)0), and in fact the periodic slab calculations indicate three types of CT depending on the adsorption site: full CT, partial CT, and no CT. Interestingly, when full CT occurs in the periodic calculations, the calculated Cu atom adsorption energy depends on the underlying ZnO substrate supercell size, since when the electron enters the ZnO it delocalizes over as many atoms as possible. In the embedded-cluster calculations, the electron transferred to the ZnO delocalizes over the entire cluster region, and as a result the calculated Cu atom adsorption energy does not agree with the value obtained using a large periodic supercell, but instead to the adsorption energy obtained for a periodic supercell of roughly the same size as the embedded cluster. Different density functionals (of GGA and hybrid types) and basis sets (local atom-centered and plane-waves) were assessed, and we show that embedded clusters can be used to model Cu adsorption on ZnO(10(1)0), as long as care is taken to account for the effects of CT. © 2015 Wiley Periodicals, Inc.

  6. Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

    NASA Astrophysics Data System (ADS)

    Gisslén, Linus; Scholz, Reinhard

    2009-09-01

    The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

  7. Potential for direct interspecies electron transfer in methanogenic wastewater digester aggregates.

    PubMed

    Morita, Masahiko; Malvankar, Nikhil S; Franks, Ashley E; Summers, Zarath M; Giloteaux, Ludovic; Rotaru, Amelia E; Rotaru, Camelia; Lovley, Derek R

    2011-01-01

    Mechanisms for electron transfer within microbial aggregates derived from an upflow anaerobic sludge blanket reactor converting brewery waste to methane were investigated in order to better understand the function of methanogenic consortia. The aggregates were electrically conductive, with conductivities 3-fold higher than the conductivities previously reported for dual-species aggregates of Geobacter species in which the two species appeared to exchange electrons via interspecies electron transfer. The temperature dependence response of the aggregate conductance was characteristic of the organic metallic-like conductance previously described for the conductive pili of Geobacter sulfurreducens and was inconsistent with electron conduction through minerals. Studies in which aggregates were incubated with high concentrations of potential electron donors demonstrated that the aggregates had no significant capacity for conversion of hydrogen to methane. The aggregates converted formate to methane but at rates too low to account for the rates at which that the aggregates syntrophically metabolized ethanol, an important component of the reactor influent. Geobacter species comprised 25% of 16S rRNA gene sequences recovered from the aggregates, suggesting that Geobacter species may have contributed to some but probably not all of the aggregate conductivity. Microorganisms most closely related to the acetate-utilizing Methanosaeta concilii accounted for more than 90% of the sequences that could be assigned to methane producers, consistent with the poor capacity for hydrogen and formate utilization. These results demonstrate for the first time that methanogenic wastewater aggregates can be electrically conductive and suggest that direct interspecies electron transfer could be an important mechanism for electron exchange in some methanogenic systems.

  8. Exciton Energy Transfer from Halide Terminated Nanocrystals to Graphene in Solar Photovoltaics

    NASA Astrophysics Data System (ADS)

    Ajayi, Obafunso; Abramson, Justin; Anderson, Nicholas; Owen, Jonathan; Zhao, Yue; Kim, Phillip; Gesuele, Felice; Wong, Chee Wei

    2011-03-01

    Graphene, a zero-gap semiconductor, has been identified as an ideal electrode for nanocrystal solar cell photovoltaic applications due to its high carrier mobility. Further advances in efficient current extraction are required towards this end. We investigate the resonant energy transfer dynamics between photoexcited nanocrystals and graphene, where the energy transfer rate is characterized by the fluorescent quenching of the quantum dots in the presence of graphene. Energy transfer has been shown to have a d -4 dependence on the nanocrystal distance from the graphene surface, with a correction due to blinking statistics. We investigate this relationship with single and few layer graphene. We study halide-terminated CdSe quantum dots; where the absence of the insulating outershell improves the electronic coupling of the donor-acceptor system leads to improved electron transfer. We observe quenching of the halide terminated nanocrystals on graphene, with the quenching factor ρ defined as IQ /IG (the relative intensities on quartz and graphene).

  9. Chemical and physical investigations on the charge transfer interaction of organic donors with iodine and its application as non-traditional organic conductors

    NASA Astrophysics Data System (ADS)

    Refat, Moamen S.; Sharshar, T.; Adam, Abdel Majid A.; Elsabawy, Khaled M.; Hemeda, O. M.

    2014-09-01

    The iso-leucine-iodide and methionine-iodide charge-transfer complexes were prepared and characterized using different spectroscopic techniques. The iodide charge-transfer complexes were synthesized by grinding KI-I2-amino acid with 1:1:1 M ratio in presence of few drops of methanol solvent. The structures of both solid amino acid iodide charge-transfer complexes are discussed with the help of the obtained results of the infrared and Raman laser spectra, Uv-vis. electronic spectra and thermal analyses. The electrical properties (AC resistivity and dielectric constant) of both complexes were investigated. The positron annihilation Doppler broadening (PADB) spectroscopies were also used to probe the structural changes of both complexes. The PADB line-shape parameters (S and W) were found to be dependent on the structure, electronic configuration of the charge transfer complex. The PADB technique is a powerful tool to probe the structural features of the KI-I2-amino acid complexes.

  10. The behavior of exciplex decay processes and interplay of radiationless transition and preliminary reorganization mechanisms of electron transfer in loose and tight pairs of reactants.

    PubMed

    Kuzmin, Michael G; Soboleva, Irina V; Dolotova, Elena V

    2007-01-18

    Exciplex emission spectra and rate constants of their decay via internal conversion and intersystem crossing are studied and discussed in terms of conventional radiationless transition approach. Exciplexes of 9-cyanophenanthrene with 1,2,3-trimethoxybenzene and 1,3,5-trimethoxybenzene were studied in heptane, toluene, butyl acetate, dichloromethane, butyronitrile, and acetonitrile. A better description of spectra and rate constants is obtained using 0-0 transition energy and Gauss broadening of vibrational bands rather than the free energy of electron transfer and reorganization energy. The coincidence of parameters describing exciplex emission spectra and dependence of exciplex decay rate constants on energy gap gives the evidence of radiationless quantum transition mechanism rather than thermally activated medium reorganization mechanism of charge recombination in exciplexes and excited charge transfer complexes (contact radical ion pairs) as well as in solvent separated radical ion pairs. Radiationless quantum transition mechanism is shown to provide an appropriate description also for the main features of exergonic excited-state charge separation reactions if fast mutual transformations of loose and tight pairs of reactants are considered. In particular, very fast electron transfer (ET) in tight pairs of reactants with strong electronic coupling of locally excited and charge transfer states can prevent the observation of an inverted region in bimolecular excited-state charge separation even for highly exergonic reactions.

  11. Interfacial Molecular Packing Determines Exciton Dynamics in Molecular Heterostructures: The Case of Pentacene-Perfluoropentacene.

    PubMed

    Rinn, Andre; Breuer, Tobias; Wiegand, Julia; Beck, Michael; Hübner, Jens; Döring, Robin C; Oestreich, Michael; Heimbrodt, Wolfram; Witte, Gregor; Chatterjee, Sangam

    2017-12-06

    The great majority of electronic and optoelectronic devices depend on interfaces between p-type and n-type semiconductors. Finding matching donor-acceptor systems in molecular semiconductors remains a challenging endeavor because structurally compatible molecules may not necessarily be suitable with respect to their optical and electronic properties, and the large exciton binding energy in these materials may favor bound electron-hole pairs rather than free carriers or charge transfer at an interface. Regardless, interfacial charge-transfer exciton states are commonly considered as an intermediate step to achieve exciton dissociation. The formation efficiency and decay dynamics of such states will strongly depend on the molecular makeup of the interface, especially the relative alignment of donor and acceptor molecules. Structurally well-defined pentacene-perfluoropentacene heterostructures of different molecular orientations are virtually ideal model systems to study the interrelation between molecular packing motifs at the interface and their electronic properties. Comparing the emission dynamics of the heterosystems and the corresponding unitary films enables accurate assignment of every observable emission signal in the heterosystems. These heterosystems feature two characteristic interface-specific luminescence channels at around 1.4 and 1.5 eV that are not observed in the unitary samples. Their emission strength strongly depends on the molecular alignment of the respective donor and acceptor molecules, emphasizing the importance of structural control for device construction.

  12. Molecular alignment effect on the photoassociation process via a pump-dump scheme.

    PubMed

    Wang, Bin-Bin; Han, Yong-Chang; Cong, Shu-Lin

    2015-09-07

    The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na2) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X(1)Σ(+)) is associated into the molecule in the bound states of the excited state (A(1)Σ(+)) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found that the pump process can induce a superposition of the rovibrational levels |v, j〉 on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.

  13. Molecular alignment effect on the photoassociation process via a pump-dump scheme

    NASA Astrophysics Data System (ADS)

    Wang, Bin-Bin; Han, Yong-Chang; Cong, Shu-Lin

    2015-09-01

    The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na2) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X1Σ+) is associated into the molecule in the bound states of the excited state (A1Σ+) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found that the pump process can induce a superposition of the rovibrational levels |v, j> on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.

  14. Combining UV photodissociation action spectroscopy with electron transfer dissociation for structure analysis of gas-phase peptide cation-radicals.

    PubMed

    Shaffer, Christopher J; Pepin, Robert; Tureček, František

    2015-12-01

    We report the first example of using ultraviolet (UV) photodissociation action spectroscopy for the investigation of gas-phase peptide cation-radicals produced by electron transfer dissociation. z-Type fragment ions (●) Gly-Gly-Lys(+), coordinated to 18-crown-6-ether (CE), are generated, selected by mass and photodissociated in the 200-400 nm region. The UVPD action spectra indicate the presence of valence-bond isomers differing in the position of the Cα radical defect, (α-Gly)-Gly-Lys(+) (CE), Gly-(α-Gly)-Lys(+) (CE) and Gly-Gly-(α-Lys(+))(CE). The isomers are readily distinguishable by UV absorption spectra obtained by time-dependent density functional theory (TD-DFT) calculations. In contrast, conformational isomers of these radical types are calculated to have similar UV spectra. UV photodissociation action spectroscopy represents a new tool for the investigation of transient intermediates of ion-electron reactions. Specifically, z-type cation radicals are shown to undergo spontaneous hydrogen atom migrations upon electron transfer dissociation. Copyright © 2015 John Wiley & Sons, Ltd.

  15. Time-series analysis of energetic electron fluxes (1. 2 - 16 MeV) at geosynchronous altitude. Master's thesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halpin, M.P.

    This project used a Box and Jenkins time-series analysis of energetic electron fluxes measured at geosynchronous orbit in an effort to derive prediction models for the flux in each of five energy channels. In addition, the technique of transfer function modeling described by Box and Jenkins was used in an attempt to derive input-output relationships between the flux channels (viewed as the output) and the solar-wind speed or interplanetary magnetic field (IMF) north-south component, Bz, (viewed as the input). The transfer function modeling was done in order to investigate the theoretical dynamic relationship which is believed to exist between themore » solar wind, the IMF Bz, and the energetic electron flux in the magnetosphere. The models derived from the transfer-function techniques employed were also intended to be used in the prediction of flux values. The results from this study indicate that the energetic electron flux changes in the various channels are dependent on more than simply the solar-wind speed or the IMF Bz.« less

  16. Control of Electron Flow Direction in Photoexcited Cycloplatinated Complex Containing Conjugated Polymer-Single Walled Carbon Nanotube Hybrids.

    PubMed

    Xiong, Wenjuan; Du, Lili; Lo, Kin Cheung; Shi, Haiting; Takaya, Tomohisa; Iwata, Koichi; Chan, Wai Kin; Phillips, David Lee

    2018-06-25

    Conjugated polymers incorporated with cycloplatinated complexes (P1-Pt and P2-Pt) were used as dispersants for single walled carbon nanotubes (SWCNTs). Significant changes in the UV-vis absorption spectra were observed after the formation of the polymer/SWCNT hybrids. Molecular dynamics (MD) simulations revealed the presence of a strong interaction between the cycloplatinated complex moieties and the SWCNT surface. The photoinduced electron transfer processes in these hybrids were strongly dependent on the type of the comonomer unit. Upon photoexcitation, the excited P1-Pt donates electrons to the SWCNT, while P2-Pt accepts electrons from the photoexcited SWCNT. These observations were supported by results from Raman and femtosecond time-resolved transient absorption spectroscopy experiments. The strong electronic interaction between the Pt complexes and the SWCNT gives rise to a new hybrid system that has a controllable photo-induced electron transfer flow, which are important in regulating the charge transport processes SWCNT-based optoelectronic devices.

  17. Boosting the efficiency of quantum dot sensitized solar cells through modulation of interfacial charge transfer.

    PubMed

    Kamat, Prashant V

    2012-11-20

    The demand for clean energy will require the design of nanostructure-based light-harvesting assemblies for the conversion of solar energy into chemical energy (solar fuels) and electrical energy (solar cells). Semiconductor nanocrystals serve as the building blocks for designing next generation solar cells, and metal chalcogenides (e.g., CdS, CdSe, PbS, and PbSe) are particularly useful for harnessing size-dependent optical and electronic properties in these nanostructures. This Account focuses on photoinduced electron transfer processes in quantum dot sensitized solar cells (QDSCs) and discusses strategies to overcome the limitations of various interfacial electron transfer processes. The heterojunction of two semiconductor nanocrystals with matched band energies (e.g., TiO(2) and CdSe) facilitates charge separation. The rate at which these separated charge carriers are driven toward opposing electrodes is a major factor that dictates the overall photocurrent generation efficiency. The hole transfer at the semiconductor remains a major bottleneck in QDSCs. For example, the rate constant for hole transfer is 2-3 orders of magnitude lower than the electron injection from excited CdSe into oxide (e.g., TiO(2)) semiconductor. Disparity between the electron and hole scavenging rate leads to further accumulation of holes within the CdSe QD and increases the rate of electron-hole recombination. To overcome the losses due to charge recombination processes at the interface, researchers need to accelerate electron and hole transport. The power conversion efficiency for liquid junction and solid state quantum dot solar cells, which is in the range of 5-6%, represents a significant advance toward effective utilization of nanomaterials for solar cells. The design of new semiconductor architectures could address many of the issues related to modulation of various charge transfer steps. With the resolution of those problems, the efficiencies of QDSCs could approach those of dye sensitized solar cells (DSSC) and organic photovoltaics.

  18. Electric-field-driven electron-transfer in mixed-valence molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blair, Enrique P., E-mail: enrique-blair@baylor.edu; Corcelli, Steven A., E-mail: scorcell@nd.edu; Lent, Craig S., E-mail: lent@nd.edu

    2016-07-07

    Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate themore » electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.« less

  19. Photoinduced electron transfer process on emission spectrum of N,N‧-bis(salicylidene)-1,2-phenylenediamine as a Mg2+ cation chemosensor: A first principle DFT and TDDFT study

    NASA Astrophysics Data System (ADS)

    Taherpour, Avat (Arman); Jamshidi, Morteza; Rezaei, Omid; Belverdi, Ali Rezaei

    2018-06-01

    The electronic and optical properties of N,N‧-bis(salicylidene)-1,2-phenylenediamine (SPDA) ligand were studied as a chemical sensor of Mg2+ cation in two solvents (water and DMSO) using the ab initio theory through Density Functional Theory (DFT) and Time Dependent Density Functional theory (TDDFT) methods. The results show that the SPDA ligand has a high ability for chemical sensing of Mg2+. The results has also represented that HOMO-LUMO energy gap decreases 0.941 eV after the complex formation between SPDA and Mg2+. In addition, obvious changes are found in the UV-Vis absorption spectrum, optical analyses SPDA ligand and [SPDA.Mg]2+ complex, which it has the capability of detecting Mg2+ via the adsorptive UV-Vis and colorimetric methods. Emission spectrum calculations and photoinduced electron transfer (PET) process in water solution shows different wavelength emission spectrum in amount of 4.6 nm. An analysis of NBO (natural bond orbital) data indicates tangible changes in the electron transfers data from the electron pairs of ligand to the conjugated system, both prior and subsequent to Mg2+addition.

  20. Unravelling the pH-dependence of a molecular photocatalytic system for hydrogen production† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c5sc01349f Click here for additional data file.

    PubMed Central

    Pastor, Ernest; Gross, Manuela A.; Selim, Shababa

    2015-01-01

    Photocatalytic systems for the reduction of aqueous protons are strongly pH-dependent, but the origin of this dependency is still not fully understood. We have studied the effect of different degrees of acidity on the electron transfer dynamics and catalysis taking place in a homogeneous photocatalytic system composed of a phosphonated ruthenium tris(bipyridine) dye (RuP) and a nickel bis(diphosphine) electrocatalyst (NiP) in an aqueous ascorbic acid solution. Our approach is based on transient absorption spectroscopy studies of the efficiency of photo-reduction of RuP and NiP correlated with pH-dependent photocatalytic H2 production and the degree of catalyst protonation. The influence of these factors results in an observed optimum photoactivity at pH 4.5 for the RuP–NiP system. The electron transfer from photo-reduced RuP to NiP is efficient and independent of the pH value of the medium. At pH <4.5, the efficiency of the system is limited by the yield of RuP photo-reduction by the sacrificial electron donor, ascorbic acid. At pH >4.5, the efficiency of the system is limited by the poor protonation of NiP, which inhibits its ability to reduce protons to hydrogen. We have therefore developed a rational strategy utilising transient absorption spectroscopy combined with bulk pH titration, electrocatalytic and photocatalytic experiments to disentangle the complex pH-dependent activity of the homogenous RuP–NiP photocatalytic system, which can be widely applied to other photocatalytic systems. PMID:28717491

  1. "Abnormal" salt and solvent effects on anion/cation electron-transfer reactions: an interpretation based on Marcus-Hush treatment.

    PubMed

    Garcia-Fernandez, E; Prado-Gotor, R; Sanchez, F

    2005-08-11

    Salt and solvent effects on the kinetics of the reactions [Fe(CN)6]3- + [Ru(NH3)5pz](2+) right arrow over left arrow [Fe(CN)6]4- + [Ru(NH3)5pz]3+ (pz = pyrazine) have been studied through T-jump measurements. The forward and reverse reactions show different behaviors: "abnormal" salt and solvent effects in the first case and normal effects in the second one. These facts imply an asymmetric behavior of anion/cation reactions depending on the charge of the oxidant. The results can be rationalized by using the Marcus-Hush treatment for electron-transfer reactions.

  2. Direct measurements of intramolecular electron transfer rates between cytochrome c and cytochrome c peroxidase: effects of exothermicity and primary sequence on rate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheung, E.; Taylor, K.; Kornblatt, J.A.

    1986-03-01

    Rapid mixing of ferrocytochrome c peroxidase (cyt c peroxidase(II)) and ferricytochrome c (cyt c(III)) results in the reduction of cyt c(III) by cyt c peroxidase(II). In 10 mM phosphate, pH 7.0, the rate of decay of cyt c peroxidase(II) and the rate of accumulation of cyt c(II) give equal first-order rate constants. Equivalent results are obtained by pulse radiolysis using isopropanol radical as the reducing agent. This rate is independent of the initial cyt c(III):cyt c peroxidase(II) ratios. These results are consistent with unimolecular electron transfer occurring within a cyt c(III)-cyt c peroxidase(II) complex. When cyt c is replaced bymore » porphyrin cyt c (iron-free cyt c), a complex still forms with cyt c peroxidase. On radiolysis intracomplex electron transfer occurs from the porphyrin cyt c anion radical to cyt c peroxidase(III). This large rate increase suggest that the barrier for intracomplex electron transfer is large. Finally, the authors have briefly investigated how the cyt c peroxidase(II) ..-->.. cyt c(III) rate depends on the primary structure of cyt c(III). They find the reactivity order to be as follows: yeast > horse > tuna.« less

  3. The effect of twisted D–D–π–A configuration on electron transfer and photo-physics characteristics

    NASA Astrophysics Data System (ADS)

    Liu, Yunpeng; Li, Yuanzuo; Song, Peng; Ma, Fengcai; Yang, Yanhui

    2018-05-01

    Two D-D-π-A organic dyes (M45, M46) with dithieno[3,2-b:2‧,3‧-d]pyrrole (DTP) units as election donors in two perpendicular directions, were investigated using density functional theory (DFT) and time-dependent DFT. The ground-state geometries, the absorption, the electronic structures, the charge density difference and molecular electrostatic potential were obtained. To simulate a more realistic performance, all calculations were based on gas condition and dichloromethane solvent. Photoelectric parameters were evaluated by the following factors: the light harvesting efficiency, electron injection driving force, the excited lifetime and vertical dipole moment. Meanwhile, the polarisability and hyperpolarisability were investigated to further explain the relationship between non-linear optical properties and efficiency. The direction of the DTP obviously affects the twisted degree of molecule, forming a better coplanarity on the donor 2 of M45, which results in stronger charge transfer interactions. Furthermore, M45 possesses significant advantages in geometric structure, absorption band and intramolecular charge transfer mechanism. These critical parameters supported the higher performance of M45 in comparison with M46. Moreover, four dyes were designed by the substitution of donor 2, which further verify the influence of the twisted donor 2 on electron transfer and photoelectric properties of D-D-π-A configuration.

  4. Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya

    The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

  5. Understanding How Isotopes Affect Charge Transfer in P3HT/PCBM: A Quantum Trajectory-Electronic Structure Study with Nonlinear Quantum Corrections

    DOE PAGES

    Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...

    2016-08-09

    The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less

  6. Handling Density Conversion in TPS.

    PubMed

    Isobe, Tomonori; Mori, Yutaro; Takei, Hideyuki; Sato, Eisuke; Tadano, Kiichi; Kobayashi, Daisuke; Tomita, Tetsuya; Sakae, Takeji

    2016-01-01

    Conversion from CT value to density is essential to a radiation treatment planning system. Generally CT value is converted to the electron density in photon therapy. In the energy range of therapeutic photon, interactions between photons and materials are dominated with Compton scattering which the cross-section depends on the electron density. The dose distribution is obtained by calculating TERMA and kernel using electron density where TERMA is the energy transferred from primary photons and kernel is a volume considering spread electrons. Recently, a new method was introduced which uses the physical density. This method is expected to be faster and more accurate than that using the electron density. As for particle therapy, dose can be calculated with CT-to-stopping power conversion since the stopping power depends on the electron density. CT-to-stopping power conversion table is also called as CT-to-water-equivalent range and is an essential concept for the particle therapy.

  7. Electroactive Biofilms: Current Status and Future Research Needs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borole, Abhijeet P; Reguera, Gemma; Ringeisen, Bradley

    2011-01-01

    Electroactive biofilms generated by electrochemically active microorganisms have many potential applications in bioenergy and chemicals production. This review assesses the effects of microbiological and process parameters on enrichment of such biofilms as well as critically evaluates the current knowledge of the mechanisms of extracellular electron transfer in BES systems. First we discuss the role of biofilm forming microorganisms vs. planktonic microorganisms. Physical, chemical and electrochemical parameters which dictate the enrichment and subsequent performance of the biofilms are discussed. Potential dependent biological parameters including biofilm growth rate, specific electron transfer rate and others and their relationship to BES system performance ismore » assessed. A review of the mechanisms of electron transfer in BES systems is included followed by a discussion of biofilm and its exopolymeric components and their electrical conductivity. A discussion of the electroactive biofilms in biocathodes is also included. Finally, we identify the research needs for further development of the electroactive biofilms to enable commercial applications.« less

  8. Tyrosine oxidation in heme oxygenase: examination of long-range proton-coupled electron transfer.

    PubMed

    Smirnov, Valeriy V; Roth, Justine P

    2014-10-01

    Heme oxygenase is responsible for the degradation of a histidine-ligated ferric protoporphyrin IX (Por) to biliverdin, CO, and the free ferrous ion. Described here are studies of tyrosyl radical formation reactions that occur after oxidizing Fe(III)(Por) to Fe(IV)=O(Por(·+)) in human heme oxygenase isoform-1 (hHO-1) and the structurally homologous protein from Corynebacterium diphtheriae (cdHO). Site-directed mutagenesis on hHO-1 probes the reduction of Fe(IV)=O(Por(·+)) by tyrosine residues within 11 Å of the prosthetic group. In hHO-1, Y58· is implicated as the most likely site of oxidation, based on the pH and pD dependent kinetics. The absence of solvent deuterium isotope effects in basic solutions of hHO-1 and cdHO contrasts with the behavior of these proteins in the acidic solution, suggesting that long-range proton-coupled electron transfer predominates over electron transfer.

  9. Construction and direct electrochemistry of orientation controlled laccase electrode.

    PubMed

    Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

    2014-03-28

    A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Electron elevator: Excitations across the band gap via a dynamical gap state

    DOE PAGES

    Lim, Anthony; Foulkes, W. M. C.; Horsfield, A. P.; ...

    2016-01-27

    We use time-dependent density functional theory to study self-irradiated Si. We calculate the electronic stopping power of Si in Si by evaluating the energy transferred to the electrons per unit path length by an ion of kinetic energy from 1 eV to 100 keV moving through the host. Electronic stopping is found to be significant below the threshold velocity normally identified with transitions across the band gap. A structured crossover at low velocity exists in place of a hard threshold. Lastly, an analysis of the time dependence of the transition rates using coupled linear rate equations enables one of themore » excitation mechanisms to be clearly identified: a defect state induced in the gap by the moving ion acts like an elevator and carries electrons across the band gap.« less

  11. Electron Elevator: Excitations across the Band Gap via a Dynamical Gap State.

    PubMed

    Lim, A; Foulkes, W M C; Horsfield, A P; Mason, D R; Schleife, A; Draeger, E W; Correa, A A

    2016-01-29

    We use time-dependent density functional theory to study self-irradiated Si. We calculate the electronic stopping power of Si in Si by evaluating the energy transferred to the electrons per unit path length by an ion of kinetic energy from 1 eV to 100 keV moving through the host. Electronic stopping is found to be significant below the threshold velocity normally identified with transitions across the band gap. A structured crossover at low velocity exists in place of a hard threshold. An analysis of the time dependence of the transition rates using coupled linear rate equations enables one of the excitation mechanisms to be clearly identified: a defect state induced in the gap by the moving ion acts like an elevator and carries electrons across the band gap.

  12. Acid proliferation to improve the sensitivity of EUV resists: a pulse radiolysis study

    NASA Astrophysics Data System (ADS)

    Enomoto, Kazuyuki; Arimitsu, Koji; Yoshizawa, Atsutaro; Yamamoto, Hiroki; Oshima, Akihiro; Kozawa, Takahiro; Tagawa, Seiichi

    2011-04-01

    The yields of acid have been measured in the electron-beam irradiation of triphenylsulfonium triflate (TPS-Tf) and pinanediol monosulfonates, which consist of tosylate (PiTs), 4-fluorobenzenesulfonate (Pi1F), or 4-trifluoromethylbenzenesulfonate (Pi3F), as an acid amplifier blended in 4-hydroxystyrene matrixes. The acid yields efficiency decreases when PiTs is present, while its efficiency increases in the presence of Pi3F. Reactions of the electrons with TPS-Tf and pinanediol monosulfonates have been studied using pulse radiolysis in liquid tetrahydrofuran (THF) to evaluate the kinetic contributions to acid production. The THF-solvated electrons react with PiTs, Pi1F, and Pi3F to produce the corresponding radical anions; the rate constants are estimated to be 4.1, 5.1, and 9.2 × 1010 M-1 s-1, respectively. Electron transfer from PiTs•-, Pi1F•-, and Pi3F•- radical anions to TPS-Tf occurs with the rate constants of 5.7×1010, 1.2×1011, and 6.3 × 1010 M-1 s-1, respectively. The long-lived Pi3F•- efficiently undergoes the electron transfer to TPS-Tf to form the TPS-Tf•-, which subsequently decompose to generate TfOH. On the other hand, the decay channels of PiTs•- and Pi1F•-, which possess a relatively short lifetime, are presumably dependent on its reactions with solvated protons (charge recombination) rather than the electron transfer to TPS-Tf. The novel acid production pathway via the electron transfer from pinanediol monosulfonate radical anions to TPS-Tf is presented.

  13. Experimental evaluation of cooling efficiency of the high performance cooling device

    NASA Astrophysics Data System (ADS)

    Nemec, Patrik; Malcho, Milan

    2016-06-01

    This work deal with experimental evaluation of cooling efficiency of cooling device capable transfer high heat fluxes from electric elements to the surrounding. The work contain description of cooling device, working principle of cooling device, construction of cooling device. Experimental part describe the measuring method of device cooling efficiency evaluation. The work results are presented in graphic visualization of temperature dependence of the contact area surface between cooling device evaporator and electronic components on the loaded heat of electronic components in range from 250 to 740 W and temperature dependence of the loop thermosiphon condenser surface on the loaded heat of electronic components in range from 250 to 740 W.

  14. Ultrafast hydrogen bond dynamics and partial electron transfer after photoexcitation of diethyl ester of 7-(diethylamino)-coumarin-3-phosphonic acid and its benzoxaphosphorin analog.

    PubMed

    Wagner, M S; Ilieva, E D; Petkov, P St; Nikolova, R D; Kienberger, R; Iglev, H

    2015-04-21

    The solvation dynamics after optical excitation of two phosphono-substituted coumarin derivatives dissolved in various solutions are studied by fluorescence up-conversion spectroscopy and quantum chemical simulations. The Kamlet-Taft analysis of the conventional absorption and emission spectra suggests weakening of the solvent-solute H-bonds upon optical excitation, which is in contrast to the results gained by the quantum simulations and earlier studies reported for coumarin derivatives without phosphono groups. The simulations give evidence that the solvent reorganisation around the excited fluorophore leads to partial electron transfer to the first solvation shell. The process occurs on a timescale between 1 and 10 ps depending on the solvent polarity and leads to a fast decay of the time-resolved emission signal. Using the ultrafast spectral shift of the time-dependent fluorescence we estimated the relaxation time of the H-bonds in the electronically excited state to be about 0.6 ps in water, 1.5 ps in ethanol and 2.8 ps in formamide.

  15. Reactions of electron-transfer flavoprotein and electron-transfer flavoprotein: ubiquinone oxidoreductase.

    PubMed Central

    Ramsay, R R; Steenkamp, D J; Husain, M

    1987-01-01

    Electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF-Q oxidoreductase) catalyses the re-oxidation of reduced electron-transfer flavoprotein (ETF) with ubiquinone-1 (Q-1) as the electron acceptor. A kinetic assay for the enzyme was devised in which glutaryl-CoA in the presence of glutaryl-CoA dehydrogenase was used to reduce ETFox. and the reduction of Q-1 was monitored at 275 nm. The partial reactions involved in the overall assay system were examined. Glutaryl-CoA dehydrogenase catalyses the rapid reduction of ETFox. to the anionic semiquinone (ETF.-), but reduces ETF.- to the fully reduced form (ETFhq) at a rate that is about 6-fold lower. ETF.-, but not ETFhq, is directly re-oxidized by Q-1 at a rate that, depending on the steady-state concentration of ETF.-, may contribute significantly to the overall reaction. ETF-Q oxidoreductase catalyses rapid disproportionation of ETF.- with an equilibrium constant of about 1.0 at pH 7.8. In the presence of Q-1 it also catalyses the re-oxidation of ETFhq at a rate that is faster than that of the overall reaction. Rapid-scan experiments indicated the formation of ETF.-, but its fractional concentration in the early stages of the re-oxidation of ETFhq is low. The data indicate that the re-oxidation of ETFhq proceeds at a rate that is adequate to account for the overall rate of electron transfer from glutaryl-CoA to Q-1. An unusual property of ETF-Q oxidoreductase seems to be that it not only catalyses the re-oxidation of the reduced forms of ETF but also facilitates the complete reduction of ETFox. to ETFhq by disproportionation of the radical. PMID:3593226

  16. Ultrafast electronic relaxation in superheated bismuth

    NASA Astrophysics Data System (ADS)

    Gamaly, E. G.; Rode, A. V.

    2013-01-01

    Interaction of moving electrons with vibrating ions in the lattice forms the basis for many physical properties from electrical resistivity and electronic heat capacity to superconductivity. In ultrafast laser interaction with matter the electrons are heated much faster than the electron-ion energy equilibration, leading to a two-temperature state with electron temperature far above that of the lattice. The rate of temperature equilibration is governed by the strength of electron-phonon energy coupling, which is conventionally described by a coupling constant, neglecting the dependence on the electron and lattice temperature. The application of this constant to the observations of fast relaxation rate led to a controversial notion of ‘ultra-fast non-thermal melting’ under extreme electronic excitation. Here we provide theoretical grounds for a strong dependence of the electron-phonon relaxation time on the lattice temperature. We show, by taking proper account of temperature dependence, that the heating and restructuring of the lattice occurs much faster than were predicted on the assumption of a constant, temperature independent energy coupling. We applied the temperature-dependent momentum and energy transfer time to experiments on fs-laser excited bismuth to demonstrate that all the observed ultra-fast transformations of the transient state of bismuth are purely thermal in nature. The developed theory, when applied to ultrafast experiments on bismuth, provides interpretation of the whole variety of transient phase relaxation without the non-thermal melting conjecture.

  17. The Role of Microbial Electron Transfer in the Coevolution of the Biosphere and Geosphere.

    PubMed

    Jelen, Benjamin I; Giovannelli, Donato; Falkowski, Paul G

    2016-09-08

    All life on Earth is dependent on biologically mediated electron transfer (i.e., redox) reactions that are far from thermodynamic equilibrium. Biological redox reactions originally evolved in prokaryotes and ultimately, over the first ∼2.5 billion years of Earth's history, formed a global electronic circuit. To maintain the circuit on a global scale requires that oxidants and reductants be transported; the two major planetary wires that connect global metabolism are geophysical fluids-the atmosphere and the oceans. Because all organisms exchange gases with the environment, the evolution of redox reactions has been a major force in modifying the chemistry at Earth's surface. Here we briefly review the discovery and consequences of redox reactions in microbes with a specific focus on the coevolution of life and geochemical phenomena.

  18. Energy transfer in a mechanically trapped exciplex.

    PubMed

    Klosterman, Jeremy K; Iwamura, Munetaka; Tahara, Tahei; Fujita, Makoto

    2009-07-15

    Host-guest complexes involving M(6)L(4) coordination cages can display unusual photoreactivity, and enclathration of the very large fluorophore bisanthracene resulted in an emissive, mechanically trapped intramolecular exciplex. Mechanically linked intramolecular exciplexes are important for understanding the dependence of energy transfer on donor-acceptor distance, orientation, and electronic coupling but are relatively unexplored. Steady-state and picosecond time-resolved fluorescence measurements have revealed that selective excitation of the encapsulated guest fluorophore results in efficient energy transfer from the excited guest to an emissive host-guest exciplex state.

  19. Diabatization for Time-Dependent Density Functional Theory: Exciton Transfers and Related Conical Intersections.

    PubMed

    Tamura, Hiroyuki

    2016-11-23

    Intermolecular exciton transfers and related conical intersections are analyzed by diabatization for time-dependent density functional theory. The diabatic states are expressed as a linear combination of the adiabatic states so as to emulate the well-defined reference states. The singlet exciton coupling calculated by the diabatization scheme includes contributions from the Coulomb (Förster) and electron exchange (Dexter) couplings. For triplet exciton transfers, the Dexter coupling, charge transfer integral, and diabatic potentials of stacked molecules are calculated for analyzing direct and superexchange pathways. We discuss some topologies of molecular aggregates that induce conical intersections on the vanishing points of the exciton coupling, namely boundary of H- and J-aggregates and T-shape aggregates, as well as canceled exciton coupling to the bright state of H-aggregate, i.e., selective exciton transfer to the dark state. The diabatization scheme automatically accounts for the Berry phase by fixing the signs of reference states while scanning the coordinates.

  20. Influence of Proton Acceptors on the Proton-Coupled Electron Transfer Reaction Kinetics of a Ruthenium-Tyrosine Complex.

    PubMed

    Lennox, J Christian; Dempsey, Jillian L

    2017-11-22

    A polypyridyl ruthenium complex with fluorinated bipyridine ligands and a covalently bound tyrosine moiety was synthesized, and its photo-induced proton-coupled electron transfer (PCET) reactivity in acetonitrile was investigated with transient absorption spectroscopy. Using flash-quench methodology with methyl viologen as an oxidative quencher, a Ru 3+ species is generated that is capable of initiating the intramolecular PCET oxidation of the tyrosine moiety. Using a series of substituted pyridine bases, the reaction kinetics were found to vary as a function of proton acceptor concentration and identity, with no significant H/D kinetic isotope effect. Through analysis of the kinetics traces and comparison to a control complex without the tyrosine moiety, PCET reactivity was found to proceed through an equilibrium electron transfer followed by proton transfer (ET-PT) pathway in which irreversible deprotonation of the tyrosine radical cation shifts the ET equilibrium, conferring a base dependence on the reaction. Comprehensive kinetics modeling allowed for deconvolution of complex kinetics and determination of rate constants for each elementary step. Across the five pyridine bases explored, spanning a range of 4.2 pK a units, a linear free-energy relationship was found for the proton transfer rate constant with a slope of 0.32. These findings highlight the influence that proton transfer driving force exerts on PCET reaction kinetics.

  1. Photosynthetic Membranes of Synechocystis or Plants Convert Sunlight to Photocurrent through Different Pathways due to Different Architectures.

    PubMed

    Pinhassi, Roy I; Kallmann, Dan; Saper, Gadiel; Larom, Shirley; Linkov, Artyom; Boulouis, Alix; Schöttler, Mark-Aurel; Bock, Ralph; Rothschild, Avner; Adir, Noam; Schuster, Gadi

    2015-01-01

    Thylakoid membranes contain the redox active complexes catalyzing the light-dependent reactions of photosynthesis in cyanobacteria, algae and plants. Crude thylakoid membranes or purified photosystems from different organisms have previously been utilized for generation of electrical power and/or fuels. Here we investigate the electron transferability from thylakoid preparations from plants or the cyanobacterium Synechocystis. We show that upon illumination, crude Synechocystis thylakoids can reduce cytochrome c. In addition, this crude preparation can transfer electrons to a graphite electrode, producing an unmediated photocurrent of 15 μA/cm2. Photocurrent could be obtained in the presence of the PSII inhibitor DCMU, indicating that the source of electrons is QA, the primary Photosystem II acceptor. In contrast, thylakoids purified from plants could not reduce cyt c, nor produced a photocurrent in the photocell in the presence of DCMU. The production of significant photocurrent (100 μA/cm2) from plant thylakoids required the addition of the soluble electron mediator DCBQ. Furthermore, we demonstrate that use of crude thylakoids from the D1-K238E mutant in Synechocystis resulted in improved electron transferability, increasing the direct photocurrent to 35 μA/cm2. Applying the analogous mutation to tobacco plants did not achieve an equivalent effect. While electron abstraction from crude thylakoids of cyanobacteria or plants is feasible, we conclude that the site of the abstraction of the electrons from the thylakoids, the architecture of the thylakoid preparations influence the site of the electron abstraction, as well as the transfer pathway to the electrode. This dictates the use of different strategies for production of sustainable electrical current from photosynthetic thylakoid membranes of cyanobacteria or higher plants.

  2. Theoretical investigation of the charge-transfer properties in different meso-linked zinc porphyrins for highly efficient dye-sensitized solar cells.

    PubMed

    Namuangruk, Supawadee; Sirithip, Kanokkorn; Rattanatwan, Rattanawelee; Keawin, Tinnagon; Kungwan, Nawee; Sudyodsuk, Taweesak; Promarak, Vinich; Surakhot, Yaowarat; Jungsuttiwong, Siriporn

    2014-06-28

    The charge transfer effect of different meso-substituted linkages on porphyrin analogue 1 (A1, B1 and C1) was theoretically investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) calculations. The calculated geometry parameters and natural bond orbital analysis reveal that the twisted conformation between porphyrin macrocycle and meso-substituted linkages leads to blocking of the conjugation of the conjugated backbone, and the frontier molecular orbital plot shows that the intramolecular charge transfer of A1, B1 and C1 hardly takes place. In an attempt to improve the photoinduced intramolecular charge transfer ability of the meso-linked zinc porphyrin sensitizer, a strong electron-withdrawing group (CN) was introduced into the anchoring group of analogue 1 forming analogue 2 (A2, B2 and C2). The density difference plot of A2, B2 and C2 shows that the charge transfer properties dramatically improved. The electron injection process has been performed using TDDFT; the direct charge-transfer transition in the A2-(TiO2)38 interacting system takes place; our results strongly indicated that introducing electron-withdrawing groups into the acceptor part of porphyrin dyes can fine-tune the effective conjugation length of the π-spacer and improve intramolecular charge transfer properties, consequently inducing the electron injection process from the anchoring group of the porphyrin dye to the (TiO2)38 surface which may improve the conversion efficiency of the DSSCs. Our calculated results can provide valuable information and a promising outlook for computation-aided sensitizer design with anticipated good properties in further experimental synthesis.

  3. Time-dependent calculations of transfer ionization by fast proton-helium collision in one-dimensional kinematics

    NASA Astrophysics Data System (ADS)

    Serov, Vladislav V.; Kheifets, A. S.

    2014-12-01

    We analyze a transfer ionization (TI) reaction in the fast proton-helium collision H++He →H0+He2 ++ e- by solving a time-dependent Schrödinger equation (TDSE) under the classical projectile motion approximation in one-dimensional kinematics. In addition, we construct various time-independent analogs of our model using lowest-order perturbation theory in the form of the Born series. By comparing various aspects of the TDSE and the Born series calculations, we conclude that the recent discrepancies of experimental and theoretical data may be attributed to deficiency of the Born models used by other authors. We demonstrate that the correct Born series for TI should include the momentum-space overlap between the double-ionization amplitude and the wave function of the transferred electron.

  4. pH-Dependent Regulation of the Relaxation Rate of the Radical Anion of the Secondary Quinone Electron Acceptor QB in Photosystem II As Revealed by Fourier Transform Infrared Spectroscopy.

    PubMed

    Nozawa, Yosuke; Noguchi, Takumi

    2018-05-15

    Photosystem II (PSII) is a protein complex that performs water oxidation using light energy during photosynthesis. In PSII, electrons abstracted from water are eventually transferred to the secondary quinone electron acceptor, Q B , and upon double reduction, Q B is converted to quinol by binding two protons. Thus, excess electron transfer in PSII increases the pH of the stroma. In this study, to investigate the pH-dependent regulation of the electron flow in PSII, we have estimated the relaxation rate of the Q B - radical anion in the pH region between 5 and 8 by direct monitoring of its population using light-induced Fourier transform infrared difference spectroscopy. The decay of Q B - by charge recombination with the S 2 state of the water oxidation center in PSII membranes was shown to be accelerated at higher pH, whereas that of Q A - examined in the presence of a herbicide was virtually unaffected at pH ≤7.5 and slightly slowed at pH 8. These observations were consistent with the previous studies that included rather indirect monitoring of the Q B - and Q A - decays using fluorescence detection. The accelerated relaxation of Q B - was explained by the shift of a redox equilibrium between Q A - and Q B - to the Q A - side due to the decrease in the redox potential of Q B at higher pH, which is induced by deprotonation of a single amino acid residue near Q B . It is proposed that this pH-dependent Q B - relaxation is one of the mechanisms of electron flow regulation in PSII for its photoprotection.

  5. Electronic couplings and on-site energies for hole transfer in DNA: Systematic quantum mechanical/molecular dynamic study

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2008-03-01

    The electron hole transfer (HT) properties of DNA are substantially affected by thermal fluctuations of the π stack structure. Depending on the mutual position of neighboring nucleobases, electronic coupling V may change by several orders of magnitude. In the present paper, we report the results of systematic QM/molecular dynamic (MD) calculations of the electronic couplings and on-site energies for the hole transfer. Based on 15ns MD trajectories for several DNA oligomers, we calculate the average coupling squares ⟨V2⟩ and the energies of basepair triplets XG +Y and XA +Y, where X, Y =G, A, T, and C. For each of the 32 systems, 15 000 conformations separated by 1ps are considered. The three-state generalized Mulliken-Hush method is used to derive electronic couplings for HT between neighboring basepairs. The adiabatic energies and dipole moment matrix elements are computed within the INDO/S method. We compare the rms values of V with the couplings estimated for the idealized B-DNA structure and show that in several important cases the couplings calculated for the idealized B-DNA structure are considerably underestimated. The rms values for intrastrand couplings G-G, A-A, G-A, and A-G are found to be similar, ˜0.07eV, while the interstrand couplings are quite different. The energies of hole states G+ and A+ in the stack depend on the nature of the neighboring pairs. The XG +Y are by 0.5eV more stable than XA +Y. The thermal fluctuations of the DNA structure facilitate the HT process from guanine to adenine. The tabulated couplings and on-site energies can be used as reference parameters in theoretical and computational studies of HT processes in DNA.

  6. Mechanism of intramolecular electron transfer in the photoexcited Zn-substituted cytochrome c: theoretical and experimental perspective.

    PubMed

    Tokita, Yuichi; Shimura, Jusuke; Nakajima, Hiroshi; Goto, Yoshio; Watanabe, Yoshihito

    2008-04-16

    Photoinduced electron transfer (ET) in zinc-substituted cytochrome c (Zn-cyt c) has been utilized in many studies on the long-range ET in protein. Attempting to understand its ET mechanism in terms of electronic structure of the molecule, we have calculated an all-electron wave function for the ground-state of Zn-cyt c on the basis of density functional theory (DFT). The four molecular orbitals (MOs) responsible for excitation by UV-vis light (Gouterman's 4-orbitals) are assigned on the basis of the excited states of chromophore model for Zn-porphine complex calculated with the time-dependent DFT method. ET rates between each Gouterman's 4-orbitals and other MOs were estimated using Fermi's golden rule. It appeared that the two occupied MOs of the 4-orbitals show exclusively higher ET rate from/to particular MOs that localize on outermost amino acid residues (Lys 7 or Asn 54), respectively, whereas ET rates involving the two unoccupied MOs of the 4-orbitals are much slower. These results imply that the intramolecular ET in photoexcited Zn-cyt c is governed by the hole transfer through occupied MOs. The couplings of MOs between zinc porphyrin core and specific amino acid residues on the protein surface have been demonstrated in Zn-cyt c immobilized on an Au electrode via carboxylic acid group-terminated self-assembled monolayer. The Zn-cyt c-modified electrode showed photocurrents responsible for photoillumination. The action spectrum of the photocurrent was identical with the absorption spectrum of Zn-cyt c, indicating photoinduced electron conduction via occupied MOs. The voltage dependence of the photocurrent appeared to be linear and bidirectional like a photoconductor, which strongly supports the intramolecular ET mechanism in Zn-cyt c proposed on the basis of the theoretical calculations.

  7. From Cholesterogenesis to Steroidogenesis: Role of Riboflavin and Flavoenzymes in the Biosynthesis of Vitamin D12

    PubMed Central

    Pinto, John T.; Cooper, Arthur J. L.

    2014-01-01

    Flavin-dependent monooxygenases and oxidoreductases are located at critical branch points in the biosynthesis and metabolism of cholesterol and vitamin D. These flavoproteins function as obligatory intermediates that accept 2 electrons from NAD(P)H with subsequent 1-electron transfers to a variety of cytochrome P450 (CYP) heme proteins within the mitochondria matrix (type I) and the (microsomal) endoplasmic reticulum (type II). The mode of electron transfer in these systems differs slightly in the number and form of the flavin prosthetic moiety. In the type I mitochondrial system, FAD-adrenodoxin reductase interfaces with adrenodoxin before electron transfer to CYP heme proteins. In the microsomal type II system, a diflavin (FAD/FMN)-dependent cytochrome P450 oxidoreductase [NAD(P)H-cytochrome P450 reductase (CPR)] donates electrons to a multitude of heme oxygenases. Both flavoenzyme complexes exhibit a commonality of function with all CYP enzymes and are crucial for maintaining a balance of cholesterol and vitamin D metabolites. Deficits in riboflavin availability, imbalances in the intracellular ratio of FAD to FMN, and mutations that affect flavin binding domains and/or interactions with client proteins result in marked structural alterations within the skeletal and central nervous systems similar to those of disorders (inborn errors) in the biosynthetic pathways that lead to cholesterol, steroid hormones, and vitamin D and their metabolites. Studies of riboflavin deficiency during embryonic development demonstrate congenital malformations similar to those associated with genetic alterations of the flavoenzymes in these pathways. Overall, a deeper understanding of the role of riboflavin in these pathways may prove essential to targeted therapeutic designs aimed at cholesterol and vitamin D metabolism. PMID:24618756

  8. Molecular level energy and electron transfer processes at nanocrystalline titanium dioxide interfaces

    NASA Astrophysics Data System (ADS)

    Farzad, Fereshteh

    This thesis describes photo-induced molecular electron and energy transfer processes occurring at nanocrystalline semiconductor interfaces. The Introductory Chapter provides background and describes how these materials may be useful for solar energy conversion. In Chapter 2, results describing excitation of Ru(deeb)(bpy)2 2+, bis(2,2'-bipyridine)(2,2'-bipyridine-4,4 '-diethylester)ruthenium(II) hexafluorophosphate, bound to nanocrystalline TiO2 thin films, immersed in an acetonitrile bath are presented. The data indicates that light excitation forms predominately long-lived metal-to-ligand charge-transfer, MLCT, excited states under these conditions. Modeling of the data as a function of irradiance has been accomplished assuming parallel unimolecular and bimolecular excited state deactivation processes. The quantum yield for excited state formation depends on the excitation irradiance, consistent with triplet-triplet annihilation processes that occur with k > 1 x 108 s-1. Chapter 3 extends the work described in Chapter 2 to LiClO4 acetonitrile solutions. Li+ addition results in a red shift in the MLCT absorption and photoluminescence, PL, and a concentration dependent quenching of the PL intensity on TiO2. The Li+ induced spectroscopic changes were found to be reversible by varying the electrolyte composition. A second-order kinetic model quantified charge recombination transients. A model is proposed wherein Li+ ion adsorption stabilizes TiO2 acceptor states resulting in energetically more favorable interfacial electron transfer. The photophysical and photoelectrochemical properties of porous nanocrystalline anatase TiO2 electrodes modified with Ru(deeb)(bpy)2 2+, Os(deeb)(bpy)22+, and mixtures of both are described in Chapters 4 and 5. In regenerative solar cells with 0.5 M LiI/0.05 M I2 acetonitrile electrolyte, both compounds efficiently inject electrons into TiO2 producing monochromatic incident photon-to-current efficiencies (IPCE), IPCE (460 nm) = 0.70 + 0.05 for Ru(dcb)(bpy)2 2+/TiO2 and 0. 10 + 0.05 for Os(dcb)(bpy)2 2+/TiO2. Os(dcb)(bpy)22+ extends the spectral sensitivity of the TiO2 material beyond 700 rim. Application of a negative bias to the derivatized TiO2 surfaces results in inefficient interfacial electron transfer and no significant photocurrent. Instead, lateral energy transfer cross the nanocrystalline TiO2 surface from Ru(dcb)(bpy)22+* to Os(dcb)(bpy) 22+ is observed. The energy transfer process can be switched off with a positive applied bias ten times with no significant deterioration. The results demonstrate control of molecular excited states at nanostructured interfaces.

  9. Ab initio characterization of electron transfer coupling in photoinduced systems: generalized Mulliken-Hush with configuration-interaction singles.

    PubMed

    Chen, Hung-Cheng; Hsu, Chao-Ping

    2005-12-29

    To calculate electronic couplings for photoinduced electron transfer (ET) reactions, we propose and test the use of ab initio quantum chemistry calculation for excited states with the generalized Mulliken-Hush (GMH) method. Configuration-interaction singles (CIS) is proposed to model the locally excited (LE) and charge-transfer (CT) states. When the CT state couples with other high lying LE states, affecting coupling values, the image charge approximation (ICA), as a simple solvent model, can lower the energy of the CT state and decouple the undesired high-lying local excitations. We found that coupling strength is weakly dependent on many details of the solvent model, indicating the validity of the Condon approximation. Therefore, a trustworthy value can be obtained via this CIS-GMH scheme, with ICA used as a tool to improve and monitor the quality of the results. Systems we tested included a series of rigid, sigma-linked donor-bridge-acceptor compounds where "through-bond" coupling has been previously investigated, and a pair of molecules where "through-space" coupling was experimentally demonstrated. The calculated results agree well with experimentally inferred values in the coupling magnitudes (for both systems studied) and in the exponential distance dependence (for the through-bond series). Our results indicate that this new scheme can properly account for ET coupling arising from both through-bond and through-space mechanisms.

  10. Charge Transfer Enhancement in the D-π-A Type Porphyrin Dyes: A Density Functional Theory (DFT) and Time-Dependent Density Functional Theory (TD-DFT) Study.

    PubMed

    Kang, Guo-Jun; Song, Chao; Ren, Xue-Feng

    2016-11-25

    The electronic geometries and optical properties of two D-π-A type zinc porphyrin dyes (NCH₃-YD2 and TPhe-YD) were systematically investigated by density functional theory (DFT) and time-dependent density functional theory (TD-DFT) to reveal the origin of significantly altered charge transfer enhancement by changing the electron donor of the famous porphyrin-based sensitizer YD2-o-C8. The molecular geometries and photophysical properties of dyes before and after binding to the TiO₂ cluster were fully investigated. From the analyses of natural bond orbital (NBO), extended charge decomposition analysis (ECDA), and electron density variations (Δρ) between the excited state and ground state, it was found that the introduction of N(CH₃)₂ and 1,1,2-triphenylethene groups enhanced the intramolecular charge-transfer (ICT) character compared to YD2-o-C8. The absorption wavelength and transition possess character were significantly influenced by N(CH₃)₂ and 1,1,2-triphenylethene groups. NCH₃-YD2 with N(CH₃)₂ groups in the donor part is an effective way to improve the interactions between the dyes and TiO₂ surface, light having efficiency (LHE), and free energy change (ΔG inject ), which is expected to be an efficient dye for use in dye-sensitized solar cells (DSSCs).

  11. Construction and direct electrochemistry of orientation controlled laccase electrode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Ying; Zhang, Jiwei; Huang, Xirong, E-mail: xrhuang@sdu.edu.cn

    2014-03-28

    Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, usingmore » genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.« less

  12. Scaling relationships for nonadiabatic energy relaxation times in warm dense matter: toward understanding the equation of state.

    PubMed

    Pradhan, Ekadashi; Magyar, Rudolph J; Akimov, Alexey V

    2016-11-30

    Understanding the dynamics of electron-ion energy transfer in warm dense (WD) matter is important to the measurement of equation of state (EOS) properties and for understanding the energy balance in dynamic simulations. In this work, we present a comprehensive investigation of nonadiabatic electron relaxation and thermal excitation dynamics in aluminum under high pressure and temperature. Using quantum-classical trajectory surface hopping approaches, we examine the role of nonadiabatic couplings and electronic decoherence in electron-nuclear energy transfer in WD aluminum. The computed timescales range from 400 fs to 4.0 ps and are consistent with existing experimental studies. We have derived general scaling relationships between macroscopic parameters of WD systems such as temperature or mass density and the timescales of energy redistribution between quantum and classical degrees of freedom. The scaling laws are supported by computational results. We show that electronic decoherence plays essential role and can change the functional dependencies qualitatively. The established scaling relationships can be of use in modelling of WD matter.

  13. Regulation of electron transfer processes affects phototrophic mat structure and activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ha, Phuc T.; Renslow, Ryan S.; Atci, Erhan

    Phototrophic microbial mats are among the most diverse ecosystems in nature. These systems undergo daily cycles in redox potential caused by variations in light energy input and metabolic interactions among the microbial species. In this work, solid electrodes with controlled potentials were placed under mats to study the electron transfer processes between the electrode and the microbial mat. The phototrophic microbial mat was harvested from Hot Lake, a hypersaline, epsomitic lake located near Oroville (Washington, USA). We operated two reactors: graphite electrodes were polarized at potentials of -700 mV Ag/AgCl [cathodic (CAT) mat system] and +300 mV Ag/AgCl [anodic (AN)more » mat system] and the electron transfer rates between the electrode and mat were monitored. We observed a diel cycle of electron transfer rates for both AN and CAT mat systems. Interestingly, the CAT mats generated the highest reducing current at the same time points that the AN mats showed the highest oxidizing current. To characterize the physicochemical factors influencing electron transfer processes, we measured depth profiles of dissolved oxygen (DO) and sulfide in the mats using microelectrodes. We further demonstrated that the mat-to-electrode and electrode-to-mat electron transfer rates were light- and temperature-dependent. Using nuclear magnetic resonance (NMR) imaging, we determined that the electrode potential regulated the diffusivity and porosity of the microbial mats. Both porosity and diffusivity were higher in the CAT mats than in the AN mats. We also used NMR spectroscopy for high-resolution quantitative metabolite analysis and found that the CAT mats had significantly higher concentrations of osmoprotectants such as betaine and trehalose. Subsequently, we performed amplicon sequencing across the V4 region of the 16S rRNA gene of incubated mats to understand the impact of electrode potential on microbial community structure. In conclusion, these data suggested that variation in the electrochemical conditions under which mats were generated significantly impacted the relative abundances of mat members and mat metabolism.« less

  14. Regulation of electron transfer processes affects phototrophic mat structure and activity

    DOE PAGES

    Ha, Phuc T.; Renslow, Ryan S.; Atci, Erhan; ...

    2015-09-03

    Phototrophic microbial mats are among the most diverse ecosystems in nature. These systems undergo daily cycles in redox potential caused by variations in light energy input and metabolic interactions among the microbial species. In this work, solid electrodes with controlled potentials were placed under mats to study the electron transfer processes between the electrode and the microbial mat. The phototrophic microbial mat was harvested from Hot Lake, a hypersaline, epsomitic lake located near Oroville (Washington, USA). We operated two reactors: graphite electrodes were polarized at potentials of -700 mV Ag/AgCl [cathodic (CAT) mat system] and +300 mV Ag/AgCl [anodic (AN)more » mat system] and the electron transfer rates between the electrode and mat were monitored. We observed a diel cycle of electron transfer rates for both AN and CAT mat systems. Interestingly, the CAT mats generated the highest reducing current at the same time points that the AN mats showed the highest oxidizing current. To characterize the physicochemical factors influencing electron transfer processes, we measured depth profiles of dissolved oxygen (DO) and sulfide in the mats using microelectrodes. We further demonstrated that the mat-to-electrode and electrode-to-mat electron transfer rates were light- and temperature-dependent. Using nuclear magnetic resonance (NMR) imaging, we determined that the electrode potential regulated the diffusivity and porosity of the microbial mats. Both porosity and diffusivity were higher in the CAT mats than in the AN mats. We also used NMR spectroscopy for high-resolution quantitative metabolite analysis and found that the CAT mats had significantly higher concentrations of osmoprotectants such as betaine and trehalose. Subsequently, we performed amplicon sequencing across the V4 region of the 16S rRNA gene of incubated mats to understand the impact of electrode potential on microbial community structure. In conclusion, these data suggested that variation in the electrochemical conditions under which mats were generated significantly impacted the relative abundances of mat members and mat metabolism.« less

  15. Dynamics of exciton transfer in coupled polymer chains.

    PubMed

    Zhang, Y L; Liu, X J; Sun, Z; An, Z

    2013-05-07

    The dynamics of singlet and triplet exciton transfer in coupled polymer chains are investigated within the Su-Schrieffer-Heeger+Pariser-Parr-Pople model including both electron-phonon (e-p) coupling and electron-electron (e-e) interactions, using a multi-configurational time-dependent Hartree-Fock dynamic method. In order to explain the processes involved, the effects of on-site and long-range e-e interactions on the locality of the singlet and triplet excitons are first investigated on an isolated chain. It is found that the locality of the singlet exciton decreases, while the locality of the triplet exciton increases with an increase in the on-site e-e interactions. On the other hand, an increase in the long-range e-e interaction results in a more localized singlet exciton and triplet exciton. In coupled polymer chains, we then quantitatively show the yields of singlet and triplet exciton transfer products under the same interchain coupling. It is found that the yield of singlet interchain excitons is much higher than that of triplet interchain excitons, that is to say, singlet exciton transfer is significantly easier than that for triplet excitons. This results from the fact that the singlet exciton is more delocalized than the triplet exciton. In addition, hopping of electrons with opposite spins between the coupled chains can facilitate the transfer of singlet excitons. The results are of great significance for understanding the photoelectric conversion process and developing high-power organic optoelectronic applications.

  16. Real-time observation of intramolecular proton transfer in the electronic ground state of chloromalonaldehyde: an ab initio study of time-resolved photoelectron spectra.

    PubMed

    do N Varella, Márcio T; Arasaki, Yasuki; Ushiyama, Hiroshi; Takatsuka, Kazuo; Wang, Kwanghsi; McKoy, Vincent

    2007-02-07

    The authors report on studies of time-resolved photoelectron spectra of intramolecular proton transfer in the ground state of chloromalonaldehyde, employing ab initio photoionization matrix elements and effective potential surfaces of reduced dimensionality, wherein the couplings of proton motion to the other molecular vibrational modes are embedded by averaging over classical trajectories. In the simulations, population is transferred from the vibrational ground state to vibrationally hot wave packets by pumping to an excited electronic state and dumping with a time-delayed pulse. These pump-dump-probe simulations demonstrate that the time-resolved photoelectron spectra track proton transfer in the electronic ground state well and, furthermore, that the geometry dependence of the matrix elements enhances the tracking compared with signals obtained with the Condon approximation. Photoelectron kinetic energy distributions arising from wave packets localized in different basins are also distinguishable and could be understood, as expected, on the basis of the strength of the optical couplings in different regions of the ground state potential surface and the Franck-Condon overlaps of the ground state wave packets with the vibrational eigenstates of the ion potential surface.

  17. Energy and charge transfer in ionized argon coated water clusters.

    PubMed

    Kočišek, J; Lengyel, J; Fárník, M; Slavíček, P

    2013-12-07

    We investigate the electron ionization of clusters generated in mixed Ar-water expansions. The electron energy dependent ion yields reveal the neutral cluster composition and structure: water clusters fully covered with the Ar solvation shell are formed under certain expansion conditions. The argon atoms shield the embedded (H2O)n clusters resulting in the ionization threshold above ≈15 eV for all fragments. The argon atoms also mediate more complex reactions in the clusters: e.g., the charge transfer between Ar(+) and water occurs above the threshold; at higher electron energies above ~28 eV, an excitonic transfer process between Ar(+)* and water opens leading to new products Ar(n)H(+) and (H2O)(n)H(+). On the other hand, the excitonic transfer from the neutral Ar* state at lower energies is not observed although this resonant process was demonstrated previously in a photoionization experiment. Doubly charged fragments (H2O)(n)H2(2+) and (H2O)(n)(2+) ions are observed and Intermolecular Coulomb decay (ICD) processes are invoked to explain their thresholds. The Coulomb explosion of the doubly charged cluster formed within the ICD process is prevented by the stabilization effect of the argon solvent.

  18. On the transferability of electron density in binary vanadium borides VB, V3B4 and VB2.

    PubMed

    Terlan, Bürgehan; Akselrud, Lev; Baranov, Alexey I; Borrmann, Horst; Grin, Yuri

    2015-12-01

    Binary vanadium borides are suitable model systems for a systematic analysis of the transferability concept in intermetallic compounds due to chemical intergrowth in their crystal structures. In order to underline this structural relationship, topological properties of the electron density in VB, V3B4 and VB2 reconstructed from high-resolution single-crystal X-ray diffraction data as well as derived from quantum chemical calculations, are analysed in terms of Bader's Quantum Theory of Atoms in Molecules [Bader (1990). Atoms in Molecules: A Quantum Theory, 1st ed. Oxford: Clarendon Press]. The compounds VB, V3B4 and VB2 are characterized by a charge transfer from the metal to boron together with two predominant atomic interactions, the shared covalent B-B interactions and the polar covalent B-M interactions. The resembling features of the crystal structures are well reflected by the respective B-B interatomic distances as well as by ρ(r) values at the B-B bond critical points. The latter decrease with an increase in the corresponding interatomic distances. The B-B bonds show transferable electron density properties at bond critical points depending on the respective bond distances.

  19. L-tryptophan-induced electron transport across supported lipid bilayers: an alkyl-chain tilt-angle, and bilayer-symmetry dependence.

    PubMed

    Sarangi, Nirod Kumar; Patnaik, Archita

    2012-12-21

    Molecular orientation-dependent electron transport across supported 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) lipid bilayers (SLBs) on semiconducting indium tin oxide (ITO) is reported with an aim towards potential nanobiotechnological applications. A bifunctional strategy is adopted to form symmetric and asymmetric bilayers of DPPC that interact with L-tryptophan, and are analyzed by surface manometry and atomic force microscopy. Polarization-dependent real-time Fourier transform infrared reflection absorption spectroscopy (FT-IRRAS) analysis of these SLBs reveals electrostatic, hydrogen-bonding, and cation-π interactions between the polar head groups of the lipid and the indole side chains. Consequently, a molecular tilt arises from the effective interface dipole, facilitating electron transport across the ITO-anchored SLBs in the presence of an internal Fe(CN)(6)(4-/3-) redox probe. The incorporation of tryptophan enhances the voltammetric features of the SLBs. The estimated electron-transfer rate constants for symmetric and asymmetric bilayers (k(s) = 2.0×10(-2) and 2.8×10(-2) s(-1)) across the two-dimensional (2D) ordered DPPC/tryptophan SLBs are higher compared to pure DPPC SLBs (k(s) = 3.2×10(-3) and 3.9×10(-3) s(-1)). In addition, they are molecular tilt-dependent, as it is the case with the standard apparent rate constants k(app)(0), estimated from electrochemical impedance spectroscopy and bipotentiostatic experiments with a Pt ultramicroelectrode. Lower magnitudes of k(s) and k(app)(0) imply that electrochemical reactions across the ITO-SLB electrodes are kinetically limited and consequently governed by electron tunneling across the SLBs. Standard theoretical rate constants (k(th)(0)) accrued upon electron tunneling comply with the potential-independent electron-tunneling coefficient β = 0.15 Å(-1). Insulator-semiconductor transitions moving from a liquid-expanded to a condensed 2D-phase state of the SLBs are noted, adding a new dimension to their transport behavior. These results highlight the role of tryptophan in expediting electron transfer across lipid bilayer membranes in a cellular environment and can provide potential clues towards patterned lipid nanocomposites and devices. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Chemical Constraints Governing the Origin of Metabolism: The Thermodynamic Landscape of Carbon Group Transformations

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; Fonda, Mark (Technical Monitor)

    2001-01-01

    The thermodynamics of organic chemistry under mild aqueous conditions was examined in order to begin to understand its influence on the structure and operation of metabolism and its antecedents. Free energies were estimated for four types reactions of biochemical importance carbon-carbon bond cleavage and synthesis, hydrogen transfer between carbon groups, dehydration of alcohol groups, and aldo-keto isomerization. The energies were calculated for mainly aliphatic groups composed of carbon, hydrogen, and oxygen. The energy values showed that (1) when carbon-carbon bond cleavage involves two different types of functional groups, transfer of the shared electron-pair to the more reduced carbon group is energetically favored over transfer to the more oxidized carbon group, and (2) the energy of carbon-carbon bond transformation is strongly dependent on the type of functional group that donates the shared electron-pair during cleavage, and the group that accepts the shared electron-pair during synthesis, and (3) the energetics of C-C bond transformation is determined primarily by the half-reaction energies of the couples: carbonyl/carboxylic acid, carboxylic acid/carbon dioxide, alcohol/carbonyl, and hydrocarbon/alcohol. The energy of hydrogen-transfer between carbon groups was found to depend on the functional group class of both the hydrogen-donor and hydrogen-acceptor. From these and other observations we concluded that the chemistry of the origin of metabolism (and to a lesser degree modem metabolism) is strongly constrained by the (1) limited disproportionation energy of organic substrates that can be dissipated in a few irreversible reactions, (2) the energy-dominance of few half-reaction couples in carbon-carbon bond transformation that establishes whether a chemical reaction is energetically irreversible, reversible or unfeasible, and (3) the dependence of the transformation-energy on the oxidation state of carbon groups (functional group type) which is contingent on prior reactions in the synthetic pathway.

  1. Orbitally dependent kinetic exchange in a heterobimetallic pair: Ferromagnetic spin alignment and magnetic anisotropy in the cyano-bridged Cr(III)Fe(II) dimer

    NASA Astrophysics Data System (ADS)

    Palii, A. V.; Tsukerblat, B. S.; Verdaguer, M.

    2002-11-01

    The problem of the kinetic exchange interaction in the cyanide-bridged heterobinuclear dimers involving orbitally degenerate transition metal ions is considered. The developed approach is based on the concept of the effective Hamiltonian of the orbitally dependent kinetic exchange. We deduce this many-electron Hamiltonian on the microscopic background so that all relevant biorbital transfer processes are taken into account as well as the properties of the many-electron states. The bioctahedral cyanide-bridged Cr(III)Fe(II) dimer is considered in detail as an example distinctly exhibiting new quantitative and qualitative features of the orbitally dependent exchange and as a structural unit of three-dimensional ferromagnetic crystals {Fe(II)3)Cr(III)(CN62}[middle dot]13H2O. The proposed mechanism of the kinetic exchange involves the electron transfer from the double occupied t2 orbitals of Fe(II) [ground state 5T2(t2)4e2] to the half occupied t2 orbitals of Cr(III) [ground state 4A2(t2)3] resulting in the charge transfer state 3T1(t2)4Cr(II)- 6A1(t2)3e2 Fe(III) and the transfer between the half-occupied t2 orbitals of the metal ions resulting in the charge transfer state 3T1(t2)4Cr(II)- 4T2(t2)3e2 Fe(III). The effective Hamiltonian of the orbitally dependent exchange for the Cr(III)Fe(II) pair deduced within this theoretical framework describes competitive ferro- and antiferromagnetic contributions arising from these two charge transfer states. This Hamiltonian leads to a complex energy pattern, consisting of two interpenetrating Heisenberg-like schemes, one exhibiting ferromagnetic and another one antiferromagnetic splitting. The condition for the ferromagnetic spin alignment in the ground state is deduced. The orbitally dependent terms of the Hamiltonian are shown to give rise to a strong magnetic anisotropy of the system, this result as well as the condition for the spin alignment in the ground term are shown to be out of the scope of the Goodenough-Kanamori rules. Along with the full spin S the energy levels are labeled by the orbital quantum numbers providing thus the direct information about the magnetic anisotropy of the system. Under a reasonable estimation of the excitation energies based on the optical absorption data we conclude that the kinetic exchange in the cyanide-bridged Cr(III)Fe(II) pair leads to the ferromagnetic spin alignment exhibiting at the same time strong axial magnetic anisotropy with C4 easy axis of magnetization.

  2. Role of Au(NPs) in the enhanced response of Au(NPs)-decorated MWCNT electrochemical biosensor

    PubMed Central

    Mehmood, Shahid; Ciancio, Regina; Carlino, Elvio; Bhatti, Arshad S

    2018-01-01

    Background The combination of Au-metallic-NPs and CNTs are a new class of hybrid nanomaterials for the development of electrochemical biosensor. Concentration of Au(nanoparticles [NPs]) in the electrochemical biosensor is crucial for the efficient charge transfer between the Au-NPs-MWCNTs modified electrode and electrolytic solution. Methods In this work, the charge transfer kinetics in the glassy carbon electrode (GCE) modified with Au(NPs)–multiwalled carbon nanotube (MWCNT) nanohybrid with varied concentrations of Au(NPs) in the range 40–100 nM was studied using electrochemical impedance spectroscopy (EIS). Field emission scanning electron microscopy and transmission electron microscopy confirmed the attachment of Au(NPs) on the surface of MWCNTs. Results The cyclic voltammetry and EIS results showed that the charge transfer mechanism was diffusion controlled and the rate of charge transfer was dependent on the concentration of Au(NPs) in the nanohybrid. The formation of spherical diffusion zone, which was dependent on the concentration of Au(NPs) in nanohybrids, was attributed to result in 3 times the increase in the charge transfer rate ks, 5 times increase in mass transfer, and 5% (9%) increase in Ipa (Ipc) observed in cyclic voltammetry in 80 nM Au(NP) nanohybrid-modified GCE from MWCNT-modified GCE. The work was extended to probe the effect of charge transfer rates at various concentrations of Au(NPs) in the nanohybrid-modified electrodes in the presence of Escherichia coli. The cyclic voltammetry results clearly showed the best results for 80 nM Au(NPs) in nanohybrid electrode. Conclusion The present study suggested that the formation of spherical diffusion zone in nanohybrid-modified electrodes is critical for the enhanced electrochemical biosensing applications. PMID:29713161

  3. Exploring the energy landscape for Q(A)(-) to Q(B) electron transfer in bacterial photosynthetic reaction centers: effect of substrate position and tail length on the conformational gating step.

    PubMed

    Xu, Qiang; Baciou, Laura; Sebban, Pierre; Gunner, M R

    2002-08-06

    The ability to initiate reactions with a flash of light and to monitor reactions over a wide temperature range allows detailed analysis of reaction mechanisms in photosynthetic reaction centers (RCs) of purple bacteria. In this protein, the electron transfer from the reduced primary quinone (Q(A)(-)) to the secondary quinone (Q(B)) is rate-limited by conformational changes rather than electron tunneling. Q(B) movement from a distal to a proximal site has been proposed to be the rate-limiting change. The importance of quinone motion was examined by shortening the Q(B) tail from 50 to 5 carbons. No change in rate was found from 100 to 300 K. The temperature dependence of the rate was also measured in three L209 proline mutants. Under conditions where Q(B) is in the distal site in wild-type RCs, it is trapped in the proximal site in the Tyr L209 mutant [Kuglstatter, A., et al. (2001) Biochemistry 40, 4253-4260]. The electron transfer slows at low temperature for all three mutants as it does in wild-type protein, indicating that conformational changes still limit the reaction rate. Thus, Q(B) movement is unlikely to be the sole, rate-limiting conformational gating step. The temperature dependence of the reaction in the L209 mutants differs somewhat from wild-type RCs. Entropy-enthalpy compensation reduces the difference in rates and free energy changes at room temperature.

  4. Photoinduced charge separation in a colloidal system of exfoliated layered semiconductor controlled by coexisting aluminosilicate clay.

    PubMed

    Nakato, Teruyuki; Yamada, Yoshimi; Miyamoto, Nobuyoshi

    2009-02-05

    We investigated photoinduced charge separation occurring in a multicomponent colloidal system composed of oxide nanosheets of photocatalytically active niobate and photochemically inert clay and electron accepting methylviologen dications (MV2+). The inorganic nanosheets were obtained by exfoliation of layered hexaniobate and hectorite clay. The niobate and clay nanosheets were spatially separated in the colloidally dispersed state, and the MV2+ molecules were selectively adsorbed on the clay platelets. UV irradiation of the colloids led to electron transfer from the niobate nanosheets to the MV2+ molecules adsorbed on clay. The photoinduced electron transfer produced methylviologen radical cations (MV*+), which was characterized by high yield and long lifetime. The yield and stability of the MV*+ species were found to depend strongly on the clay content of the colloid: from a few mol % to approximately 70 mol % of the yield and several tens of minutes to more than 40 h of the lifetime. The contents of the niobate nanosheets and MV2+ molecules and the aging of the colloid also affected the photoinduced charge separation. In the absence of MV2+ molecules in the colloid, UV irradiation induced electron accumulation in the niobate nanosheets. The stability of the electron-accumulated state also depended on the clay content. The variation in the photochemical behavior is discussed in relation to the viscosity of the colloid.

  5. UV-radiation-induced electron emission by hormones. Hypothesis for specific communication mechanisms

    NASA Astrophysics Data System (ADS)

    Getoff, Nikola

    2009-11-01

    The highlights of recently observed electron emission from electronically excited sexual hormones (17β-estradiol, progesterone, testosterone) and the phytohormone genistein in polar media are briefly reviewed. The electron yield, Q(e aq-), dependence from substrate concentration, hormone structure, polarity of solvent, absorbed energy and temperature are discussed. The hormones reactivity with e aq- and efficiency in electron transfer ensure them the ability to communicate with other biological systems in an organism. A hypothesis is presented for the explanation of the mechanisms of the distinct recognition of signals transmitted by electrons, originating from different types of hormones to receiving centres. Biological consequences of the electron emission in respect to cancer are mentioned.

  6. Unravelling the pH-dependence of a molecular photocatalytic system for hydrogen production.

    PubMed

    Reynal, Anna; Pastor, Ernest; Gross, Manuela A; Selim, Shababa; Reisner, Erwin; Durrant, James R

    2015-08-01

    Photocatalytic systems for the reduction of aqueous protons are strongly pH-dependent, but the origin of this dependency is still not fully understood. We have studied the effect of different degrees of acidity on the electron transfer dynamics and catalysis taking place in a homogeneous photocatalytic system composed of a phosphonated ruthenium tris(bipyridine) dye ( RuP ) and a nickel bis(diphosphine) electrocatalyst ( NiP ) in an aqueous ascorbic acid solution. Our approach is based on transient absorption spectroscopy studies of the efficiency of photo-reduction of RuP and NiP correlated with pH-dependent photocatalytic H 2 production and the degree of catalyst protonation. The influence of these factors results in an observed optimum photoactivity at pH 4.5 for the RuP - NiP system. The electron transfer from photo-reduced RuP to NiP is efficient and independent of the pH value of the medium. At pH <4.5, the efficiency of the system is limited by the yield of RuP photo-reduction by the sacrificial electron donor, ascorbic acid. At pH >4.5, the efficiency of the system is limited by the poor protonation of NiP , which inhibits its ability to reduce protons to hydrogen. We have therefore developed a rational strategy utilising transient absorption spectroscopy combined with bulk pH titration, electrocatalytic and photocatalytic experiments to disentangle the complex pH-dependent activity of the homogenous RuP - NiP photocatalytic system, which can be widely applied to other photocatalytic systems.

  7. Electron transfer between cytochrome. alpha. and copper A in cytochrome c oxidase: A perturbed equilibrium study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morgan, J.E.; Li, P.M.; Jang, D.J.

    1989-08-22

    Intramolecular electron transfer in partially reduced cytochrome c oxidase has been studied by the perturbed equilibrium method. The authors have prepared a three-electron-reduced, CO-inhibited form of the enzyme in which cytochrome a and copper A are partially reduced and in an intramolecular redox equilibrium. When these samples were irradiated with a nitrogen laser to photodissociate the bound CO, changes in absorbance at 598 and 830 nm were observed which were consistent with a fast electron transfer from cytochrome a to copper A. The absorbance changes at 598 nm gave an apparent rate of 17,000 {plus minus} 2,000 s{sup {minus}1} (1more » {sigma}), at pH 7.0 and 25.5{degree}C. These changes were not observed in either the CO mixed-valence or the CO-inhibited fully reduced forms of the enzyme. The rate was fastest at about pH 8.0, falling off toward both lower and higher pHs. There was a small but clear temperature dependence. The process was also observed in the cytochrome c-cytochrome c oxidase high-affinity complex. The electron equilibration measured between cytochrome {alpha} and copper A is far faster than any rate measured or inferred previously for this process.« less

  8. Chemical strain-dependent two-dimensional transport at R AlO 3 / SrTiO 3 interfaces ( R = La , Nd , Sm , and Gd )

    DOE PAGES

    Li, Chen; Shen, Xuan; Yang, Yurong; ...

    2016-12-27

    Perovskite RAlO 3 (R = La, Nd, Sm, and Gd) films have been deposited epitaxially on (001) TiO 2-terminated SrTiO 3 substrates. In this paper, it is observed that the two-dimensional transport characteristics at the RAlO 3/SrTiO 3 interfaces are very sensitive to the species of rare-earth element, that is to chemical strain. Although electron energy loss spectroscopy measurements show that electron transfer occurs in all the four polar/nonpolar heterostructures, the amount of electrons transferred across SmAlO 3/SrTiO 3 and GdAlO 3/SrTiO 3 interfaces are much less than those across LaAlO 3/SrTiO 3 and NdAlO 3/SrTiO 3 interfaces. First-principles calculationsmore » reveal the competition between ionic polarization and electronic polarization in the polar layers in compensating the build-in polarization due to the polar discontinuity at the interface. Finally, in particular, a large ionic polarization is found in SmAlO 3/SrTiO 3 and GdAlO 3/SrTiO 3 systems (which experience the largest tensile epitaxial strain), hence reducing the amount of electrons transferred.« less

  9. All-optical photochromic spatial light modulators based on photoinduced electron transfer in rigid matrices

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Perry, Joseph W. (Inventor)

    1991-01-01

    A single material (not a multi-element structure) spatial light modulator may be written to, as well as read out from, using light. The device has tailorable rise and hold times dependent on the composition and concentration of the molecular species used as the active components. The spatial resolution of this device is limited only by light diffraction as in volume holograms. The device may function as a two-dimensional mask (transmission or reflection) or as a three-dimensional volume holographic medium. This device, based on optically-induced electron transfer, is able to perform incoherent to coherent image conversion or wavelength conversion over a wide spectral range (ultraviolet, visible, or near-infrared regions).

  10. GPU-accelerated computation of electron transfer.

    PubMed

    Höfinger, Siegfried; Acocella, Angela; Pop, Sergiu C; Narumi, Tetsu; Yasuoka, Kenji; Beu, Titus; Zerbetto, Francesco

    2012-11-05

    Electron transfer is a fundamental process that can be studied with the help of computer simulation. The underlying quantum mechanical description renders the problem a computationally intensive application. In this study, we probe the graphics processing unit (GPU) for suitability to this type of problem. Time-critical components are identified via profiling of an existing implementation and several different variants are tested involving the GPU at increasing levels of abstraction. A publicly available library supporting basic linear algebra operations on the GPU turns out to accelerate the computation approximately 50-fold with minor dependence on actual problem size. The performance gain does not compromise numerical accuracy and is of significant value for practical purposes. Copyright © 2012 Wiley Periodicals, Inc.

  11. Intramolecular and Lattice Dynamics in V6-nIVVnV O7(OCH3)12 Crystal

    NASA Astrophysics Data System (ADS)

    Yablokov, Yu. V.; Augustyniak-Jabłokow, M. A.; Borshch, S.; Daniel, C.; Hartl, H.

    2006-08-01

    Multi-nuclear mixed-valence clusters V4IVV2VO7(OCH3)12 were studied by X-band EPR in the temperature range 4.2-300 K. An isotropic exchange interactions between four VIV ions with individual spin Si=1/2 determine the energy levels structure of the compound with the total spin states S=0, 1, and 2, which are doubled and split due to the extra electron transfer. The spin-Hamiltonian approach was used for the analysis of the temperature dependences of the EPR spectra parameters and the cluster dynamics. Two types of the electron transfer are assumed: the single jump transfer leading to the splitting of the total spin states by intervals comparable in magnitude with the exchange parameter J≈100-150cm-1 and the double jump one resulting in dynamics. The dependence of the transition ratesνtr on the energy of the total spin states was observed. In particular, in the range 300-220 K the νtr ≈0.7×1010 cm-1 and below 180 K the νtr≈1×1010 cm-1 was estimated. The g-factors of the spin states were shown to depend on the values of the intermediate spins. A phase transition in the T-range 210-180 K leading to the change in the initial VIV ions localization was discovered.

  12. Size-dependent single electron transfer and semi-metal-to-insulator transitions in molecular metal oxide electronics

    NASA Astrophysics Data System (ADS)

    Balliou, Angelika; Bouroushian, Mirtat; Douvas, Antonios M.; Skoulatakis, George; Kennou, Stella; Glezos, Nikos

    2018-07-01

    All-inorganic self-arranged molecular transition metal oxide hyperstructures based on polyoxometalate molecules (POMs) are fabricated and tested as electronically tunable components in emerging electronic devices. POM hyperstructures reveal great potential as charging nodes of tunable charging level for molecular memories and as enhancers of interfacial electron/hole injection for photovoltaic stacks. STM, UPS, UV–vis spectroscopy and AFM measurements show that this functionality stems from the films’ ability to structurally tune their HOMO–LUMO levels and electron localization length at room temperature. By adapting POM nanocluster size in solution, self-doping and current modulation of four orders of magnitude is monitored on a single nanocluster on SiO2 at voltages as low as 3 Volt. Structurally driven insulator-to-semi-metal transitions and size-dependent current regulation through single electron tunneling are demonstrated and examined with respect to the stereochemical and electronic structure of the molecular entities. This extends the value of self-assembly as a tool for correlation length and electronic properties tuning and demonstrate POM hyperstructures’ plausibility for on-chip molecular electronics operative at room temperature.

  13. Size-dependent single electron transfer and semi-metal-to-insulator transitions in molecular metal oxide electronics.

    PubMed

    Balliou, Angelika; Bouroushian, Mirtat; Douvas, Antonios M; Skoulatakis, George; Kennou, Stella; Glezos, Nikos

    2018-07-06

    All-inorganic self-arranged molecular transition metal oxide hyperstructures based on polyoxometalate molecules (POMs) are fabricated and tested as electronically tunable components in emerging electronic devices. POM hyperstructures reveal great potential as charging nodes of tunable charging level for molecular memories and as enhancers of interfacial electron/hole injection for photovoltaic stacks. STM, UPS, UV-vis spectroscopy and AFM measurements show that this functionality stems from the films' ability to structurally tune their HOMO-LUMO levels and electron localization length at room temperature. By adapting POM nanocluster size in solution, self-doping and current modulation of four orders of magnitude is monitored on a single nanocluster on SiO 2 at voltages as low as 3 Volt. Structurally driven insulator-to-semi-metal transitions and size-dependent current regulation through single electron tunneling are demonstrated and examined with respect to the stereochemical and electronic structure of the molecular entities. This extends the value of self-assembly as a tool for correlation length and electronic properties tuning and demonstrate POM hyperstructures' plausibility for on-chip molecular electronics operative at room temperature.

  14. Unravelling electronic and structural requisites of triplet-triplet energy transfer by advanced electron paramagnetic resonance and density functional theory

    NASA Astrophysics Data System (ADS)

    Di Valentin, M.; Salvadori, E.; Barone, V.; Carbonera, D.

    2013-10-01

    Advanced electron paramagnetic resonance (EPR) techniques, in combination with Density Functional theory (DFT), have been applied to the comparative study of carotenoid triplet states in two major photosynthetic antenna complexes, the Peridinin-chlorophyll a-protein of dinoflagellates and the light-harvesting complex II of higher plants. Carotenoid triplet states are populated by triplet-triplet energy transfer (TTET) from chlorophyll molecules to photoprotect the system from singlet oxygen formation under light-stress conditions. The TTET process is strongly dependent on the relative arrangement and on the electronic properties of the triplet states involved. The proposed spectroscopic approach exploits the concept of spin conservation during TTET, which leads to recognisable spin polarisation effects in the time-resolved and field-swept echo-detected EPR spectra. The electron spin polarisation produced at the carotenoid acceptor site depends on the initial polarisation of the chlorophyll donor and on the relative geometrical arrangement of the donor-acceptor zero-field splitting axes. We have demonstrated that a proper analysis of the spectra in the framework of spin angular momentum conservation allows to derive the pathways of TTET and to gain insight into the structural requirements of this mechanism for those antenna complexes, whose X-ray structure is available. We have further proved that this method, developed for natural antenna complexes of known X-ray structure, can be extended to systems lacking structural information in order to derive the relative arrangement of the partners in the energy transfer process. The structural requirements for efficient TTET, obtained from time-resolved and pulse EPR, have been complemented by a detailed description of the electronic structure of the carotenoid triplet state, provided by pulse Electron-Nuclear DOuble Resonance (ENDOR) experiments. Triplet-state hyperfine couplings of the α- and β-protons of the carotenoid conjugated chain have been assigned with the aid of quantum chemical calculation. DFT predictions of the electronic structure of the carotenoid triplet state, in terms of spin density distribution, frontier orbital description and orbital excitation represent suitable building blocks toward a deeper understanding of electronic requirements for efficient TTET.

  15. Redox probing study of the potential dependence of charge transport through Li 2O 2

    DOE PAGES

    Knudsen, Kristian B.; Luntz, Alan C.; Jensen, Søren H.; ...

    2015-11-20

    In the field of energy storage devices the pursuit for cheap, high energy density, reliable secondary batteries is at the top of the agenda. The Li–O 2 battery is one of the possible technologies that, in theory, should be able to close the gap, which exists between the present state-of-the-art Li-ion technologies and the demand placed on batteries by technologies such as electrical vehicles. Here we present a redox probing study of the charge transfer across the main deposition product lithium peroxide, Li 2O 2, in the Li–O 2 battery using outer-sphere redox shuttles. The change in heterogeneous electron transfermore » exchange rate as a function of the potential and the Li 2O 2 layer thickness (~depth-of-discharge) was determined using electrochemical impedance spectroscopy. In addition, the attenuation of the electron transfer exchange rate with film thickness is dependent on the probing potential, providing evidence that hole transport is the dominant process for charge transfer through Li 2O 2 and showing that the origin of the sudden death observed upon discharge is due to charge transport limitations.« less

  16. Optical properties of humic substances and CDOM: relation to structure.

    PubMed

    Boyle, Erin S; Guerriero, Nicolas; Thiallet, Anthony; Del Vecchio, Rossana; Blough, Neil V

    2009-04-01

    The spectral dependencies of absorption and fluorescence emission (emission maxima (lamdamax), quantum yields (phi), and mean lifetimes (taum)) were acquired for a commercial lignin, Suwannee River humic (SRHA) and fulvic (SRFA) acids, and a series solid phase extracts (C18) from the Middle Atlantic Bight (MAB extracts). These parameters were compared with the relative average size and total lignin phenol content (TLP). TLP was strongly correlated with absorption at 280 and 355 nm for the MAB extracts, SRHA, and SRFA. The spectral dependence of lamdamax, phi), and taum was very similar for all samples, suggesting a common photophysical and thus structural basis. A strong decrease of phi and taum with increasing average size indicates that intramolecular interactions must be important. When combined with previous work, the results lead us to conclude that the optical properties commonly associated with terrestrial humic substances and chromophoric dissolved organic matter arise primarily from an ensemble of partially oxidized lignins derived from vascular plant sources. Theyfurther provide additional support for an electronic interaction model in which intramolecular energy transfer, excited-state electron transfer, as well as charge transfer likely play important roles in producing the observed optical and photochemical properties of these materials.

  17. Molecular alignment effect on the photoassociation process via a pump-dump scheme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Bin-Bin; Han, Yong-Chang, E-mail: ychan@dlut.edu.cn; Cong, Shu-Lin

    The photoassociation processes via the pump-dump scheme for the heternuclear (Na + H → NaH) and the homonuclear (Na + Na → Na{sub 2}) molecular systems are studied, respectively, using the time-dependent quantum wavepacket method. For both systems, the initial atom pair in the continuum of the ground electronic state (X{sup 1}Σ{sup +}) is associated into the molecule in the bound states of the excited state (A{sup 1}Σ{sup +}) by the pump pulse. Then driven by a time-delayed dumping pulse, the prepared excited-state molecule can be transferred to the bound states of the ground electronic state. It is found thatmore » the pump process can induce a superposition of the rovibrational levels |v, j〉 on the excited state, which can lead to the field-free alignment of the excited-state molecule. The molecular alignment can affect the dumping process by varying the effective coupling intensity between the two electronic states or by varying the population transfer pathways. As a result, the final population transferred to the bound states of the ground electronic state varies periodically with the delay time of the dumping pulse.« less

  18. Model for Ultrafast Carrier Scattering in Semiconductors

    DTIC Science & Technology

    2012-11-14

    energy transfer between semi-classical carrier drift-diffusion under an electric field and quantum kinetics of interband /intersubband transitions...from an electron during each phonon-emission event. The net rate of phonon emission is determined by the Boltzmann scattering equation which depends ...energy-drift term under a strong dc field was demonstrated to reduce the field- dependent drift velocity and mobility. The Doppler shift in the energy

  19. Optical properties and electronic energy relaxation of metallic Au144(SR)60 nanoclusters.

    PubMed

    Yi, Chongyue; Tofanelli, Marcus A; Ackerson, Christopher J; Knappenberger, Kenneth L

    2013-12-04

    Electronic energy relaxation of Au144(SR)60(q) ligand-protected nanoclusters, where SR = SC6H13 and q = -1, 0, +1, and +2, was examined using femtosecond time-resolved transient absorption spectroscopy. The observed differential transient spectra contained three distinct components: (1) transient bleaches at 525 and 600 nm, (2) broad visible excited-state absorption (ESA), and (3) stimulated emission (SE) at 670 nm. The bleach recovery kinetics depended upon the excitation pulse energy and were thus attributed to electron-phonon coupling typical of metallic nanostructures. The prominent bleach at 525 nm was assigned to a core-localized plasmon resonance (CLPR). ESA decay kinetics were oxidation-state dependent and could be described using a metal-sphere charging model. The dynamics, emission energy, and intensity of the SE peak exhibited dielectric-dependent responses indicative of Superatom charge transfer states. On the basis of these data, the Au144(SR)60 system is the smallest-known nanocluster to exhibit quantifiable electron dynamics and optical properties characteristic of metals.

  20. Ground-state and magnetocaloric properties of a coupled spin-electron double-tetrahedral chain (exact study at the half filling)

    NASA Astrophysics Data System (ADS)

    Gálisová, Lucia; Jakubczyk, Dorota

    2017-01-01

    Ground-state and magnetocaloric properties of a double-tetrahedral chain, in which nodal lattice sites occupied by the localized Ising spins regularly alternate with triangular clusters half filled with mobile electrons, are exactly investigated by using the transfer-matrix method in combination with the construction of the Nth tensor power of the discrete Fourier transformation. It is shown that the ground state of the model is formed by two non-chiral phases with the zero residual entropy and two chiral phases with the finite residual entropy S = NkB ln 2. Depending on the character of the exchange interaction between the localized Ising spins and mobile electrons, one or three magnetization plateaus can be observed in the magnetization process. Their heights basically depend on the values of Landé g-factors of the Ising spins and mobile electrons. It is also evidenced that the system exhibits both the conventional and inverse magnetocaloric effect depending on values of the applied magnetic field and temperature.

  1. Lateral hopping of CO on Cu(111) induced by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Ueba, H.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.

    2010-09-01

    We present a theoretical study of the lateral hopping of a single CO molecule on Cu(111) induced by femtosecond laser pulses by Mehlhorn [Phys. Rev. Lett. 104, 076101 (2010)]10.1103/PhysRevLett.104.076101. Our model assumes an intermode coupling between the CO frustrated translation (FT) and frustrated rotation (FR) modes with a weak and strong electronic friction coupling to hot electrons, respectively, and heat transfer between the FT mode and the substrate phonons. In this model the effective electronic friction coupling of the FT mode depends on the absorbed laser fluence F through the temperature of the FR mode. The calculated hopping yield as a function of F nicely reproduces the nonlinear increase observed above F=4.0J/m2 . It is found that the electronic heating via friction coupling nor the phonon coupling alone cannot explain the experimental result. Both heatings are cooperatively responsible for CO hopping on Cu(111). The electronic heat transfer dominates over the phononic one at high F , where the effective electronic friction coupling becomes larger than the phononic coupling.

  2. DFT/TDDFT investigation on the photophysical properties of a series of phosphorescent cyclometalated complexes based on the benchmark complex FIrpic

    NASA Astrophysics Data System (ADS)

    Han, Deming; Gong, Ping; Lv, Shuhui; Zhao, Lihui; Zhao, Henan

    2018-05-01

    The photophysical properties of four Ir(III) complexes have been investigated by means of the density functional theory/time-dependent density functional theory (DFT/TDDFT). The effect of the electron-withdrawing and electron-donating substituents on charge injection, transport, absorption and phosphorescent properties has been studied. The theoretical calculation shows that the lowest-lying singlet absorptions for complexes 1-4 are located at 387, 385, 418 and 386 nm, respectively. For 1-4, the phosphorescence at 465, 485, 494 and 478 nm is mainly attributed to the LUMO → HOMO and LUMO → HOMO-1 transition configurations characteristics. In addition, ionisation potential (IP), electron affinities (EAs) and reorganisation energy have been investigated to evaluate the charge transfer and balance properties between hole and electron. The balance of the reorganisation energies for complex 3 is better than others. The difference between hole transport and electron transport for complex 3 is the smallest among these complexes, which is beneficial to achieve the hole and electron transfer balance in emitting layer.

  3. Photoinduced electron transfer and persistent spectral hole-burning in natural emerald.

    PubMed

    Riesen, Hans

    2011-06-02

    Wavelength-selective excited-state lifetime measurements and absorption, luminescence, and hole-burning spectra of a natural African emerald crystal are reported. The (2)E excited-state lifetime displays an extreme wavelength dependence, varying from 190 to 37 μs within 1.8 nm of the R(1)-line. Overall, the excited state is strongly quenched, in comparison to laboratory-created emerald (τ=1.3 ms), with an average quenching rate of ∼6 × 10(3) s(-1) at 2.5 K. This quenching is attributed to photoinduced electron transfer caused by a relatively high concentration of Fe(2+) ions. The forward electron-transfer rate, k(f), from the nearest possible Fe(2+) sites at around 5 Å is estimated to be ∼20 × 10(3) s(-1) at 2.5 K. The photoreductive quenching of the excited Cr(3+) ions by Fe(2+) is followed by rapid electron back-transfer in the ground state upon deactivation. The exchange interaction based quenching can be modeled by assuming a random quencher distribution within the possible Fe(2+) sites with the forward electron-transfer rate, k(f), given as a function of acceptor-donor separation R by exp[(R(f)-R)/a(f)]; R(f) and a(f) values of 13.5 and 2.7 Å are obtained at 2.5 K. The electron transfer/back-transfer reorganizes the local crystal lattice, occasionally leading to a minor variation of the short-range structure around the Cr(3+) ions. This provides a mechanism for spectral hole-burning for which a moderately high quantum efficiency of about ∼0.005% is observed. Spectral holes are subject to spontaneous hole-filling and spectral diffusion, and both effects can be quantified within the standard two-level systems for non-photochemical hole-burning. Importantly, the absorbance increases on both sides of broad spectral holes, and isosbestic points are observed, in accord with the expected distribution of the "photoproduct" in a non-photochemical hole-burning process. © 2011 American Chemical Society

  4. Pivotal Role of Iron in the Regulation of Cyanobacterial Electron Transport.

    PubMed

    González, A; Sevilla, E; Bes, M T; Peleato, M L; Fillat, M F

    2016-01-01

    Iron-containing metalloproteins are the main cornerstones for efficient electron transport in biological systems. The abundance and diversity of iron-dependent proteins in cyanobacteria makes those organisms highly dependent of this micronutrient. To cope with iron imbalance, cyanobacteria have developed a survey of adaptation strategies that are strongly related to the regulation of photosynthesis, nitrogen metabolism and other central electron transfer pathways. Furthermore, either in its ferrous form or as a component of the haem group, iron plays a crucial role as regulatory signalling molecule that directly or indirectly modulates the composition and efficiency of cyanobacterial redox reactions. We present here the major mechanism used by cyanobacteria to couple iron homeostasis to the regulation of electron transport, making special emphasis in processes specific in those organisms. © 2016 Elsevier Ltd. All rights reserved.

  5. Strain- and Substrate-Dependent Redox Mediator and Electricity Production by Pseudomonas aeruginosa.

    PubMed

    Bosire, Erick M; Blank, Lars M; Rosenbaum, Miriam A

    2016-08-15

    Pseudomonas aeruginosa is an important, thriving member of microbial communities of microbial bioelectrochemical systems (BES) through the production of versatile phenazine redox mediators. Pure culture experiments with a model strain revealed synergistic interactions of P. aeruginosa with fermenting microorganisms whereby the synergism was mediated through the shared fermentation product 2,3-butanediol. Our work here shows that the behavior and efficiency of P. aeruginosa in mediated current production is strongly dependent on the strain of P. aeruginosa We compared levels of phenazine production by the previously investigated model strain P. aeruginosa PA14, the alternative model strain P. aeruginosa PAO1, and the BES isolate Pseudomonas sp. strain KRP1 with glucose and the fermentation products 2,3-butanediol and ethanol as carbon substrates. We found significant differences in substrate-dependent phenazine production and resulting anodic current generation for the three strains, with the BES isolate KRP1 being overall the best current producer and showing the highest electrochemical activity with glucose as a substrate (19 μA cm(-2) with ∼150 μg ml(-1) phenazine carboxylic acid as a redox mediator). Surprisingly, P. aeruginosa PAO1 showed very low phenazine production and electrochemical activity under all tested conditions. Microbial fuel cells and other microbial bioelectrochemical systems hold great promise for environmental technologies such as wastewater treatment and bioremediation. While there is much emphasis on the development of materials and devices to realize such systems, the investigation and a deeper understanding of the underlying microbiology and ecology are lagging behind. Physiological investigations focus on microorganisms exhibiting direct electron transfer in pure culture systems. Meanwhile, mediated electron transfer with natural redox compounds produced by, for example, Pseudomonas aeruginosa might enable an entire microbial community to access a solid electrode as an alternative electron acceptor. To better understand the ecological relationships between mediator producers and mediator utilizers, we here present a comparison of the phenazine-dependent electroactivities of three Pseudomonas strains. This work forms the foundation for more complex coculture investigations of mediated electron transfer in microbial fuel cells. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Strain- and Substrate-Dependent Redox Mediator and Electricity Production by Pseudomonas aeruginosa

    PubMed Central

    Bosire, Erick M.; Blank, Lars M.

    2016-01-01

    ABSTRACT Pseudomonas aeruginosa is an important, thriving member of microbial communities of microbial bioelectrochemical systems (BES) through the production of versatile phenazine redox mediators. Pure culture experiments with a model strain revealed synergistic interactions of P. aeruginosa with fermenting microorganisms whereby the synergism was mediated through the shared fermentation product 2,3-butanediol. Our work here shows that the behavior and efficiency of P. aeruginosa in mediated current production is strongly dependent on the strain of P. aeruginosa. We compared levels of phenazine production by the previously investigated model strain P. aeruginosa PA14, the alternative model strain P. aeruginosa PAO1, and the BES isolate Pseudomonas sp. strain KRP1 with glucose and the fermentation products 2,3-butanediol and ethanol as carbon substrates. We found significant differences in substrate-dependent phenazine production and resulting anodic current generation for the three strains, with the BES isolate KRP1 being overall the best current producer and showing the highest electrochemical activity with glucose as a substrate (19 μA cm−2 with ∼150 μg ml−1 phenazine carboxylic acid as a redox mediator). Surprisingly, P. aeruginosa PAO1 showed very low phenazine production and electrochemical activity under all tested conditions. IMPORTANCE Microbial fuel cells and other microbial bioelectrochemical systems hold great promise for environmental technologies such as wastewater treatment and bioremediation. While there is much emphasis on the development of materials and devices to realize such systems, the investigation and a deeper understanding of the underlying microbiology and ecology are lagging behind. Physiological investigations focus on microorganisms exhibiting direct electron transfer in pure culture systems. Meanwhile, mediated electron transfer with natural redox compounds produced by, for example, Pseudomonas aeruginosa might enable an entire microbial community to access a solid electrode as an alternative electron acceptor. To better understand the ecological relationships between mediator producers and mediator utilizers, we here present a comparison of the phenazine-dependent electroactivities of three Pseudomonas strains. This work forms the foundation for more complex coculture investigations of mediated electron transfer in microbial fuel cells. PMID:27287325

  7. Styrene-spaced copolymers including anthraquinone and β-O-4 lignin model units: synthesis, characterization and reactivity under alkaline pulping conditions.

    PubMed

    Megiatto, Jackson D; Cazeils, Emmanuel; Ham-Pichavant, Frédérique; Grelier, Stéphane; Gardrat, Christian; Castellan, Alain

    2012-05-14

    A series of random copoly(styrene)s has been synthesized via radical polymerization of functionalized anthraquinone (AQ) and β-O-4 lignin model monomers. The copolymers were designed to have a different number of styrene spacer groups between the AQ and β-O-4 lignin side chains aiming at investigating the distance effects on AQ/β-O-4 electron transfer mechanisms. A detailed molecular characterization, including techniques such as size exclusion chromatography, MALDI-TOF mass spectrometry, and (1)H, (13)C, (31)P NMR and UV-vis spectroscopies, afforded quantitative information about the composition of the copolymers as well as the average distribution of the AQ and β-O-4 groups in the macromolecular structures. TGA and DSC thermal analysis have indicated that the copolymers were thermally stable under regular pulping conditions, revealing the inertness of the styrene polymer backbone in the investigation of electron transfer mechanisms. Alkaline pulping experiments showed that close contact between the redox active side chains in the copolymers was fundamental for an efficient degradation of the β-O-4 lignin model units, highlighting the importance of electron transfer reactions in the lignin degradation mechanisms catalyzed by AQ. In the absence of glucose, AQ units oxidized phenolic β-O-4 lignin model parts, mainly by electron transfer leading to vanillin as major product. By contrast, in presence of glucose, anthrahydroquinone units (formed by reduction of AQ) reduced the quinone-methide units (issued by dehydration of phenolic β-O-4 lignin model part) mainly by electron transfer leading to guaiacol as major product. Both processes were distance dependent.

  8. Quantum coherent π-electron rotations in a non-planar chiral molecule induced by using a linearly polarized UV laser pulse

    NASA Astrophysics Data System (ADS)

    Mineo, Hirobumi; Fujimura, Yuichi

    2015-06-01

    We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.

  9. Self-exchange reactions of radical anions in n-hexane.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Werst, D. W.; Chemistry

    The formation and reactions of radical anions in n-hexane at 190 K were investigated by pulse radiolysis and time-resolved fluorescence-detected magnetic resonance (FDMR). Electron attachment was found to occur for compounds with gas-phase electron affinities (EA) more positive than -1.1 {+-} 0.1 eV. The FDMR concentration and time dependence are interpreted as evidence for self-exchange electron-transfer reactions, indicating that formation of dimer radical anions is not prevalent for the range of molecules studied. FDMR detection of radical anions is mainly restricted to electron acceptors with EA less than approximately 0.5 eV.

  10. Dynamic spin polarization by orientation-dependent separation in a ferromagnet-semiconductor hybrid

    NASA Astrophysics Data System (ADS)

    Korenev, V. L.; Akimov, I. A.; Zaitsev, S. V.; Sapega, V. F.; Langer, L.; Yakovlev, D. R.; Danilov, Yu. A.; Bayer, M.

    2012-07-01

    Integration of magnetism into semiconductor electronics would facilitate an all-in-one-chip computer. Ferromagnet/bulk semiconductor hybrids have been, so far, mainly considered as key devices to read out the ferromagnetism by means of spin injection. Here we demonstrate that a Mn-based ferromagnetic layer acts as an orientation-dependent separator for carrier spins confined in a semiconductor quantum well that is set apart from the ferromagnet by a barrier only a few nanometers thick. By this spin-separation effect, a non-equilibrium electron-spin polarization is accumulated in the quantum well due to spin-dependent electron transfer to the ferromagnet. The significant advance of this hybrid design is that the excellent optical properties of the quantum well are maintained. This opens up the possibility of optical readout of the ferromagnet's magnetization and control of the non-equilibrium spin polarization in non-magnetic quantum wells.

  11. Dynamic spin polarization by orientation-dependent separation in a ferromagnet-semiconductor hybrid.

    PubMed

    Korenev, V L; Akimov, I A; Zaitsev, S V; Sapega, V F; Langer, L; Yakovlev, D R; Danilov, Yu A; Bayer, M

    2012-07-17

    Integration of magnetism into semiconductor electronics would facilitate an all-in-one-chip computer. Ferromagnet/bulk semiconductor hybrids have been, so far, mainly considered as key devices to read out the ferromagnetism by means of spin injection. Here we demonstrate that a Mn-based ferromagnetic layer acts as an orientation-dependent separator for carrier spins confined in a semiconductor quantum well that is set apart from the ferromagnet by a barrier only a few nanometers thick. By this spin-separation effect, a non-equilibrium electron-spin polarization is accumulated in the quantum well due to spin-dependent electron transfer to the ferromagnet. The significant advance of this hybrid design is that the excellent optical properties of the quantum well are maintained. This opens up the possibility of optical readout of the ferromagnet's magnetization and control of the non-equilibrium spin polarization in non-magnetic quantum wells.

  12. Donor acceptor electronic couplings in π-stacks: How many states must be accounted for?

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2006-04-01

    Two-state model is commonly used to estimate the donor-acceptor electronic coupling Vda for electron transfer. However, in some important cases, e.g. for DNA π-stacks, this scheme fails to provide accurate values of Vda because of multistate effects. The Generalized Mulliken-Hush method enables a multistate treatment of Vda. In this Letter, we analyze the dependence of calculated electronic couplings on the number of the adiabatic states included in the model. We suggest a simple scheme to determine this number. The superexchange correction of the two-state approximation is shown to provide good estimates of the electronic coupling.

  13. Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cave, R.J.; Newton, M.D.; Kumar, K.

    1995-12-07

    The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

  14. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized 2H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M. Ferro-Luzzi; M. Bouwhuis; E. Passchier

    1996-09-23

    We report an absolute measurement of the tensor analyzing powers T20 and T22 in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup -1}. The novel approach of this measurement is the use of a tensor polarized 2H target internal to an electron storage ring, with in situ measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering.

  15. Proton-coupled electron-transfer reduction of dioxygen catalyzed by a saddle-distorted cobalt phthalocyanine.

    PubMed

    Honda, Tatsuhiko; Kojima, Takahiko; Fukuzumi, Shunichi

    2012-03-07

    Proton-coupled electron-transfer reduction of dioxygen (O(2)) to afford hydrogen peroxide (H(2)O(2)) was investigated by using ferrocene derivatives as reductants and saddle-distorted (α-octaphenylphthalocyaninato)cobalt(II) (Co(II)(Ph(8)Pc)) as a catalyst under acidic conditions. The selective two-electron reduction of O(2) by dimethylferrocene (Me(2)Fc) and decamethylferrocene (Me(10)Fc) occurs to yield H(2)O(2) and the corresponding ferrocenium ions (Me(2)Fc(+) and Me(10)Fc(+), respectively). Mechanisms of the catalytic reduction of O(2) are discussed on the basis of detailed kinetics studies on the overall catalytic reactions as well as on each redox reaction in the catalytic cycle. The active species to react with O(2) in the catalytic reaction is switched from Co(II)(Ph(8)Pc) to protonated Co(I)(Ph(8)PcH), depending on the reducing ability of ferrocene derivatives employed. The protonation of Co(II)(Ph(8)Pc) inhibits the direct reduction of O(2); however, the proton-coupled electron transfer from Me(10)Fc to Co(II)(Ph(8)Pc) and the protonated [Co(II)(Ph(8)PcH)](+) occurs to produce Co(I)(Ph(8)PcH) and [Co(I)(Ph(8)PcH(2))](+), respectively, which react immediately with O(2). The rate-determining step is a proton-coupled electron-transfer reduction of O(2) by Co(II)(Ph(8)Pc) in the Co(II)(Ph(8)Pc)-catalyzed cycle with Me(2)Fc, whereas it is changed to the electron-transfer reduction of [Co(II)(Ph(8)PcH)](+) by Me(10)Fc in the Co(I)(Ph(8)PcH)-catalyzed cycle with Me(10)Fc. A single crystal of monoprotonated [Co(III)(Ph(8)Pc)](+), [Co(III)Cl(2)(Ph(8)PcH)], produced by the proton-coupled electron-transfer reduction of O(2) by Co(II)(Ph(8)Pc) with HCl, was obtained, and the crystal structure was determined in comparison with that of Co(II)(Ph(8)Pc). © 2012 American Chemical Society

  16. Time-dependent transition density matrix for visualizing charge-transfer excitations in photoexcited organic donor-acceptor systems

    NASA Astrophysics Data System (ADS)

    Li, Yonghui; Ullrich, Carsten

    2013-03-01

    The time-dependent transition density matrix (TDM) is a useful tool to visualize and interpret the induced charges and electron-hole coherences of excitonic processes in large molecules. Combined with time-dependent density functional theory on a real-space grid (as implemented in the octopus code), the TDM is a computationally viable visualization tool for optical excitation processes in molecules. It provides real-time maps of particles and holes which gives information on excitations, in particular those that have charge-transfer character, that cannot be obtained from the density alone. Some illustration of the TDM and comparison with standard density difference plots will be shown for photoexcited organic donor-acceptor molecules. This work is supported by NSF Grant DMR-1005651

  17. Measurement of polarization-transfer to bound protons in carbon and its virtuality dependence

    NASA Astrophysics Data System (ADS)

    Izraeli, D.; Brecelj, T.; Achenbach, P.; Ashkenazi, A.; Böhm, R.; Cohen, E. O.; Distler, M. O.; Esser, A.; Gilman, R.; Kolar, T.; Korover, I.; Lichtenstadt, J.; Mardor, I.; Merkel, H.; Mihovilovič, M.; Müller, U.; Olivenboim, M.; Piasetzky, E.; Ron, G.; Schlimme, B. S.; Schoth, M.; Sfienti, C.; Širca, S.; Štajner, S.; Strauch, S.; Thiel, M.; Weber, A.; Yaron, I.; A1 Collaboration

    2018-06-01

    We measured the ratio Px /Pz of the transverse to longitudinal components of polarization transferred from electrons to bound protons in 12C by the 12C (e → ,e‧ p →) process at the Mainz Microtron (MAMI). We observed consistent deviations from unity of this ratio normalized to the free-proton ratio, (Px /Pz) 12C /(Px /Pz) 1H, for both s- and p-shell knocked out protons, even though they are embedded in averaged local densities that differ by about a factor of two. The dependence of the double ratio on proton virtuality is similar to the one for knocked out protons from 2H and 4He, suggesting a universal behavior. It further implies no dependence on average local nuclear density.

  18. Ab Initio Simulation of Charge Transfer at the Semiconductor Quantum Dot/TiO 2 Interface in Quantum Dot-Sensitized Solar Cells

    DOE PAGES

    Xin, Xukai; Li, Bo; Jung, Jaehan; ...

    2014-07-24

    Quantum dot-sensitized solar cells (QDSSCs) have emerged as a promising solar architecture for next-generation solar cells. The QDSSCs exhibit a remarkably fast electron transfer from the quantum dot (QD) donor to the TiO 2 acceptor with size quantization properties of QDs that allows for the modulation of band energies to control photoresponse and photoconversion efficiency of solar cells. In order to understand the mechanisms that underpin this rapid charge transfer, the electronic properties of CdSe and PbSe QDs with different sizes on the TiO 2 substrate are simulated using a rigorous ab initio density functional method. Our method capitalizes onmore » localized orbital basis set, which is computationally less intensive. Quite intriguingly, a remarkable set of electron bridging states between QDs and TiO 2 occurring via the strong bonding between the conduction bands of QDs and TiO 2 is revealed. Such bridging states account for the fast adiabatic charge transfer from the QD donor to the TiO 2 acceptor, and may be a general feature for strongly coupled donor/acceptor systems. All the QDs/TiO 2 systems exhibit type II band alignments, with conduction band offsets that increase with the decrease in QD size. This facilitates the charge transfer from QDs donors to TiO 2 acceptors and explains the dependence of the increased charge transfer rate with the decreased QD size.« less

  19. Charge transfer in iridate-manganite superlattices

    DOE PAGES

    Okamoto, Satoshi; Nichols, John; Sohn, Changhee; ...

    2017-03-03

    Charge transfer in superlattices consisting of SrIrOmore » $$_3$$ and SrMnO$$_3$$ is investigated using density functional theory. Despite the nearly identical work function and non-polar interfaces between SrIrO$$_3$$ and SrMnO$$_3$$, rather large charge transfer was experimentally reported between them. Our results provide a qualitative understanding to such experimental reports. We further develop a microscopic model that captures the mechanism behind this phenomenon. This leads to unique strain dependence of such charge transfer in iridate-manganite superlattices. The predicted behavior is consistently verified by experiment. Lastly, our work thus demonstrates a new route to control electronic states in non-polar oxide heterostructures.« less

  20. High resolution photoemission investigation: The oxidation of W

    NASA Astrophysics Data System (ADS)

    Morar, J. F.; Himpsel, F. J.; Hughes, G. J.; Jordan, J. L.; McFeely, F. R.; Hollinge, G.

    High resolution photoemission measurements of surface oxide layers on tungsten has revealed a set of well resolved core level shifts characteristic of individual metal oxidation states. Measurement and analysis of this type of data can provide specific and quantitative chemical information about surface oxides. The formation of bonds between transition metals and strongly electronegative elements such as oxygen and fluorine results in charge transfer with the effect of shifting the metal core electron binding energies. The magnitude of such shifts depends primarily on two factors; the amount of charge transfer and the screening ability of the metals electrons. The size of core-level shifts tend to increase with additional charge transfer and be decreased by screening. In the case of tungsten the amount of screening should be a function of oxygen content since the oxygen ties up free electrons which are effective at screening. A continuous change in the tungsten core level shifts is observed with increasing oxygen content, i.e., as the screening changes from that characteristic of a metal screened to that characteristic of an insulator unscreened.

  1. Near-UV Photodissociation of Tryptic Peptide Cation Radicals. Scope and Effects of Amino Acid Residues and Radical Sites

    NASA Astrophysics Data System (ADS)

    Nguyen, Huong T. H.; Tureček, František

    2017-07-01

    Peptide cation-radical fragment ions of the z-type, [●AXAR+], [●AXAK+], and [●XAR+], where X = A, C, D, E, F, G, H, K, L, M, N, P, Y, and W, were generated by electron transfer dissociation of peptide dications and investigated by MS3-near-ultraviolet photodissociation (UVPD) at 355 nm. Laser-pulse dependence measurements indicated that the ion populations were homogeneous for most X residues except phenylalanine. UVPD resulted in dissociations of backbone CO-NH bonds that were accompanied by hydrogen atom transfer, producing fragment ions of the [yn]+ type. Compared with collision-induced dissociation, UVPD yielded less side-chain dissociations even for residues that are sensitive to radical-induced side-chain bond cleavages. The backbone dissociations are triggered by transitions to second ( B) excited electronic states in the peptide ion R-CH●-CONH- chromophores that are resonant with the 355-nm photon energy. Electron promotion increases the polarity of the B excited states, R-CH+-C●(O-)NH-, and steers the reaction to proceed by transfer of protons from proximate acidic Cα and amide nitrogen positions.

  2. Ultrafast photoinduced electron transfer in the micelle and the gel phase of a PEO-PPO-PEO triblock copolymer

    NASA Astrophysics Data System (ADS)

    Mandal, Ujjwal; Ghosh, Subhadip; Dey, Shantanu; Adhikari, Aniruddha; Bhattacharyya, Kankan

    2008-04-01

    Ultrafast photoinduced electron transfer (PET) from N,N-dimethylaniline (DMA) to coumarin dyes is studied in the micelle and the gel phase of a triblock copolymer, (PEO)20-(PPO)70-(PEO)20 (Pluronic P123) by picosecond and femtosecond emission spectroscopies. The rate of PET in a P123 micelle and gel is found to be nonexponential and faster than the slow components of solvation dynamics. In a P123 micelle and gel, PET occurs on multiple time scales ranging from a subpicosecond time scale to a few nanoseconds. In the gel phase, the highest rate constant (9.3×109M-1s-1) of ET for C152 is about two times higher than that (3.8×109M-1s-1) observed in micelle phase. The ultrafast components of electron transfer (ET) exhibits a bell shaped dependence with the free energy change which is similar to the Marcus inversion. Possible reasons for slower PET in P123 micelle compared to other micelles and relative to P123 gel are discussed.

  3. Punicalagin and catechins contain polyphenolic substructures that influence cell viability and can be monitored by radical chemosensors sensitive to electron transfer.

    PubMed

    Carreras, Anna; Mateos-Martín, María Luisa; Velázquez-Palenzuela, Amado; Brillas, Enric; Sánchez-Tena, Susana; Cascante, Marta; Juliá, Luis; Torres, Josep Lluís

    2012-02-22

    Plant polyphenols may be free radical scavengers or generators, depending on their nature and concentration. This dual effect, mediated by electron transfer reactions, may contribute to their influence on cell viability. This study used two stable radicals (tris(2,3,5,6-tetrachloro-4-nitrophenyl)methyl (TNPTM) and tris(2,4,6-trichloro-3,5-dinitrophenyl)methyl (HNTTM)) sensitive only to electron transfer reduction reactions to monitor the redox properties of polyphenols (punicalagin and catechins) that contain phenolic hydroxyls with different reducing capacities. The use of the two radicals reveals that punicalagin's substructures consisting of gallate esters linked together by carbon-carbon (C-C) bonds are more reactive than simple gallates and less reactive than the pyrogallol moiety of green tea catechins. The most reactive hydroxyls, detected by TNPTM, are present in the compounds that affect HT-29 cell viability the most. TNPTM reacts with C-C-linked gallates and pyrogallol and provides a convenient way to detect potentially beneficial polyphenols from natural sources.

  4. Effect of Molecular Interactions on Electron-Transfer and Antioxidant Activity of Bis(alkanol)selenides: A Radiation Chemical Study.

    PubMed

    Kumar, Pavitra V; Singh, Beena G; Phadnis, Prasad P; Jain, Vimal K; Priyadarsini, K Indira

    2016-08-16

    Understanding electron-transfer processes is crucial for developing organoselenium compounds as antioxidants and anti-inflammatory agents. To find new redox-active selenium antioxidants, we have investigated one-electron-transfer reactions between hydroxyl ((.) OH) radical and three bis(alkanol)selenides (SeROH) of varying alkyl chain length, using nanosecond pulse radiolysis. (.) OH radical reacts with SeROH to form radical adduct, which is converted primarily into a dimer radical cation (>Se∴Se<)(+) and α-{bis(hydroxyl alkyl)}-selenomethine radical along with a minor quantity of an intramolecularly stabilized radical cation. Some of these radicals have been subsequently converted to their corresponding selenoxide, and formaldehyde. Estimated yield of these products showed alkyl chain length dependency and correlated well with their antioxidant ability. Quantum chemical calculations suggested that compounds that formed more stable (>Se∴Se<)(+) , produced higher selenoxide and lower formaldehyde. Comparing these results with those for sulfur analogues confirmed for the first time the distinctive role of selenium in making such compounds better antioxidants. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Ultrashort electromagnetic pulse control of intersubband quantum well transitions

    PubMed Central

    2012-01-01

    We study the creation of high-efficiency controlled population transfer in intersubband transitions of semiconductor quantum wells. We give emphasis to the case of interaction of the semiconductor quantum well with electromagnetic pulses with a duration of few cycles and even a single cycle. We numerically solve the effective nonlinear Bloch equations for a specific double GaAs/AlGaAs quantum well structure, taking into account the ultrashort nature of the applied field, and show that high-efficiency population inversion is possible for specific pulse areas. The dependence of the efficiency of population transfer on the electron sheet density and the carrier envelope phase of the pulse is also explored. For electromagnetic pulses with a duration of several cycles, we find that the change in the electron sheet density leads to a very different response of the population in the two subbands to pulse area. However, for pulses with a duration equal to or shorter than 3 cycles, we show that efficient population transfer between the two subbands is possible, independent of the value of electron sheet density, if the pulse area is Π. PMID:22916956

  6. Ultrashort electromagnetic pulse control of intersubband quantum well transitions.

    PubMed

    Paspalakis, Emmanuel; Boviatsis, John

    2012-08-23

    : We study the creation of high-efficiency controlled population transfer in intersubband transitions of semiconductor quantum wells. We give emphasis to the case of interaction of the semiconductor quantum well with electromagnetic pulses with a duration of few cycles and even a single cycle. We numerically solve the effective nonlinear Bloch equations for a specific double GaAs/AlGaAs quantum well structure, taking into account the ultrashort nature of the applied field, and show that high-efficiency population inversion is possible for specific pulse areas. The dependence of the efficiency of population transfer on the electron sheet density and the carrier envelope phase of the pulse is also explored. For electromagnetic pulses with a duration of several cycles, we find that the change in the electron sheet density leads to a very different response of the population in the two subbands to pulse area. However, for pulses with a duration equal to or shorter than 3 cycles, we show that efficient population transfer between the two subbands is possible, independent of the value of electron sheet density, if the pulse area is Π.

  7. Does menaquinone participate in brain astrocyte electron transport?

    PubMed

    Lovern, Douglas; Marbois, Beth

    2013-10-01

    Quinone compounds act as membrane resident carriers of electrons between components of the electron transport chain in the periplasmic space of prokaryotes and in the mitochondria of eukaryotes. Vitamin K is a quinone compound in the human body in a storage form as menaquinone (MK); distribution includes regulated amounts in mitochondrial membranes. The human brain, which has low amounts of typical vitamin K dependent function (e.g., gamma carboxylase) has relatively high levels of MK, and different regions of brain have different amounts. Coenzyme Q (Q), is a quinone synthesized de novo, and the levels of synthesis decline with age. The levels of MK are dependent on dietary intake and generally increase with age. MK has a characterized role in the transfer of electrons to fumarate in prokaryotes. A newly recognized fumarate cycle has been identified in brain astrocytes. The MK precursor menadione has been shown to donate electrons directly to mitochondrial complex III. Vitamin K compounds function in the electron transport chain of human brain astrocytes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Charge-transfer channel in quantum dot-graphene hybrid materials

    NASA Astrophysics Data System (ADS)

    Cao, Shuo; Wang, Jingang; Ma, Fengcai; Sun, Mengtao

    2018-04-01

    The energy band theory of a classical semiconductor can qualitatively explain the charge-transfer process in low-dimensional hybrid colloidal quantum dot (QD)-graphene (GR) materials; however, the definite charge-transfer channels are not clear. Using density functional theory (DFT) and time-dependent DFT, we simulate the hybrid QD-GR nanostructure, and by constructing its orbital interaction diagram, we show the quantitative coupling characteristics of the molecular orbitals (MOs) of the hybrid structure. The main MOs are derived from the fragment MOs (FOs) of GR, and the Cd13Se13 QD FOs merge with the GR FOs in a certain proportion to afford the hybrid system. Upon photoexcitation, electrons in the GR FOs jump to the QD FOs, leaving holes in the GR FOs, and the definite charge-transfer channels can be found by analyzing the complex MOs coupling. The excited electrons and remaining holes can also be localized in the GR or the QD or transfer between the QD and GR with different absorption energies. The charge-transfer process for the selected excited states of the hybrid QD-GR structure are testified by the charge difference density isosurface. The natural transition orbitals, charge-transfer length analysis and 2D site representation of the transition density matrix also verify the electron-hole delocalization, localization, or coherence chacracteristics of the selected excited states. Therefore, our research enhances understanding of the coupling mechanism of low-dimensional hybrid materials and will aid in the design and manipulation of hybrid photoelectric devices for practical application in many fields.

  9. Charge-transfer channel in quantum dot-graphene hybrid materials.

    PubMed

    Cao, Shuo; Wang, Jingang; Ma, Fengcai; Sun, Mengtao

    2018-04-06

    The energy band theory of a classical semiconductor can qualitatively explain the charge-transfer process in low-dimensional hybrid colloidal quantum dot (QD)-graphene (GR) materials; however, the definite charge-transfer channels are not clear. Using density functional theory (DFT) and time-dependent DFT, we simulate the hybrid QD-GR nanostructure, and by constructing its orbital interaction diagram, we show the quantitative coupling characteristics of the molecular orbitals (MOs) of the hybrid structure. The main MOs are derived from the fragment MOs (FOs) of GR, and the Cd 13 Se 13 QD FOs merge with the GR FOs in a certain proportion to afford the hybrid system. Upon photoexcitation, electrons in the GR FOs jump to the QD FOs, leaving holes in the GR FOs, and the definite charge-transfer channels can be found by analyzing the complex MOs coupling. The excited electrons and remaining holes can also be localized in the GR or the QD or transfer between the QD and GR with different absorption energies. The charge-transfer process for the selected excited states of the hybrid QD-GR structure are testified by the charge difference density isosurface. The natural transition orbitals, charge-transfer length analysis and 2D site representation of the transition density matrix also verify the electron-hole delocalization, localization, or coherence chacracteristics of the selected excited states. Therefore, our research enhances understanding of the coupling mechanism of low-dimensional hybrid materials and will aid in the design and manipulation of hybrid photoelectric devices for practical application in many fields.

  10. Variety of DNA Replication Activity Among Cyanobacteria Correlates with Distinct Respiration Activity in the Dark.

    PubMed

    Ohbayashi, Ryudo; Yamamoto, Jun-Ya; Watanabe, Satoru; Kanesaki, Yu; Chibazakura, Taku; Miyagishima, Shin-Ya; Yoshikawa, Hirofumi

    2017-02-01

    Cyanobacteria exhibit light-dependent cell growth since most of their cellular energy is obtained by photosynthesis. In Synechococcus elongatus PCC 7942, one of the model cyanobacteria, DNA replication depends on photosynthetic electron transport. However, the critical signal for the regulatory mechanism of DNA replication has not been identified. In addition, conservation of this regulatory mechanism has not been investigated among cyanobacteria. To understand this regulatory signal and its dependence on light, we examined the regulation of DNA replication under both light and dark conditions among three model cyanobacteria, S. elongatus PCC 7942, Synechocystis sp. PCC 6803 and Anabaena sp. PCC 7120. Interestingly, DNA replication activity in Synechocystis and Anabaena was retained when cells were transferred to the dark, although it was drastically decreased in S. elongatus. Glycogen metabolism and respiration were higher in Synechocystis and Anabaena than in S. elongatus in the dark. Moreover, DNA replication activity in Synechocystis and Anabaena was reduced to the same level as that in S. elongatus by inhibition of respiratory electron transport after transfer to the dark. These results demonstrate that there is disparity in DNA replication occurring in the dark among cyanobacteria, which is caused by the difference in activity of respiratory electron transport. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  11. Sirtuin activation: a role for plasma membrane in the cell growth puzzle.

    PubMed

    Crane, Frederick L; Navas, Plácido; Low, Hans; Sun, Iris L; de Cabo, Rafael

    2013-04-01

    For more than 20 years, the observation that impermeable oxidants can stimulate cell growth has not been satisfactorily explained. The discovery of sirtuins provides a logical answer to the puzzle. The NADH-dependent transplasma membrane electron transport system, which is stimulated by growth factors and interventions such as calorie restriction, can transfer electrons to external acceptors and protect against stress-induced apoptosis. We hypothesize that the activation of plasma membrane electron transport contributes to the cytosolic NAD(+) pool required for sirtuin to activate transcription factors necessary for cell growth and survival.

  12. Tensor Analyzing Powers for Quasi-Elastic Electron Scattering from Deuterium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Z.-L. Zhou; M. Bouwhuis; M. Ferro-Luzzi

    1999-01-01

    We report on a first measurement of tensor analyzing powers in quasi-elastic electron-deuteron scattering at an average three-momentum transfer of 1.7 fm{sup -1}. Data sensitive to the spin-dependent nucleon density in the deuteron were obtained for missing momenta up to 150 MeV/c with a tensor polarized {sup 2}H target internal to an electron storage ring. The data are well described by a calculation that includes the effects of final-state interaction, meson-exchange and isobar currents, and leading-order relativistic contributions.

  13. Monte Carlo study of the effective Sherman function for electron polarimetry

    NASA Astrophysics Data System (ADS)

    Drągowski, M.; Włodarczyk, M.; Weber, G.; Ciborowski, J.; Enders, J.; Fritzsche, Y.; Poliszczuk, A.

    2016-12-01

    The PEBSI Monte Carlo simulation was upgraded towards usefulness for electron Mott polarimetry. The description of Mott scattering was improved and polarisation transfer in Møller scattering was included in the code. An improved agreement was achieved between the simulation and available experimental data for a 100 keV polarised electron beam scattering off gold foils of various thicknesses. The dependence of the effective Sherman function on scattering angle and target thickness, as well as the method of finding optimal conditions for Mott polarimetry measurements were analysed.

  14. Energetics and kinetics of primary charge separation in bacterial photosynthesis.

    PubMed

    LeBard, David N; Kapko, Vitaliy; Matyushov, Dmitry V

    2008-08-21

    We report the results of molecular dynamics (MD) simulations and formal modeling of the free-energy surfaces and reaction rates of primary charge separation in the reaction center of Rhodobacter sphaeroides. Two simulation protocols were used to produce MD trajectories. Standard force-field potentials were employed in the first protocol. In the second protocol, the special pair was made polarizable to reproduce a high polarizability of its photoexcited state observed by Stark spectroscopy. The charge distribution between covalent and charge-transfer states of the special pair was dynamically adjusted during the simulation run. We found from both protocols that the breadth of electrostatic fluctuations of the protein/water environment far exceeds previous estimates, resulting in about 1.6 eV reorganization energy of electron transfer in the first protocol and 2.5 eV in the second protocol. Most of these electrostatic fluctuations become dynamically frozen on the time scale of primary charge separation, resulting in much smaller solvation contributions to the activation barrier. While water dominates solvation thermodynamics on long observation times, protein emerges as the major thermal bath coupled to electron transfer on the picosecond time of the reaction. Marcus parabolas were obtained for the free-energy surfaces of electron transfer by using the first protocol, while a highly asymmetric surface was obtained in the second protocol. A nonergodic formulation of the diffusion-reaction electron-transfer kinetics has allowed us to reproduce the experimental results for both the temperature dependence of the rate and the nonexponential decay of the population of the photoexcited special pair.

  15. Interplay between structure, stoichiometry, and electron transfer dynamics in SILAR-based quantum dot-sensitized oxides.

    PubMed

    Wang, Hai; Barceló, Irene; Lana-Villarreal, Teresa; Gómez, Roberto; Bonn, Mischa; Cánovas, Enrique

    2014-10-08

    We quantify the rate and efficiency of picosecond electron transfer (ET) from PbS nanocrystals, grown by successive ionic layer adsorption and reaction (SILAR), into a mesoporous SnO2 support. Successive SILAR deposition steps allow for stoichiometry- and size-variation of the QDs, characterized using transmission electron microscopy. Whereas for sulfur-rich (p-type) QD surfaces substantial electron trapping at the QD surface occurs, for lead-rich (n-type) QD surfaces, the QD trapping channel is suppressed and the ET efficiency is boosted. The ET efficiency increase achieved by lead-rich QD surfaces is found to be QD-size dependent, increasing linearly with QD surface area. On the other hand, ET rates are found to be independent of both QD size and surface stoichiometry, suggesting that the donor-acceptor energetics (constituting the driving force for ET) are fixed due to Fermi level pinning at the QD/oxide interface. Implications of our results for QD-sensitized solar cell design are discussed.

  16. A Bioelectrochemical Approach to Characterize Extracellular Electron Transfer by Synechocystis sp. PCC6803

    PubMed Central

    Cereda, Angelo; Hitchcock, Andrew; Symes, Mark D.; Cronin, Leroy; Bibby, Thomas S.; Jones, Anne K.

    2014-01-01

    Biophotovoltaic devices employ photosynthetic organisms at the anode of a microbial fuel cell to generate electrical power. Although a range of cyanobacteria and algae have been shown to generate photocurrent in devices of a multitude of architectures, mechanistic understanding of extracellular electron transfer by phototrophs remains minimal. Here we describe a mediatorless bioelectrochemical device to measure the electrogenic output of a planktonically grown cyanobacterium, Synechocystis sp. PCC6803. Light dependent production of current is measured, and its magnitude is shown to scale with microbial cell concentration and light intensity. Bioelectrochemical characterization of a Synechocystis mutant lacking Photosystem II demonstrates conclusively that production of the majority of photocurrent requires a functional water splitting aparatus and electrons are likely ultimately derived from water. This shows the potential of the device to rapidly and quantitatively characterize photocurrent production by genetically modified strains, an approach that can be used in future studies to delineate the mechanisms of cyanobacterial extracellular electron transport. PMID:24637387

  17. Cobamide-mediated enzymatic reductive dehalogenation via long-range electron transfer

    PubMed Central

    Kunze, Cindy; Bommer, Martin; Hagen, Wilfred R.; Uksa, Marie; Dobbek, Holger; Schubert, Torsten; Diekert, Gabriele

    2017-01-01

    The capacity of metal-containing porphyrinoids to mediate reductive dehalogenation is implemented in cobamide-containing reductive dehalogenases (RDases), which serve as terminal reductases in organohalide-respiring microbes. RDases allow for the exploitation of halogenated compounds as electron acceptors. Their reaction mechanism is under debate. Here we report on substrate–enzyme interactions in a tetrachloroethene RDase (PceA) that also converts aryl halides. The shape of PceA’s highly apolar active site directs binding of bromophenols at some distance from the cobalt and with the hydroxyl substituent towards the metal. A close cobalt–substrate interaction is not observed by electron paramagnetic resonance spectroscopy. Nonetheless, a halogen substituent para to the hydroxyl group is reductively eliminated and the path of the leaving halide is traced in the structure. Based on these findings, an enzymatic mechanism relying on a long-range electron transfer is concluded, which is without parallel in vitamin B12-dependent biochemistry and represents an effective mode of RDase catalysis. PMID:28671181

  18. Cobamide-mediated enzymatic reductive dehalogenation via long-range electron transfer.

    PubMed

    Kunze, Cindy; Bommer, Martin; Hagen, Wilfred R; Uksa, Marie; Dobbek, Holger; Schubert, Torsten; Diekert, Gabriele

    2017-07-03

    The capacity of metal-containing porphyrinoids to mediate reductive dehalogenation is implemented in cobamide-containing reductive dehalogenases (RDases), which serve as terminal reductases in organohalide-respiring microbes. RDases allow for the exploitation of halogenated compounds as electron acceptors. Their reaction mechanism is under debate. Here we report on substrate-enzyme interactions in a tetrachloroethene RDase (PceA) that also converts aryl halides. The shape of PceA's highly apolar active site directs binding of bromophenols at some distance from the cobalt and with the hydroxyl substituent towards the metal. A close cobalt-substrate interaction is not observed by electron paramagnetic resonance spectroscopy. Nonetheless, a halogen substituent para to the hydroxyl group is reductively eliminated and the path of the leaving halide is traced in the structure. Based on these findings, an enzymatic mechanism relying on a long-range electron transfer is concluded, which is without parallel in vitamin B 12 -dependent biochemistry and represents an effective mode of RDase catalysis.

  19. Covalent Linking Greatly Enhances Photoinduced Electron Transfer in Fullerene-Quantum Dot Nanocomposites: Time-Domain Ab Initio Study.

    PubMed

    Chaban, Vitaly V; Prezhdo, Victor V; Prezhdo, Oleg V

    2013-01-03

    Nonadiabatic molecular dynamics combined with time-domain density functional theory are used to study electron transfer (ET) from a CdSe quantum dot (QD) to the C60 fullerene, occurring in several types of hybrid organic/inorganic nanocomposites. By unveiling the time dependence of the ET process, we show that covalent bonding between the QD and C60 is particularly important to ensure ultrafast transmission of the excited electron from the QD photon-harvester to the C60 electron acceptor. Despite the close proximity of the donor and acceptor species provided by direct van der Waals contact, it leads to a notably weaker QD-C60 interaction than a lengthy molecular bridge. We show that the ET rate in a nonbonded mixture of QDs and C60 can be enhanced by doping. The photoinduced ET is promoted primarily by mid- and low-frequency vibrations. The study establishes the basic design principles for enhancing photoinduced charge separation in nanoscale light harvesting materials.

  20. Synthesis and characterization of highly conductive charge-transfer complexes using positron annihilation spectroscopy

    NASA Astrophysics Data System (ADS)

    Adam, Abdel Majid A.; Refat, Moamen S.; Sharshar, T.; Heiba, Z. K.

    Molecular charge-transfer complexes of the tetramethylethylenediamine (TMEDA) with picric acid (Pi-OH), benzene-1,4-diol (QL), tin(IV) tetrachloride (SnCl4), iodine, bromine, and zinc chloride (ZnCl2) have been synthesized and investigated by elemental and thermal analysis, electronic, infrared, Raman and proton-NMR, energy-dispersive X-ray spectroscopy, X-ray powder diffraction and positron annihilation lifetime spectroscopy, and scanning electron microscopy. In this work, three types of acceptors π-acceptors (Pi-OH and QL), σ-acceptors (iodine and bromine), and vacant orbital acceptors (SnCl4 and ZnCl2) were covered. The results of elemental analysis indicated that the CT complexes were formed with ratios 1:1 and 1:2 for QL, SnCl4, and ZnCl2 acceptors and iodine, Pi-OH, and Br2 acceptors, respectively. The type of chelating between the TMEDA donor and the mentioned acceptors depends upon the behavior of both items. The positron annihilation lifetime parameters were found to be dependent on the structure, electronic configuration, and the power of acceptors. The correlation between these parameters and the molecular weight and biological activities of studied complexes was also observed. Regarding the electrical properties, the AC conductivity and the dielectric coefficients were measured as a function of frequency at room temperature. The TMEDA charge-transfer complexes were screened against antibacterial (Escherichia coli, Staphylococcus aureus, Bacillus subtilis, and Pseudomonas aeruginosa) and antifungal (Aspergillus flavus and Candida albicans) activities.

  1. Spectrophotometric and spectroscopic studies of charge transfer complexes of p-toluidine as an electron donor with picric acid as an electron acceptor in different solvents

    NASA Astrophysics Data System (ADS)

    Singh, Neeti; Khan, Ishaat M.; Ahmad, Afaq

    2010-04-01

    The charge transfer complexes of the donor p-toluidine with π-acceptor picric acid have been studied spectrophotometrically in various solvents such as carbon tetrachloride, chloroform, dichloromethane acetone, ethanol, and methanol at room temperature using absorption spectrophotometer. The results indicate that formation of CTC in non-polar solvent is high. The stoichiometry of the complex was found to be 1:1 ratio by straight-line method between donor and acceptor with maximum absorption bands. The data are discussed in terms of formation constant ( KCT), molar extinction coefficient ( ɛCT), standard free energy (Δ Go), oscillator strength ( f), transition dipole moment ( μEN), resonance energy ( RN) and ionization potential ( ID). The results indicate that the formation constant ( KCT) for the complex was shown to be dependent upon the nature of electron acceptor, donor and polarity of solvents that were used.

  2. Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis

    PubMed Central

    Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik

    2016-01-01

    Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1–0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. PMID:26969746

  3. Proton-Coupled Electron Transfer and a Tyrosine-Histidine Pair in a Photosystem II-Inspired β-Hairpin Maquette: Kinetics on the Picosecond Time Scale.

    PubMed

    Pagba, Cynthia V; McCaslin, Tyler G; Chi, San-Hui; Perry, Joseph W; Barry, Bridgette A

    2016-02-25

    Photosystem II (PSII) and ribonucleotide reductase employ oxidation and reduction of the tyrosine aromatic ring in radical transport pathways. Tyrosine-based reactions involve either proton-coupled electron transfer (PCET) or electron transfer (ET) alone, depending on the pH and the pKa of tyrosine's phenolic oxygen. In PSII, a subset of the PCET reactions are mediated by a tyrosine-histidine redox-driven proton relay, YD-His189. Peptide A is a PSII-inspired β-hairpin, which contains a single tyrosine (Y5) and histidine (H14). Previous electrochemical characterization indicated that Peptide A conducts a net PCET reaction between Y5 and H14, which have a cross-strand π-π interaction. The kinetic impact of H14 has not yet been explored. Here, we address this question through time-resolved absorption spectroscopy and 280-nm photolysis, which generates a neutral tyrosyl radical. The formation and decay of the neutral tyrosyl radical at 410 nm were monitored in Peptide A and its variant, Peptide C, in which H14 is replaced by cyclohexylalanine (Cha14). Significantly, both electron transfer (ET, pL 11, L = lyonium) and PCET (pL 9) were accelerated in Peptide A and C, compared to model tyrosinate or tyrosine at the same pL. Increased electronic coupling, mediated by the peptide backbone, can account for this rate acceleration. Deuterium exchange gave no significant solvent isotope effect in the peptides. At pL 9, but not at pL 11, the reaction rate decreased when H14 was mutated to Cha14. This decrease in rate is attributed to an increase in reorganization energy in the Cha14 mutant. The Y5-H14 mechanism in Peptide A is reminiscent of proton- and electron-transfer events involving YD-H189 in PSII. These results document a mechanism by which proton donors and acceptors can regulate the rate of PCET reactions.

  4. Fluorinated graphenes as advanced biosensors - effect of fluorine coverage on electron transfer properties and adsorption of biomolecules

    NASA Astrophysics Data System (ADS)

    Urbanová, Veronika; Karlický, František; Matěj, Adam; Šembera, Filip; Janoušek, Zbyněk; Perman, Jason A.; Ranc, Václav; Čépe, Klára; Michl, Josef; Otyepka, Michal; Zbořil, Radek

    2016-06-01

    Graphene derivatives are promising materials for the electrochemical sensing of diverse biomolecules and development of new biosensors owing to their improved electron transfer kinetics compared to pristine graphene. Here, we report complex electrochemical behavior and electrocatalytic performance of variously fluorinated graphene derivatives prepared by reaction of graphene with a nitrogen-fluorine mixture at 2 bars pressure. The fluorine content was simply controlled by varying the reaction time and temperature. The studies revealed that electron transfer kinetics and electrocatalytic activity of CFx strongly depend on the degree of fluorination. The versatility of fluorinated graphene as a biosensor platform was demonstrated by cyclic voltammetry for different biomolecules essential in physiological processes, i.e. NADH, ascorbic acid and dopamine. Importantly, the highest electrochemical performance, even higher than pristine graphene, was obtained for fluorinated graphene with the lowest fluorine content (CF0.084) due to its high conductivity and enhanced adsorption properties combining π-π stacking interaction with graphene regions with hydrogen-bonding interaction with fluorine atoms.Graphene derivatives are promising materials for the electrochemical sensing of diverse biomolecules and development of new biosensors owing to their improved electron transfer kinetics compared to pristine graphene. Here, we report complex electrochemical behavior and electrocatalytic performance of variously fluorinated graphene derivatives prepared by reaction of graphene with a nitrogen-fluorine mixture at 2 bars pressure. The fluorine content was simply controlled by varying the reaction time and temperature. The studies revealed that electron transfer kinetics and electrocatalytic activity of CFx strongly depend on the degree of fluorination. The versatility of fluorinated graphene as a biosensor platform was demonstrated by cyclic voltammetry for different biomolecules essential in physiological processes, i.e. NADH, ascorbic acid and dopamine. Importantly, the highest electrochemical performance, even higher than pristine graphene, was obtained for fluorinated graphene with the lowest fluorine content (CF0.084) due to its high conductivity and enhanced adsorption properties combining π-π stacking interaction with graphene regions with hydrogen-bonding interaction with fluorine atoms. Electronic supplementary information (ESI) available: SEM, HRTEM, and AFM images the sheet in pristine graphene sample, survey XPS spectrum, high resolution C 1s XPS spectrum, and Raman spectrum of pristine graphene precursor used for controlled fluorination, survey and high resolution F 1s XPS spectra of the CF0.084, CF0.158, and CF0.218 samples, EDS chemical mapping of fluorine in CF0.158, contact angle measurement of CF0.084, CF0.158, CF0.218, and HOPG, and additional electrochemical data. See DOI: 10.1039/c6nr00353b

  5. A Comparison of Solvent Effects in the Kinetics of Simple Electron Transfer and Amalgam Formation Reactions

    DTIC Science & Technology

    1988-10-15

    by measuring the temperature dependence of the half-wave potential in a non-isothermal cell. In the case of reduction of p- semiquinones55 and p... electrooxidation of 1,4-diaminobenzene at platinum5 , it was argued that since 16 the reaction occurs close to the p.z.c., double layer effects are negligible...effects would lead to large errors in the apparent transfer coefficient, ou. In the case of kinetic data for the electrooxidation of phenothiazine 4 and

  6. O2 adsorbed on Ptn clusters: Structure and optical absorption

    NASA Astrophysics Data System (ADS)

    Wang, Ruiying; Zhao, Liang; Jia, Jianfeng; Wu, Hai-Shun

    2018-03-01

    The interaction of O2 with Ptn and the optical absorption properties of PtnO2 were explored under the framework of density functional theory. The Ptn (n= 2, 4, 6, 9, 10, 14, 18, 22, and 27) clusters were selected, which were reported as magnetic number Ptn clusters in reference (V. Kumar and Y. Kawazoe, Phys. Rev. B 77(20), 205418 (2008)). The single Pt atom was also considered. The longest O2 bonds were found for Pt27O2, Pt6O2 and Pt14O2, while PtO2 and Pt2O2 have the shortest O2 bonds. This result showed that the single Pt atom was not preferred for O2 activation. The O2 bond length was closely related to the electron transfer from Ptn to O2. The optical absorptions of PtnO2 were investigated with time-dependent density functional theory method. A new term of charge transfer strength was defined to estimate the further electron transfer from Ptn to O2 caused by the optical absorption in the visible light range. Our calculations showed that with the increasing n, the further electron transfer from Ptn to O2 caused by optical absorption will become very weak.

  7. MutY: optimized to find DNA damage site electronically?

    NASA Astrophysics Data System (ADS)

    Lin, Jong-Chin; Cox, Daniel; Singh, Rajiv

    2006-03-01

    Iron sulfur clusters are present in the DNA repair protein MutY in a region highly homologous in species as diverse as E. Coli and Homo Sapiens, yet their function remains unknown. In MutY, this mixed valence cluster exists in two oxidation states, [Fe4S4]^2+/3+, with the stability depending upon the presence of DNA. We have studied the electronic structure and stability of these clusters using the local orbital based SIESTA implementation of density functional theory. We find that the iron-sulfur cluster in MutY can undergo 2+ to 3+ oxidation when coupling to DNA through hole transfer, especially when MutY is near an oxoguanine modified base(oxoG). Employing the Marcus theory for electron transfer, we find (i) near optimal Frank-Condon(FC) factor for 2+ transfer to oxoG; (ii) reduced FC factor for transfer to G due to a high oxidation potential; (iii) reduced FC factor with the mutation L154F; (iv) reduced tunning matrix element with the mutation R149W. Both L154F and R149W mutations dramatically reduce or eliminate repair efficiency. Hence, redox modulation of MutY search and binding appears plausible and may have broader implications for DNA-protein interactions.

  8. Biochemistry of Catabolic Reductive Dehalogenation.

    PubMed

    Fincker, Maeva; Spormann, Alfred M

    2017-06-20

    A wide range of phylogenetically diverse microorganisms couple the reductive dehalogenation of organohalides to energy conservation. Key enzymes of such anaerobic catabolic pathways are corrinoid and Fe-S cluster-containing, membrane-associated reductive dehalogenases. These enzymes catalyze the reductive elimination of a halide and constitute the terminal reductases of a short electron transfer chain. Enzymatic and physiological studies revealed the existence of quinone-dependent and quinone-independent reductive dehalogenases that are distinguishable at the amino acid sequence level, implying different modes of energy conservation in the respective microorganisms. In this review, we summarize current knowledge about catabolic reductive dehalogenases and the electron transfer chain they are part of. We review reaction mechanisms and the role of the corrinoid and Fe-S cluster cofactors and discuss physiological implications.

  9. Thickness-dependent electron–lattice equilibration in laser-excited thin bismuth films

    DOE PAGES

    Sokolowski-Tinten, K.; Li, R. K.; Reid, A. H.; ...

    2015-11-19

    Electron–phonon coupling processes determine electronic transport properties of materials and are responsible for the transfer of electronic excess energy to the lattice. With decreasing device dimensions an understanding of these processes in nanoscale materials is becoming increasingly important. We use time-resolved electron diffraction to directly study energy relaxation in thin bismuth films after optical excitation. Precise measurements of the transient Debye–Waller-effect for various film thicknesses and over an extended range of excitation fluences allow to separate different contributions to the incoherent lattice response. While phonon softening in the electronically excited state is responsible for an immediate increase of the r.m.s.more » atomic displacement within a few hundred fs, 'ordinary' electron–phonon coupling leads to subsequent heating of the material on a few ps time-scale. Moreover, the data reveal distinct changes in the energy transfer dynamics which becomes faster for stronger excitation and smaller film thickness, respectively. The latter effect is attributed to a cross-interfacial coupling of excited electrons to phonons in the substrate.« less

  10. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that provides an...

  11. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 8 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

  12. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 8 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

  13. Electron transport in the two-dimensional channel material - zinc oxide nanoflake

    NASA Astrophysics Data System (ADS)

    Lai, Jian-Jhong; Jian, Dunliang; Lin, Yen-Fu; Ku, Ming-Ming; Jian, Wen-Bin

    2018-03-01

    ZnO nanoflakes of 3-5 μm in lateral size and 15-20 nm in thickness are synthesized. The nanoflakes are used to make back-gated transistor devices. Electron transport in the ZnO nanoflake channel between source and drain electrodes are investigated. In the beginning, we argue and determine that electrons are in a two-dimensional system. We then apply Mott's two-dimensional variable range hopping model to analyze temperature and electric field dependences of resistivity. The disorder parameter, localization length, hopping distance, and hopping energy of the electron system in ZnO nanoflakes are obtained and, additionally, their temperature behaviors and dependences on room-temperature resistivity are presented. On the other hand, the basic transfer characteristics of the channel material are carried out, as well, and the carrier concentration, the mobility, and the Fermi wavelength of two-dimensional ZnO nanoflakes are estimated.

  14. Programming interfacial energetic offsets and charge transfer in β-Pb 0.33V 2O 5/quantum-dot heterostructures: Tuning valence-band edges to overlap with midgap states

    DOE PAGES

    Pelcher, Kate E.; Milleville, Christopher C.; Wangoh, Linda; ...

    2016-12-06

    Here, semiconductor heterostructures for solar energy conversion interface light-harvesting semiconductor nanoparticles with wide-band-gap semiconductors that serve as charge acceptors. In such heterostructures, the kinetics of charge separation depend on the thermodynamic driving force, which is dictated by energetic offsets across the interface. A recently developed promising platform interfaces semiconductor quantum dots (QDs) with ternary vanadium oxides that have characteristic midgap states situated between the valence and conduction bands. In this work, we have prepared CdS/β-Pb 0.33V 2O 5 heterostructures by both linker-assisted assembly and surface precipitation and contrasted these materials with CdSe/β-Pb 0.33V 2O 5 heterostructures prepared by the samemore » methods. Increased valence-band (VB) edge onsets in X-ray photoelectron spectra for CdS/β-Pb 0.33V 2O 5 heterostructures relative to CdSe/β-Pb 0.33V 2O 5 heterostructures suggest a positive shift in the VB edge potential and, therefore, an increased driving force for the photoinduced transfer of holes to the midgap state of β-Pb 0.33V 2O 5. This approach facilitates a ca. 0.40 eV decrease in the thermodynamic barrier for hole injection from the VB edge of QDs suggesting an important design parameter. Transient absorption spectroscopy experiments provide direct evidence of hole transfer from photoexcited CdS QDs to the midgap states of β-Pb 0.33V 2O 5 NWs, along with electron transfer into the conduction band of the β-Pb 0.33V 2O 5 NWs. Hole transfer is substantially faster and occurs at <1-ps time scales, whereas completion of electron transfer requires 5—30 ps depending on the nature of the interface. The differentiated time scales of electron and hole transfer, which are furthermore tunable as a function of the mode of attachment of QDs to NWs, provide a vital design tool for designing architectures for solar energy conversion. More generally, the approach developed here suggests that interfacing semiconductor QDs with transition-metal oxide NWs exhibiting intercalative midgap states yields a versatile platform wherein the thermodynamics and kinetics of charge transfer can be systematically modulated to improve the efficiency of charge separation across interfaces.« less

  15. Programming interfacial energetic offsets and charge transfer in β-Pb 0.33V 2O 5/quantum-dot heterostructures: Tuning valence-band edges to overlap with midgap states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pelcher, Kate E.; Milleville, Christopher C.; Wangoh, Linda

    Here, semiconductor heterostructures for solar energy conversion interface light-harvesting semiconductor nanoparticles with wide-band-gap semiconductors that serve as charge acceptors. In such heterostructures, the kinetics of charge separation depend on the thermodynamic driving force, which is dictated by energetic offsets across the interface. A recently developed promising platform interfaces semiconductor quantum dots (QDs) with ternary vanadium oxides that have characteristic midgap states situated between the valence and conduction bands. In this work, we have prepared CdS/β-Pb 0.33V 2O 5 heterostructures by both linker-assisted assembly and surface precipitation and contrasted these materials with CdSe/β-Pb 0.33V 2O 5 heterostructures prepared by the samemore » methods. Increased valence-band (VB) edge onsets in X-ray photoelectron spectra for CdS/β-Pb 0.33V 2O 5 heterostructures relative to CdSe/β-Pb 0.33V 2O 5 heterostructures suggest a positive shift in the VB edge potential and, therefore, an increased driving force for the photoinduced transfer of holes to the midgap state of β-Pb 0.33V 2O 5. This approach facilitates a ca. 0.40 eV decrease in the thermodynamic barrier for hole injection from the VB edge of QDs suggesting an important design parameter. Transient absorption spectroscopy experiments provide direct evidence of hole transfer from photoexcited CdS QDs to the midgap states of β-Pb 0.33V 2O 5 NWs, along with electron transfer into the conduction band of the β-Pb 0.33V 2O 5 NWs. Hole transfer is substantially faster and occurs at <1-ps time scales, whereas completion of electron transfer requires 5—30 ps depending on the nature of the interface. The differentiated time scales of electron and hole transfer, which are furthermore tunable as a function of the mode of attachment of QDs to NWs, provide a vital design tool for designing architectures for solar energy conversion. More generally, the approach developed here suggests that interfacing semiconductor QDs with transition-metal oxide NWs exhibiting intercalative midgap states yields a versatile platform wherein the thermodynamics and kinetics of charge transfer can be systematically modulated to improve the efficiency of charge separation across interfaces.« less

  16. A density functional theory (DFT) and time-dependent density functional theory (TDDFT) study on optical transitions in oligo(p-phenylenevinylene)-fullerene dyads and the applicability to resonant energy transfer.

    PubMed

    Toivonen, Teemu L J; Hukka, Terttu I

    2007-06-07

    The optical transitions of three different size oligo(p-phenylenevinylene)-fullerene dyads (OPV(n)-MPC(60); n = 2-4) and of the corresponding separate molecules are studied using density functional theory (DFT) and time-dependent density functional theory. The DFT is used to determine the geometries and the electronic structures of the ground states. Transition energies and excited-state structures are obtained from the TDDFT calculations. Resonant energy transfer from OPV(n) to MPC(60) is also studied and the Fermi golden rule is used, along with two simple models to describe the electronic coupling to calculate the energy transfer rates. The hybrid-type PBE0 functional is used with a split-valence basis set augmented with a polarization function (SV(P)) in calculations and the calculated results are compared to the corresponding experimental results. The calculated PBE0 spectra of the OPV(n)-MPC(60) dyads correspond to the experimental spectra very well and are approximately sums of the absorption spectra of the separate OPV(n) and MPC(60) molecules. Also, the absorption energies of OPV(n) and MPC(60) and the emission energies of OPV(n) are predicted well with the PBE0 functional. The PBE0 calculated resonant energy transfer rates are in a good agreement with the experimental rates and show the existence of many possible pathways for energy transfer from the first excited singlet states of the OPV(n) molecules to the MPC(60) molecule.

  17. Utilizing the dynamic stark shift as a probe for dielectric relaxation in photosynthetic reaction centers during charge separation.

    PubMed

    Guo, Zhi; Lin, Su; Woodbury, Neal W

    2013-09-26

    In photosynthetic reaction centers, the electric field generated by light-induced charge separation produces electrochromic shifts in the transitions of reaction center pigments. The extent of this Stark shift indirectly reflects the effective field strength at a particular cofactor in the complex. The dynamics of the effective field strength near the two monomeric bacteriochlorophylls (BA and BB) in purple photosynthetic bacterial reaction centers has been explored near physiological temperature by monitoring the time-dependent Stark shift during charge separation (dynamic Stark shift). This dynamic Stark shift was determined through analysis of femtosecond time-resolved absorbance change spectra recorded in wild type reaction centers and in four mutants at position M210. In both wild type and the mutants, the kinetics of the dynamic Stark shift differ from those of electron transfer, though not in the same way. In wild type, the initial electron transfer and the increase in the effective field strength near the active-side monomer bacteriochlorophyll (BA) occur in synchrony, but the two signals diverge on the time scale of electron transfer to the quinone. In contrast, when tyrosine is replaced by aspartic acid at M210, the kinetics of the BA Stark shift and the initial electron transfer differ, but transfer to the quinone coincides with the decay of the Stark shift. This is interpreted in terms of differences in the dynamics of the local dielectric environment between the mutants and the wild type. In wild type, comparison of the Stark shifts associated with BA and BB on the two quasi-symmetric halves of the reaction center structure confirm that the effective dielectric constants near these cofactors are quite different when the reaction center is in the state P(+)QA(-), as previously determined by Steffen et al. at 1.5 K (Steffen, M. A.; et al. Science 1994, 264, 810-816). However, it is not possible to determine from static, low-temperature measurments if the difference in the effective dielectric constant between the two sides of the reaction center is manifest on the time scale of initial electron transfer. By comparing directly the Stark shift dynamics of the ground-state spectra of the two monomer bacteriochlorophylls, it is evident that there is, in fact, a large dielectric difference between protein environments of the two quasi-symmetric electron-transfer branches on the time scale of initial electron transfer and that the effective dielectric constant in the region continues to evolve on a time scale of hundreds of picoseconds.

  18. Spin polarization transfer by the radical pair mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zarea, Mehdi, E-mail: m-zarea@northwestern.edu; Ratner, Mark A.; Wasielewski, Michael R.

    2015-08-07

    In a three-site representation, we study a spin polarization transfer from radical pair spins to a nearby electron or nuclear spin. The quantum dynamics of the radical pair spins is governed by a constant exchange interaction between the radical pair spins which have different Zeeman frequencies. Radical pair spins can recombine to the singlet ground state or to lower energy triplet states. It is then shown that the coherent dynamics of the radical pair induces spin polarization on the nearby third spin in the presence of a magnetic field. The spin polarization transfer depends on the difference between Zeeman frequencies,more » the singlet and triplet recombination rates, and on the exchange and dipole-dipole interactions between the different spins. In particular, the sign of the polarization depends on the exchange coupling between radical pair spins and also on the difference between singlet and triplet recombination rate constants.« less

  19. Correlated Electrons in Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Odintsov, Arkadi A.; Yoshioka, Hideo

    Single-wall carbon nanotubes are almost ideal systems for the investigation of exotic many-body effects due to non-Fermi liquid behavior of interacting electrons in one dimension. Recent theoretical and experimental results are reviewed with a focus on electron correlations. Starting from a microscopic lattice model we derive an effective phase Hamiltonian for conducting single-wall nanotubes with arbitrary chirality. The parameters of the Hamiltonian show very weak dependence on the chiral angle, which makes the low-energy physics of conducting nanotubes universal. The temperature-dependent resistivity and frequency-dependent optical conductivity of nanotubes with impurities are evaluated within the Luttinger-like model. Localization effects are studied. In particular, we found that intra-valley and inter-valley electron scattering can not coexist at low energies. Low-energy properties of clean nanotubes are studied beyond the Luttinger liquid approximation. The strongest Mott-like electron instability occurs at half filling. In the Mott insulating phase electrons at different atomic sublattices form characteristic bound states. The energy gaps occur in all modes of elementary excitations and estimate at 0.01-0.1 eV. We finally discuss observability of the Mott insulating phase in transport experiments. The accent is made on the charge transfer from external electrodes which results in a deviation of the electron density from half-filling.

  20. Theoretical Characterization of Charge Transport in Chromia (α-Cr2O3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iordanova, Nellie I.; Dupuis, Michel; Rosso, Kevin M.

    2005-08-15

    Transport of conduction electrons and holes through the lattice of ?-Cr2O3 (chromia) is modeled as a valence alternation of chromium cations using ab initio electronic structure calculations and electron transfer theory. In the context of the small polaron model, a cluster approach was used to compute quantities controlling the mobility of localized electrons and holes, i.e. the reorganization energy and the electronic coupling matrix element that enter Marcus? theory. The calculation of the electronic coupling followed the Generalized Mulliken-Hush approach and the quasi-diabatic method using the complete active space self-consistent field (CASSCF) method. Our findings indicate that hole mobility ismore » more than three orders of magnitude larger than electron mobility in both (001) and [001] lattice directions. The difference arises mainly from the larger internal reorganization energy calculated for electron transport relative to hole transport processes while electronic couplings have similar magnitudes. The much larger hole mobility vs electron mobility in ?-Cr2O3 is in contrast to similar hole and electron mobility in hematite ?-Fe2O3 previously calculated. Our calculations also indicate that the electronic coupling for all charge transfer processes of interest is smaller than for the corresponding processes in hematite. This variation is attributed to weaker interaction between the metal 3d states and the O(2p) states in chromia than in hematite, leading to smaller overlap between the charge transfer donor and acceptor wavefunctions and smaller super-exchange coupling in chromia. Nevertheless, the weaker coupling in chromia is still sufficiently large to suggest that charge transport processes in chromia are adiabatic in nature. The electronic coupling is found to depend on both the superexchange interaction through the bridging oxygen atoms and the d-shell electron spin coupling within the Cr-Cr donor-acceptor pair, while the reorganization energy is essentially independent of the electron spin coupling.« less

  1. Theoretical characterization of charge transport in chromia (α-Cr2O3)

    NASA Astrophysics Data System (ADS)

    Iordanova, N.; Dupuis, M.; Rosso, K. M.

    2005-08-01

    Transport of conduction electrons and holes through the lattice of α-Cr2O3 (chromia) is modeled as a valence alternation of chromium cations using ab initio electronic structure calculations and electron-transfer theory. In the context of the small polaron model, a cluster approach was used to compute quantities controlling the mobility of localized electrons and holes, i.e., the reorganization energy and the electronic coupling matrix element that enter Marcus' theory. The calculation of the electronic coupling followed the generalized Mulliken-Hush approach using the complete active space self-consistent-field (CASSCF) method and the quasidiabatic method. Our findings indicate that hole mobility is more than three orders of magnitude larger than electron mobility in both (001) and [001] lattice directions. The difference arises mainly from the larger internal reorganization energy calculated for electron-transport relative to hole-transport processes while electronic couplings have similar magnitudes. The much larger hole mobility versus electron mobility in α-Cr2O3 is in contrast to similar hole and electron mobilities in hematite α-Fe2O3 previously calculated. Our calculations also indicate that the electronic coupling for all charge-transfer processes of interest is smaller than for the corresponding processes in hematite. This variation is attributed to the weaker interaction between the metal 3d states and the O(2p ) states in chromia than in hematite, leading to a smaller overlap between the charge-transfer donor and acceptor wave functions and smaller superexchange coupling in chromia. Nevertheless, the weaker coupling in chromia is still sufficiently large to suggest that charge-transport processes in chromia are adiabatic in nature. The electronic coupling is found to depend on both the superexchange interaction through the bridging oxygen atoms and the d-shell electron-spin coupling within the Cr-Cr donor-acceptor pair, while the reorganization energy is essentially independent of the electron-spin coupling.

  2. Applications of free-electron lasers to measurements of energy transfer in biopolymers and materials

    NASA Astrophysics Data System (ADS)

    Edwards, Glenn S.; Johnson, J. B.; Kozub, John A.; Tribble, Jerri A.; Wagner, Katrina

    1992-08-01

    Free-electron lasers (FELs) provide tunable, pulsed radiation in the infrared. Using the FEL as a pump beam, we are investigating the mechanisms for energy transfer between localized vibrational modes and between vibrational modes and lattice or phonon modes. Either a laser-Raman system or a Fourier transform infrared (FTIR) spectrometer will serve as the probe beam, with the attribute of placing the burden of detection on two conventional spectroscopic techniques that circumvent the limited response of infrared detectors. More specifically, the Raman effect inelastically shifts an exciting laser line, typically a visible frequency, by the energy of the vibrational mode; however, the shifted Raman lines also lie in the visible, allowing for detection with highly efficient visible detectors. With regards to FTIR spectroscopy, the multiplex advantage yields a distinct benefit for infrared detector response. Our group is investigating intramolecular and intermolecular energy transfer processes in both biopolymers and more traditional materials. For example, alkali halides contain a number of defect types that effectively transfer energy in an intermolecular process. Similarly, the functioning of biopolymers depends on efficient intramolecular energy transfer. Understanding these mechanisms will enhance our ability to modify biopolymers and materials with applications to biology, medecine, and materials science.

  3. Resonant electronic excitation energy transfer by exchange mechanism in the quantum dot system

    NASA Astrophysics Data System (ADS)

    Chikalova-Luzina, O. P.; Samosvat, D. M.; Vyatkin, V. M.; Zegrya, G. G.

    2017-11-01

    A microscopic theory of nonradiative resonance energy transfer between spherical A3B5 semiconductor quantum dots by the exchange mechanism is suggested. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same A3B5 compound and are embedded in the matrix of another material that produces potential barriers for electrons and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found in the frame of the Kane model that provides the most adequate description of the real spectra of A3B5 semiconductors. The analytical treatment is carried out with using the density matrix method, which enabled us to perform an energy transfer analysis both in the weak-interaction approximation and in the strong-interaction approximation. The numerical calculations showed the saturation of the energy transfer rate at the distances between the donor and the acceptor approaching the contact one. The contributions of the exchange and direct Coulomb intractions can be of the same order at the small distances and can have the same value in the saturation range.

  4. Experimental Investigation on Heat Transfer Characteristics of Different Metallic Fin Arrays

    NASA Astrophysics Data System (ADS)

    Sangewar, Ravi Kumar

    2018-04-01

    The reliability of electronic equipment depends on the reliability of the system. For small applications natural convection cooling is sufficient, but for the electronic equipment having number of heat generating components, forced convection cooling is essential. In number of cases, pin fin arrangement is preferred for augmentation of heat transfer. Here, the performance of pin fin array of copper and aluminum material with in-line, as well as staggered arrangement over a flat plate is studied. Constant heat input was given to the inline, staggered arrangement of copper as well as aluminium pin fin arrays. In the present experimental study, heat input and airflow rates are the variables. It was found that the heat transfer coefficient for staggered array is 15% more than that of the in-line array, at the same time pressure drop across the staggered array is more by 10% than the in-line array. The pressure drop was observed to be increasing with increase in flow rate as expected. Endeavor of the present work is to find the optimum spacing between the fins in an array for maximum heat transfer rate, by investigating the heat transfer characteristics.

  5. Ultra-fast electron capture by electrosterically-stabilized gold nanoparticles.

    PubMed

    Ghandi, Khashayar; Findlater, Alexander D; Mahimwalla, Zahid; MacNeil, Connor S; Awoonor-Williams, Ernest; Zahariev, Federico; Gordon, Mark S

    2015-07-21

    Ultra-fast pre-solvated electron capture has been observed for aqueous solutions of room-temperature ionic liquid (RTIL) surface-stabilized gold nanoparticles (AuNPs; ∼9 nm). The extraordinarily large inverse temperature dependent rate constants (k(e)∼ 5 × 10(14) M(-1) s(-1)) measured for the capture of electrons in solution suggest electron capture by the AuNP surface that is on the timescale of, and therefore in competition with, electron solvation and electron-cation recombination reactions. The observed electron transfer rates challenge the conventional notion that radiation induced biological damage would be enhanced in the presence of AuNPs. On the contrary, AuNPs stabilized by non-covalently bonded ligands demonstrate the potential to quench radiation-induced electrons, indicating potential applications in fields ranging from radiation therapy to heterogeneous catalysis.

  6. Respiratory chain components involved in the glycerophosphate dehydrogenase-dependent ROS production by brown adipose tissue mitochondria.

    PubMed

    Vrbacký, Marek; Drahota, Zdenek; Mrácek, Tomás; Vojtísková, Alena; Jesina, Pavel; Stopka, Pavel; Houstek, Josef

    2007-07-01

    Involvement of mammalian mitochondrial glycerophosphate dehydrogenase (mGPDH, EC 1.1.99.5) in reactive oxygen species (ROS) generation was studied in brown adipose tissue mitochondria by different spectroscopic techniques. Spectrofluorometry using ROS-sensitive probes CM-H2DCFDA and Amplex Red was used to determine the glycerophosphate- or succinate-dependent ROS production in mitochondria supplemented with respiratory chain inhibitors antimycin A and myxothiazol. In case of glycerophosphate oxidation, most of the ROS originated directly from mGPDH and coenzyme Q while complex III was a typical site of ROS production in succinate oxidation. Glycerophosphate-dependent ROS production monitored by KCN-insensitive oxygen consumption was highly activated by one-electron acceptor ferricyanide, whereas succinate-dependent ROS production was unaffected. In addition, superoxide anion radical was detected as a mGPDH-related primary ROS species by fluorescent probe dihydroethidium, as well as by electron paramagnetic resonance (EPR) spectroscopy with DMPO spin trap. Altogether, the data obtained demonstrate pronounced differences in the mechanism of ROS production originating from oxidation of glycerophosphate and succinate indicating that electron transfer from mGPDH to coenzyme Q is highly prone to electron leak and superoxide generation.

  7. STUDY OF THE INELASTIC SCATTERING OF ELECTRONS BY THE NUCLEI $sup 6$Li AND $sup 7$Li (in French)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernheim, M.; Bishop, G.R.

    1963-11-01

    We have measured the form factors for transitions to the following excited states by the inelastic scattering of electrons: 2.189, 3.57, and 4.52 Mev of /sup 6/Li; and 0.478, 4.61, 5.76, and 6.8 Mev of /sup 7/Li. The dependence of the form factors on the momentum transfer indicates the principal components of the wave functions describing these states. (auth)

  8. Acceptor number-dependent ultrafast photo-physical properties of push-pull chromophores using time-resolved methods

    NASA Astrophysics Data System (ADS)

    Chi, Xiao-Chun; Wang, Ying-Hui; Gao, Yu; Sui, Ning; Zhang, Li-Quan; Wang, Wen-Yan; Lu, Ran; Ji, Wen-Yu; Yang, Yan-Qiang; Zhang, Han-Zhuang

    2018-04-01

    Three push-pull chromophores comprising a triphenylamine (TPA) as electron-donating moiety and functionalized β-diketones as electron acceptor units are studied by various spectroscopic techniques. The time-correlated single-photon counting data shows that increasing the number of electron acceptor units accelerates photoluminescence relaxation rate of compounds. Transient spectra data shows that intramolecular charge transfer (ICT) takes place from TPA units to β-diketones units after photo-excitation. Increasing the number of electron acceptor units would prolong the generation process of ICT state, and accelerate the excited molecule reorganization process and the relaxation process of ICT state.

  9. Electronic communication across diamagnetic metal bridges: a homoleptic gallium(III) complex of a redox-active diarylamido-based ligand and its oxidized derivatives

    PubMed Central

    Liddle, Brendan J.; Wanniarachchi, Sarath; Hewage, Jeewantha S.; Lindeman, Sergey V.; Bennett, Brian; Gardinier, James R.

    2012-01-01

    Complexes with cations of the type [Ga(L)2]n+ where L = bis(4-methyl-2-(1H-pyrazol-1-yl)phenyl)amido and n = 1, 2, 3 have been prepared and structurally characterized. The electronic properties of each were probed by electrochemical and spectroscopic means and were interpreted with the aid of DFT calculations. The dication, best described as [Ga(L−)(L0)]2+, and is a Robin-Day class II mixed-valence species. As such, a broad, weak, solvent-dependent intervalence charge transfer (IVCT) band was found in the NIR spectrum in the range 6390 to 6925 cm−1, depending on solvent. Band shape analyses and the use of Hush and Marcus relations revealed a modest electronic coupling, Hab of about 200 cm−1, and a large rate constant for electron transfer, ket, on the order of 1010 s−1 between redox active ligands. The di-oxidized complex [Ga(L0)2]3+ shows a half-field ΔMs = 2 transition in its solid-state X-Band EPR spectrum at 5 K which indicates that the triplet state is thermally populated. DFT calculations (M06/Def2-SV(P)) suggest that the singlet state is 21.7 cm−1 lower in energy than the triplet state. PMID:23163736

  10. Photoinduced electron transfer (PET) versus excimer formation in supramolecular p/n-heterojunctions of perylene bisimide dyes and implications for organic photovoltaics.

    PubMed

    Nowak-Król, Agnieszka; Fimmel, Benjamin; Son, Minjung; Kim, Dongho; Würthner, Frank

    2015-01-01

    Foldamer systems comprised of two perylene bisimide (PBI) dyes attached to the conjugated backbones of 1,2-bis(phenylethynyl)benzene and phenylethynyl-bis(phenylene)indane, respectively, were synthesized and investigated with regard to their solvent-dependent properties. UV/Vis absorption and steady-state fluorescence spectra show that both foldamers exist predominantly in a folded H-aggregated state consisting of π-π-stacked PBIs in THF and in more random conformations with weaker excitonic coupling between the PBIs in chloroform. Time-resolved fluorescence spectroscopy and transient absorption spectroscopy reveal entirely different relaxation pathways for the photoexcited molecules in the given solvents, i.e. photoinduced electron transfer leading to charge separated states for the open conformations (in chloroform) and relaxation into excimer states with red-shifted emission for the stacked conformations (in THF). Supported by redox data from cyclic voltammetry and Rehm-Weller analysis we could relate the processes occurring in these solution-phase model systems to the elementary processes in organic solar cells. Accordingly, only if relaxation pathways such as excimer formation are strictly avoided in molecular semiconductor materials, excitons may diffuse over larger distances to the heterojunction interface and produce photocurrent via the formation of electron/hole pairs by photoinduced electron transfer.

  11. Electron-transfer mediator for a NAD-glucose dehydrogenase-based glucose sensor.

    PubMed

    Kim, Dong-Min; Kim, Min-yeong; Reddy, Sanapalli S; Cho, Jaegeol; Cho, Chul-ho; Jung, Suntae; Shim, Yoon-Bo

    2013-12-03

    A new electron-transfer mediator, 5-[2,5-di (thiophen-2-yl)-1H-pyrrol-1-yl]-1,10-phenanthroline iron(III) chloride (FePhenTPy) oriented to the nicotinamide adenine dinucleotide-dependent-glucose dehydrogenase (NAD-GDH) system was synthesized through a Paal-Knorr condensation reaction. The structure of the mediator was confirmed by Fourier-transform infrared spectroscopy, proton and carbon nucler magnetic resonance spectroscopy, and mass spectroscopy, and its electron-transfer characteristic for a glucose sensor was investigated using voltammetry and impedance spectroscopy. A disposable amperometric glucose sensor with NAD-GDH was constructed with FePhenTPy as an electron-transfer mediator on a screen printed carbon electrode (SPCE) and its performance was evaluated, where the addition of reduces graphene oxide (RGO) to the mediator showed the enhanced sensor performance. The experimental parameters to affect the analytical performance and the stability of the proposed glucose sensor were optimized, and the sensor exhibited a dynamic range between 30 mg/dL and 600 mg/dL with the detection limit of 12.02 ± 0.6 mg/dL. In the real sample experiments, the interference effects by acetaminophen, ascorbic acid, dopamine, uric acid, caffeine, and other monosaccharides (fructose, lactose, mannose, and xylose) were completely avoided through coating the sensor surface with the Nafion film containing lead(IV) acetate. The reliability of proposed glucose sensor was evaluated by the determination of glucose in artificial blood and human whole blood samples.

  12. Conformational control of cofactors in nature: The effect of methoxy group orientation on the electronic structure of ubisemiquinone

    NASA Astrophysics Data System (ADS)

    De Almeida, Wagner B.; O'Malley, Patrick J.

    2018-03-01

    Ubiquinone is the key electron and proton transfer agent in biology. Its mechanism involves the formation of its intermediate one-electron reduced form, the ubisemiquinone radical. This is formed in a protein-bound form which permits the semiquinone to vary its electronic and redox properties. This can be achieved by hydrogen bonding acceptance by one or both oxygen atoms or as we now propose by restricted orientations for the methoxy groups of the headgroup. We show how the orientation of the two methoxy groups of the quinone headgroup affects the electronic structure of the semiquinone form and demonstrate a large dependence of the ubisemiquinone spin density distribution on the orientation each methoxy group takes with respect to the headgroup ring plane. This is shown to significantly modify associated hyperfine couplings which in turn needs to be accounted for in interpreting experimental values in vivo. The study uncovers the key potential role the methoxy group orientation can play in controlling the electronic structure and spin density of ubisemiquinone and provides an electronic-level insight into the variation in electron affinity and redox potential of ubiquinone as a function of the methoxy orientation. Taken together with the already known influence of cofactor conformation on heme and chlorophyll electronic structure, it reveals a more widespread role for cofactor conformational control of electronic structure and associated electron transfer in biology.

  13. Optimisation of stability and charge transferability of ferrocene-encapsulated carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Prajongtat, Pongthep; Sriyab, Suwannee; Zentgraf, Thomas; Hannongbua, Supa

    2018-01-01

    Ferrocene-encapsulated carbon nanotubes (Fc@CNTs) became promising nanocomposite materials for a wide range of applications due to their superior catalytic, mechanical and electronic properties. To open up new windows of applications, the highly stable and charge transferable encapsulation complexes are required. In this work, we designed the new encapsulation complexes formed from ferrocene derivatives (FcR, where R = -CHO, -CH2OH, -CON3 and -PCl2) and single-walled carbon nanotubes (SWCNTs). The influence of diameter and chirality of the nanotubes on the stability, charge transferability and electronic properties of such complexes has been investigated using density functional theory. The calculations suggest that the encapsulation stability and charge transferability of the encapsulation complexes depend on the size and chirality of the nanotubes. FcR@SWCNTs are more stable than Fc@SWCNTs at the optimum tube diameter. The greatest charge transfer was observed for FcCH2OH@SWCNTs and Fc@SWCNTs since the Fe d levels of FcCH2OH and Fc are nearly equal and close to the Fermi energy level of the nanotubes. The obtained results pave the way to the design of new encapsulated ferrocene derivatives which can give rise to higher stability and charge transferability of the encapsulation complexes.

  14. Quantification of free convection for embarked QFN64 electronic package: An experimental and numerical survey

    NASA Astrophysics Data System (ADS)

    Baïri, A.

    2017-08-01

    Embarked Quad Flat Non-lead (QFN) electronic devices are equipped with a significant number of sensors used for flight parameters measurement purposes. Their accuracy directly depends on the package thermal state. Flight safety therefore depends on the reliability of these QFNs, whose junction temperature must remain as low as possible while operating. The QFN64 is favored for these applications. In the operating power range considered here (0.01-0.1W), the study shows that radiative heat transfer is negligible with respect to natural convective exchanges. It is then essential to quantify the convective heat transfer coefficient on its different areas so that the arrangement is properly dimensioned. This is the objective of this work. The device is welded on a PCB which may be inclined with respect to the horizontal plane by an angle ranging from 0° to 90°. Numerical approach results are confirmed by thermal and electrical measurements carried out on prototypes for all power-inclination angle combinations. The correlations here proposed help determine the natural convective heat transfer coefficient in any area of the assembly. This work allowed to thermally characterize and certify a new QFN64 package equipped with sensors designed for aeronautics, currently under industrialization process.

  15. A Novel F420-dependent Thioredoxin Reductase Gated by Low Potential FAD

    PubMed Central

    Susanti, Dwi; Loganathan, Usha; Mukhopadhyay, Biswarup

    2016-01-01

    A recent report suggested that the thioredoxin-dependent metabolic regulation, which is widespread in all domains of life, existed in methanogenic archaea about 3.5 billion years ago. We now show that the respective electron delivery enzyme (thioredoxin reductase, TrxR), although structurally similar to flavin-containing NADPH-dependent TrxRs (NTR), lacked an NADPH-binding site and was dependent on reduced coenzyme F420 (F420H2), a stronger reductant with a mid-point redox potential (E′0) of −360 mV; E′0 of NAD(P)H is −320 mV. Because F420 is a deazaflavin, this enzyme was named deazaflavin-dependent flavin-containing thioredoxin reductase (DFTR). It transferred electrons from F420H2 to thioredoxin via protein-bound flavin; Km values for thioredoxin and F420H2 were 6.3 and 28.6 μm, respectively. The E′0 of DFTR-bound flavin was approximately −389 mV, making electron transfer from NAD(P)H or F420H2 to flavin endergonic. However, under high partial pressures of hydrogen prevailing on early Earth and present day deep-sea volcanoes, the potential for the F420/F420H2 pair could be as low as −425 mV, making DFTR efficient. The presence of DFTR exclusively in ancient methanogens and mostly in the early Earth environment of deep-sea volcanoes and DFTR's characteristics suggest that the enzyme developed on early Earth and gave rise to NTR. A phylogenetic analysis revealed six more novel-type TrxR groups and suggested that the broader flavin-containing disulfide oxidoreductase family is more diverse than previously considered. The unprecedented structural similarities between an F420-dependent enzyme (DFTR) and an NADPH-dependent enzyme (NTR) brought new thoughts to investigations on F420 systems involved in microbial pathogenesis and antibiotic production. PMID:27590343

  16. Intramolecular Long-Distance Electron Transfer in Organic Molecules

    NASA Astrophysics Data System (ADS)

    Closs, Gerhard L.; Miller, John R.

    1988-04-01

    Intramolecular long-distance electron transfer (ET) has been actively studied in recent years in order to test existing theories in a quantitative way and to provide the necessary constants for predicting ET rates from simple structural parameters. Theoretical predictions of an ``inverted region,'' where increasing the driving force of the reaction will decrease its rate, have begun to be experimentally confirmed. A predicted nonlinear dependence of ET rates on the polarity of the solvent has also been confirmed. This work has implications for the design of efficient photochemical charge-separation devices. Other studies have been directed toward determining the distance dependence of ET reactions. Model studies on different series of compounds give similar distance dependences. When different stereochemical structures are compared, it becomes apparent that geometrical factors must be taken into account. Finally, the mechanism of coupling between donor and acceptor in weakly interacting systems has become of major importance. The theoretical and experimental evidence favors a model in which coupling is provided by the interaction with the orbitals of the intervening molecular fragments, although more experimental evidence is needed. Studies on intramolecular ET in organic model compounds have established that current theories give an adequate description of the process. The separation of electronic from nuclear coordinates is only a convenient approximation applied to many models, but in long-distance ET it works remarkably well. It is particularly gratifying to see Marcus' ideas finally confirmed after three decades of skepticism. By obtaining the numbers for quantitative correlations between rates and distances, these experiments have shown that saturated hydrocarbon fragments can ``conduct'' electrons over tens of angstroms. A dramatic demonstration of this fact has recently been obtained by tunneling electron microscopy on Langmuir-Blodgett films, showing in a pictorial fashion that electrons prefer to travel from cathode to anode through the fatty-acid chains (46).

  17. Quantum tunneling resonant electron transfer process in Lorentzian plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, Woo-Pyo; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr; Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 426-791

    The quantum tunneling resonant electron transfer process between a positive ion and a neutral atom collision is investigated in nonthermal generalized Lorentzian plasmas. The result shows that the nonthermal effect enhances the resonant electron transfer cross section in Lorentzian plasmas. It is found that the nonthermal effect on the classical resonant electron transfer cross section is more significant than that on the quantum tunneling resonant charge transfer cross section. It is shown that the nonthermal effect on the resonant electron transfer cross section decreases with an increase of the Debye length. In addition, the nonthermal effect on the quantum tunnelingmore » resonant electron transfer cross section decreases with increasing collision energy. The variation of nonthermal and plasma shielding effects on the quantum tunneling resonant electron transfer process is also discussed.« less

  18. CHARGE-TRANSFER ASSOCIATION AND PARAMAGNETISM OF SOME ORGANIC SYSTEMS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eastman, J W

    When p-xylene was combined with chloranil in n-heptane, charge-transfer optical absorption was observed. The magnitude of this absorption was used to calculate an equilibrium constant for the formation of a donor-acceptor complex containing one p-xylene was combined with carbon tetrabromide and with carbon tetrachloride in n-heptane, no charge-transfer absorption was observed. Reactions of N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD) with chloranil (pQCl/ sub 4/) were observed in ethylene dichloride and acetonitrile. In both solvents adduct formation occurred initially, as observed by its charge-transfer absorption. In acetonitrile time-dependent electron spin resonance (ESR) absorption was observed, and it was identified with the positive and negative radicalmore » ions of TMPD and pQCl/sub 4/, respectively. In this case a completely ionized electron transfer had occurred. Chloranil and other quinones were found to react with N,N-dimethylaniline forming a crystal violet salt. The diamagnetic donor-acceptor complexes and also semiquinone radicals are intermediates which were observed. Some physical measurements of the kinetics of this reaction are described and correlated. When fluoranil was allowed to react with dimethylaniline, the hyperfine splitting by the fluorine atoms of the fluoranil radical was not resolved. Characteristics of the ESR absorption by this radical in dimethylaniline are discussed in terms of an electron transfer between the semiquinone and quinone, and between the semiquinone and hydroquinone ion. Paramagnetism was discovered in hydrocarbon-quinone solids. ESR absorption was assigned to imperfections in the solid which was normally diamagnetic. The preparation of these solids and some of their physical characteristics are described. (auth)« less

  19. [2.2]paracyclophane-bridged mixed-valence compounds: application of a generalized Mulliken-Hush three-level model.

    PubMed

    Amthor, Stephan; Lambert, Christoph

    2006-01-26

    A series of [2.2]paracylophane-bridged bis-triarylamine mixed-valence (MV) radical cations were analyzed by a generalized Mulliken-Hush (GMH) three-level model which takes two transitions into account: the intervalence charge transfer (IV-CT) band which is assigned to an optically induced hole transfer (HT) from one triarylamine unit to the second one and a second band associated with a triarylamine radical cation to bridge (in particular, the [2.2]paracyclophane bridge) hole transfer. From the GMH analysis, we conclude that the [2.2]paracyclophane moiety is not the limiting factor which governs the intramolecular charge transfer. AM1-CISD calculations reveal that both through-bond as well as through-space interactions of the [2.2]paracyclophane bridge play an important role for hole transfer processes. These electronic interactions are of course smaller than direct pi-conjugation, but from the order of magnitude of the couplings of the [2.2]paracyclophane MV species, we assume that this bridge is able to mediate significant through-space and through-bond interactions and that the cyclophane bridge acts more like an unsaturated spacer rather than a saturated one. From the exponential dependence of the electronic coupling V between the two triarylamine localized states on the distance r between the two redox centers, we infer that the hole transfer occurs via a superexchange mechanism. Our analysis reveals that even significantly longer pi-conjugated bridges should still mediate significant electronic interactions because the decay constant beta of a series of pi-conjugated MV species is small.

  20. Dimensionality of nanoscale TiO 2 determines the mechanism of photoinduced electron injection from a CdSe nanoparticle

    DOE PAGES

    Tafen, De Nyago; Long, Run; Prezhdo, Oleg V.

    2014-03-10

    Assumptions about electron transfer (ET) mechanisms guide design of catalytic, photovoltaic, and electronic systems. We demonstrate that the mechanism of ET from a CdSe quantum dot (QD) into nanoscale TiO 2 depends on TiO 2 dimensionality. The injection into a TiO 2 QD is adiabatic due to strong donor–acceptor coupling, arising from unsaturated chemical bonds on the QD surface, and low density of acceptor states. In contrast, the injection into a TiO 2 nanobelt (NB) is nonadiabatic, because the state density is high, the donor–acceptor coupling is weak, and multiple phonons accommodate changes in the electronic energy. The CdSe adsorbantmore » breaks symmetry of delocalized TiO 2 NB states, relaxing coupling selection rules, and generating more ET channels. Both mechanisms can give efficient ultrafast injection. Furthermore, the dependence on system properties is very different for the two mechanisms, demonstrating that the fundamental principles leading to efficient charge separation depend strongly on the type of nanoscale material.« less

  1. Dimensionality of nanoscale TiO 2 determines the mechanism of photoinduced electron injection from a CdSe nanoparticle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tafen, De Nyago; Long, Run; Prezhdo, Oleg V.

    Assumptions about electron transfer (ET) mechanisms guide design of catalytic, photovoltaic, and electronic systems. We demonstrate that the mechanism of ET from a CdSe quantum dot (QD) into nanoscale TiO 2 depends on TiO 2 dimensionality. The injection into a TiO 2 QD is adiabatic due to strong donor–acceptor coupling, arising from unsaturated chemical bonds on the QD surface, and low density of acceptor states. In contrast, the injection into a TiO 2 nanobelt (NB) is nonadiabatic, because the state density is high, the donor–acceptor coupling is weak, and multiple phonons accommodate changes in the electronic energy. The CdSe adsorbantmore » breaks symmetry of delocalized TiO 2 NB states, relaxing coupling selection rules, and generating more ET channels. Both mechanisms can give efficient ultrafast injection. Furthermore, the dependence on system properties is very different for the two mechanisms, demonstrating that the fundamental principles leading to efficient charge separation depend strongly on the type of nanoscale material.« less

  2. Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

    PubMed

    Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

    2016-09-01

    To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

  3. Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer

    DTIC Science & Technology

    2011-05-01

    Briefly, the electron transfer activities of complex I/III (NADH dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from NADH to...ferricytochrome c) and complex II/III (succinate dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from succinate to ferricytochrome...The electron transfer activity of complex IV (cytochrome c oxidase: catalyzes the final step of the respiratory chain by transferring electrons from

  4. Properties of Intermediates in the Catalytic Cycle of Oxalate Oxidoreductase and Its Suicide Inactivation by Pyruvate

    PubMed Central

    2017-01-01

    Oxalate:ferredoxin oxidoreductase (OOR) is an unusual member of the thiamine pyrophosphate (TPP)-dependent 2-oxoacid:ferredoxin oxidoreductase (OFOR) family in that it catalyzes the coenzyme A (CoA)-independent conversion of oxalate into 2 equivalents of carbon dioxide. This reaction is surprising because binding of CoA to the acyl-TPP intermediate of other OFORs results in formation of a CoA ester, and in the case of pyruvate:ferredoxin oxidoreductase (PFOR), CoA binding generates the central metabolic intermediate acetyl-CoA and promotes a 105-fold acceleration of the rate of electron transfer. Here we describe kinetic, spectroscopic, and computational results to show that CoA has no effect on catalysis by OOR and describe the chemical rationale for why this cofactor is unnecessary in this enzymatic transformation. Our results demonstrate that, like PFOR, OOR binds pyruvate and catalyzes decarboxylation to form the same hydroxyethylidine–TPP (HE–TPP) intermediate and one-electron transfer to generate the HE–TPP radical. However, in OOR, this intermediate remains stranded at the active site as a covalent inhibitor. These and other results indicate that, like other OFOR family members, OOR generates an oxalate-derived adduct with TPP (oxalyl-TPP) that undergoes decarboxylation and one-electron transfer to form a radical intermediate remaining bound to TPP (dihydroxymethylidene–TPP). However, unlike in PFOR, where CoA binding drives formation of the product, in OOR, proton transfer and a conformational change in the “switch loop” alter the redox potential of the radical intermediate sufficiently to promote the transfer of an electron into the iron–sulfur cluster network, leading directly to a second decarboxylation and completing the catalytic cycle. PMID:28514140

  5. Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

    PubMed Central

    Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

    2009-01-01

    Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

  6. Theoretical Study of Electron Transfer Properties of Squaraine Dyes for Dye Sensitized Solar Cell

    NASA Astrophysics Data System (ADS)

    Juwita, Ratna; Tsai, Hui-Hsu Gavin

    2018-01-01

    The environmental issues and high cost of Ru create many scientists to explore cheaper and safer sensitizer as alternative for dye sensitized solar cells (DSCs). Dyes play an important role in solar energy conversion efficiency. The squaraine (SQ) dyes has good spectral match with the solar spectra, therefore, SQ dyes have great potential for the applications in DSCs. SQ01_CA is an unsymmetrical SQ dye, reported by Grätzel and colleagues in 2007, featuring a D-π-spacer-A framework and has a carboxylic acid anchoring group. The electron donating ability of indolium in SQ01_CA and SQ01_CAA dyes is relatively weak, better performance may be achieved by introducing an additional donor moiety into indolium [1]. In this study, we investigate six unsymmetrical SQ dyes adsorbed on a (TiO2)38 cluster [2] using density functional theory (DFT) and time-dependent DFT to study electron transfer properties of squaraine dyes on their photophysical. SQ01_CA, WH-SQ01_CA, and WH-SQ02_CA use a carboxylic acid group as its electron acceptor. Furthermore, SQ01_CAA, WH-SQ01_CAA, and WH-SQ02_CAA use a cyanoacrylic acid group as its electron acceptor. WH-SQ01_CA and WH-SQ01_CAA have an alkyl, while WH-SQ02_CA and WH-SQ02_CAA have alkoxyl substituted diarylamines to the indolium donor of sensitizer SQ01_CA. Our calculations show with additional diarylamines in donor tail of WH-SQ02_CAA, the SQ dyes have red-shifted absorption and have slightly larger probability of electron density transferred to TiO2 moiety. Furthermore, an additional -CN group as electron a withdrawing group in the acceptor exhibits red-shifted absorption and enhances the electron density transferred to TiO2 and anchoring moiety after photo-excitation. The tendency of calculated probabilities of electron density being delocalized into TiO2 and driving force for excited-state electron injection of these studied SQ dyes is compatible with their experimentally observed.

  7. Sirtuin Activation: A Role for Plasma Membrane in the Cell Growth Puzzle

    PubMed Central

    2013-01-01

    For more than 20 years, the observation that impermeable oxidants can stimulate cell growth has not been satisfactorily explained. The discovery of sirtuins provides a logical answer to the puzzle. The NADH-dependent transplasma membrane electron transport system, which is stimulated by growth factors and interventions such as calorie restriction, can transfer electrons to external acceptors and protect against stress-induced apoptosis. We hypothesize that the activation of plasma membrane electron transport contributes to the cytosolic NAD+ pool required for sirtuin to activate transcription factors necessary for cell growth and survival. PMID:23033342

  8. Electron collisions with ethylene

    NASA Astrophysics Data System (ADS)

    Panajotovic, R.; Kitajima, M.; Tanaka, H.; Jelisavcic, M.; Lower, J.; Campbell, L.; Brunger, M. J.; Buckman, S. J.

    2003-04-01

    We have measured absolute elastic scattering and vibrational excitation cross sections for electron impact on ethylene. The experimental data have been obtained on two different crossed-beam electron spectrometers and they cover the energy range from 1 to 100 eV and scattering angles between 10° and 130°. Both differential (in angle) and energy-dependent cross sections have been measured. The differential cross sections have also been analysed using a molecular phase shift analysis technique in order to derive the integral elastic and elastic momentum transfer cross sections. Comparison is made with earlier data, where available, and also with a number of recent theoretical calculations.

  9. Electron Raman scattering in a strained ZnO/MgZnO double quantum well

    NASA Astrophysics Data System (ADS)

    Mojab-abpardeh, M.; Karimi, M. J.

    2018-02-01

    In this work, the electron Raman scattering in a strained ZnO / MgZnO double quantum wells is studied. The energy eigenvalues and the wave functions are obtained using the transfer matrix method. The effects of Mg composition, well width and barrier width on the internal electric field in well and barrier layers are investigated. Then, the influences of these parameters on the differential cross-section of electron Raman scattering are studied. Results indicate that the position, magnitude and the number of the peaks depend on the Mg composition, well width and barrier width.

  10. Function of Coenzyme F420 in Aerobic Catabolism of 2,4,6-Trinitrophenol and 2,4-Dinitrophenol by Nocardioides simplex FJ2-1A

    PubMed Central

    Ebert, Sybille; Rieger, Paul-Gerhard; Knackmuss, Hans-Joachim

    1999-01-01

    2,4,6-Trinitrophenol (picric acid) and 2,4-dinitrophenol were readily biodegraded by the strain Nocardioides simplex FJ2-1A. Aerobic bacterial degradation of these π-electron-deficient aromatic compounds is initiated by hydrogenation at the aromatic ring. A two-component enzyme system was identified which catalyzes hydride transfer to picric acid and 2,4-dinitrophenol. Enzymatic activity was dependent on NADPH and coenzyme F420. The latter could be replaced by an authentic preparation of coenzyme F420 from Methanobacterium thermoautotrophicum. One of the protein components functions as a NADPH-dependent F420 reductase. A second component is a hydride transferase which transfers hydride from reduced coenzyme F420 to the aromatic system of the nitrophenols. The N-terminal sequence of the F420 reductase showed high homology with an F420-dependent NADP reductase found in archaea. In contrast, no N-terminal similarity to any known protein was found for the hydride-transferring enzyme. PMID:10217752

  11. Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

    PubMed Central

    Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

    2017-01-01

    The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Coverage dependent non-adiabaticity of CO on a copper surface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Omiya, Takuma; Surface and Interface Science Laboratory, RIKEN, Wako 351-0198; Arnolds, Heike

    2014-12-07

    We have studied the coverage-dependent energy transfer dynamics between hot electrons and CO on Cu(110) with femtosecond visible pump, sum frequency probe spectroscopy. We find that transients of the C–O stretch frequency display a red shift, which increases from 3 cm{sup −1} at 0.1 ML to 9 cm{sup −1} at 0.77 ML. Analysis of the transients reveals that the non-adiabatic coupling between the adsorbate vibrational motion and the electrons becomes stronger with increasing coverage. This trend requires the frustrated rotational mode to be the cause of the non-adiabatic behavior, even for relatively weak laser excitation of the adsorbate. We attributemore » the coverage dependence to both an increase in the adsorbate electronic density of states and an increasingly anharmonic potential energy surface caused by repulsive interactions between neighboring CO adsorbates. This work thus reveals adsorbate-adsorbate interactions as a new way to control adsorbate non-adiabaticity.« less

  14. Catalytic two-electron reduction of dioxygen by ferrocene derivatives with manganese(V) corroles.

    PubMed

    Jung, Jieun; Liu, Shuo; Ohkubo, Kei; Abu-Omar, Mahdi M; Fukuzumi, Shunichi

    2015-05-04

    Electron transfer from octamethylferrocene (Me8Fc) to the manganese(V) imidocorrole complex (tpfc)Mn(V)(NAr) [tpfc = 5,10,15-tris(pentafluorophenyl)corrole; Ar = 2,6-Cl2C6H3] proceeds efficiently to give an octamethylferrocenium ion (Me8Fc(+)) and [(tpfc)Mn(IV)(NAr)](-) in acetonitrile (MeCN) at 298 K. Upon the addition of trifluoroacetic acid (TFA), further reduction of [(tpfc)Mn(IV)(NAr)](-) by Me8Fc gives (tpfc)Mn(III) and ArNH2 in deaerated MeCN. TFA also results in hydrolysis of (tpfc)Mn(V)(NAr) with residual water to produce a protonated manganese(V) oxocorrole complex ([(tpfc)Mn(V)(OH)](+)) in deaerated MeCN. [(tpfc)Mn(V)(OH)](+) is rapidly reduced by 2 equiv of Me8Fc in the presence of TFA to give (tpfc)Mn(III) in deaerated MeCN. In the presence of dioxygen (O2), (tpfc)Mn(III) catalyzes the two-electron reduction of O2 by Me8Fc with TFA in MeCN to produce H2O2 and Me8Fc(+). The rate of formation of Me8Fc(+) in the catalytic reduction of O2 follows zeroth-order kinetics with respect to the concentrations of Me8Fc and TFA, whereas the rate increases linearly with increasing concentrations of (tpfc)Mn(V)(NAr) and O2. These kinetic dependencies are consistent with the rate-determining step being electron transfer from (tpfc)Mn(III) to O2, followed by further proton-coupled electron transfer from Me8Fc to produce H2O2 and [(tpfc)Mn(IV)](+). Rapid electron transfer from Me8Fc to [(tpfc)Mn(IV)](+) regenerates (tpfc)Mn(III), completing the catalytic cycle. Thus, catalytic two-electron reduction of O2 by Me8Fc with (tpfc)Mn(V)(NAr) as a catalyst precursor proceeds via a Mn(III)/Mn(IV) redox cycle.

  15. 31 CFR 208.3 - Payment by electronic funds transfer.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

  16. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  17. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  18. 31 CFR 208.3 - Payment by electronic funds transfer.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

  19. 48 CFR 18.123 - Electronic funds transfer.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Electronic funds transfer. 18.123 Section 18.123 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  20. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  1. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  2. Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

    NASA Astrophysics Data System (ADS)

    Brockt, C.; Jeckelmann, E.

    2017-02-01

    We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.

  3. Electron spin relaxation enhancement measurements of interspin distances in human, porcine, and Rhodobacter electron transfer flavoprotein ubiquinone oxidoreductase (ETF QO)

    NASA Astrophysics Data System (ADS)

    Fielding, Alistair J.; Usselman, Robert J.; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

    2008-02-01

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S] 2+,1+ cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S] + cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S] + between 8 and 18 K and for semiquinone between 25 and 65 K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S] + were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S] + and obtain point-dipole interspin distances of 18.6 ± 1 Å for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present.

  4. Electron Spin Relaxation Enhancement Measurements of Interspin Distances in Human, Porcine, and Rhodobacter Electron Transfer Flavoprotein-ubiquinone Oxidoreductase (ETF-QO)

    PubMed Central

    Fielding, Alistair J.; Usselman, Robert J.; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

    2008-01-01

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S]2+,1+ cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S]+ cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S]+ between 8 and 18 K and for semiquinone between 25 and 65 K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S]+ were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S]+ and obtain point dipole interspin distances of 18.6 ± 1 Å for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present. PMID:18037314

  5. Electron spin relaxation enhancement measurements of interspin distances in human, porcine, and Rhodobacter electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO).

    PubMed

    Fielding, Alistair J; Usselman, Robert J; Watmough, Nicholas; Simkovic, Martin; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

    2008-02-01

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a membrane-bound electron transfer protein that links primary flavoprotein dehydrogenases with the main respiratory chain. Human, porcine, and Rhodobacter sphaeroides ETF-QO each contain a single [4Fe-4S](2+,1+) cluster and one equivalent of FAD, which are diamagnetic in the isolated enzyme and become paramagnetic on reduction with the enzymatic electron donor or with dithionite. The anionic flavin semiquinone can be reduced further to diamagnetic hydroquinone. The redox potentials for the three redox couples are so similar that it is not possible to poise the proteins in a state where both the [4Fe-4S](+) cluster and the flavoquinone are fully in the paramagnetic form. Inversion recovery was used to measure the electron spin-lattice relaxation rates for the [4Fe-4S](+) between 8 and 18K and for semiquinone between 25 and 65K. At higher temperatures the spin-lattice relaxation rates for the [4Fe-4S](+) were calculated from the temperature-dependent contributions to the continuous wave linewidths. Although mixtures of the redox states are present, it was possible to analyze the enhancement of the electron spin relaxation of the FAD semiquinone signal due to dipolar interaction with the more rapidly relaxing [4Fe-4S](+) and obtain point-dipole interspin distances of 18.6+/-1A for the three proteins. The point-dipole distances are within experimental uncertainty of the value calculated based on the crystal structure of porcine ETF-QO when spin delocalization is taken into account. The results demonstrate that electron spin relaxation enhancement can be used to measure distances in redox poised proteins even when several redox states are present.

  6. Substituent effects on the electronic characteristics of pentacene derivatives for organic electronic devices: dioxolane-substituted pentacene derivatives with triisopropylsilylethynyl functional groups.

    PubMed

    Griffith, Olga Lobanova; Anthony, John E; Jones, Adolphus G; Shu, Ying; Lichtenberger, Dennis L

    2012-08-29

    The intramolecular electronic structures and intermolecular electronic interactions of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS pentacene), 6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]-pentacene (TP-5 pentacene), and 2,2,10,10-tetraethyl-6,14-bis-(triisopropylsilylethynyl)-1,3,9,11-tetraoxa-dicyclopenta[b,m]pentacene (EtTP-5 pentacene) have been investigated by the combination of gas-phase and solid-phase photoelectron spectroscopy measurements. Further insight has been provided by electrochemical measurements in solution, and the principles that emerge are supported by electronic structure calculations. The measurements show that the energies of electron transfer such as the reorganization energies, ionization energies, charge-injection barriers, polarization energies, and HOMO-LUMO energy gaps are strongly dependent on the particular functionalization of the pentacene core. The ionization energy trends as a function of the substitution observed for molecules in the gas phase are not reproduced in measurements of the molecules in the condensed phase due to polarization effects in the solid. The electronic behavior of these materials is impacted less by the direct substituent electronic effects on the individual molecules than by the indirect consequences of substituent effects on the intermolecular interactions. The ionization energies as a function of film thickness give information on the relative electrical conductivity of the films, and all three molecules show different material behavior. The stronger intermolecular interactions in TP-5 pentacene films lead to better charge transfer properties versus those in TIPS pentacene films, and EtTP-5 pentacene films have very weak intermolecular interactions and the poorest charge transfer properties of these molecules.

  7. From non-covalent binding to irreversible DNA lesions: nile blue and nile red as photosensitizing agents

    PubMed Central

    Gattuso, Hugo; Besancenot, Vanessa; Grandemange, Stéphanie; Marazzi, Marco; Monari, Antonio

    2016-01-01

    We report a molecular modeling study, coupled with spectroscopy experiments, on the behavior of two well known organic dyes, nile blue and nile red, when interacting with B-DNA. In particular, we evidence the presence of two competitive binding modes, for both drugs. However their subsequent photophysical behavior is different and only nile blue is able to induce DNA photosensitization via an electron transfer mechanism. Most notably, even in the case of nile blue, its sensitization capabilities strongly depend on the environment resulting in a single active binding mode: the minor groove. Fluorescence spectroscopy confirms the presence of competitive interaction modes for both sensitizers, while the sensitization via electron transfer, is possible only in the case of nile blue. PMID:27329409

  8. Impact of Temperature and Non-Gaussian Statistics on Electron Transfer in Donor-Bridge-Acceptor Molecules.

    PubMed

    Waskasi, Morteza M; Newton, Marshall D; Matyushov, Dmitry V

    2017-03-30

    A combination of experimental data and theoretical analysis provides evidence of a bell-shaped kinetics of electron transfer in the Arrhenius coordinates ln k vs 1/T. This kinetic law is a temperature analogue of the familiar Marcus bell-shaped dependence based on ln k vs the reaction free energy. These results were obtained for reactions of intramolecular charge shift between the donor and acceptor separated by a rigid spacer studied experimentally by Miller and co-workers. The non-Arrhenius kinetic law is a direct consequence of the solvent reorganization energy and reaction driving force changing approximately as hyperbolic functions with temperature. The reorganization energy decreases and the driving force increases when temperature is increased. The point of equality between them marks the maximum of the activationless reaction rate. Reaching the consistency between the kinetic and thermodynamic experimental data requires the non-Gaussian statistics of the donor-acceptor energy gap described by the Q-model of electron transfer. The theoretical formalism combines the vibrational envelope of quantum vibronic transitions with the Q-model describing the classical component of the Franck-Condon factor and a microscopic solvation model of the solvent reorganization energy and the reaction free energy.

  9. Electronic structure and charge transfer excited states of endohedral fullerene containing electron donoracceptor complexes utilized in organic photovoltaics

    NASA Astrophysics Data System (ADS)

    Amerikheirabadi, Fatemeh

    Organic Donor-Acceptor complexes form the main component of the organic photovoltaic devices (OPVs). The open circuit voltage of OPVs is directly related to the charge transfer excited state energies of these complexes. Currently a large number of different molecular complexes are being tested for their efficiency in photovoltaic devices. In this work, density functional theory as implemented in the NRLMOL code is used to investigate the electronic structure and related properties of these donor-acceptor complexes. The charge transfer excitation energies are calculated using the perturbative delta self-consistent field method recently developed in our group as the standard time dependent density functional approaches fail to accurately provide them. The model photovoltaics systems analyzed are as follows: Sc3N C 80--ZnTPP, Y3 N C80-- ZnTPP and Sc3 N C80-- ZnPc. In addition, a thorough analysis of the isolated donor and acceptor molecules is also provided. The studied acceptors are chosen from a class of fullerenes named trimetallic nitride endohedral fullerenes. These molecules have shown to possess advantages as acceptors such as long lifetimes of the charge-separated states.

  10. Carotenoid radical cation formation in LH2 of purple bacteria: a quantum chemical study.

    PubMed

    Wormit, Michael; Dreuw, Andreas

    2006-11-30

    In LH2 complexes of Rhodobacter sphaeroides the formation of a carotenoid radical cation has recently been observed upon photoexcitation of the carotenoid S2 state. To shed more light onto the yet unknown molecular mechanism leading to carotenoid radical formation in LH2, the interactions between carotenoid and bacteriochlorophyll in LH2 are investigated by means of quantum chemical calculations for three different carotenoids--neurosporene, spheroidene, and spheroidenone--using time-dependent density functional theory. Crossings of the calculated potential energy curve of the electron transfer state with the bacteriochlorophyll Qx state and the carotenoid S1 and S2 states occur along an intermolecular distance coordinate for neurosporene and spheroidene, but for spheroidenone no crossing of the electron transfer state with the carotenoid S1 state could be found. By comparison with recent experiments where no formation of a spheroidenone radical cation has been observed, a molecular mechanism for carotenoid radical cation formation is proposed in which it is formed via a vibrationally excited carotenoid S1 or S*state. Arguments are given why the formation of the carotenoid radical cation does not proceed via the Qx, S2, or higher excited electron transfer states.

  11. Transfer matrix approach to electron transport in monolayer MoS2/MoO x heterostructures

    NASA Astrophysics Data System (ADS)

    Li, Gen

    2018-05-01

    Oxygen plasma treatment can introduce oxidation into monolayer MoS2 to transfer MoS2 into MoO x , causing the formation of MoS2/MoO x heterostructures. We find the MoS2/MoO x heterostructures have the similar geometry compared with GaAs/Ga1‑x Al x As semiconductor superlattice. Thus, We employ the established transfer matrix method to analyse the electron transport in the MoS2/MoO x heterostructures with double-well and step-well geometries. We also considere the coupling between transverse and longitudinal kinetic energy because the electron effective mass changes spatially in the MoS2/MoO x heterostructures. We find the resonant peaks show red shift with the increasing of transverse momentum, which is similar to the previous work studying the transverse-momentum-dependent transmission in GaAs/Ga1‑x Al x As double-barrier structure. We find electric field can enhance the magnitude of peaks and intensify the coupling between longitudinal and transverse momentums. Moreover, higher bias is applied to optimize resonant tunnelling condition to show negative differential effect can be observed in the MoS2/MoO x system.

  12. Solving Kinetic Equations for the Laser Flash Photolysis Experiment on Nitric Oxide Synthases: Effect of Conformational Dynamics on the Interdomain Electron Transfer.

    PubMed

    Astashkin, Andrei V; Feng, Changjian

    2015-11-12

    The production of nitric oxide by the nitric oxide synthase (NOS) enzyme depends on the interdomain electron transfer (IET) between the flavin mononucleotide (FMN) and heme domains. Although the rate of this IET has been measured by laser flash photolysis (LFP) for various NOS proteins, no rigorous analysis of the relevant kinetic equations was performed so far. In this work, we provide an analytical solution of the kinetic equations underlying the LFP approach. The derived expressions reveal that the bulk IET rate is significantly affected by the conformational dynamics that determines the formation and dissociation rates of the docking complex between the FMN and heme domains. We show that in order to informatively study the electron transfer across the NOS enzyme, LFP should be used in combination with other spectroscopic methods that could directly probe the docking equilibrium and the conformational change rate constants. The implications of the obtained analytical expressions for the interpretation of the LFP results from various native and modified NOS proteins are discussed. The mathematical formulas derived in this work should also be applicable for interpreting the IET kinetics in other modular redox enzymes.

  13. Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

    PubMed

    Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

    2009-01-01

    A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhattacharyya, K.; Das, P.K.

    In the course of benzophenone triplet quenching by triethylamine (TEA) at high concentrations in alkaline aqueous acetonitrile, two temporally distinct processes are observed for ketyl radical anion formation. The fast component occurs on a nanosecond time scale, has kinetics sensitive to basicity and water content of the medium, and is ascribed to the deprotonation of the diphenylhydroxymethyl radical initially produced as a result of subnanosecond intra-ion-pair proton transfer. The slow process occurs on a microsecond time scale and is characterized by pseudo-first-order rate constants linearly dependent on ketone ground-state concentration; this is assigned to the one-electron reduction of the ketonemore » by the methyl(diethylamino)methyl radical (derived from TEA). Substituent effects on the kinetics of the two processes follow trends expected from those of the acidity of diarylhydroxymethyl radicals and of the behavior of diaryl ketones as oxidants. Neither of the two processes is observed with N,N-dimethylaniline (DMA) and 1,4-diazabicyclo(2.2.2)octane (DABCO) as quenchers. The electron or hydrogen transfer yields in the course of diaryl ketone triplet quenching by the three amines are all close to unity, suggesting that the back electron transfer in the triplet ion pairs is relatively unimportant.« less

  15. New insights into the nonadiabatic state population dynamics of model proton-coupled electron transfer reactions from the mixed quantum-classical Liouville approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shakib, Farnaz A.; Hanna, Gabriel, E-mail: gabriel.hanna@ualberta.ca

    In a previous study [F. A. Shakib and G. Hanna, J. Chem. Phys. 141, 044122 (2014)], we investigated a model proton-coupled electron transfer (PCET) reaction via the mixed quantum-classical Liouville (MQCL) approach and found that the trajectories spend the majority of their time on the mean of two coherently coupled adiabatic potential energy surfaces. This suggested a need for mean surface evolution to accurately simulate observables related to ultrafast PCET processes. In this study, we simulate the time-dependent populations of the three lowest adiabatic states in the ET-PT (i.e., electron transfer preceding proton transfer) version of the same PCET modelmore » via the MQCL approach and compare them to the exact quantum results and those obtained via the fewest switches surface hopping (FSSH) approach. We find that the MQCL population profiles are in good agreement with the exact quantum results and show a significant improvement over the FSSH results. All of the mean surfaces are shown to play a direct role in the dynamics of the state populations. Interestingly, our results indicate that the population transfer to the second-excited state can be mediated by dynamics on the mean of the ground and second-excited state surfaces, as part of a sequence of nonadiabatic transitions that bypasses the first-excited state surface altogether. This is made possible through nonadiabatic transitions between different mean surfaces, which is the manifestation of coherence transfer in MQCL dynamics. We also investigate the effect of the strength of the coupling between the proton/electron and the solvent coordinate on the state population dynamics. Drastic changes in the population dynamics are observed, which can be understood in terms of the changes in the potential energy surfaces and the nonadiabatic couplings. Finally, we investigate the state population dynamics in the PT-ET (i.e., proton transfer preceding electron transfer) and concerted versions of the model. The PT-ET results confirm the participation of all of the mean surfaces, albeit in different proportions compared to the ET-PT case, while the concerted results indicate that the mean of the ground- and first-excited state surfaces only plays a role, due to the large energy gaps between the ground- and second-excited state surfaces.« less

  16. Solvent dynamics and electron transfer reactions

    NASA Astrophysics Data System (ADS)

    Rasaiah, Jayendran C.; Zhu, Jianjun

    1994-02-01

    Recent experimental and theoretical studies of the influence of solvent dynamics on electron transfer (ET) reactions are discussed. It is seen that the survival probabilities of the reactants and products can be obtained as the solution to an integral equation using experimental or simulation data on the solvation dynamics. The theory developed for ET between thermally equilibrated reactants in solution, in which the ligand vibrations were treated classically, is extended to include quantum effects on the inner-shell ligand vibration and electron transfer from a nonequilibrium initial state prepared, for example, by laser excitation. This leads to a slight modification of the integral equation which is easily solved on a personal computer to provide results that can be directly compared with experiment. Analytic approximations to the solutions of the integral equation, ranging from a single exponential to multiexponential time dependence of the survival probabilities are discussed. The rate constant for the single exponential decay of the reactants interpolates between the thermal equilibrium rate constant kie (that is independent of solvent dynamics) and a diffusion controlled rate constant kid (determined by solvent dynamics) and also between the wide (A=0) and narrow (A=1) window limits dominated by inner-sphere ligand vibration and outer-sphere solvent reorganization respectively. The explicit dependence of the integral equation solutions on solvation dynamics S(t), the free energy of reaction ΔG0, the total reorganization energy λ and its partitioning between ligand vibration λq and solvent polarization fluctuations λ0, and the nature of the initial state should be useful in the analysis and design of ET experiments in different solvents.

  17. Charge Transfer Exciton in Halogen-Bridged Mixed-Valent Pt and Pd Complexes: Analysis Based on the Peierls-Hubbard Model

    NASA Astrophysics Data System (ADS)

    Wada, Yoshiki; Mitani, Tadaoki; Yamashita, Masahiro; Koda, Takao

    1985-08-01

    Polarized reflection and luminescence have been measured for the single crystals of [MA2][MX2A2](ClO4)4 (M=Pt, Pd, X=Cl, Br, I and A=ethylenediamine, cyclohexanediamine). The strong absorption bands due to the charge-transfer (CT) exciton transitions between the mixed-valent metal ions have been investigated in detail in the visible or infrared energy regions. The dependence of the CT excitation energies on the species M and X is shown to be consistent with the prediction by the Peierls-Hubbard model which incorporates the effect of the electron-electron correlation on inter-metal sites. The oscillator strength of the CT excitons are observed to be enhanced by substituting heavier halogen ions. This enhancement is interpreted by a halogen-linked super-transfer mechanism. The unusually large values of the oscillator strength can be qualitatively explained in terms of the trimer CT model.

  18. Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis.

    PubMed

    Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik

    2016-04-01

    Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1-0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. Quantitative imaging of electron transfer flavoprotein autofluorescence reveals the dynamics of lipid partitioning in living pancreatic islets.

    PubMed

    Lam, Alan K; Silva, Pamuditha N; Altamentova, Svetlana M; Rocheleau, Jonathan V

    2012-08-01

    Pancreatic islet β-cells metabolically sense nutrients to maintain blood glucose homeostasis through the regulated secretion of insulin. Long-term exposure to a mixed supply of excess glucose and fatty acids induces β-cell dysfunction and type II diabetes in a process termed glucolipotoxicity. Despite a number of documented mechanisms for glucolipotoxicity, the interplay between glucose and fatty acid oxidation in islets remains debated. Here, we develop confocal imaging of electron transfer flavoprotein (ETF) autofluorescence to reveal the dynamics of fatty acid oxidation in living pancreatic islets. This method further integrates microfluidic devices to hold the islets stationary in flow, and thus achieve ETF imaging in the β-cells with high spatial and temporal resolution. Our data first confirm that ETF autofluorescence reflects electron transport chain (ETC) activity downstream of Complex I, consistent with a response directly related to fatty acid metabolism. Together with two-photon imaging of NAD(P)H and confocal imaging of lipoamide dehydrogenase (LipDH) autofluorescence, we show that the ETC predominantly draws electrons from LipDH/NADH-dependent Complex I rather than from ETF/FADH(2)-dependent ETF:CoQ oxidoreductase (ETF-QO). Islets stimulated with palmitate also show increased ETF redox state that is dose-dependently diminished by glucose (>10 mM). Furthermore, stimulation with a glucose bolus causes a two-tier drop in the ETF redox state at ∼5 and ∼20 min, suggesting glucose metabolism immediately increases ETC activity and later decreases fatty acid oxidation. Our results demonstrate the utility of ETF imaging in characterizing fatty acid-induced redox responses with high subcellular and temporal resolution. Our results further demonstrate a dominant role of glucose metabolism over fatty acid oxidation in β-cells even when presented with a mixed nutrient condition associated with glucolipotoxicity.

  20. Modular electron transfer circuits for synthetic biology

    PubMed Central

    Agapakis, Christina M

    2010-01-01

    Electron transfer is central to a wide range of essential metabolic pathways, from photosynthesis to fermentation. The evolutionary diversity and conservation of proteins that transfer electrons makes these pathways a valuable platform for engineered metabolic circuits in synthetic biology. Rational engineering of electron transfer pathways containing hydrogenases has the potential to lead to industrial scale production of hydrogen as an alternative source of clean fuel and experimental assays for understanding the complex interactions of multiple electron transfer proteins in vivo. We designed and implemented a synthetic hydrogen metabolism circuit in Escherichia coli that creates an electron transfer pathway both orthogonal to and integrated within existing metabolism. The design of such modular electron transfer circuits allows for facile characterization of in vivo system parameters with applications toward further engineering for alternative energy production. PMID:21468209

  1. Electrochemical control over photoinduced electron transfer and trapping in CdSe-CdTe quantum-dot solids.

    PubMed

    Boehme, Simon C; Walvis, T Ardaan; Infante, Ivan; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Houtepen, Arjan J

    2014-07-22

    Understanding and controlling charge transfer between different kinds of colloidal quantum dots (QDs) is important for devices such as light-emitting diodes and solar cells and for thermoelectric applications. Here we study photoinduced electron transfer between CdTe and CdSe QDs in a QD film. We find that very efficient electron trapping in CdTe QDs obstructs electron transfer to CdSe QDs under most conditions. Only the use of thiol ligands results in somewhat slower electron trapping; in this case the competition between trapping and electron transfer results in a small fraction of electrons being transferred to CdSe. However, we demonstrate that electron trapping can be controlled and even avoided altogether by using the unique combination of electrochemistry and transient absorption spectroscopy. When the Fermi level is raised electrochemically, traps are filled with electrons and electron transfer from CdTe to CdSe QDs occurs with unity efficiency. These results show the great importance of knowing and controlling the Fermi level in QD films and open up the possibility of studying the density of trap states in QD films as well as the systematic investigation of the intrinsic electron transfer rates in donor-acceptor films.

  2. Redox electrodeposition polymers: adaptation of the redox potential of polymer-bound Os complexes for bioanalytical applications.

    PubMed

    Guschin, Dmitrii A; Castillo, John; Dimcheva, Nina; Schuhmann, Wolfgang

    2010-10-01

    The design of polymers carrying suitable ligands for coordinating Os complexes in ligand exchange reactions against labile chloro ligands is a strategy for the synthesis of redox polymers with bound Os centers which exhibit a wide variation in their redox potential. This strategy is applied to polymers with an additional variation of the properties of the polymer backbone with respect to pH-dependent solubility, monomer composition, hydrophilicity etc. A library of Os-complex-modified electrodeposition polymers was synthesized and initially tested with respect to their electron-transfer ability in combination with enzymes such as glucose oxidase, cellobiose dehydrogenase, and PQQ-dependent glucose dehydrogenase entrapped during the pH-induced deposition process. The different polymer-bound Os complexes in a library containing 50 different redox polymers allowed the statistical evaluation of the impact of an individual ligand to the overall redox potential of an Os complex. Using a simple linear regression algorithm prediction of the redox potential of Os complexes becomes feasible. Thus, a redox polymer can now be designed to optimally interact in electron-transfer reactions with a selected enzyme.

  3. Increasing the productivity of glycopeptides analysis by using higher-energy collision dissociation-accurate mass-product-dependent electron transfer dissociation.

    PubMed

    Saba, Julian; Dutta, Sucharita; Hemenway, Eric; Viner, Rosa

    2012-01-01

    Currently, glycans are attracting attention from the scientific community as potential biomarkers or as posttranslational modifications (PTMs) of therapeutic proteins. However, structural characterization of glycoproteins and glycopeptides remains analytically challenging. Here, we report on the implementation of a novel acquisition strategy termed higher-energy collision dissociation-accurate mass-product-dependent electron transfer dissociation (HCD-PD-ETD) on a hybrid linear ion trap-orbitrap mass spectrometer. This acquisition strategy uses the complementary fragmentations of ETD and HCD for glycopeptides analysis in an intelligent fashion. Furthermore, the approach minimizes user input for optimizing instrumental parameters and enables straightforward detection of glycopeptides. ETD spectra are only acquired when glycan oxonium ions from MS/MS HCD are detected. The advantage of this approach is that it streamlines data analysis and improves dynamic range and duty cycle. Here, we present the benefits of HCD-PD-ETD relative to the traditional alternating HCD/ETD for a trainer set containing twelve-protein mixture with two glycoproteins: human serotransferrin, ovalbumin and contaminations of two other: bovine alpha 1 acid glycoprotein (bAGP) and bovine fetuin.

  4. Nonlinear resistivity for magnetohydrodynamical models

    DOE PAGES

    Lingam, M.; Hirvijoki, E.; Pfefferlé, D.; ...

    2017-04-20

    A new formulation of the plasma resistivity that stems from the collisional momentum-transfer rate between electrons and ions is presented. The resistivity computed herein is shown to depend not only on the temperature and density but also on all other polynomial velocity-space moments of the distribution function, such as the pressure tensor and heat flux vector. The full expression for the collisional momentum-transfer rate is determined and is used to formulate the nonlinear anisotropic resistivity. The new formalism recovers the Spitzer resistivity, as well as the concept of thermal force if the heat flux is assumed to be proportional tomore » a temperature gradient. Furthermore, if the pressure tensor is related to viscous stress, the latter enters the expression for the resistivity. The relative importance of the nonlinear term(s) with respect to the well-established electron inertia and Hall terms is also examined. Lastly, the subtle implications of the nonlinear resistivity, and its dependence on the fluid variables, are discussed in the context of magnetized plasma environments and phenomena such as magnetic reconnection.« less

  5. Theoretical study on the optical response behavior to hydrogen chloride gas of a series of Schiff-base-based star-shaped structures.

    PubMed

    Wang, Fei; Qi, Tianhong; Su, Zhongmin; Xie, Yuzhong

    2018-02-17

    Schiff-base compounds have many applications in the field of optoelectronic materials and chemical sensing because of their appealing coordination ability, and simple and easily accessible use in structural modification. Herein, five kinds of star-shaped Schiff-base compounds were designed and their optical response behavior to hydrogen chloride (HCl) gas was studied using dependent/time-dependent density functional theory (DFT/TDDFT). Moreover, the relationship between structures and properties was investigated upon changing the benzene group into N atom or triazine group at the core-position and introducing a methoxyl (-OCH 3 ) or nitro (-NO 2 ) group into the star-shaped Schiff-bases at the tail of the branches. The results show that all five Schiff-bases could be candidates for HCl gas sensing materials. Furthermore, introducing an electron-donating group at either the core or the tail forms a charge transfer channel with the electron deficient H-bonded imino group, which is convenient for charge transfer and subsequently promotes a red-shift in absorption spectra and fluorescence quenching.

  6. A single residue controls electron transfer gating in photosynthetic reaction centers

    NASA Astrophysics Data System (ADS)

    Shlyk, Oksana; Samish, Ilan; Matěnová, Martina; Dulebo, Alexander; Poláková, Helena; Kaftan, David; Scherz, Avigdor

    2017-03-01

    Interquinone QA- → QB electron-transfer (ET) in isolated photosystem II reaction centers (PSII-RC) is protein-gated. The temperature-dependent gating frequency “k” is described by the Eyring equation till levelling off at T ≥ 240 °K. Although central to photosynthesis, the gating mechanism has not been resolved and due to experimental limitations, could not be explored in vivo. Here we mimic the temperature dependency of “k” by enlarging VD1-208, the volume of a single residue at the crossing point of the D1 and D2 PSII-RC subunits in Synechocystis 6803 whole cells. By controlling the interactions of the D1/D2 subunits, VD1-208 (or 1/T) determines the frequency of attaining an ET-active conformation. Decelerated ET, impaired photosynthesis, D1 repair rate and overall cell physiology upon increasing VD1-208 to above 130 Å3, rationalize the >99% conservation of small residues at D1-208 and its homologous motif in non-oxygenic bacteria. The experimental means and resolved mechanism are relevant for numerous transmembrane protein-gated reactions.

  7. Photoinduced electron transfer in a room temperature ionic liquid 1-butyl-3-methylimidazolium octyl sulfate micelle: a temperature dependent study.

    PubMed

    Sarkar, Souravi; Mandal, Sarthak; Pramanik, Rajib; Ghatak, Chiranjib; Rao, Vishal Govind; Sarkar, Nilmoni

    2011-05-19

    The effect of temperature on the dynamics of photoinduced electron transfer (PET) between different coumarin dyes and N,N-dimethyl aniline in a room temperature ionic liquid 1-butyl-3-methylimidazolium octyl sulfate ([C(4)mim][C(8)SO(4)]) micelle have been investigated using steady-state and time-resolved fluorescence quenching measurements at four different temperatures: 208, 298, 308, and 318 K. The quenching rates (k(q)(TR)) of the PET process in this micellar system are found to be lower than the PET rate in sodium dodecyl sulfate and Triton-X 100 micelle and almost comparable to the dodecyl trimethyl ammonium bromide and cetyl trimethyl ammonium bromide micelle due to larger donor–acceptor separation in the micellar phase. The temperature dependent PET rates are well correlated with the Arrhenius type of correlation for all the coumarin dyes. Marcus type of inversion in PET rates has been observed at relatively lower exergonicity, and the correlation plots gradually move upward with the increase of temperature. © 2011 American Chemical Society

  8. Ligand-induced dependence of charge transfer in nanotube–quantum dot heterostructures

    DOE PAGES

    Wang, Lei; Han, Jinkyu; Sundahl, Bryan; ...

    2016-07-01

    As a model system to probe ligand-dependent charge transfer in complex composite heterostructures, we fabricated double-walled carbon nanotube (DWNT) – CdSe quantum dot (QD) composites. Whereas the average diameter of the QDs probed was kept fixed at ~4.1 nm and the nanotubes analyzed were similarly oxidatively processed, by contrast, the ligands used to mediate the covalent attachment between the QDs and DWNTs were systematically varied to include p-phenylenediamine (PPD), 2-aminoethanethiol (AET), and 4-aminothiophenol (ATP). Herein, we have put forth a unique compilation of complementary data from experiment and theory, including results from transmission electron microscopy (TEM), near-edge X-ray absorption finemore » structure (NEXAFS) spectroscopy, Raman spectroscopy, electrical transport measurements, and theoretical modeling studies, in order to fundamentally assess the nature of the charge transfer between CdSe QDs and DWNTs, as a function of the structure of various, intervening bridging ligand molecules. Specifically, we correlated evidence of charge transfer as manifested by changes and shifts associated with NEXAFS intensities, Raman peak positions, and threshold voltages both before and after CdSe QD deposition onto the underlying DWNT surface. Importantly, for the first time ever in these types of nanoscale composite systems, we have sought to use theoretical modeling to justify and account for our experimental results. Finally, our overall data suggest that (i) QD coverage density on the DWNTs varies, based upon the different ligand pendant groups used and that (ii) the presence of a π-conjugated carbon framework within the ligands themselves and the electron affinity of the pendant groups collectively play important roles in the resulting charge transfer from QDs to the underlying CNTs.« less

  9. Spin dependent transport and spin transfer in nanoconstrictions and current confined nanomagnets

    NASA Astrophysics Data System (ADS)

    Ozatay, Ozhan

    In this thesis, I have employed point contact spectroscopy to determine the nature of electron transport across constrained domain walls in a ferromagnetic nanocontact and to uncover the relationship between ballisticity of electron transport and domain wall magnetoresistance. In the range of hole sizes studied (from 10 to 3 nm) the resulting magnetoresistance was found to be less than 0.5% and one that increases with decreasing contact size. I have used point contacts as local probes, to study the spin dependent transport across Ferromagnet/Normal Metal/Ferromagnet(FM/NM/FM) trilayers as well as the consequences of localized spin polarized current injection into a nano magnet on spin angular momentum transfer and high frequency magnetization dynamics. I have demonstrated that absolute values for spin transfer switching critical currents are reduced in this new geometry as compared to uniform current injection. I have also performed micromagnetic simulations to determine the evolution of magnetization under the application of magnetic fields and currents to gain more insights into experimental results. I have used Scanning Transmission Electron Microscopy (STEM), X-Ray Photoemission Spectroscopy (XPS) and Electron Energy Loss Spectroscopy (EELS) techniques to characterize the interfacial mixing and oxygen diffusion in the metallic multilayers of interest. I have shown that the Ta/CuOx bilayer structure provides a smooth substrate by improving interfacial roughness due to grain boundary diffusion of oxygen and reaction with Ta that fills in the grain boundary gaps in Cu. Analysis of the Py/AlOx interface proved a strong oxidation passivation on the Py surface by Al coating accompanied by Fe segregation into the alumina. I have utilized the characterization results to design a new nanomagnet whose sidewalls are protected from adventitious sidewall oxide layers and yields improved device performance. The oxide layers that naturally develop at the sidewalls of Py nanomagnets cause an enhancement in magnetic damping especially for temperatures below the blocking temperature of the AFM layer (≤40K). Studies with pillars protected by Al coating and ones with more NiO coating (˜2.5 nm) shed light onto the role of surface oxides in determining temperature dependent behaviour of both spin torque and field driven switching characteristics.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Megala, M.; Rajkumar, Beulah J. M., E-mail: beulah-rajkumar@yahoo.co.in

    The electronic and optical transfer properties of Benzene, Benzoic Acid (BA), Nitrobenzene (NB) and Para Nitro Benzoic Acid (PNBA) at ground and first excited state has been investigated by the Density functional theory (DFT)and Time Dependent Density Functional Theory (TDDFT) using SVWN functional/3-21G basis set respectively. Possible intra-molecular charge transfer and n to π* transitions in the ground and the first excitation states have been predicted by the molecular orbitals and the Natural Bond Orbital (NBO) analysis. The simulated absorption spectra have been generated and the result compared with existing experimental results.

  11. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized {sup 2}H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferro-Luzzi, M.; Bouwhuis, M.; Passchier, E.

    1996-09-01

    We report an absolute measurement of the tensor analyzing powers {ital T}{sub 20} and {ital T}{sub 22} in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup {minus}1}. The novel approach of this measurement is the use of a tensor polarized {sup 2}H target internal to an electron storage ring, with {ital in} {ital situ} measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering. {copyright} {ital 1996 The American Physical Society.}

  12. Hot-electron transfer in quantum-dot heterojunction films.

    PubMed

    Grimaldi, Gianluca; Crisp, Ryan W; Ten Brinck, Stephanie; Zapata, Felipe; van Ouwendorp, Michiko; Renaud, Nicolas; Kirkwood, Nicholas; Evers, Wiel H; Kinge, Sachin; Infante, Ivan; Siebbeles, Laurens D A; Houtepen, Arjan J

    2018-06-13

    Thermalization losses limit the photon-to-power conversion of solar cells at the high-energy side of the solar spectrum, as electrons quickly lose their energy relaxing to the band edge. Hot-electron transfer could reduce these losses. Here, we demonstrate fast and efficient hot-electron transfer between lead selenide and cadmium selenide quantum dots assembled in a quantum-dot heterojunction solid. In this system, the energy structure of the absorber material and of the electron extracting material can be easily tuned via a variation of quantum-dot size, allowing us to tailor the energetics of the transfer process for device applications. The efficiency of the transfer process increases with excitation energy as a result of the more favorable competition between hot-electron transfer and electron cooling. The experimental picture is supported by time-domain density functional theory calculations, showing that electron density is transferred from lead selenide to cadmium selenide quantum dots on the sub-picosecond timescale.

  13. Probing conformational dynamics by photoinduced electron transfer

    NASA Astrophysics Data System (ADS)

    Neuweiler, Hannes; Herten, Dirk P.; Marme, N.; Knemeyer, J. P.; Piestert, Oliver; Tinnefeld, Philip; Sauer, Marcus

    2004-07-01

    We demonstrate how photoinduced electron transfer (PET) reactions can be successfully applied to monitor conformational dynamics in individual biopolymers. Single-pair fluorescence resonance energy transfer (FRET) experiments are ideally suited to study conformational dynamics occurring on the nanometer scale, e.g. during protein folding or unfolding. In contrast, conformational dynamics with functional significance, for example occurring in enzymes at work, often appear on much smaller spatial scales of up to several Angströms. Our results demonstrate that selective PET-reactions between fluorophores and amino acids or DNA nucleotides represent a versatile tool to measure small-scale conformational dynamics in biopolymers on a wide range of time scales, extending from nanoseconds to seconds, at the single-molecule level under equilibrium conditions. That is, the monitoring of conformational dynamics of biopolymers with temporal resolutions comparable to those within reach using new techniques of molecular dynamic simulations. We present data about structural changes of single biomolecules like DNA hairpins and peptides by using quenching electron transfer reactions between guanosine or tryptophan residues in close proximity to fluorescent dyes. Furthermore, we demonstrate that the strong distance dependence of charge separation reactions on the sub-nanometer scale can be used to develop conformationally flexible PET-biosensors. These sensors enable the detection of specific target molecules in the sub-picomolar range and allow one to follow their molecular binding dynamics with temporal resolution.

  14. Electron, proton and hydrogen-atom transfers in photosynthetic water oxidation.

    PubMed Central

    Tommos, Cecilia

    2002-01-01

    When photosynthetic organisms developed so that they could use water as an electron source to reduce carbon dioxide, the stage was set for efficient proliferation. Algae and plants spread globally and provided the foundation for our atmosphere and for O(2)-based chemistry in biological systems. Light-driven water oxidation is catalysed by photosystem II, the active site of which contains a redox-active tyrosine denoted Y(Z), a tetramanganese cluster, calcium and chloride. In 1995, Gerald Babcock and co-workers presented the hypothesis that photosynthetic water oxidation occurs as a metallo-radical catalysed process. In this model, the oxidized tyrosine radical is generated by coupled proton/electron transfer and re-reduced by abstracting hydrogen atoms from substrate water or hydroxide-ligated to the manganese cluster. The proposed function of Y(Z) requires proton transfer from the tyrosine site upon oxidation. The oxidation mechanism of Y(Z) in an inhibited and O(2)-evolving photosystem II is discussed. Domino-deprotonation from Y(Z) to the bulk solution is shown to be consistent with a variety of data obtained on metal-depleted samples. Experimental data that suggest that the oxidation of Y(Z) in O(2)-evolving samples is coupled to proton transfer in a hydrogen-bonding network are described. Finally, a dielectric-dependent model for the proton release that is associated with the catalytic cycle of photosystem II is discussed. PMID:12437877

  15. On the use of electrokinetic phenomena of the second kind for probing electrode kinetic properties of modified electron-conducting surfaces.

    PubMed

    Duval, Jérôme F L; Sorrenti, Estelle; Waldvogel, Yves; Görner, Tatiana; De Donato, Philippe

    2007-04-14

    The electrokinetic features of electron-conducting substrates, as measured in a conventional thin-layer electrokinetic cell, strongly depend on the extent of bipolar faradaic depolarisation of the interface formed with the adjacent electrolytic solution. Streaming potential versus applied pressure data obtained for metallic substrates must generally be interpreted on the basis of a modified Helmholtz-Smoluchowski equation corrected by an electronic conduction term-non linear with respect to the lateral potential and applied pressure gradient-that stems from the bipolar electrodic behavior of the metallic surface. In the current study, streaming potential measurements have been performed in KNO(3) solutions on porous plugs made of electron-conducting grains of pyrite (FeS(2)) covered by humic acids. For zero coverage, the extensive bipolar electronic conduction taking place in the plug-depolarized by concomitant and spatially distributed oxidation and reduction reactions of Fe(2+) and Fe(3+) species-leads to the complete extinction of the streaming potential over the entire range of applied pressure examined. For low to intermediate coverage, the local electron-transfer kinetics on the covered regions of the plug becomes more sluggish. The overall bipolar electronic conduction is then diminished which leads to an increase in the streaming potential with a non-linear dependence on the pressure. For significant coverage, a linear response is observed which basically reflects the interfacial double layer properties of the humics surface layer. A tractable, semi-analytical model is presented that reproduces the electrokinetic peculiarities of the complex and composite system FeS(2)/humics investigated. The study demonstrates that the streaming potential technique is a fast and valuable tool for establishing how well the electron transfer kinetics at a partially or completely depolarised bare electron-conducting substrate/electrolyte solution interface is either promoted (catalysis) or blocked (passivation) by the presence of a discontinuous surface layer.

  16. Cell-secreted flavins bound to membrane cytochromes dictate electron transfer reactions to surfaces with diverse charge and pH.

    PubMed

    Okamoto, Akihiro; Kalathil, Shafeer; Deng, Xiao; Hashimoto, Kazuhito; Nakamura, Ryuhei; Nealson, Kenneth H

    2014-07-11

    The variety of solid surfaces to and from which microbes can deliver electrons by extracellular electron transport (EET) processes via outer-membrane c-type cytochromes (OM c-Cyts) expands the importance of microbial respiration in natural environments and industrial applications. Here, we demonstrate that the bifurcated EET pathway of OM c-Cyts sustains the diversity of the EET surface in Shewanella oneidensis MR-1 via specific binding with cell-secreted flavin mononucleotide (FMN) and riboflavin (RF). Microbial current production and whole-cell differential pulse voltammetry revealed that RF and FMN enhance EET as bound cofactors in a similar manner. Conversely, FMN and RF were clearly differentiated in the EET enhancement by gene-deletion of OM c-Cyts and the dependency of the electrode potential and pH. These results indicate that RF and FMN have specific binding sites in OM c-Cyts and highlight the potential roles of these flavin-cytochrome complexes in controlling the rate of electron transfer to surfaces with diverse potential and pH.

  17. Visualizing changes in electron distribution in coupled chains of cytochrome bc(1) by modifying barrier for electron transfer between the FeS cluster and heme c(1).

    PubMed

    Cieluch, Ewelina; Pietryga, Krzysztof; Sarewicz, Marcin; Osyczka, Artur

    2010-02-01

    Cytochrome c(1) of Rhodobacter (Rba.) species provides a series of mutants which change barriers for electron transfer through the cofactor chains of cytochrome bc(1) by modifying heme c(1) redox midpoint potential. Analysis of post-flash electron distribution in such systems can provide useful information about the contribution of individual reactions to the overall electron flow. In Rba. capsulatus, the non-functional low-potential forms of cytochrome c(1) which are devoid of the disulfide bond naturally present in this protein revert spontaneously by introducing a second-site suppression (mutation A181T) that brings the potential of heme c(1) back to the functionally high levels, yet maintains it some 100 mV lower from the native value. Here we report that the disulfide and the mutation A181T can coexist in one protein but the mutation exerts a dominant effect on the redox properties of heme c(1) and the potential remains at the same lower value as in the disulfide-free form. This establishes effective means to modify a barrier for electron transfer between the FeS cluster and heme c(1) without breaking disulfide. A comparison of the flash-induced electron transfers in native and mutated cytochrome bc(1) revealed significant differences in the post-flash equilibrium distribution of electrons only when the connection of the chains with the quinone pool was interrupted at the level of either of the catalytic sites by the use of specific inhibitors, antimycin or myxothiazol. In the non-inhibited system no such differences were observed. We explain the results using a kinetic model in which a shift in the equilibrium of one reaction influences the equilibrium of all remaining reactions in the cofactor chains. It follows a rather simple description in which the direction of electron flow through the coupled chains of cytochrome bc(1) exclusively depends on the rates of all reversible partial reactions, including the Q/QH2 exchange rate to/from the catalytic sites. 2009 Elsevier B.V. All rights reserved.

  18. Possible Dynamically Gated Conductance along Heme Wires in Bacterial Multiheme Cytochromes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, Dayle MA; Rosso, Kevin M.

    2014-07-24

    The staggered cross decaheme configuration of electron transfer co-factors in the outer-membrane cytochrome MtrF may serve as a prototype for conformationally-gated multi-heme electron transport. Derived from the bacterium Shewanella oneidensis, the staggered cross configuration reveals intersecting c-type octaheme and tetraheme “wires” containing thermodynamic “hills” and “valleys”, suggesting that the protein structure may include a dynamical mechanism for conductance and pathway switching depending on enzymatic functional need. Recent molecular simulations have established the pair-wise electronic couplings, redox potentials, and reorganization energies to predict the maximum conductance along the various heme wire pathways by sequential hopping of a single electron (PNAS (2014)more » 11,611-616). Here, we expand this information with classical molecular and statistical mechanics calculations of large-amplitude protein dynamics in MtrF, to address its potential to modulate pathway conductance, including assessment of the effect of the total charge state. Explicit solvent molecular dynamics simulations of fully oxidized and fully reduced MtrF employing ten independent 50-ns simulations at 300 K and 1 atm showed that reduced MtrF is more expanded and explores more conformational space than oxidized MtrF, and that heme reduction leads to increased heme solvent exposure. The slowest mode of collective decaheme motion is 90% similar between the oxidized and reduced states, and consists primarily of inter-heme separation with minor rotational contributions. The frequency of this motion is 1.7×107 s 1 for fully-oxidized and fully-reduced MtrF, respectively, slower than the downhill electron transfer rates between stacked heme pairs at the octaheme termini and faster than the electron transfer rates between parallel hemes in the tetraheme chain. This implies that MtrF uses slow conformational fluctuations to modulate electron flow along the octaheme pathway, apparently for the purpose of increasing the residence time of electrons on lowest potential hemes 4 and 9. This apparent gating mechanism should increase the success rate of electron transfer from MtrF to low potential environmental acceptors via these two solvent-exposed hemes.« less

  19. Electron transport in single molecules: from benzene to graphene.

    PubMed

    Chen, F; Tao, N J

    2009-03-17

    Electron movement within and between molecules--that is, electron transfer--is important in many chemical, electrochemical, and biological processes. Recent advances, particularly in scanning electrochemical microscopy (SECM), scanning-tunneling microscopy (STM), and atomic force microscopy (AFM), permit the study of electron movement within single molecules. In this Account, we describe electron transport at the single-molecule level. We begin by examining the distinction between electron transport (from semiconductor physics) and electron transfer (a more general term referring to electron movement between donor and acceptor). The relation between these phenomena allows us to apply our understanding of single-molecule electron transport between electrodes to a broad range of other electron transfer processes. Electron transport is most efficient when the electron transmission probability via a molecule reaches 100%; the corresponding conductance is then 2e(2)/h (e is the charge of the electron and h is the Planck constant). This ideal conduction has been observed in a single metal atom and a string of metal atoms connected between two electrodes. However, the conductance of a molecule connected to two electrodes is often orders of magnitude less than the ideal and strongly depends on both the intrinsic properties of the molecule and its local environment. Molecular length, means of coupling to the electrodes, the presence of conjugated double bonds, and the inclusion of possible redox centers (for example, ferrocene) within the molecular wire have a pronounced effect on the conductance. This complex behavior is responsible for diverse chemical and biological phenomena and is potentially useful for device applications. Polycyclic aromatic hydrocarbons (PAHs) afford unique insight into electron transport in single molecules. The simplest one, benzene, has a conductance much less than 2e(2)/h due to its large LUMO-HOMO gap. At the other end of the spectrum, graphene sheets and carbon nanotubes--consisting of infinite numbers of aromatic rings--have small or even zero energy gaps between the conduction and valence bands. Between these two limits are intermediate molecules with rich properties, such as perylene derivatives made of seven aromatic rings; the properties of these types of molecules have yet to be fully explored. Studying PAHs is important not only in answering fundamental questions about electron transport but also in the ongoing quest for molecular-scale electronic devices. This line of research also helps bridge the gap between electron transfer phenomena in small redox molecules and electron transport properties in nanostructures.

  20. From Geometry Optimization to Time Dependent Molecular Structure Modeling: Method Developments, ab initio Theories and Applications

    NASA Astrophysics Data System (ADS)

    Liang, Wenkel

    This dissertation consists of two general parts: (I) developments of optimization algorithms (both nuclear and electronic degrees of freedom) for time-independent molecules and (II) novel methods, first-principle theories and applications in time dependent molecular structure modeling. In the first part, we discuss in specific two new algorithms for static geometry optimization, the eigenspace update (ESU) method in nonredundant internal coordinate that exhibits an enhanced performace with up to a factor of 3 savings in computational cost for large-sized molecular systems; the Car-Parrinello density matrix search (CP-DMS) method that enables direct minimization of the SCF energy as an effective alternative to conventional diagonalization approach. For the second part, we consider the time dependence and first presents two nonadiabatic dynamic studies that model laser controlled molecular photo-dissociation for qualitative understandings of intense laser-molecule interaction, using ab initio direct Ehrenfest dynamics scheme implemented with real-time time-dependent density functional theory (RT-TDDFT) approach developed in our group. Furthermore, we place our special interest on the nonadiabatic electronic dynamics in the ultrafast time scale, and presents (1) a novel technique that can not only obtain energies but also the electron densities of doubly excited states within a single determinant framework, by combining methods of CP-DMS with RT-TDDFT; (2) a solvated first-principles electronic dynamics method by incorporating the polarizable continuum solvation model (PCM) to RT-TDDFT, which is found to be very effective in describing the dynamical solvation effect in the charge transfer process and yields a consistent absorption spectrum in comparison to the conventional linear response results in solution. (3) applications of the PCM-RT-TDDFT method to study the intramolecular charge-transfer (CT) dynamics in a C60 derivative. Such work provides insights into the characteristics of ultrafast dynamics in photoexcited fullerene derivatives, and aids in the rational design for pre-dissociative exciton in the intramolecular CT process in organic solar cells.

  1. 14 CFR 1274.931 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

  2. 77 FR 40459 - Electronic Fund Transfers (Regulation E); Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-10

    ... Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... published the Final Rule (77 FR 6194), which implements the Electronic Fund Transfer Act, and the official... Sec. 1005.3(a) in the interim final rule, Electronic Fund Transfers (Regulation E), published on...

  3. 14 CFR 1274.931 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

  4. Sulfide-dependent photosynthetic electron flow coupled to proton translocation in thylakoids of the cyanobacterium Oscillatoria limnetica.

    PubMed

    Shahak, Y; Arieli, B; Binder, B; Padan, E

    1987-12-01

    Light-induced proton translocation coupled to sulfide-dependent electron transport has been studied in isolated thylakoids of the cyanobacterium Oscillatoria limnetica. The thylakoids are obtained by osmotic shock of washed spheroplasts, prepared with glycine-betaine as the osmotic stabilizer. 13C NMR studies suggests that betaine is the major osmoregulator in O. limnetica. Thylakoid preparations obtained from both sulfide-induced anoxygenic cells and noninduced oxygenic cells are capable of proton pumping coupled to phenazinemethosulfate-mediated cyclic electron flow. However, only in the induced thylakoids can sulfide-dependent proton gradient (delta pH) formation be measured, using either NADP or methyl viologen as the terminal acceptor. Sulfide-dependent delta pH formation correlates with a high-affinity electron donation site (apparent Km 44 microM at pH 7.9). This site is not lost upon washing of the thylakoids. In addition, both sulfide-dependent electron transport and delta pH formation are sensitive to inhibitors of the cytochrome b6f complex such as 2-n-nonyl-4-hydroxyquinoline-N-oxide, 2,4-dinitrophenyl ether of 2-iodo-4-nitrothymol, or stigmatellin. Sulfide-dependent NADP photoreduction of low affinity (which does not saturate by as much as 7 mM sulfide) is detected in both induced and noninduced thylakoids, but this activity is insensitive to the inhibitors and is not coupled to proton transport. It is suggested that the adaptation of O. limnetica to anoxygenic photosynthesis involves the induction of a thylakoid factor(s) which creates a high-affinity site for sulfide, and the transfer of its electrons via the cytochrome b6f complex, coupled to proton translocation.

  5. Modification of graphene electronic properties via controllable gas-phase doping with copper chloride

    NASA Astrophysics Data System (ADS)

    Rybin, Maxim G.; Islamova, Vera R.; Obraztsova, Ekaterina A.; Obraztsova, Elena D.

    2018-01-01

    Molecular doping is an efficient, non-destructive, and simple method for changing the electronic structure of materials. Here, we present a simple air ambient vapor deposition method for functionalization of pristine graphene with a strong electron acceptor: copper chloride. The doped graphene was characterized by Raman spectroscopy, UV-vis-NIR optical absorption spectroscopy, scanning electron microscopy, and electro-physical measurements performed using the 4-probe method. The effect of charge transfer from graphene to a dopant results in shifting the Fermi level in doped graphene. The change of the electronic structure of doped graphene was confirmed by the tangential Raman peak (G-peak) shift and by the appearance of the gap in the UV-vis-NIR spectrum after doping. Moreover, the charge transfer resulted in a substantial decrease in electrical sheet resistance depending on the doping level. At the highest concentration of copper chloride, a Fermi level shift into the valence band up to 0.64 eV and a decrease in the sheet resistance value by 2.36 times were observed (from 888 Ω/sq to 376 Ω/sq for a single graphene layer with 97% of transparency).

  6. An Electron-bifurcating Caffeyl-CoA Reductase*

    PubMed Central

    Bertsch, Johannes; Parthasarathy, Anutthaman; Buckel, Wolfgang; Müller, Volker

    2013-01-01

    A low potential electron carrier ferredoxin (E0′ ≈ −500 mV) is used to fuel the only bioenergetic coupling site, a sodium-motive ferredoxin:NAD+ oxidoreductase (Rnf) in the acetogenic bacterium Acetobacterium woodii. Because ferredoxin reduction with physiological electron donors is highly endergonic, it must be coupled to an exergonic reaction. One candidate is NADH-dependent caffeyl-CoA reduction. We have purified a complex from A. woodii that contains a caffeyl-CoA reductase and an electron transfer flavoprotein. The enzyme contains three subunits encoded by the carCDE genes and is predicted to have, in addition to FAD, two [4Fe-4S] clusters as cofactor, which is consistent with the experimental determination of 4 mol of FAD, 9 mol of iron, and 9 mol of acid-labile sulfur. The enzyme complex catalyzed caffeyl-CoA-dependent oxidation of reduced methyl viologen. With NADH as donor, it catalyzed caffeyl-CoA reduction, but this reaction was highly stimulated by the addition of ferredoxin. Spectroscopic analyses revealed that ferredoxin and caffeyl-CoA were reduced simultaneously, and a stoichiometry of 1.3:1 was determined. Apparently, the caffeyl-CoA reductase-Etf complex of A. woodii uses the novel mechanism of flavin-dependent electron bifurcation to drive the endergonic ferredoxin reduction with NADH as reductant by coupling it to the exergonic NADH-dependent reduction of caffeyl-CoA. PMID:23479729

  7. Probing the dependence of electron transfer on size and coverage in carbon nanotube-quantum dot heterostructures

    DOE PAGES

    Wang, Lei; Wong, Stanislaus S.; Han, Jinkyu; ...

    2015-11-16

    As a model system for understanding charge transfer in novel architectural designs for solar cells, double-walled carbon nanotube (DWNT)–CdSe quantum dot (QD) (QDs with average diameters of 2.3, 3.0, and 4.1 nm) heterostructures have been fabricated. The individual nanoscale building blocks were successfully attached and combined using a hole-trapping thiol linker molecule, i.e., 4-mercaptophenol (MTH), through a facile, noncovalent π–π stacking attachment strategy. Transmission electron microscopy confirmed the attachment of QDs onto the external surfaces of the DWNTs. We herein demonstrate a meaningful and unique combination of near-edge X-ray absorption fine structure (NEXAFS) and Raman spectroscopies bolstered by complementary electricalmore » transport measurements in order to elucidate the synergistic interactions between CdSe QDs and DWNTs, which are facilitated by the bridging MTH molecules that can scavenge photoinduced holes and potentially mediate electron redistribution between the conduction bands in CdSe QDs and the C 2p-derived states of the DWNTs. Specifically, we correlated evidence of charge transfer as manifested by (i) changes in the NEXAFS intensities of π* resonance in the C K-edge and Cd M3-edge spectra, (ii) a perceptible outer tube G-band downshift in frequency in Raman spectra, as well as (iii) alterations in the threshold characteristics present in transport data as a function of CdSe QD deposition onto the DWNT surface. Furthermore, the separate effects of (i) varying QD sizes and (ii) QD coverage densities on the electron transfer were independently studied.« less

  8. Electron Transfer Dissociation of iTRAQ Labeled Peptide Ions

    PubMed Central

    Han, Hongling; Pappin, Darryl J.; Ross, Philip L; McLuckey, Scott A.

    2009-01-01

    Triply and doubly charged iTRAQ (isobaric tagging for relative and absolute quantitation) labeled peptide cations from a tryptic peptide mixture of bovine carbonic anhydrase II were subjected to electron transfer ion/ion reactions to investigate the effect of charge bearing modifications associated with iTRAQ on the fragmentation pattern. It was noted that electron transfer dissociation (ETD) of triply charged or activated ETD (ETD + supplemental collisional activation of intact electron transfer species) of doubly charged iTRAQ tagged peptide ions yielded extensive sequence information, in analogy with ETD of unmodified peptide ions. That is, addition of the fixed charge iTRAQ tag showed relatively little deleterious effect on the ETD performance of the modified peptides. ETD of the triply charged iTRAQ labeled peptide ions followed by collision-induced dissociation (CID) of the product ion at m/z 162 yielded the reporter ion at m/z 116, which is the reporter ion used for quantitation via CID of the same precursor ions. The reporter ion formed via the two-step activation process is expected to provide quantitative information similar to that directly produced from CID. A 103 Da neutral loss species observed in the ETD spectra of all the triply and doubly charged iTRAQ labeled peptide ions is unique to the 116 Da iTRAQ reagent, which implies that this process also has potential for quantitation of peptides/proteins. Therefore, ETD with or without supplemental collisional activation, depending on the precursor ion charge state, has the potential to directly identify and quantify the peptides/proteins simultaneously using existing iTRAQ reagents. PMID:18646790

  9. A highly sensitive and selective fluorimetric probe for intracellular peroxynitrite based on photoinduced electron transfer from ferrocene to carbon dots.

    PubMed

    Zhu, Jiali; Sun, Shan; Jiang, Kai; Wang, Yuhui; Liu, Wenqing; Lin, Hengwei

    2017-11-15

    Herein, a highly sensitive and selective fluorimetric nanoprobe for peroxynitrite (ONOO - ) detection based on photoinduced electron transfer (PET) from ferrocene (Fc) to carbon dots (CDs) is reported. The nanoprobe (named CDs-Fc) can be facilely constructed through covalently conjugating CDs and ferrocenecarboxylic acid. Further studies reveal that the energy level of highest occupied molecular orbital (HOMO) of the CDs is lowered with the addition of ONOO - due to its oxidation and nitration capabilities. Thus, an efficient electron transfer from Fc to the excited states of CDs could occur, leading to obvious fluorescence quenching. The fluorescence quenching of the nanoprobe was determined to be peroxynitrite concentrations dependence with a linear range between 4nM to 0.12μM. Thanks to the excellent optical properties of the CDs and efficient electron transfer efficiency from Fc to the excited CDs, the nanoprobe exhibits very high sensitivity to ONOO - with a limit of detection (LOD) of 2.9nM. To the best of our knowledge, this LOD is the highest reported value till today for the detection of peroxynitrite. Besides, the nanoprobe also shows excellent selectivity to ONOO - among a broad range of substances, even including other reactive oxygen/nitrogen species (ROS/RNS). Finally, the nanoprobe was verified to be very low cytotoxicity, and was successfully applied for intracellular ONOO - detection. This work would provide a promising tool for the research of ONOO - in cytobiology and disease diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Investigation of the redox-dependent modulation of structure and dynamics in human cytochrome c

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imai, Mizue; Saio, Tomohide; Department of Chemistry, Faculty of Science, Hokkaido University, Sapporo 060-0810

    2016-01-22

    Redox-dependent changes in the structure and dynamics of human cytochrome c (Cyt c) were investigated by solution NMR. We found significant structural changes in several regions, including residues 23–28 (loop 3), which were further corroborated by chemical shift differences between the reduced and oxidized states of Cyt c. These differences are essential for discriminating redox states in Cyt c by cytochrome c oxidase (CcO) during electron transfer reactions. Carr-Purcell-Meiboom-Gill (CPMG) relaxation dispersion experiments identified that the region around His33 undergoes conformational exchanges on the μs-ms timescale, indicating significant redox-dependent structural changes. Because His33 is not part of the interaction sitemore » for CcO, our data suggest that the dynamic properties of the region, which is far from the interaction site for CcO, contribute to conformational changes during electron transfer to CcO. - Highlights: • Solution structure and dynamics analysis for human Cyt c by NMR. • Structural changes responsible for the discrimination of the redox state in Cyt c. • Conformational exchange in the region outside of the interaction site for CcO. • Less flexibility and rigid structure of the interaction site on Cyt c for CcO.« less

  11. 14 CFR § 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Electronic funds transfer payment methods... GRANTS AND COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made...

  12. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  13. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  14. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  15. Proton transfer in microbial electrolysis cells

    DOE PAGES

    Borole, Abhijeet P.; Lewis, Alex J.

    2017-02-15

    Proton transfer and electron transfer are of prime importance in the development of microbial electrochemical cells. While electron transfer is primarily controlled by biology, proton transfer is controlled by process engineering and cell design. To develop commercially feasible technologies around the concept of a bioelectrochemical cell, real feedstocks have to be explored and associated limitations have to be identified. Here in this study, the proton transfer rate was quantified for a microbial electrolysis cell (MEC) and its dependence on process parameters was investigated using a proton balance model. The reaction system consisted of a biomass-derived pyrolytic aqueous stream as amore » substrate producing hydrogen in a flow-through MEC. The proton transfer rate increased with anode flow rate and organic loading rate up to a maximum of 0.36 ± 0.01 moles per m 2 per h, equivalent to a hydrogen production rate of 9.08 L per L per day. Higher rates of hydrogen production, reaching 11.7 ± 0.2 L per L per day were achieved, when additional protons were provided via the cathode buffer. Electrochemical impedance spectroscopy shows that proton transfer was the dominant resistance in the production of hydrogen. The quantification of proton transfer rates for MECs with potential for biorefinery application and the demonstration of high hydrogen production rates approaching those required for commercial consideration indicate the strong potential of this technology for renewable hydrogen production. Understanding the transport phenomenon in bioelectrochemical cells is of great significance since these systems have potential for wide-ranging applications including energy production, bioremediation, chemical and nanomaterial synthesis, electro-fermentation, energy storage, desalination, and produced water treatment. Electron transfer in anode biofilms has been investigated extensively, but proton transfer studies are also important, since many cathodic half reactions require protons as the reactant. Determination of transport rates via proton balance was investigated in microbial electrolysis cells, which can be applied to other forms of microbial electrochemical systems. Lastly, these systems have a unique niche in the development of future biorefineries as a means of recovering energy from waste streams with potential for water recycle, making them an integral part of the water–energy nexus focus area.« less

  16. Proton transfer in microbial electrolysis cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borole, Abhijeet P.; Lewis, Alex J.

    Proton transfer and electron transfer are of prime importance in the development of microbial electrochemical cells. While electron transfer is primarily controlled by biology, proton transfer is controlled by process engineering and cell design. To develop commercially feasible technologies around the concept of a bioelectrochemical cell, real feedstocks have to be explored and associated limitations have to be identified. Here in this study, the proton transfer rate was quantified for a microbial electrolysis cell (MEC) and its dependence on process parameters was investigated using a proton balance model. The reaction system consisted of a biomass-derived pyrolytic aqueous stream as amore » substrate producing hydrogen in a flow-through MEC. The proton transfer rate increased with anode flow rate and organic loading rate up to a maximum of 0.36 ± 0.01 moles per m 2 per h, equivalent to a hydrogen production rate of 9.08 L per L per day. Higher rates of hydrogen production, reaching 11.7 ± 0.2 L per L per day were achieved, when additional protons were provided via the cathode buffer. Electrochemical impedance spectroscopy shows that proton transfer was the dominant resistance in the production of hydrogen. The quantification of proton transfer rates for MECs with potential for biorefinery application and the demonstration of high hydrogen production rates approaching those required for commercial consideration indicate the strong potential of this technology for renewable hydrogen production. Understanding the transport phenomenon in bioelectrochemical cells is of great significance since these systems have potential for wide-ranging applications including energy production, bioremediation, chemical and nanomaterial synthesis, electro-fermentation, energy storage, desalination, and produced water treatment. Electron transfer in anode biofilms has been investigated extensively, but proton transfer studies are also important, since many cathodic half reactions require protons as the reactant. Determination of transport rates via proton balance was investigated in microbial electrolysis cells, which can be applied to other forms of microbial electrochemical systems. Lastly, these systems have a unique niche in the development of future biorefineries as a means of recovering energy from waste streams with potential for water recycle, making them an integral part of the water–energy nexus focus area.« less

  17. Inhibition of melanosome transfer results in skin lightening.

    PubMed

    Seiberg, M; Paine, C; Sharlow, E; Andrade-Gordon, P; Costanzo, M; Eisinger, M; Shapiro, S S

    2000-08-01

    The chemical basis of melanogenesis is well documented, but the mechanism of melanosome transfer and the regulation of pigmentation by keratinocyte-melanocyte interactions are not well understood. Therefore we examined the effects of serine protease inhibitors on skin pigmentation and found that the protease-activated receptor 2, expressed on keratinocytes, may regulate pigmentation via keratinocyte-melanocyte interactions. Here we show that modulation of protease-activated receptor 2 activation affects melanosome transfer into keratinocytes, resulting in changes in pigment production and deposition. SLIGRL, the protease-activated receptor 2 activating peptide, enhanced melanosome ingestion by keratinocytes, thus increasing pigment deposition. RWJ-50353, a serine protease inhibitor, led to reduced pigment deposition in melanocytes and depigmentation. Electron microscopy studies illustrated an accumulation of immature melanosomes inside melanocytes and abnormal dendrite dynamics in RWJ-50353-treated epidermal equivalents. RWJ-50353 induced a visible and dose-dependent skin lightening effect in the dark-skinned Yucatan swine. Examinations by electron microscopy indicated that the in vivo transfer of melanosomes from melanocytes to keratinocytes was affected. Our data suggest that modulation of keratinocyte-melanocyte interactions via the protease-activated receptor 2 pathway affects melanosome transfer. The use of RWJ-50353 to modulate protease-activated receptor 2 activation could lead to a new class of depigmenting agents.

  18. Extracellular ascorbate stabilization as a result of transplasma electron transfer in Saccharomyces cerevisiae.

    PubMed

    Santos-Ocaña, C; Navas, P; Crane, F L; Córdoba, F

    1995-12-01

    The presence of yeast cells in the incubation medium prevents the oxidation of ascrobate catalyzed by copper ions. Ethanol increases ascorbate retention. Pyrazole, an alcohol dehydrogenase inhibitor, prevents ascorbate stabilization by cells. Chelation of copper ions does not account for stabilization, since oxidation rates with broken or boiled cells or conditioned media are similar to control rates in the absence of cells. Protoplast integrity is needed to reach optimal values of stabilization. Chloroquine, a known inhibitor of plasma membrane redox systems, inhibits the ascorbate stabilization, the inhibition being partially reversed by coenzyme Q6. Chloroquine does not inhibit ferricyanide reduction. Growth of yeast in iron-deficient media to increase ferric ion reductase activity also increases the stabilization. In conclusion, extracellular ascorbate stabilization by yeast cells can reflect a coenzyme Q dependent transplasmalemma electron transfer which uses NADH as electron donor. Iron deficiency increases the ascorbate stabilization but the transmembrane ferricyanide reduction system can act independently of ascorbate stabilization.

  19. How the Number of Layers and Relative Position Modulate the Interlayer Electron Transfer in π-Stacked 2D Materials.

    PubMed

    Biancardi, Alessandro; Caraiani, Claudiu; Chan, Wai-Lun; Caricato, Marco

    2017-04-06

    Understanding the interfacial electron transfer (IET) between 2D layers is central to technological applications. We present a first-principles study of the IET between a zinc phthalocyanine film and few-layer graphene by using our recent method for the calculation of electronic coupling in periodic systems. The ultimate goal is the development of a predictive in silico approach for designing new 2D materials. We find IET to be critically dependent on the number of layers and their stacking orientation. In agreement with experiment, IET to single-layer graphene is shown to be faster than that to double-layer graphene due to interference effects between layers. We predict that additional graphene layers increase the number of IET pathways, eventually leading to a faster rate. These results shed new light on the subtle interplay between structure and IET, which may lead to more effective "bottom up" design strategies for these materials.

  20. n l -> n' l' transition rates in electron and proton - Rydberg atom collision

    NASA Astrophysics Data System (ADS)

    Vrinceanu, Daniel

    2017-04-01

    Electrons and protons drive the recombination dynamics of highly excited Rydberg atoms in cold rarefied plasmas found in astrophysical conditions such as primordial recombination or star formation in H-II clouds. It has been recognized that collisions induce both energy and angular momentum transitions in Rydberg atoms, although in different proportions, depending on the initial state, temperature and the given species considered in the collision (electron or proton). Most studies focused on one collision type at a time, under the assumption that collision types are independent or their effects are not competing. The classical Monte-Carlo trajectory simulations presented in this work calculate the rates for both energy and angular momentum transfers and show their interdependence. For example, energy transfer with small angular momentum change are more efficient for target states with initial large angular momentum. The author acknowledges support received from the National Science Foundation through a Grant for the Center for Research on Complex Networks (HRD-1137732).

  1. FAD oxidizes the ERO1-PDI electron transfer chain: The role of membrane integrity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Papp, Eszter; Nardai, Gabor; Mandl, Jozsef

    2005-12-16

    The molecular steps of the electron transfer in the endoplasmic reticulum from the secreted proteins during their oxidation are relatively unknown. We present here that flavine adenine dinucleotide (FAD) is a powerful oxidizer of the oxidoreductase system, Ero1 and PDI, besides the proteins of rat liver microsomes and HepG2 hepatoma cells. Inhibition of FAD transport hindered the action of FAD. Microsomal membrane integrity was mandatory for all FAD-related oxidation steps downstream of Ero1. The PDI inhibitor bacitracin could inhibit FAD-mediated oxidation of microsomal proteins and PDI, but did not hinder the FAD-driven oxidation of Ero1. Our data demonstrated that Ero1more » can utilize FAD as an electron acceptor and that FAD-driven protein oxidation goes through the Ero1-PDI pathway and requires the integrity of the endoplasmic reticulum membrane. Our findings prompt further studies to elucidate the membrane-dependent steps of PDI oxidation and the role of FAD in redox folding.« less

  2. The excited-state intramolecular proton transfer in Nsbnd H-type dye molecules with a seven-membered-ring intramolecular hydrogen bond: A theoretical insight

    NASA Astrophysics Data System (ADS)

    Yuan, Huijuan; Feng, Songyan; Wen, Keke; Guo, Xugeng; Zhang, Jinglai

    2018-02-01

    Excited-state intramolecular proton transfer (ESIPT) reactions of a series of N(R)sbnd H ⋯ N-type seven-membered-ring hydrogen-bonding compounds were explored by employing density functional theory/time-dependent density functional theory calculations with the PBE0 functional. Our results indicate that the absorption and emission spectra predicted theoretically match very well the experimental findings. Additionally, as the electron-withdrawing strength of R increases, the intramolecular H-bond of the Nsbnd S1 form gradually enhances, and the forward energy barrier along the ESIPT reaction gradually decreases. For compound 4, its ESIPT reaction is found to be a barrierless process due to the involvement of a strong electron-withdrawing COCF3 group. It is therefore a reasonable presumption that the ESIPT efficiency of these N(R)sbnd H ⋯ N-type seven-membered-ring H-bonding systems can be improved when a strong electron-withdrawing group in R is introduced.

  3. Charge transfer complex studies between some non-steroidal anti-inflammatory drugs and π-electron acceptors

    NASA Astrophysics Data System (ADS)

    Duymus, Hulya; Arslan, Mustafa; Kucukislamoglu, Mustafa; Zengin, Mustafa

    2006-12-01

    Charge transfer (CT) complexes of some non-steroidal anti-inflammatory drugs, naproxen and etodolac which are electron donors with some π-acceptors, such as tetracyanoethylene (TCNE), 2,3-dichloro-5,6-dicyano- p-benzoquinone (DDQ), p-chloranil ( p-CHL), have been investigated spectrophotometrically in chloroform at 21 °C. The coloured products are measured spectrophotometrically at different wavelength depending on the electronic transition between donors and acceptors. Beer's law is obeyed and colours were produced in non-aqueous media. All complexes were stable at least 2 h except for etodolac with DDQ stable for 5 min. The equilibrium constants of the CT complexes were determined by the Benesi-Hildebrand equation. The thermodynamic parameters Δ H, Δ S, Δ G° were calculated by Van't Hoff equation. Stochiometries of the complexes formed between donors and acceptors were defined by the Job's method of the continuous variation and found in 1:1 complexation with donor and acceptor at the maximum absorption bands in all cases.

  4. The Involvement of Hydrogen-producing and ATP-dependent NADPH-consuming Pathways in Setting the Redox Poise in the Chloroplast of Chlamydomonas reinhardtii in Anoxia

    PubMed Central

    Clowez, Sophie; Godaux, Damien; Cardol, Pierre; Wollman, Francis-André; Rappaport, Fabrice

    2015-01-01

    Photosynthetic microalgae are exposed to changing environmental conditions. In particular, microbes found in ponds or soils often face hypoxia or even anoxia, and this severely impacts their physiology. Chlamydomonas reinhardtii is one among such photosynthetic microorganisms recognized for its unusual wealth of fermentative pathways and the extensive remodeling of its metabolism upon the switch to anaerobic conditions. As regards the photosynthetic electron transfer, this remodeling encompasses a strong limitation of the electron flow downstream of photosystem I. Here, we further characterize the origin of this limitation. We show that it stems from the strong reducing pressure that builds up upon the onset of anoxia, and this pressure can be relieved either by the light-induced synthesis of ATP, which promotes the consumption of reducing equivalents, or by the progressive activation of the hydrogenase pathway, which provides an electron transfer pathway alternative to the CO2 fixation cycle. PMID:25691575

  5. Spectrophotometric and spectroscopic studies of charge transfer complexes of p-toluidine as an electron donor with picric acid as an electron acceptor in different solvents.

    PubMed

    Singh, Neeti; Khan, Ishaat M; Ahmad, Afaq

    2010-04-01

    The charge transfer complexes of the donor p-toluidine with pi-acceptor picric acid have been studied spectrophotometrically in various solvents such as carbon tetrachloride, chloroform, dichloromethane acetone, ethanol, and methanol at room temperature using absorption spectrophotometer. The results indicate that formation of CTC in non-polar solvent is high. The stoichiometry of the complex was found to be 1:1 ratio by straight-line method between donor and acceptor with maximum absorption bands. The data are discussed in terms of formation constant (K(CT)), molar extinction coefficient (epsilon(CT)), standard free energy (DeltaG(o)), oscillator strength (f), transition dipole moment (mu(EN)), resonance energy (R(N)) and ionization potential (I(D)). The results indicate that the formation constant (K(CT)) for the complex was shown to be dependent upon the nature of electron acceptor, donor and polarity of solvents that were used. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Integration of Indium Phosphide Based Devices with Flexible Substrates

    NASA Astrophysics Data System (ADS)

    Chen, Wayne Huai

    2011-12-01

    Flexible substrates have many advantages in applications where bendability, space, or weight play important roles or where rigid circuits are undesirable. However, conventional flexible thin film transistors are typically characterized as having low carrier mobility as compared to devices used in the electronics industry. This is in part due to the limited temperature tolerance of plastic flexible substrates, which commonly reduces the highest processing temperature to below 200°C. Common approaches of implementation include low temperature deposition of organic, amorphous, or polycrystalline semiconductors, all of which result in carrier mobility well below 100 cm2V -1s-1. High quality, single crystalline III-V semiconductors such as indium phosphide (InP), on the other hand, have carrier mobility well over 1000 cm 2V-1s-1 at room temperature, depending on carrier concentration. Recently, the ion-cut process has been used in conjunction with wafer bonding to integrate thin layers of III-V material onto silicon for optoelectronic applications. This approach has the advantage of high scalability, reusability of the initial III-V substrate, and the ability to tailor the location (depth) of the layer splitting. However, the transferred substrate usually suffers from hydrogen implantation damage. This dissertation demonstrates a new approach to enable integration of InP with various substrates, called the double-flip transfer process. The process combines ion-cutting with adhesive bonding. The problem of hydrogen implantation was overcome by patterned ion-cut transfer. In this type of transfer, areas of interest are shielded from implantation but still transferred by surrounding implanted regions. We found that patterned ion-cut transfer is strongly dependent upon crystal orientation and that using cleavage-plane oriented donors can be beneficial in transferring large areas of high quality semiconductor material. InP-based devices were fabricated to demonstrate the transfer process and test functionality following transfer. Passive devices (photodetectors) as well as active transistors were transferred and fabricated on various substrates. The transferred device layers were either implanted through with a blanket implant or protected with an ion-mask during implantation. Results demonstrate the viability of the double-flip ion-cut process in achieving very high electron mobility (˜2800 cm2V-1s-1) transistors on plastic flexible substrates.

  7. Reduced energy offset via substitutional doping for efficient organic/inorganic hybrid solar cells.

    PubMed

    Jin, Xiao; Sun, Weifu; Zhang, Qin; Ruan, Kelian; Cheng, Yuanyuan; Xu, Haijiao; Xu, Zhongyuan; Li, Qinghua

    2015-06-01

    Charge carrier transport in bulk heterojunction that is central to the device performance of solar cells is sensitively dependent on the energy level alignment of acceptor and donor. However, the effect of energy level regulation induced by nickel ions on the primary photoexcited electron transfer and the performance of P3HT/TiO2 hybrid solar cells remains being poorly understood and rarely studied. Here we demonstrate that the introduction of the versatile nickel ions into TiO2 nanocrystals can significantly elevate the conduction and valence band energy levels of the acceptor, thus resulting in a remarkable reduction of energy level offset between the conduction band of acceptor and lowest unoccupied molecular orbital of donor. By applying transient photoluminescence and femtosecond transient absorption spectroscopies, we demonstrate that the electron transfer becomes more competitive after incorporating nickel ions. In particular, the electron transfer life time is shortened from 30.2 to 16.7 ps, i.e., more than 44% faster than pure TiO2 acceptor, thus leading to a notable increase of power conversion efficiency in organic/inorganic hybrid solar cells. This work underscores the promising virtue of engineering the reduction of 'excess' energy offset to accelerate electron transport and demonstrates the potential of nickel ions in applications of solar energy conversion and photon detectors.

  8. Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

    DOE PAGES

    Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei; ...

    2017-03-02

    A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less

  9. Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei

    A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less

  10. Laser phase control of high-order harmonic generation at large internuclear distance: the H+ -H2+ system.

    PubMed

    Bandrauk, André D; Barmaki, Samira; Kamta, Gerard Lagmago

    2007-01-05

    Exact (Born-Oppenheimer) 3-D numerical solutions of the time-dependent Schrödinger equation are obtained for the one electron linear H+-H2+ atom-molecule system at large internuclear distance R in interaction with two-cycles intense (I>10(14) W cm(-2)) 800 nm laser pulses. High-order harmonic generation (HHG) spectra are obtained with an energy cutoff larger than the atomic maximum of I(p)+3U(p), where I(p) is the ionization potential and U(p) is the ponderomotive energy. At large R, this extended cutoff is shown to be related to the nature of electron transfer, whose direction is shown to depend critically on the carrier-envelope phase (CEP) of the ultrashort pulse. Constructive and destructive interferences in the HHG spectrum resulting from coherent superpositions of electronic states in the H+-H2+ system are interpreted in terms of multiple electron trajectories extracted from a time profile analysis.

  11. [Role of proton-motive force in the conjugative DNA transport in Staphylococci].

    PubMed

    Gavriliuk, V G; Vinnikov, A I

    1997-01-01

    Sensitivity of the conjugative process in staphylococci to the action of uncouplers of oxidative phosphorylation and inhibitors of electron transport systems have been proved, that testifies to the energy-dependent character of conjugative transport of DNA. Proceeding of the conjugation process depends upon the generation of delta microH+ on the membrane of both the donor and recipient cells. contribution of protonmotive forces to providing for the transfer of plasmids during conjugation to staphylococci has been defined.

  12. Calculation of rates of exciton dissociation into hot charge-transfer states in model organic photovoltaic interfaces

    NASA Astrophysics Data System (ADS)

    Vázquez, Héctor; Troisi, Alessandro

    2013-11-01

    We investigate the process of exciton dissociation in ordered and disordered model donor/acceptor systems and describe a method to calculate exciton dissociation rates. We consider a one-dimensional system with Frenkel states in the donor material and states where charge transfer has taken place between donor and acceptor. We introduce a Green's function approach to calculate the generation rates of charge-transfer states. For disorder in the Frenkel states we find a clear exponential dependence of charge dissociation rates with exciton-interface distance, with a distance decay constant β that increases linearly with the amount of disorder. Disorder in the parameters that describe (final) charge-transfer states has little effect on the rates. Exciton dissociation invariably leads to partially separated charges. In all cases final states are “hot” charge-transfer states, with electron and hole located far from the interface.

  13. Spatial distribution of transferred charges across the heterointerface between perovskite transition metal oxides LaNiO{sub 3} and LaMnO{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kitamura, Miho; Photon Factory, Institute of Materials Structure Science, High Energy Accelerator Research Organization; Horiba, Koji

    2016-03-14

    To investigate the interfacial charge-transfer phenomena between perovskite transition metal oxides LaNiO{sub 3} (LNO) and LaMnO{sub 3} (LMO), we have performed in situ x-ray absorption spectroscopy (XAS) measurements on LNO/LMO multilayers. The Ni-L{sub 2,3} and Mn-L{sub 2,3} XAS spectra clearly show the occurrence of electron transfer from Mn to Ni ions in the interface region. Detailed analysis of the thickness dependence of these XAS spectra has revealed that the spatial distribution of the transferred charges across the interface is significantly different between the two constituent layers. The observed spatial distribution is presumably described by the charge spreading model that treatsmore » the transfer integral between neighboring transition metal ions and the Coulomb interaction, rather than the Thomas–Fermi screening model.« less

  14. Creating and optimizing interfaces for electric-field and photon-induced charge transfer.

    PubMed

    Park, Byoungnam; Whitham, Kevin; Cho, Jiung; Reichmanis, Elsa

    2012-11-27

    We create and optimize a structurally well-defined electron donor-acceptor planar heterojunction interface in which electric-field and/or photon-induced charge transfer occurs. Electric-field-induced charge transfer in the dark and exciton dissociation at a pentacene/PCBM interface were probed by in situ thickness-dependent threshold voltage shift measurements in field-effect transistor devices during the formation of the interface. Electric-field-induced charge transfer at the interface in the dark is correlated with development of the pentacene accumulation layer close to PCBM, that is, including interface area, and dielectric relaxation time in PCBM. Further, we demonstrate an in situ test structure that allows probing of both exciton diffusion length and charge transport properties, crucial for optimizing optoelectronic devices. Competition between the optical absorption length and the exciton diffusion length in pentacene governs exciton dissociation at the interface. Charge transfer mechanisms in the dark and under illumination are detailed.

  15. Size and shape dependent deprotonation potential and proton affinity of nanodiamond

    NASA Astrophysics Data System (ADS)

    Barnard, Amanda S.; Per, Manolo C.

    2014-11-01

    Many important reactions in biology and medicine involve proton abstraction and transfer, and it is integral to applications such as drug delivery. Unlike electrons, which are quantum mechanically delocalized, protons are instantaneously localized on specific residues in these reactions, which can be a distinct advantage. However, the introduction of nanoparticles, such as non-toxic nanodiamonds, to this field complicates matters, as the number of possible sites increases as the inverse radius of the particle. In this paper we present \\gt {{10}4} simulations that map the size- and shape-dependence of the deprotonation potential and proton affinity of nanodiamonds in the range 1.8-2.7 nm in average diameter. We find that while the average deprotonation potential and proton affinities decrease with size, the site-specific values are inhomogeneous over the surface of the particles, exhibiting strong shape-dependence. The proton affinity is strongly facet-dependent, whereas the deprotonation potential is edge/corner-dependent, which creates a type of spatial hysteresis in the transfer of protons to and from the nanodiamond, and provides new opportunities for selective functionalization.

  16. 12 CFR 205.15 - Electronic fund transfer of government benefits.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer of government benefits. 205.15 Section 205.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.15 Electronic fund transfer of government...

  17. 12 CFR 1005.3 - Coverage.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...-time electronic fund transfer from a consumer's account. The consumer must authorize the transfer. (ii... one-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR... transfer. A consumer authorizes a one-time electronic fund transfer from his or her account to pay the fee...

  18. Tuning the Direction of Intramolecular Charge Transfer and the Nature of the Fluorescent State in a T-Shaped Molecular Dyad.

    PubMed

    Felouat, Abdellah; D'Aléo, Anthony; Charaf-Eddin, Azzam; Jacquemin, Denis; Le Guennic, Boris; Kim, Eunsun; Lee, Kwang Jin; Woo, Jae Heun; Ribierre, Jean-Charles; Wu, Jeong Weon; Fages, Frédéric

    2015-06-18

    Controlling photoinduced intramolecular charge transfer at the molecular scale is key to the development of molecular devices for nanooptoelectronics. Here, we describe the design, synthesis, electronic characterization, and photophysical properties of two electron donor-acceptor molecular systems that consist of tolane and BF2-containing curcuminoid chromophoric subunits connected in a T-shaped arrangement. The two π-conjugated segments intersect at the electron acceptor dioxaborine core. From steady-state electronic absorption and fluorescence emission, we find that the photophysics of the dialkylamino-substituted analogue is governed by the occurrence of two closely lying excited states. From DFT calculations, we show that excitation in either of these two states results in a distinct shift of the electron density, whether it occurs along the curcuminoid or tolane moiety. Femtosecond transient absorption spectroscopy confirmed these findings. As a consequence, the nature of the emitting state and the photophysical properties are strongly dependent on solvent polarity. Moreover, these characteristics can also be switched by protonation or complexation at the nitrogen atom of the amino group. These features set new approaches toward the construction of a three-terminal molecular system in which the lateral branch would transduce a change of electronic state and ultimately control charge transport in a molecular-scale device.

  19. Investigation of dissociative electron attachment to 2'-deoxycytidine-3'-monophosphate using DFT method and time dependent wave packet approach

    NASA Astrophysics Data System (ADS)

    Bhowmick, Somnath; B, Renjith; Mishra, Manoj K.; Sarma, Manabendra

    2012-08-01

    Effect of electron correlation on single strand breaks (SSBs) induced by low energy electron (LEE) has been investigated in a fragment excised from a DNA, viz., 2'-deoxycytidine-3'-monophosphate [3'-dCMPH] molecule in gas phase at DFT-B3LYP/6-31+G(d) accuracy level and using local complex potential based time dependent wave packet (LCP-TDWP) approach. The results obtained, in conjunction with our earlier investigation, show the possibility of SSB at very low energy (0.15 eV) where the LEE transfers from π* to σ* resonance state which resembles a SN2 type mechanism. In addition, for the first time, an indication of quantum mechanical tunneling in strand breaking is seen from the highest anionic bound vibrational state (χ5), which may have a substantial role during DNA damage.

  20. Theoretical investigation of the electron transfer dynamics and photodegradation pathways in a hydrogen-evolving ruthenium-palladium photocatalyst.

    PubMed

    Staniszewska, Magdalena; Kupfer, Stephan; Guthmuller, Julien

    2018-05-16

    Time-dependent density functional theory calculations combined with the Marcus theory of electron transfer (ET) were applied on the molecular photocatalyst [(tbbpy)2Ru(tpphz)PdCl2]2+ in order to elucidate the light-induced relaxation pathways populated upon excitation in the longer wavelength range of its absorption spectrum. The computational results show that after the initial excitation, metal (Ru) to ligand (tpphz) charge transfer (MLCT) triplet states are energetically accessible, but that an ET toward the catalytic center (PdCl2) from these states is a slow process, with estimated time constants above 1 ns. Instead, the calculations predict that low-lying Pd-centered states are efficiently populated - associated to an energy transfer toward the catalytic center. Thus, it is postulated that these states lead to the dissociation of a Cl- and are consequently responsible for the experimentally observed degradation of the catalytic center. Following dissociation, it is shown that the ET rates from the MLCT states to the charge separated states are significantly increased (i.e. 10^5-10^6 times larger). This demonstrates that alteration of the catalytic center generates efficient charge separation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Top