Park, Soo Nam; Kim, Moon Jin; Ha, Ji Hoon; Lee, Nan Hee; Park, Jino; Lee, Jiwon; Kim, Dukha; Yoon, Chulsoo
2016-11-01
2-[Tris(oleoyloxymethyl)methylamino]-1-ethane sulfonic acid (TES trioleate) is an inhibitor of phospholipase A 2 (PLA2), which hydrolyzes cell membrane phospholipids to produce arachidonic acid (AA) and lysophospholipids (LysoPLs). Here, we investigated the protective effects of TES trioleate on cell damage caused by ultraviolet A (UVA) light and reactive oxygen species (ROS). Pre-incubation with 250-1000μM TES trioleate resulted in concentration-dependent protection from UVA-induced damage in HaCaT cells. Additionally, 25-1000μM TES trioleate provided protection against H 2 O 2 in a concentration-dependent manner. In human erythrocytes treated with 1 O 2 , 10-100μM TES trioleate showed concentration-dependent protective effects, similar to but stronger than the controls, 4-BPB and lipophilic antioxidant (+)-α-tocopherol at 100μM. TES trioleate did not have detectable radical scavenging activity. Moreover, compared with (+)-α-tocopherol and rutin, TES trioleate showed low ROS scavenging activity. Thus, although TES trioleate showed cell protective effects against UVA, H 2 O 2 , and 1 O 2 -induced damages, these effects were not caused by the scavenging ability of the radical or ROS. Finally, pretreatment of HaCaT cells and human erythrocytes with l-α-lysophosphatidylcholine produced by PLA2 promoted increased cell damage at low concentrations. Thus, the protective effects of TES trioleate on cellular damage by UVA and ROS may be associated with inhibition of PLA2-dependent cell damage rather than ROS scavenging. Copyright © 2016. Published by Elsevier B.V.
Alcoholism risk moderation by a socio-religious dimension.
Haber, Jon Randolph; Jacob, Theodore
2007-11-01
Religious affiliation is inversely associated with the development of alcohol-dependence symptoms in adolescents, but the mechanisms of this effect are unclear. The degree to which religious affiliations accommodate to or differentiate from cultural values may influence attitudes about alcohol use. We hypothesized that, given permissive cultural norms about alcohol in the United States, if a religious affiliation differentiates itself from cultural norms, then high-risk adolescents (those with parents having a history of alcoholism) would exhibit fewer alcohol-dependence symptoms compared with other affiliations and nonreligious adolescents. A sample of female adolescent offspring (N = 3,582) in Missouri was selected. Parental alcoholism and religious affiliation and their interaction were examined as predictors of offspring alcohol-dependence symptoms. Findings indicated that (1) parental alcohol history robustly predicted increased offspring alcohol-dependence symptoms, (2) religious rearing appeared protective (offspring exhibited fewer alcohol-dependence symptoms), (3) religious differentiation accounted for most of the protective effect, (4) other religious variables did not account for the differentiation effect, and (5) black religious adolescents were more frequently raised with differentiating affiliations and exhibited greater protective effects. Results demonstrate that religious differentiation accounts for most of the protective influence of religious affiliation. This may be because religious differences from cultural norms (that include permissive alcohol norms) counteract these social influences given alternative "higher" religious ideals.
Lublin, Alex; Isoda, Fumiko; Patel, Harshil; Yen, Kelvin; Nguyen, Linda; Hajje, Daher; Schwartz, Marc; Mobbs, Charles
2011-01-01
Screening a library of drugs with known safety profiles in humans yielded 30 drugs that reliably protected mammalian neurons against glucose toxicity. Subsequent screening demonstrated that 6 of these 30 drugs increase lifespan in C. elegans: caffeine, ciclopirox olamine, tannic acid, acetaminophen, bacitracin, and baicalein. Every drug significantly reduced the age-dependent acceleration of mortality rate. These protective effects were blocked by RNAi inhibition of cbp-1 in adults only, which also blocks protective effects of dietary restriction. Only 2 drugs, caffeine and tannic acid, exhibited a similar dependency on DAF-16. Caffeine, tannic acid, and bacitracin also reduced pathology in a transgenic model of proteotoxicity associated with Alzheimer's disease. These results further support a key role for glucose toxicity in driving age-related pathologies and for CBP-1 in protection against age-related pathologies. These results also provide novel lead compounds with known safety profiles in human for treatment of age-related diseases, including Alzheimer's disease and diabetic complications.
The Two Faces of Social Interaction Reward in Animal Models of Drug Dependence.
El Rawas, Rana; Saria, Alois
2016-03-01
Drug dependence is a serious health and social problem. Social factors can modify vulnerability to developing drug dependence, acting as risk factors or protective factors. Whereas stress and peer environment that encourage substance use may increase drug taking, strong attachments between family members and peer environment that do not experience drug use may protect against drug taking and, ultimately, drug dependence. The rewarding effects of drug abuse and social interaction can be evaluated using animal models. In this review we focus on evaluating social interaction reward in the conditioned place preference paradigm. We give an overview of how social interaction, if made available within the drug context, may facilitate, promote and interact with the drug's effects. However, social interaction, if offered alternatively outside the drug context, may have pronounced protective effects against drug abuse and relapse. We also address the importance of the weight difference parameter between the social partners in determining the positive or "agonistic" versus the hostile or "antagonistic" social interaction. We conclude that understanding social interaction reward and its subsequent effects on drug reward is sorely needed for therapeutic interventions against drug dependence.
Leclercq, Karine; Kaminski, Rafal M
2015-08-01
Several factors may influence the efficacy of antiepileptic drugs (AEDs) in patients with epilepsy, and treatment resistance could be related to genetics, neuronal network alterations, and modification of drug transporters or targets. Consequently, preclinical models used for the identification of potential new, more efficacious AEDs should reflect at least a few of these factors. Previous studies indicate that induction of status epilepticus (SE) may alter drug efficacy and that this effect could be long-lasting. In this context, we wanted to assess the protective effects of mechanistically diverse AEDs in mice subjected to pilocarpine-induced SE in another seizure model. We first determined seizure thresholds in mice subjected to pilocarpine-induced SE in the 6-Hz model, 2 weeks and 8 weeks following SE. We then evaluated the protective effects of mechanistically diverse AEDs in post-SE and control animals. No major differences in 6-Hz seizure susceptibility were observed between control groups, while the seizure threshold of pilocarpine mice at 8 weeks after SE was higher than at 2 weeks and higher than in control groups. Treatment with AEDs revealed major differences in drug response depending on their mechanism of action. Diazepam produced a dose-dependent protection against 6-Hz seizures in control and pilocarpine mice, both at 2 weeks and 8 weeks after SE, but with a more pronounced increase in potency in post-SE animals at 2 weeks. Levetiracetam induced a potent and dose-dependent protection in pilocarpine mice, 2 weeks after SE, while its protective effects were observed only at much higher doses in control mice. Its potency decreased in post-SE mice at 8 weeks and was very limited (30% protection at the highest tested dose) in the control group. Carbamazepine induced a dose-dependent protection at 2 weeks in control mice but only limited effect (50% at the highest tested dose) in pilocarpine mice. Its efficacy deeply decreased in post-SE mice at 8 weeks after SE. Perampanel and phenytoin showed almost comparable protective effects in all groups of mice. These experiments confirm that prior SE may have an impact on both potency and efficacy of AEDs and indicate that this effect may be dependent on the underlying epileptogenic processes. This article is part of a Special Issue entitled "Status Epilepticus". Copyright © 2015 Elsevier Inc. All rights reserved.
The Two Faces of Social Interaction Reward in Animal Models of Drug Dependence
Rawas, Rana El
2016-01-01
Drug dependence is a serious health and social problem. Social factors can modify vulnerability to developing drug dependence, acting as risk factors or protective factors. Whereas stress and peer environment that encourage substance use may increase drug taking, strong attachments between family members and peer environment that do not experience drug use may protect against drug taking and, ultimately, drug dependence. The rewarding effects of drug abuse and social interaction can be evaluated using animal models. In this review we focus on evaluating social interaction reward in the conditioned place preference paradigm. We give an overview of how social interaction, if made available within the drug context, may facilitate, promote and interact with the drug’s effects. However, social interaction, if offered alternatively outside the drug context, may have pronounced protective effects against drug abuse and relapse. We also address the importance of the weight difference parameter between the social partners in determining the positive or “agonistic” versus the hostile or “antagonistic” social interaction. We conclude that understanding social interaction reward and its subsequent effects on drug reward is sorely needed for therapeutic interventions against drug dependence. PMID:26088685
Relating ecosystem services to domains of human well-being: Foundation for a U.S. index
Humans are dependent upon the services provided by nature, and unless we effectively account for the range of values from ecosystems in our efforts to protect the environment, we cannot sustain human well-being. In light of this dependence, the US Environmental Protections Agency...
USDA-ARS?s Scientific Manuscript database
Population studies suggested that the consumption of a soy rich diet provides protective effects against several chronic diseases including prostate cancer. However, the active components in soy, as well as the mechanisms of action of soy’s protective effects, remain unclear. It would be important t...
Influence of various scavengers of •OH radicals on the radiation sensitivity of yeast and bacteria.
Múčka, Viliam; Bláha, Pavel; Čuba, Václav; Červenák, Jaroslav
2013-12-01
To quantitatively investigate the influence of various •OH (hydroxyl radical) scavengers on the radiation sensitivity of yeast and bacteria, particularly to define the relationship between the protective effect of a scavenger and its •OH scavenging efficiency. In order to study the protective effect of •OH scavengers we used various concentrations of four scavengers (methanol, potassium formate, ethanol and ascorbic acid) in isotonic salt solutions. These solutions containing live yeast (Saccharomyces cerevisiae) or bacteria (Escherichia coli) were irradiated with (60)Co isotope γ -radiation using two different doses and dose rates. The number of surviving cells was determined prior to and after irradiation both in suspension with and without scavengers. The surviving fractions after irradiation with and without the scavenger were evaluated. The main results of the paper were: The surviving fraction increased approximately linearly within the measured interval with increasing concentration of the scavenger. The same dependences were found for the protecting effect depending on the scavenging efficiency. The slopes of these dependences (k) were found to be characteristic for each scavenger. The k value determined the degree in which the scavenging of •OH radicals participated in the protection of living cells. The protective effects of scavengers at the same scavenging efficiency were different and unique for each scavenger. No simple relation was found between the efficiency of scavenger k and the rate constant kOH of the reactions between scavengers and •OH radicals. Our results suggest that the studied scavengers effectively protected yeast and bacteria against ionizing radiation. Although the scavenging of •OH radicals seems to be important for protection of living cells, it is clearly not the only process on which the protection is based.
Hosseini, Azar; Shafiee-Nick, Reza; Mousavi, Seyed Hadi
2014-12-01
The use of doxorubicin (DOX) is limited by its dose-dependent cardio toxicity in which reactive Oxygen Species (ROS) play an important role in the pathological process. The aim of this study was to evaluate the protective effect of three medicinal plants, Nigella sativa (N), Glycyrrhiza glabra (G) and Zingiber officinale (Z), and their combination (NGZ), against DOX-induced apoptosis and death in H9c2 cells. The cells were incubated with different concentrations of each extract or NGZ for 4 hr which continued in the presence or absence of 5µM doxorubicin for 24 hr. Cell viability and the apoptotic rate were determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) and propidium iodide (PI) staining assays, respectively. The level of ROS and lipid peroxidation were measured by fluorimetric methods. Treatment with doxorubicin increased ROS generation, enhanced malondialdehyde (MDA) formation, and induced apoptosis. Co-treatment of the cells with each herb extract increased viability of cells dose-dependently with a maximum protection effect of about 30%, and their potencies were N>G>Z. The combination of the threshold dose of each extract (NGZ) produced a similar effect, which was increased dose-dependently to a maximum protection of 70%. These effects were correlated with the effects of NGZ on ROS and MDA. All of the extracts have some protective effects against DOX-induced toxicity in cardiomyocytes with similar efficacies, but with different potencies. However, NGZ produced much higher protective effect via reducing oxidative stress and inhibiting of apoptotic induction processes. Further investigations are needed to determine the effects of NGZ on DOX chemotherapy.
Hosseini, Azar; Shafiee-Nick, Reza; Mousavi, Seyed Hadi
2014-01-01
Objective(s): The use of doxorubicin (DOX) is limited by its dose-dependent cardio toxicity in which reactive Oxygen Species (ROS) play an important role in the pathological process. The aim of this study was to evaluate the protective effect of three medicinal plants, Nigella sativa (N), Glycyrrhiza glabra (G) and Zingiber officinale (Z), and their combination (NGZ), against DOX-induced apoptosis and death in H9c2 cells. Materials and Methods: The cells were incubated with different concentrations of each extract or NGZ for 4 hr which continued in the presence or absence of 5µM doxorubicin for 24 hr. Cell viability and the apoptotic rate were determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) and propidium iodide (PI) staining assays, respectively. The level of ROS and lipid peroxidation were measured by fluorimetric methods. Results: Treatment with doxorubicin increased ROS generation, enhanced malondialdehyde (MDA) formation, and induced apoptosis. Co-treatment of the cells with each herb extract increased viability of cells dose-dependently with a maximum protection effect of about 30%, and their potencies were N>G>Z. The combination of the threshold dose of each extract (NGZ) produced a similar effect, which was increased dose-dependently to a maximum protection of 70%. These effects were correlated with the effects of NGZ on ROS and MDA. Conclusion: All of the extracts have some protective effects against DOX-induced toxicity in cardiomyocytes with similar efficacies, but with different potencies. However, NGZ produced much higher protective effect via reducing oxidative stress and inhibiting of apoptotic induction processes. Further investigations are needed to determine the effects of NGZ on DOX chemotherapy. PMID:25859303
Li, Bin; Lee, Dong-Sung; Kang, Yue; Yao, Nai-Qi; An, Ren-Bo; Kim, Youn-Chul
2013-03-01
Ganodermanondiol, a biologically active compound, was isolated from the Lingzhi mushroom (Ganoderma lucidum). The present study examined the protective effects of ganodermanondiol against tert-butyl hydroperoxide (t-BHP)-induced hepatotoxicity. Ganodermanondiol protected human liver-derived HepG2 cells through nuclear factor-E2-related factor 2 (Nrf2) pathway-dependent heme oxygenase-1 expressions. Moreover, ganodermanondiol increased cellular glutathione levels and the expression of the glutamine-cysteine ligase gene in a dose-dependent manner. Furthermore, ganodermanondiol exposure enhanced the phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) and its upstream kinase activators, LKB1 and Ca(2+)/calmodulin-dependent protein kinase-II (CaMKII). This study indicates that ganodermanondiol exhibits potent cytoprotective effects on t-BHP-induced hepatotoxicity in human liver-derived HepG2 cells, presumably through Nrf2-mediated antioxidant enzymes and AMPK. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Domat, M.; Pla, J.; Cadavid-Rodríguez, M. C.; Fito, C.
2017-06-01
The rapid expansion of nanotechnology is outpacing health and safety recommendations for engineered nanomaterials. Thus, there is a lack of information about the effects that nanomaterials can induce in the human health. Nevertheless, workers in nanotechnology-related industries are potentially at risk of being exposed to nanomaterials. Therefore, there is a need of characterize the behaviour of personal protective equipment against penetration nanoparticles, in order to provide an adequate protection to the workers. In this study, the efficiency of several protective dermal equipment against water-based NaCl aerosol was evaluated. For this purpose, different protective clothing and gloves were selected to carry out the assays, simulating typical use conditions of protective equipment under occupational settings. Results obtained exposed that the level of protection offered by the distinct types of personal protective coveralls depended not only on the fabric, but also on their fitting to the body of the subject. On the other hand, the efficiency of the protective gloves was set in the range from 95% to 99%, depending on the thickness and the type of material.
Montoro, A; Barquinero, J F; Almonacid, M; Montoro, A; Sebastià, N; Verdú, G; Sahuquillo, V; Serrano, J; Saiz, M; Villaescusa, J I; Soriano, J M
2011-01-01
Radioprotection with natural products may be relevant to the mitigation of ionizing radiation-induced damage in mammalian systems; in this sense, propolis extracts have shown effects such as antioxidant, antitumoral, anti-inflammatory, and immunostimulant. We report for the first time a cytogenetic study to evaluate the radioprotective effect, in vitro, of propolis against radiation-induced chromosomal damage. Lymphocytes were cultured with increasing concentrations of ethanol extract of propolis (EEP), including 20, 40, 120, 250, 500, 750, 1000, and 2000 μg mL(-1) and then exposed to 2 Gy γ-rays. A significant and concentration-dependent decrease is observed in the frequency of chromosome aberrations in samples treated with EEP. The protection against the formation of dicentrics was concentration-dependent, with a maximum protection at 120 μg mL(-1) of EEP. The observed frequency of dicentrics is described as negative exponential function, indicating that the maximum protectible fraction of dicentrics is approximately 44%. Free radical scavenging and antioxidant activities are the mechanisms that these substances use to protect cells from ionizing radiation.
Montoro, A.; Barquinero, J. F.; Almonacid, M.; Montoro, A.; Sebastià, N.; Verdú, G.; Sahuquillo, V.; Serrano, J.; Saiz, M.; Villaescusa, J. I.; Soriano, J. M.
2011-01-01
Radioprotection with natural products may be relevant to the mitigation of ionizing radiation-induced damage in mammalian systems; in this sense, propolis extracts have shown effects such as antioxidant, antitumoral, anti-inflammatory, and immunostimulant. We report for the first time a cytogenetic study to evaluate the radioprotective effect, in vitro, of propolis against radiation-induced chromosomal damage. Lymphocytes were cultured with increasing concentrations of ethanol extract of propolis (EEP), including 20, 40, 120, 250, 500, 750, 1000, and 2000 μg mL−1 and then exposed to 2 Gy γ-rays. A significant and concentration-dependent decrease is observed in the frequency of chromosome aberrations in samples treated with EEP. The protection against the formation of dicentrics was concentration-dependent, with a maximum protection at 120 μg mL−1 of EEP. The observed frequency of dicentrics is described as negative exponential function, indicating that the maximum protectible fraction of dicentrics is approximately 44%. Free radical scavenging and antioxidant activities are the mechanisms that these substances use to protect cells from ionizing radiation. PMID:20981159
Murat, Nergiz; Korhan, Peyda; Kizer, Onur; Evcim, Sinem; Kefi, Aykut; Demir, Ömer; Gidener, Sedef; Atabey, Neşe; Esen, Ahmet Adil
2016-01-01
Oxidative stress dependent-decrease in nitric oxide (NO) bioavailability plays an integral role in hypercholesterolemia-induced erectile dysfunction (ED). Resveratrol has been demonstrated to exert beneficial effects against oxidative stress and improve NO bioavailability. The protective and restorative potentials of resveratrol on endothelium-dependent relaxations were evaluated in hypercholesterolemic rabbit corpus cavernosum (CC). Hypercholesterolemia was induced by administering 2% cholesterol diet (CD) (w/w) to the rabbits for 6 weeks. Two different protocols were applied to test the effects of resveratrol on hypercholesterolemia-induced ED. In Protocol-1 (P1), resveratrol was administrated to the rabbits simultaneously with CD in order to evaluate the protective effect, and for Protocol-2 (P2), resveratrol was administrated for 6 weeks after termination of CD in order to evaluate the restorative effect. Endothelium-dependent relaxations of CC were evaluated by using organ bath studies. In order to elucidate the possible molecular mechanisms, we measured endothelial NO synthase (eNOS) and phosphovasodilator-stimulated phosphoprotein (VASP) expressions and activations, NADPH oxidase, superoxide dismutase (SOD), and catalase (CAT) and glutathione peroxidase (GPx) activity in cavernosal tissues obtained at the end of the study. Resveratrol showed an improvement in the endothelium-dependent relaxation responses in vitro. We demonstrated significantly increased activatory-phosphorylation (p[S1177]-eNOS) and activated phosphovasodilator-stimulated phosphoprotein (phospho-VASP) levels, but reduced phosphorylation (p[T495]-eNOS) of eNOS and NADPH oxidase activity in the resveratrol-administered HC animals compared with hypercholesterolemic control rabbits in the P1. In the P2, resveratrol exhibited an improvement in endothelium-dependent relaxation responses and more pronounced effects on eNOS activation. Resveratrol administration, either simultaneously with HC diet or after HC, caused an improvement in the endothelium-dependent relaxation responses in the CC, suggesting its potential in both protective and restorative purposes in hypercholesterolemic rabbit CC. Copyright © 2016 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.
Poliandri, Ariel H B; Machiavelli, Leticia I; Quinteros, Alnilan F; Cabilla, Jimena P; Duvilanski, Beatriz H
2006-02-15
Cadmium (Cd2+) is a highly toxic metal that affects the endocrine system. We have previously shown that Cd2+ induces caspase-3 activation and apoptosis of anterior pituitary cells and that endogenous nitric oxide (NO) protects these cells from Cd2+. Here we investigate the mechanisms by which NO exerts this protective role. Cd2+ (25 microM) reduced the mitochondrial membrane potential (MMP) as measured by flow cytometry. Cd2+-induced apoptosis was mitochondrial dependent since cyclosporin A protected the cells from this metal. Inhibition of NO synthesis with 0.5 mM L-NAME increased the effect of Cd2+ on MMP, whereas the NO donor DETANONOate (0.1 mM) reduced it. Cd2+ increased the production of reactive oxygen species (ROS) as measured by flow cytometry. This effect was electron-transfer-chain-dependent since it was inhibited by rotenone. In fact, rotenone reduced the cytotoxic effect of the metal. The action of Cd2+ on mitochondrial integrity was ROS dependent. Trolox, an antioxidant, inhibited the effect of the metal on the MMP. Cd2+-induced increase in ROS generation was reduced by DETANONOate. There are discrepancies concerning the role of NO in Cd2+ toxicity. Here we show that NO reduces Cd2+ toxicity by protecting the mitochondria from oxidative stress in a system where NO plays a regulatory role.
Multilayer graphene as an effective corrosion protection coating for copper
NASA Astrophysics Data System (ADS)
Ravishankar, Vasumathy; Ramaprabhu, S.; Jaiswal, Manu
2018-04-01
Graphene grown by chemical vapor deposition (CVD) has been studied as a protective layer against corrosion of copper. The layer number dependence on the protective nature of graphene has been investigated using techniques such as Tafel analysis and Electroimpedance Spectroscopy. Multiple layers of graphene were achieved by wet transfer above CVD grown graphene. Though this might cause grain boundaries, the sites where corrosion is initiated, to be staggered, wet transfer inherently carries the disadvantage of tearing of graphene, as confirmed by Raman spectroscopy measurements. However, Electroimpedance Spectroscopy (EIS) reflects that graphene protected copper has a layer dependent resistance to corrosion. Decrease in corrosion current (Icorr) for graphene protected copper is presented. There is only small dependence of corrosion current on the layer number, Tafel plots clearly indicate passivation in the presence of graphene, whether it be single layer or multiple layers. Notwithstanding the crystallite size, defect free layers of graphene with staggered grain boundaries combined with passivation could offer good corrosion protection for metals.
Leonard, Bobby E
2008-02-27
Prior work has provided incremental phases to a microdosimetry modeling program to describe the dose response behavior of the radio-protective adaptive response effect. We have here consolidated these prior works (Leonard 2000, 2005, 2007a, 2007b, 2007c) to provide a composite, comprehensive Microdose Model that is also herein modified to include the bystander effect. The nomenclature for the model is also standardized for the benefit of the experimental cellular radio-biologist. It extends the prior work to explicitly encompass separately the analysis of experimental data that is 1.) only dose dependent and reflecting only adaptive response radio-protection, 2.) both dose and dose-rate dependent data and reflecting only adaptive response radio-protection for spontaneous and challenge dose damage, 3.) only dose dependent data and reflecting both bystander deleterious damage and adaptive response radio-protection (AR-BE model). The Appendix cites the various applications of the model. Here we have used the Microdose Model to analyze the, much more human risk significant, Elmore et al (2006) data for the dose and dose rate influence on the adaptive response radio-protective behavior of HeLa x Skin cells for naturally occurring, spontaneous chromosome damage from a Brachytherapy type (125)I photon radiation source. We have also applied the AR-BE Microdose Model to the Chromosome inversion data of Hooker et al (2004) reflecting both low LET bystander and adaptive response effects. The micro-beam facility data of Miller et al (1999), Nagasawa and Little (1999) and Zhou et al (2003) is also examined. For the Zhou et al (2003) data, we use the AR-BE model to estimate the threshold for adaptive response reduction of the bystander effect. The mammogram and diagnostic X-ray induction of AR and protective BE are observed. We show that bystander damage is reduced in the similar manner as spontaneous and challenge dose damage as shown by the Azzam et al (1996) data. We cite primary unresolved questions regarding adaptive response behavior and bystander behavior. The five features of major significance provided by the Microdose Model so far are 1. Single Specific Energy Hits initiate Adaptive Response. 2. Mammogram and diagnostic X-rays induce a protective Bystander Effect as well as Adaptive Response radio-protection. 3. For mammogram X-rays the Adaptive Response protection is retained at high primer dose levels. 4. The dose range of the AR protection depends on the value of the Specific Energy per Hit, 1 >. 5. Alpha particle induced deleterious Bystander damage is modulated by low LET radiation.
Carey, Amanda N; Fisher, Derek R; Joseph, James A; Shukitt-Hale, Barbara
2013-01-01
Previous research from our lab has demonstrated that dietary walnut supplementation protects against age-related cognitive declines in rats; however, the cellular mechanisms by which walnuts and polyunsaturated fatty acids (PUFAs) may affect neuronal health and functioning in aging are undetermined. We assessed if pretreatment of primary hippocampal neurons with walnut extract or PUFAs would protect cells against dopamine- and lipopolysaccharide-mediated cell death and calcium dysregulation. Rat primary hippocampal neurons were pretreated with varying concentrations of walnut extract, linoleic acid, alpha-linolenic acid, eicosapentaenoic acid, or docosahexaenoic acid prior to exposure to either dopamine or lipopolysaccharide. Viability was assessed using the Live/Dead Cellular Viability/Cytotoxicity Kit. Also, the ability of the cells to return to baseline calcium levels after depolarization was measured with fluorescent imaging. Results indicated that walnut extract, alpha-linolenic acid, and docosahexaenoic acid provided significant protection against cell death and calcium dysregulation; the effects were pretreatment concentration dependent and stressor dependent. Linoleic acid and eicosapentaenoic acid were not as effective at protecting hippocampal cells from these insults. Walnut extract and omega-3 fatty acids may protect against age-related cellular dysfunction, but not all PUFAs are equivalent in their beneficial effects.
Shi, Haohong; Luo, Xingjing
2016-01-01
Background 7, 8, 3′-trihydroxyflavone (THF) is a novel pro-neuronal small molecule that acts as a TrkB agonist. In this study, we examined the effect of THF on promoting neuronal growth and protecting anesthetics-induced neurotoxicity in dorsal root ganglion (DRG) neurons in vitro. Material/Methods Neonatal mouse DRG neurons were cultured in vitro and treated with various concentrations of THF. The effect of THF on neuronal growth was investigated by neurite outgrowth assay and Western blot. In addition, the protective effects of THF on bupivacaine-induced neurotoxicity were investigated by apoptosis TUNEL assay, neurite outgrowth assay, and Western blot, respectively. Results THF promoted neurite outgrowth of DRG neurons in dose-dependent manner, with an EC50 concentration of 67.4 nM. Western blot analysis showed THF activated TrkB signaling pathway by inducing TrkB phosphorylation. THF also rescued bupivacaine-induced neurotoxicity by reducing apoptosis and protecting neurite retraction in DRG neurons. Furthermore, the protection of THF in bupivacaine-injured neurotoxicity was directly associated with TrkB phosphorylation in a concentration-dependent manner in DRG neurons. Conclusions THF has pro-neuronal effect on DRG neurons by promoting neurite growth and protecting against bupivacaine-induced neurotoxicity, likely through TrkB activation. PMID:27371503
Yu, Hyeon-Hee; Seo, Se-Jeong; Kim, Yeon-Hwa; Lee, Hae-Youn; Park, Rae-Kil; So, Hong-Seob; Jang, Seon Ll; You, Yong-Ouk
2006-10-11
The steamed root of Rehmannia glutinosa has been used in traditional Oriental Medicine for treatment of inner ear diseases, such as tinnitus and hearing loss. In the present study, we showed that the ethanol extract of steamed roots of Rehmannia glutinosa (SRG) protected HEI-OC1 auditory cells from cisplatin cytotoxicity in a dose-dependent fashion. In addition, to investigate the protection mechanism of SRG on cisplatin cytotoxicity towards HEI-OC1, we measured the effects of SRG on lipid peroxidation of cisplatin treated cells as well as scavenging activities against superoxide radical, hydroxyl radical, hydrogen peroxide, and DPPH radical. SRG (5-100 microg/ml) had protective effect against the cisplatin-induced HEI-OC1 cell damage and reduced lipid peroxidation in a dose-dependent manner. Furthermore, SRG showed strong scavenging activity against superoxide radical, hydroxyl radical, hydrogen peroxide, and DPPH radical. These results indicate that SRG protects cisplatin-induced HEI-OC1 cell damage through inhibition of lipid peroxidation and scavenging activities of free radials.
Long-term organ protection by doxazosin and/or quinapril as antihypertensive therapy.
Gallego-Delgado, Julio; Lazaro, Alberto; Gomez-Garre, Dulcenombre; Osende, Julio I; Gonzalez-Rubio, Maria L; Herraiz, Marta; Manzarbeitia, Félix; Fortes, José; Fernandez-Cruz, Arturo; Egido, Jesús
2006-01-01
Even with optimal blood pressure control, organ protection may also depend on the selected therapeutic regime. Angiotensin-converting enzyme inhibitors have been shown to provide excellent organ protection in hypertension, and may show dose-dependent protective effects. Adrenergic alpha blockers have been associated with an increased rate of heart failure in the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) and Vasodilator-Heart Failure Trial (V-HeFT). This has been related to a proapoptotic effect of this drug in cardiomyocytes. Our purpose is to compare the heart and renal protection of a high quinapril dose, with a combined low quinapril dose plus doxazosin, in an animal model of chronic hypertension. Uninephrectomized spontaneously hypertensive 12-week-old rats were treated for 36 weeks with either quinapril or a combination of doxazosin plus a low quinapril dose. Tight blood pressure control was achieved with both treatments. Renal and cardiac protection was assessed by different parameters, and cardiac apoptosis was evaluated by active caspase-3, apoptotic protein and heat shock protein levels. Untreated hypertensive and normotensive rats were included as controls. Both treatments showed significant heart and renal protection compared with untreated animals. Both therapeutic regimes showed similar protection in renal and cardiac pathology, coronary media fibrosis, myocardial apoptosis and cardiac index. Proteinuria and left ventricular hypertrophy regression were significantly lower in the quinapril group compared with the combined treatment group. Blood pressure control with a high quinapril dose provided higher organ protection than a combined therapy with a lower quinapril dose. This effect was not due to a deleterious effect of doxazosin.
Shen, Yaqi; Guo, Wei; Wang, Zhijun; Zhang, Yuchen; Zhong, Liangjie; Zhu, Yizhun
2013-01-01
The aim of the study was to investigate the protective effects of sodium hydrosulfide (NaHS), a H2S donor, against hypoxia-induced injury in human umbilical vein endothelial cells (HUVECs) and also to look into the possible mechanisms by which H2S exerts this protective effect. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and scratch wound healing assay were chosen to measure the cell viability and migration-promoting effects. The fluorescent probe, DCFH-DA and 5,5′,6,6′-Tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (JC-1) were applied to detect the reactive oxygen species (ROS) level and mitochondrial membrane potential (ΔΨm). Furthermore, western blots were used to measure the expressions of the apoptosis-related proteins. Under hypoxic conditions, 300 μM and 600 μM of H2S could protect HUVECs against hypoxia-induced injury, as determined by MTT assay. Following the treatment of 60 μM NaHS for 18 h, scratch wound healing assays indicated that the scratch became much narrower than control group. After treatment with 60 μM, 120 μM, and 600 μM NaHS, and hypoxia for 30 min, flow cytometry demonstrated that the ROS concentrations decreased to 95.08% ± 5.52%, 73.14% ± 3.36%, and 73.51% ± 3.05%, respectively, compared with the control group. In addition, the JC-1 assay showed NaHS had a protective effect on mitochondria damage. Additionally, NaHS increased Bcl-2 expression and decreased the expression of Bax, Caspase-3 and Caspase-9 in a dose-dependent way. Our results suggest that H2S can protect endothelial cells and promote migration under hypoxic condition in HUVECs. These effects are partially associated with the preservation of mitochondrial function mediated by regulating the mitochondrial-dependent apoptotic pathway. PMID:23799362
Oxidation of Peptides by Methyl(trifluoromethyl)dioxirane: the Protecting Group Matters
Rella, Maria Rosaria; Williard, Paul G.
2011-01-01
Representative Boc protected and acetyl protected peptide methyl esters bearing alkyl side chains undergo effective oxidation using methyl(trifluoromethyl)dioxirane (1b) under mild conditions. We observe a protecting group dependency in the chemoselectivity displayed by the dioxirane 1b. N-hydroxylation occurs in the case of the Boc protected peptides, side chain hydroxylation takes place in the case of acetyl protected peptides. Both are attractive transformations since they yield derivatized peptides that serve as valuable synthons. PMID:17221970
Parvardeh, Siavash; Moghimi, Mahsa; Eslami, Pegah; Masoudi, Alireza
2016-02-01
Dependence and tolerance to opioid analgesics are major problems limiting their clinical application. α-Terpineol is a monoterpenoid alcohol with neuroprotective effects which is found in several medicinal plants such as Myrtus communis, Laurus nobilis, and Stachys byzantina. It has been shown that some of these medicinal plants such as S. byzantina attenuate dependence and tolerance to morphine. Since α-terpineol is one of the bioactive phytochemical constituent of these medicinal plants, the present study was conducted to investigate the effects of α-terpineol on morphine-induced dependence and tolerance in mice. The mice were rendered dependent or tolerant to morphine by a 3-day administration schedule. The hot-plate test and naloxone-induced withdrawal syndrome were used to evaluate tolerance and dependence on morphine, respectively. To investigate a possible role for nitric oxide (NO) in the protective effect of α-terpineol, the NO synthase inhibitor, L-N(G)-nitroarginine methyl ester (L-NAME) and NO precursor, L-arginine, were used. Administration of α-terpineol (5, 10, and 20 mg/kg, IP) significantly decreased the number of jumps in morphine dependent animals. Moreover, α-terpineol (20 and 40 mg/kg, IP) attenuated tolerance to the analgesic effect of morphine. The inhibitory effects of α-terpineol on morphine-induced dependence and tolerance were enhanced by pretreatment with L-NAME (10 mg/kg, IP). However, L-arginine (300 mg/kg, IP) antagonized the protective effects of α-terpineol on dependence and tolerance to morphine. These findings indicate that α-terpineol prevents the development of dependence and tolerance to morphine probably through the influence on NO production.
Pezzoni, Magdalena; Tribelli, Paula M; Pizarro, Ramón A; López, Nancy I; Costa, Cristina S
2016-05-01
Solar UVA radiation is one of the main environmental stress factors for Pseudomonas aeruginosa. Exposure to high UVA doses produces lethal effects by the action of the reactive oxygen species (ROS) it generates. P. aeruginosa has several enzymes, including KatA and KatB catalases, which provide detoxification of ROS. We have previously demonstrated that KatA is essential in defending P. aeruginosa against high UVA doses. In order to analyse the mechanisms involved in the adaptation of this micro-organism to UVA, we investigated the effect of exposure to low UVA doses on KatA and KatB activities, and the physiological consequences. Exposure to UVA induced total catalase activity; assays with non-denaturing polyacrylamide gels showed that both KatA and KatB activities were increased by radiation. This regulation occurred at the transcriptional level and depended, at least partly, on the increase in H2O2 levels. We demonstrated that exposure to low UVA produced a protective effect against subsequent lethal doses of UVA, sodium hypochlorite and H2O2. Protection against lethal UVA depends on katA, whilst protection against sodium hypochlorite depends on katB, demonstrating that different mechanisms are involved in the defence against these oxidative agents, although both genes can be involved in the global cellular response. Conversely, protection against lethal doses of H2O2 could depend on induction of both genes and/or (an)other defensive factor(s). A better understanding of the adaptive response of P. aeruginosa to UVA is relevant from an ecological standpoint and for improving disinfection strategies that employ UVA or solar irradiation.
Leonard, Bobby E.
2008-01-01
Prior work has provided incremental phases to a microdosimetry modeling program to describe the dose response behavior of the radio-protective adaptive response effect. We have here consolidated these prior works (Leonard 2000, 2005, 2007a, 2007b, 2007c) to provide a composite, comprehensive Microdose Model that is also herein modified to include the bystander effect. The nomenclature for the model is also standardized for the benefit of the experimental cellular radio-biologist. It extends the prior work to explicitly encompass separately the analysis of experimental data that is 1.) only dose dependent and reflecting only adaptive response radio-protection, 2.) both dose and dose-rate dependent data and reflecting only adaptive response radio-protection for spontaneous and challenge dose damage, 3.) only dose dependent data and reflecting both bystander deleterious damage and adaptive response radio-protection (AR-BE model). The Appendix cites the various applications of the model. Here we have used the Microdose Model to analyze the, much more human risk significant, Elmore et al (2006) data for the dose and dose rate influence on the adaptive response radio-protective behavior of HeLa x Skin cells for naturally occurring, spontaneous chromosome damage from a Brachytherapy type 125I photon radiation source. We have also applied the AR-BE Microdose Model to the Chromosome inversion data of Hooker et al (2004) reflecting both low LET bystander and adaptive response effects. The micro-beam facility data of Miller et al (1999), Nagasawa and Little (1999) and Zhou et al (2003) is also examined. For the Zhou et al (2003) data, we use the AR-BE model to estimate the threshold for adaptive response reduction of the bystander effect. The mammogram and diagnostic X-ray induction of AR and protective BE are observed. We show that bystander damage is reduced in the similar manner as spontaneous and challenge dose damage as shown by the Azzam et al (1996) data. We cite primary unresolved questions regarding adaptive response behavior and bystander behavior. The five features of major significance provided by the Microdose Model so far are 1.) Single Specific Energy Hits initiate Adaptive Response, 2.) Mammogram and diagnostic X-rays induce a protective Bystander Effect as well as Adaptive Response radio-protection. 3.) For mammogram X-rays the Adaptive Response protection is retained at high primer dose levels. 4.) The dose range of the AR protection depends on the value of the Specific Energy per Hit,
Effects of a long-acting mutant bacterial cocaine esterase on acute cocaine toxicity in rats
Collins, Gregory T.; Zaks, Matthew E.; Cunningham, Alyssa R.; St. Clair, Carley; Nichols, Joseph; Narasimhan, Diwahar; Ko, Mei-Chuan; Sunahara, Roger K.; Woods, James H.
2011-01-01
Background A longer acting, double mutant bacterial cocaine esterase (CocE T172R/G173Q; DM CocE) has been shown to protect mice from cocaine-induced lethality, inhibit the reinforcing effects of cocaine in rats, and reverse cocaine’s cardiovascular effects in rhesus monkeys. The current studies evaluated the effectiveness of DM CocE to protect against, and reverse cocaine’s cardiovascular, convulsant, and lethal effects in male and female rats. Methods Pretreatment studies were used to determine the effectiveness and in vivo duration of action for DM CocE to protect rats against the occurrence of cardiovascular changes, convulsion and lethality associated with acute cocaine toxicity. Posttreatment studies were used to evaluate the capacity of DM CocE to rescue rats from the cardiovascular and lethal effects of large doses of cocaine. In addition, male and female rats were studied to determine if there were any potential effects of sex on the capacity of DM CocE to protect against, or reverse acute cocaine toxicity in rats. Results Pretreatment with DM CocE dose-dependently protected rats against cocaine-induced cardiovascular changes, convulsion and lethality, with higher doses active for up to 4 hrs, and shifting cocaine-induced lethality at least 10-fold to the right. In addition to dose-dependently recovering rats from an otherwise lethal dose of cocaine, post-treatment with DM CocE also reversed the cardiovascular effects of cocaine. There were no sex-related differences in the effectiveness of DM CocE to protect against, or reverse acute cocaine toxicity. Conclusions Together, these results support the development of DM CocE for the treatment of acute cocaine toxicity. PMID:21481548
NASA Astrophysics Data System (ADS)
Boron, Sergiusz
2017-06-01
Operational safety of electrical machines and equipment depends, inter alia, on the hazards resulting from their use and on the scope of applied protective measures. The use of insufficient protection against existing hazards leads to reduced operational safety, particularly under fault conditions. On the other hand, excessive (in relation to existing hazards) level of protection may compromise the reliability of power supply. This paper analyses the explosion hazard created by earth faults in longwall power supply systems and evaluates existing protection equipment from the viewpoint of its protective performance, particularly in the context of explosion hazards, and also assesses its effect on the reliability of power supply.
Pretreatment with apoaequorin protects hippocampal CA1 neurons from oxygen-glucose deprivation.
Detert, Julia A; Adams, Erin L; Lescher, Jacob D; Lyons, Jeri-Anne; Moyer, James R
2013-01-01
Ischemic stroke affects ∼795,000 people each year in the U.S., which results in an estimated annual cost of $73.7 billion. Calcium is pivotal in a variety of neuronal signaling cascades, however, during ischemia, excess calcium influx can trigger excitotoxic cell death. Calcium binding proteins help neurons regulate/buffer intracellular calcium levels during ischemia. Aequorin is a calcium binding protein isolated from the jellyfish Aequorea victoria, and has been used for years as a calcium indicator, but little is known about its neuroprotective properties. The present study used an in vitro rat brain slice preparation to test the hypothesis that an intra-hippocampal infusion of apoaequorin (the calcium binding component of aequorin) protects neurons from ischemic cell death. Bilaterally cannulated rats received an apoaequorin infusion in one hemisphere and vehicle control in the other. Hippocampal slices were then prepared and subjected to 5 minutes of oxygen-glucose deprivation (OGD), and cell death was assayed by trypan blue exclusion. Apoaequorin dose-dependently protected neurons from OGD--doses of 1% and 4% (but not 0.4%) significantly decreased the number of trypan blue-labeled neurons. This effect was also time dependent, lasting up to 48 hours. This time dependent effect was paralleled by changes in cytokine and chemokine expression, indicating that apoaequorin may protect neurons via a neuroimmunomodulatory mechanism. These data support the hypothesis that pretreatment with apoaequorin protects neurons against ischemic cell death, and may be an effective neurotherapeutic.
Protection from sunburn with beta-Carotene--a meta-analysis.
Köpcke, Wolfgang; Krutmann, Jean
2008-01-01
Nutritional protection against skin damage from sunlight is increasingly advocated to the general public, but its effectiveness is controversial. In this meta-analysis, we have systematically reviewed the existing literature on human supplementation studies on dietary protection against sunburn by beta-carotene. A review of literature until June 2007 was performed in PubMed, ISI Web of Science and EBM Cochrane library and identified a total of seven studies which evaluated the effectiveness of beta-carotene in protection against sunburn. Data were abstracted from these studies by means of a standardized data collection protocol. The subsequent meta-analysis showed that (1) beta-carotene supplementation protects against sunburn and (2) the study duration had a significant influence on the effected size. Regression plot analysis revealed that protection required a minimum of 10 weeks of supplementation with a mean increase of the protective effect of 0.5 standard deviations with every additional month of supplementation. Thus, dietary supplementation of humans with beta-carotene provides protection against sunburn in a time-dependent manner.
Programs for the Alleviation of Institutional Dependency. Final Report.
ERIC Educational Resources Information Center
Callahan, Orel D.; And Others
The Summer School Functional Education program of the Kalamazoo (Michigan) State Hospital was evaluated in terms of the program's effectiveness in enhancing the emotional health of participants and reducing their institutional dependency (adjustment patterns dependent on the structured and protected environment of the institution). Subjects were…
Arkema, Katie K; Griffin, Robert; Maldonado, Sergio; Silver, Jessica; Suckale, Jenny; Guerry, Anne D
2017-07-01
Interest in the role that ecosystems play in reducing the impacts of coastal hazards has grown dramatically. Yet the magnitude and nature of their effects are highly context dependent, making it difficult to know under what conditions coastal habitats, such as saltmarshes, reefs, and forests, are likely to be effective for saving lives and protecting property. We operationalize the concept of natural and nature-based solutions for coastal protection by adopting an ecosystem services framework that propagates the outcome of a management action through ecosystems to societal benefits. We review the literature on the basis of the steps in this framework, considering not only the supply of coastal protection provided by ecosystems but also the demand for protective services from beneficiaries. We recommend further attention to (1) biophysical processes beyond wave attenuation, (2) the combined effects of multiple habitat types (e.g., reefs, vegetation), (3) marginal values and expected damage functions, and, in particular, (4) community dependence on ecosystems for coastal protection and co-benefits. We apply our approach to two case studies to illustrate how estimates of multiple benefits and losses can inform restoration and development decisions. Finally, we discuss frontiers for linking social, ecological, and physical science to advance natural and nature-based solutions to coastal protection. © 2017 New York Academy of Sciences.
NASA Astrophysics Data System (ADS)
Zhang, Wanshu; Zhang, Lanying; Liang, Xiao; Le Zhou; Xiao, Jiumei; Yu, Li; Li, Fasheng; Cao, Hui; Li, Kexuan; Yang, Zhou; Yang, Huai
2017-02-01
High-performance and cost-effective laser protection system is of crucial importance for the rapid advance of lasers in military and civilian fields leading to severe damages of human eyes and sensitive optical devices. However, it is crucially hindered by the angle-dependent protective effect and the complex preparation process. Here we demonstrate that angle-independence, good processibility, wavelength tunability, high optical density and good visibility can be effectuated simultaneously, by embedding dichroic anthraquinone dyes in a cholesteric liquid crystal matrix. More significantly, unconventional two-dimensional parabolic protection behavior is reported for the first time that in stark contrast to the existing protection systems, the overall parabolic protection behavior enables protective effect to increase with incident angles, hence providing omnibearing high-performance protection. The protective effect is controllable by dye concentration, LC cell thickness and CLC reflection efficiency, and the system can be made flexible enabling applications in flexible and even wearable protection devices. This research creates a promising avenue for the high-performance and cost-effective laser protection, and may foster the development of optical applications such as solar concentrators, car explosion-proof membrane, smart windows and polarizers.
Chechushkov, Anton; Zaitseva, Natalia; Vorontsova, Elena; Kozhin, Petr; Menshchikova, Elena; Shkurupiy, Vyacheslav
2016-12-01
Linear dextrans are often proposed as drug delivery systems with milder adverse effects and lower effective drug concentrations. Linear dextrans are polysaccharides that can potentially be used to load macrophages with drugs to transport them to a site of inflammation. Recently, it was reported that dextrans may exert a protective effect vis-à-vis drug cytotoxicity and during wound healing. The aim of the current work was to evaluate molecular mechanisms of action of dextrans that may be relevant to the cytoprotective effects. We determined the effect of treatment with 40- or 70-kDa dextran on production of reactive oxygen species, lipid peroxidation, and lysosomal pH in the J774 macrophage cell line. In addition, induction of Keap1/Nrf2/ARE and autophagic activity were evaluated. Dextrans of both molecular weights protected the cells from oxidative stress induced by cumene hydroperoxide and from lysosomal stress induced by ammonium chloride. The effect was associated with induction of the Keap1/Nrf2/ARE signaling pathway. Furthermore, dextran stimulated autophagy in a dose-dependent manner but inhibited the autophagosome-lysosome fusion in a time-dependent manner. This study shows possible cytoprotective effects of dextran under oxidative stress, and these findings may be used for the development of novel (dextran-based) drug delivery approaches. Copyright © 2016 Elsevier Inc. All rights reserved.
Du, Xiao Fei; Song, Jae-Jun; Hong, Seungug; Kim, Jihye
2012-06-01
Piper longum L. (PL), also as known as long pepper, a well-known spice and traditional medicine in Asia and Pacific islands, has been reported to exhibit wide spectrum activity including antioxidant activity. However, little information is available on its protective effect on gentamicin (GM) induced ototoxicity which is commonly regarded as being mediated by reactive oxygen species and reactive nitrogen species. This study was undertaken to investigate the protective effect of PL ethanol extract on gentamicin-induced hair cell loss in neonatal cochlea cultures. Cochlea cultures from postnatal day 2-3 mice were used for analysis of the protective effects of PL against gentamicin-induced hair cell loss by phalloidin staining. E. coil cultures were used to determine whether PL interferes with the antibiotic activity of GM. Nitric oxide (NO)-scavenging activity of PL was also measured in vitro. GM induced significant dose-dependent hair cell loss in cochlea cultures. However, without interfering with the antibiotic activity of GM, PL showed a significant and concentration-dependent protective effect against GM-induced hair cell loss, and hair cells retained their stereocilia well. In addition, PL expressed direct scavenging activity toward NO radical liberated within solution of sodium nitroprusside. These findings demonstrate the protective effect of PL on GM-induced hair cell loss in neonatal cochlea cultures, and suggest that it might be of therapeutic benefit for treatment of GM-induced ototoxicity.
Wei, Wei; Li, Langen; Zhang, Yufeng; Geriletu; Yang, Jia; Zhang, Yanmei; Xing, Yiqiao
2014-01-01
The purpose was to investigate the protective effects of Vitamin C (Vit C) and the regulatory mechanism between Vit C and sirtuin 1 (SIRT1) in PREs during oxidative stress as Vit C and SIRT1 exerted famous effects as antioxidants. We found that moderate Vit C (100 µM) prevented ARPE-19 cells from damages induced by H2O2, including increasing viability, reducing apoptosis, and attenuating intracellular ROS levels. But lower and higher concentration of Vit C had no effects. Further results indicated that Vit C caused the dysregulation of some stress responses factors (SIRT1, p53 and FOXO3) in ARPE-19 cells response to H2O2. Moreover we found that SIRT1 activator resveratrol (SRV) stimulated significantly the protective effects of moderate Vit C, provided the property of antioxidative stress for the lower and higher concentration of Vit C in ARPE-19 cells as well. Consistently, nicotinamide (NA) relieved the protective functions of moderate Vit C. Interestingly, data also revealed the dysregulation of p53 and FOXO3 was dependent on the regulation of SIRT1 rather than Vit C. Summarily, the protective effect of Vit C against oxidative stress was involved in regulation of SIRT1. It suggested that combined application of Vit C and RSV might be a promising therapeutic method for AMD. PMID:25147862
Dobrikova, Anelia G; Apostolova, Emilia L
2015-07-20
The effect of the exogenously added quercetin against the UV-B inhibition of the photosystem II (PSII) functions in isolated pea thylakoid membranes suspended at different pH of the medium (6.5, 7.6 and 8.4) was investigated. The data revealed that the interaction of this flavonoid with the membranes depends on the pH and influences the initial S0-S1 state distribution of PSII in the dark, the energy transfer between pigment-protein complexes of the photosynthetic apparatus and the membrane fluidity. Quercetin also displays a different UV-protective effect depending on its location in the membranes, as the effect is more pronounced at pH 8.4 when it is located at the membrane surface. The results suggest that quercetin induces structural changes in thylakoid membranes, one of the possible reasons for its protection of the photosynthetic apparatus. Copyright © 2015 Elsevier GmbH. All rights reserved.
Jansen, Felix; Yang, Xiaoyan; Hoyer, Friedrich Felix; Paul, Kathrin; Heiermann, Nadine; Becher, Marc Ulrich; Abu Hussein, Nebal; Kebschull, Moritz; Bedorf, Jörg; Franklin, Bernardo S; Latz, Eicke; Nickenig, Georg; Werner, Nikos
2012-08-01
Endothelial microparticles (EMP) are released from activated or apoptotic cells, but their effect on target cells and the exact way of incorporation are largely unknown. We sought to determine the uptake mechanism and the biological effect of EMP on endothelial and endothelial-regenerating cells. EMP were generated from starved endothelial cells and isolated by ultracentrifugation. Caspase 3 activity assay and terminal deoxynucleotidyl transferase dUTP nick end labeling assay showed that EMP protect target endothelial cells against apoptosis in a dose-dependent manner. Proteomic analysis was performed to identify molecules contained in EMP, which might be involved in EMP uptake. Expression of annexin I in EMP was found and confirmed by Western blot, whereas the corresponding receptor phosphatidylserine receptor was present on endothelial target cells. Silencing either annexin I on EMP or phosphatidylserine receptor on target cells using small interfering RNA showed that the uptake of EMP by human coronary artery endothelial cells is annexin I/phosphatidylserine receptor dependent. Annexin I-downregulated EMP abrogated the EMP-mediated protection against apoptosis of endothelial target cells. p38 activation was found to mediate camptothecin-induced apoptosis. Finally, human coronary artery endothelial cells pretreated with EMP inhibited camptothecin-induced p38 activation. EMP are incorporated by endothelial cells in an annexin I/phosphatidylserine receptor-dependent manner and protect target cells against apoptosis. Inhibition of p38 activity is involved in EMP-mediated protection against apoptosis.
Kim, Jeong-Hwan; Kwon, Hyun Ju; Kim, Byung Woo
2016-05-28
The present study investigated the protective effect of naturally purified 4-(3,4- dihydroxyphenyl)-3-buten-2-one (DHP) from Phellinus linteus against naproxen-induced gastric antral ulcers in rats. To verify the protective effect of DHP on naproxen-induced gastric antral ulcers, various doses (1, 5, and 10 μg/kg) of DHP were pretreated for 3 days, and then gastric damage was caused by 80 mg/kg naproxen applied for 3 days. DHP prevented naproxen-induced gastric antral ulcers in a dose-dependent manner. In particular, 10 μg/kg DHP showed the best protective effect against naproxen-induced gastric antral ulcers. Moreover, DHP significantly attenuated the naproxen-induced lipid peroxide level in gastric mucosa and increased the activities of radical scavenging enzymes, such as superoxide dismutase, catalase, and glutathione peroxidase, in a dose-dependent manner. A histological examination clearly demonstrated that the gastric antral ulcer induced by naproxen nearly disappeared after the pretreatment of DHP. These results suggest that DHP can inhibit naproxen-induced gastric antral ulcers through prevention of lipid peroxidation and activation of radical scavenging enzymes.
Land use change around protected areas: management to balance human needs and ecological function.
DeFries, Ruth; Hansen, Andrew; Turner, B L; Reid, Robin; Liu, Jianguo
2007-06-01
Protected areas throughout the world are key for conserving biodiversity, and land use is key for providing food, fiber, and other ecosystem services essential for human sustenance. As land use change isolates protected areas from their surrounding landscapes, the challenge is to identify management opportunities that maintain ecological function while minimizing restrictions on human land use. Building on the case studies in this Invited Feature and on ecological principles, we identify opportunities for regional land management that maintain both ecological function in protected areas and human land use options, including preserving crucial habitats and migration corridors, and reducing dependence of local human populations on protected area resources. Identification of appropriate and effective management opportunities depends on clear definitions of: (1) the biodiversity attributes of concern; (2) landscape connections to delineate particular locations with strong ecological interactions between the protected area and its surrounding landscape; and (3) socioeconomic dynamics that determine current and future use of land resources in and around the protected area.
Lutnicki, K; Szpringer, E; Czerny, K; Ledwozyw, A
2001-01-01
Cytoprotection in the stomach, consisting in the mucus secretion, mucous circulation intensification and bicarbonate secretion to the gastric lumen, is highly dependent on the products of arachidonic acid pathway and peroxidative-antioxidative balance. The aim of the paper was to examine the effects of selected inhibitors of arachidonic acid pathway on the natural protective system of the gastric mucosa exposed to 50% ethanol. The results show that leukotrienes, thromboxane and oxygen reactive forms significantly impair the protective function of the gastric mucosa while prostaglandins and antioxidant enzymes act protectively.
Ko, Eun-Ju; Lee, Young-Tae; Kim, Ki-Hye; Lee, Youri; Jung, Yu-Jin; Kim, Min-Chul; Lee, Yu-Na; Kang, Taeuk; Kang, Sang-Moo
2016-01-01
Vaccine adjuvant effects in CD4 deficient condition largely remain unknown. We investigated the roles of combined monophosphoryl lipid A (MPL) and Alum adjuvant (MPL+Alum) in inducing immunity after immunization of CD4-knockout (CD4KO) and wild-type (WT) mice with T-dependent influenza vaccine. MPL+Alum adjuvant mediated IgG isotype-switched antibodies, IgG secreting cell responses, and protection in CD4KO mice, which were comparable to those in WT mice. In contrast, Alum adjuvant effects were dependent on CD4+ T cells. MPL+Alum adjuvant was effective in recruiting monocytes and neutrophils as well as in protecting macrophages from alum-mediated cell loss at the injection site in CD4KO mice. MPL+Alum appeared to attenuate MPL-induced inflammatory responses in WT mice, likely improving the safety. Additional studies in CD4-depleted WT mice and MHCII KO mice suggest that MHCII positive antigen presenting cells contribute to providing alternative B cell help in CD4 deficient condition in the context of MPL+Alum adjuvanted vaccination. PMID:27881702
Maciejewski, Kristine; De Vos, Alta; Cumming, Graeme S; Moore, Christine; Biggs, Duan
2015-01-01
Protected areas are a central strategy for achieving global conservation goals, but their continued existence depends heavily on maintaining sufficient social and political support to outweigh economic interests or other motives for land conversion. Thus, the resilience of protected areas can be considered a function of their perceived benefits to society. Nature-based tourism (NBT), a cultural ecosystem service, provides a key source of income to protected areas, facilitating a sustainable solution to conservation. The ability of tourism to generate income depends, however, on both the scales at which this cultural service is provided and the scales at which tourists respond to services on offer. This observation raises a set of location-, context-, and scale-related questions that need to be confronted before we can understand and value cultural service provision appropriately. We combine elements of resilience analysis with a systems ecology framework and apply this to NBT in protected areas to investigate cross-scale interactions and scale mismatches. We postulate that cross-scale effects can either have a positive effect on protected area resilience or lead to scale mismatches, depending on their interactions with cross-scale feedbacks. To demonstrate this, we compare spatial scales and nested levels of institutions to develop a typology of scale mismatches for common scenarios in NBT. In our new typology, the severity of a scale mismatch is expressed as the ratio of spatial scale to institutional level, producing 25 possible outcomes with differing consequences for system resilience. We predict that greater differences between interacting scales and levels, and greater magnitudes of cross-scale interactions, will lead to greater magnitudes of scale mismatch. Achieving a better understanding of feedbacks and mismatches, and finding ways of aligning spatial and institutional scales, will be critical for strengthening the resilience of protected areas that depend on NBT.
Gumenscheimer, Marina; Mitov, Ivan; Galanos, Chris; Freudenberg, Marina A.
2002-01-01
Priming with heat-killed Propionibacterium acnes enhances the sensitivity of mice to lipopolysaccharide (LPS) and other biologically active bacterial components. We show that P. acnes priming has protective and deleterious effects on a subsequent serovar Typhimurium infection. It may result in a complete protection or prolonged survival, or it may accelerate mortality of the infected mice, depending on the number of serovar Typhimurium bacteria administered and on the degree of LPS hypersensitivity at the time of infection. Both effects of P. acnes-induced hypersensitivity are mediated by gamma interferon (IFN-γ) and are based on a differential activation of the innate immune mechanisms which recognize and react against the LPS present in infecting bacteria. In P. acnes-primed mice null for LPS-binding protein (LBP−/− mice), the impaired LPS recognition, due to the absence of LBP, resulted in a higher resistance to serovar Typhimurium infection. A similar P. acnes priming of mice had a protective, but no deleterious effect on a subsequent L. monocytogenes infection. This effect was IFN-γ dependent but independent of LBP. PMID:12228287
Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W.
2013-01-01
Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury. PMID:24454979
Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W; Chung, Hun Taeg
2013-01-01
Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.
Couteau, C; Diarra, H; Coiffard, L
2016-03-16
Using a topical product is part of the overall strategy for skin cancer prevention. The level of protection attainable when using commercial products is indicated by the Sun Protection Factor (SPF) value, in use everywhere. This value reflects the level of protection primarily in the UVB range. However, UVA radiation also has deleterious effects on the skin, and it is essential to prevent it, which is why products must offer a wide spectrum of protection. Tests conducted in vivo, before any marketing, are done by applying the studied product at a rate of 2.0 mg cm(-2), while users, in practice, only use 1.0-1.5 mg cm(-2). We now know that this reduction in the amount of applied product greatly affects the SPF. To complete the state of knowledge in this area, we sought to evaluate the effect of a decrease in the amount of applied sunscreen product by studying sunscreen creams and oils on the level of protection attainable in the UVA range. We have shown that the PF-UVA is divided by a factor of 2.2, on average, when the amount of applied product is reduced by half, with differences depending on the product type under consideration (cream or oil) and depending on the SPF of the preparation. Copyright © 2016 Elsevier B.V. All rights reserved.
Antihypoxic activities of Eryngium caucasicum and Urtica dioica.
Khalili, M; Dehdar, T; Hamedi, F; Ebrahimzadeh, M A; Karami, M
2015-09-01
Urtica dioica and Eryngium spp. have been used in traditional medicine for many years. In spite of many works, nothing is known about their protective effect against hypoxia-induced lethality. Protective effects of U. dioica (UD) aerial parts and E. caucasicum (EC) inflorescence against hypoxia-induced lethality in mice were evaluated by three experimental models of hypoxia, asphyctic, haemic and circulatory. Statistically significant protective activities were established in some doses of extracts in three models. Antihypoxic activity was especially pronounced in polyphenol fractions in asphyctic model. EC polyphenol fraction at 400 mg/kg prolonged survival time (48.80 ± 4.86, p < 0.001) which was comparable with that of phenytoin (p > 0.05). It was the most effective extract in circulatory model, too. It prolonged survival time significantly respect to control group (p < 0.001). UD extracts protected the mice but the response was not dose-dependent. In haemic model, extracts of EP significantly and dose dependently prolonged survival time as compared to control group (p < 0.001). At 600 mg/kg, EP was the most effective one, being capable of keeping the mice alive for 12.71 ± 0.75 min. Only the concentration of 300 mg/kg of UD was effective (p < 0.001). Extracts showed remarkable antihypoxic effects. Pharmacological effects may be attributed to the presence of polyphenols in the extracts.
Tullio, Francesca; Penna, Claudia; Cabiale, Karine; Femminò, Saveria; Galloni, Marco; Pagliaro, Pasquale
2017-06-01
The calcitonin-gene-related-peptide (CGRP) release is coupled to the signaling of Angeli's salt in determining vasodilator effects. However, it is unknown whether CGRP is involved in Angeli's salt cardioprotective effects and which are the mechanisms of protection. We aimed to determine whether CGRP is involved in myocardial protection induced by Angeli's salt. We also analyzed the intracellular signaling pathway activated by CGRP. Isolated rat hearts were pre-treated with Angeli's salt or Angeli's salt plus CGRP 8-37 , a specific CGRP-receptor antagonist, and subjected to ischemia (30-min) and reperfusion (120-min). Moreover, we studied CGRP-induced protection during oxidative stress (H 2 O 2 ) and hypoxia/reoxygenation protocols in H9c2 cardiomyocytes. Cell vitality and mitochondrial membrane potential (ΔYm, MMP) were measured using MTT and JC-1 dyes. Angeli's salt reduced infarct size and ameliorated post-ischemic cardiac function via a CGRP-receptor-dependent mechanism. Pre-treatment with CGRP increased H9c2 survival upon challenging with either H 2 O 2 (redox stress) or hypoxia/reoxygenation (H/R stress). Under these stress conditions, reduction in MMP and cell death were partly prevented by CGRP. These CGRP beneficial effects were blocked by CGRP 8-37. During H/R stress, pre-treatment with either CGRP-receptor, protein kinase C (PKC) or mitochondrial K ATP channel antagonists, and pre-treatment with an antioxidant (2-mercaptopropionylglycine) blocked the protection mediated by CGRP. In conclusion, CGRP is involved in the cardioprotective effects of Angeli's salt. In H9c2 cardiomyocytes, CGRP elicits PKC-dependent and mitochondrial-K ATP -redox-dependent mechanisms. Hence, CGRP is an important factor in the redox-sensible cardioprotective effects of Angeli's salt. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Su, Yun; Li, Jun; Song, Guowen
2018-06-01
The moisture from skin sweat and atmospheric water affects the thermal protective performance provided by multilayer protective clothing. Four levels of moisture content were selected to evaluate the impact of moisture on thermal protection under dry (thermal radiation) and wet (thermal radiation and low-pressure steam) heat exposure. Also, the role of moisture and its relationship with exposure time were analyzed based on skin heat flux and Henriques integral value. The addition of moisture to a fabric system was found to result in differences in second-degree and third-degree skin burn times. When moisture is added to a fabric system, it both acts as a thermal conductor to present a negative effect and provides a positive effect owing to thermal storage of water and evaporative heat loss. The positive or negative effects of moisture are mainly dependent on the thermal exposure time, the moisture content and the presence of hot steam.
Protective effect of natural honey against acetic acid-induced colitis in rats.
Mahgoub, A A; el-Medany, A H; Hagar, H H; Sabah, D M
2002-01-01
The protective effects of natural honey against acetic acid-induced colitis were investigated in rats. Honey and glucose, fructose, sucrose, maltose mixture were administered, orally and rectally, daily for a period of 4 days. Induction of colitis was done on the third day using 3% acetic acid. Animals were killed on day 4 two hours after administration of the dose and colonic biopsies were taken for macroscopic scoring, histopathological and biochemical studies. Honey dose-dependently afforded protection against acetic acid-induced colonic damage. There was almost 100% protection with the highest dose (5 g/kg) used while glucose, fructose, sucrose, maltose mixture produced no significant protective effect. Also, honey prevented the depletion of the antioxidant enzymes reduced glutathione and catalase and restored the lipid peroxide malondialdehyde towards normal levels. Further studies are required to explore the active ingredients responsible for the antioxidant effect of honey and its therapeutic potential in humans.
E.M.I Effects of Cathodic Protection on Electromagnetic Flowmeters
Gundogdu, Serdar; Sahin, Ozge
2007-01-01
Electromagnetic flowmeters are used to measure the speed of water flow in water distribution systems. Corrosion problem in metal pipelines can be solved by cathodic protection methods. This paper presents a research on corruptive effects of the cathodic protection system on electromagnetic flowmeter depending on its measuring principle. Experimental measurements are realized on the water distribution pipelines of the Izmir Municipality, Department of Water and Drainage Administration (IZSU) in Turkey and measurement results are given. Experimental results proved that the values measured by the electromagnetic flowmeter (EMF) are affected by cathodic protection system current. Comments on the measurement results are made and precautions to be taken are proposed.
Environmental protection in Italy: the emerging concept of a right to a healthful environment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patti, S.
1984-07-01
Italy's concepts of private law limit the possibilities for environmental protection. The failure to use available public law effectively and the failure of other governments to solve the problem with constitutional changes, emphasizes the need to establish an effective legal means within the existing constitutional structure. A recent approach draws on the right of the individual to a healthful environment, but whether this succeeds in protecting the environment depends, to a large degree, on the ability of Italians to overcome a system characterized by economic individualism. 40 references.
Rodeiro, I; Delgado, R; Garrido, G
2014-02-01
Mangifera indica L. (mango) stem bark aqueous extract (MSBE) that has antioxidant, anti-inflammatory and immunomodulatory properties, can be obtained in Cuba. It is rich in polyphenols, where mangiferin is the main component. In this study, we have tested DNA damage and protection effects of MSBE and mangiferin on primary human lymphocytes and lymphoblastoid cells. Cell suspensions were incubated with the products (50-1000 μg/ml) for experiments on damage induction, and evaluation of any potential protective effects (5-100 μg/ml) for 60 min at 37 °C. Irradiation was performed using a γ-ray source, absorbed dose 5 Gy. At the end of exposure, DNA damage, protection and repair processes were evaluated using the comet assay. MSBE (100-1000 μg/ml) induced DNA damage in a concentration dependent manner in both cell types tested, primary cells being more sensitive. Mangiferin (200 μg/ml) only induced light DNA damage at higher concentrations. DNA repair capacity was not affected after MSBE or mangiferin exposure. On the other hand, MSBE (25 and 50 μg/ml) and mangiferin (5-25 ug/ml) protected against gamma radiation-induced DNA damage. These results show MSBE has protector or harmful effects on DNA in vitro depending on the experimental conditions, which suggest that the extract could be acting as an antioxidant or pro-oxidant product. Mangiferin was involved in protective effects of the extract. © 2013 John Wiley & Sons Ltd.
Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto, E
Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a{sup fh318}. After treatment with 1 mM sodium arsenite, the survival of nrf2a{sup fh318} larvae was significantly shortermore » than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity. - Highlights: • The role of Nrf2 under arsenite exposure was valuated using zebrafish. • Nrf2 mutant zebrafish was highly sensitive to acute arsenic toxicity. • Nrf2 induced anti-arsenic genes in response to arsenite. • Sulforaphane attenuated arsenic toxicity through Nrf2 activation. • Nrf2 system plays an important role in the defense against acute arsenic toxicity.« less
NASA Astrophysics Data System (ADS)
Yang, Wei; Sharp, Basil
2017-04-01
This paper analyses spatial dependence and determinants of the New Zealand dairy farmers' adoption of best management practices to protect water quality. A Bayesian spatial durbin probit model is used to survey data collected from farmers in the Waikato region of New Zealand. The results show that farmers located near each other exhibit similar choice behaviour, indicating the importance of farmer interactions in adoption decisions. The results also address that information acquisition is the most important determinant of farmers' adoption of best management practices. Financial problems are considered a significant barrier to adopting best management practices. Overall, the existence of distance decay effect and spatial dependence in farmers' adoption decisions highlights the importance of accounting for spatial effects in farmers' decision-making, which emerges as crucial to the formulation of sustainable agriculture policy.
Yang, Wei; Sharp, Basil
2017-04-01
This paper analyses spatial dependence and determinants of the New Zealand dairy farmers' adoption of best management practices to protect water quality. A Bayesian spatial durbin probit model is used to survey data collected from farmers in the Waikato region of New Zealand. The results show that farmers located near each other exhibit similar choice behaviour, indicating the importance of farmer interactions in adoption decisions. The results also address that information acquisition is the most important determinant of farmers' adoption of best management practices. Financial problems are considered a significant barrier to adopting best management practices. Overall, the existence of distance decay effect and spatial dependence in farmers' adoption decisions highlights the importance of accounting for spatial effects in farmers' decision-making, which emerges as crucial to the formulation of sustainable agriculture policy.
Gapeyev, A B; Lukyanova, N A
2015-01-01
Using a comet assay technique, we investigated protective effects of. extremely high frequency electromagnetic radiation in combination with the damaging effect of X-ray irradiation, the effect of damaging agents hydrogen peroxide and methyl methanesulfonate on DNA in mouse whole blood leukocytes. It was shown that the preliminary exposure of the cells to low intensity pulse-modulated electromagnetic radiation (42.2 GHz, 0.1 mW/cm2, 20-min exposure, modulation frequencies of 1 and 16 Hz) caused protective effects decreasing the DNA damage by 20-45%. The efficacy of pulse-modulated electromagnetic radiation depended on the type of genotoxic agent and increased in a row methyl methanesulfonate--X-rays--hydrogen peroxide. Continuous electromagnetic radiation was ineffective. The mechanisms of protective effects may be connected with an induction of the adaptive response by nanomolar concentrations of reactive oxygen species formed by pulse-modulated electromagnetic radiation.
A New Method for Setting Calculation Sequence of Directional Relay Protection in Multi-Loop Networks
NASA Astrophysics Data System (ADS)
Haijun, Xiong; Qi, Zhang
2016-08-01
Workload of relay protection setting calculation in multi-loop networks may be reduced effectively by optimization setting calculation sequences. A new method of setting calculation sequences of directional distance relay protection in multi-loop networks based on minimum broken nodes cost vector (MBNCV) was proposed to solve the problem experienced in current methods. Existing methods based on minimum breakpoint set (MBPS) lead to more break edges when untying the loops in dependent relationships of relays leading to possibly more iterative calculation workloads in setting calculations. A model driven approach based on behavior trees (BT) was presented to improve adaptability of similar problems. After extending the BT model by adding real-time system characters, timed BT was derived and the dependency relationship in multi-loop networks was then modeled. The model was translated into communication sequence process (CSP) models and an optimization setting calculation sequence in multi-loop networks was finally calculated by tools. A 5-nodes multi-loop network was applied as an example to demonstrate effectiveness of the modeling and calculation method. Several examples were then calculated with results indicating the method effectively reduces the number of forced broken edges for protection setting calculation in multi-loop networks.
Cytoprotective signaling by activated protein C requires protease-activated receptor-3 in podocytes
Madhusudhan, Thati; Wang, Hongjie; Straub, Beate K.; Gröne, Elisabeth; Zhou, Qianxing; Shahzad, Khurrum; Müller-Krebs, Sandra; Schwenger, Vedat; Gerlitz, Bruce; Grinnell, Brian W.; Griffin, John H.; Reiser, Jochen; Gröne, Hermann-Josef; Esmon, Charles T.; Nawroth, Peter P.
2012-01-01
The cytoprotective effects of activated protein C (aPC) are well established. In contrast, the receptors and signaling mechanism through which aPC conveys cytoprotection in various cell types remain incompletely defined. Thus, within the renal glomeruli, aPC preserves endothelial cells via a protease-activated receptor-1 (PAR-1) and endothelial protein C receptor-dependent mechanism. Conversely, the signaling mechanism through which aPC protects podocytes remains unknown. While exploring the latter, we identified a novel aPC/PAR-dependent cytoprotective signaling mechanism. In podocytes, aPC inhibits apoptosis through proteolytic activation of PAR-3 independent of endothelial protein C receptor. PAR-3 is not signaling competent itself as it requires aPCinduced heterodimerization with PAR-2 (human podocytes) or PAR-1 (mouse podocytes). This cytoprotective signaling mechanism depends on caveolin-1 dephosphorylation. In vivo aPC protects against lipopolysaccharide-induced podocyte injury and proteinuria. Genetic deletion of PAR-3 impairs the nephroprotective effect of aPC, demonstrating the crucial role of PAR-3 for aPC-dependent podocyte protection. This novel, aPC-mediated interaction of PARs demonstrates the plasticity and cell-specificity of cytoprotective aPC signaling. The evidence of specific, dynamic signaling complexes underlying aPC-mediated cytoprotection may allow the design of cell type specific targeted therapies. PMID:22117049
Visual responses of corn silk flies (Diptera: Ulidiidae)
USDA-ARS?s Scientific Manuscript database
Corn silk flies are major pests impacting fresh market sweet corn production in Florida and Georgia. Control depends solely on well-times applications of insecticides to protect corn ear development. Surveillance depends on visual inspection of ears with no effective trapping methods currently ava...
Scale dependency in effectiveness, isolation, and social-ecological spillover of protected areas.
Ament, Judith M; Cumming, Graeme S
2016-08-01
Protected areas are considered vital for the conservation of biodiversity. Given their central role in many conservation strategies, it is important to know whether they adequately protect biodiversity within their boundaries; whether they are becoming more isolated from other natural areas over time; and whether they play a role in facilitating or reducing land-cover change in their surroundings. We used matching methods and national and local analyses of land-cover change to evaluate the combined effectiveness (i.e., avoided natural-cover loss), isolation (i.e., changes in adjacent areas), and spillover effects (i.e., impacts on adjacent areas) of 19 national parks in South Africa from 2000 to 2009. All parks had either similar or lower rates of natural-cover loss than matched control samples. On a national level, mean net loss of natural cover and mean net gain of cultivation cover decreased with distance from park boundary, but there was considerable variation in trends around individual parks, providing evidence for both increased isolation and buffering of protected areas. Fourteen parks had significant positive spillover and reduced natural-cover loss in their surroundings, whereas five parks experienced elevated levels of natural-cover loss. Conclusions about social-ecological spillover effects from protected areas depended heavily on the measures of land-cover change used and the scale at which the results were aggregated. Our findings emphasize the need for high-resolution data when assessing spatially explicit phenomena such as land-cover change and challenge the usefulness of large-scale (coarse grain, broad extent) studies for understanding social-ecological dynamics around protected areas. © 2016 Society for Conservation Biology.
Ismailoglu, U B; Saracoglu, I; Harput, U S; Sahin-Erdemli, I
2002-02-01
The protective effect of phenylpropanoid glycosides, forsythoside B and alyssonoside, and the iridoid glycoside lamiide, isolated from the aerial parts of Phlomis pungens var. pungens, against free radical-induced impairment of endothelium-dependent relaxation in isolated rat aorta was investigated. Aortic rings were exposed to free radicals by the electrolysis of the physiological bathing solution. Free radical-induced inhibition of the endothelium-dependent relaxation in response to acetylcholine was countered by incubation of the aortic rings before electrolysis with the aqueous extract (200 microg/ml), phenylpropanoid fraction (100 microg/ml) and iridoid fraction (150 microg/ml) of P. pungens var. pungens. Major components of the phenylpropanoid fraction forsythoside B and alyssonoside also prevented the inhibition of the acetylcholine response, at 10(-4) M concentration. However, the major component of iridoid fraction lamiide was found ineffective at the same concentration. The protective activity of phenylpropanoid glycosides against the free radical-induced impairment of endothelium-dependent relaxation may be related to their free radical scavenging property.
Bimczok, R; Gers-Barlag, H; Mundt, C; Klette, E; Bielfeldt, S; Rudolph, T; Pflucker, F; Heinrich, U; Tronnier, H; Johncock, W; Klebon, B; Westenfelder, H; Flosser-Muller, H; Jenni, K; Kockott, D; Lademann, J; Herzog, B; Rohr, M
2007-01-01
It is often debated that the protection against solar-induced erythema under real conditions is dependent upon the amount of sunscreen applied. It is believed that when too little is applied a lower sun protection than indicated on the label will result. The aim of this study was to quantify this effect. In this multicenter study, the influence of three different amounts (0.5, 1.0, 2.0 mg/cm(2)) of three commercial sunscreen products in three reliable test centers was investigated according to the test protocol of The International Sun Protection Factor Test Method. The main result was a linear dependence of the SPF on the quantity applied. Taking into consideration the volunteer-specific variations, an exponential dependence of confidence interval of the in vivo SPF and amount applied was found. The highest amount applied (2.0 mg/cm(2)) was linked to the lowest confidence intervals. Thus, from the point of view of producing reliable and reproducible in vivo results under laboratory conditions, the recommendation of this multicenter study is an application quantity of 2.0 mg/cm(2).
Dose-dependent protective effect of BPC 157 on capsaicin-induced rhinitis in rats.
Kalogjera, L; Ries, M; Baudoin, T; Ferencic, Z; Trotic, R; Pegan, B
1997-01-01
Protection of BPC 157 on capsaicin-induced rhinitis was studied in Wistar rats for its effect on mastocyte infiltration, degranulation and inflammatory cell infiltration. Animals were pretreated with 10 microg/kg, 10 ng/kg or 2 ml saline i.p. and capsaicin (0.05 ml/nostril of 1750 nmol/l sol.) was applied intranasally. They were then euthanized at 1, 3 and 12 h after capsaicin provocation. Nasal mucosa was analyzed and scored for mastocyte infiltration, degranulation and inflammatory cell infiltration. BPC 157 pretreatment significantly prevented mastocyte infiltration at 1 h. Polymorphonuclear leukocyte infiltration was significantly reduced in rats pretreated with 10 microg/kg BPC 157. A dose-dependent effect of BPC 157 pretreatment was demonstrated only for polymorphonuclear leukocyte infiltration at 12 h.
Achieving unequal error protection with convolutional codes
NASA Technical Reports Server (NTRS)
Mills, D. G.; Costello, D. J., Jr.; Palazzo, R., Jr.
1994-01-01
This paper examines the unequal error protection capabilities of convolutional codes. Both time-invariant and periodically time-varying convolutional encoders are examined. The effective free distance vector is defined and is shown to be useful in determining the unequal error protection (UEP) capabilities of convolutional codes. A modified transfer function is used to determine an upper bound on the bit error probabilities for individual input bit positions in a convolutional encoder. The bound is heavily dependent on the individual effective free distance of the input bit position. A bound relating two individual effective free distances is presented. The bound is a useful tool in determining the maximum possible disparity in individual effective free distances of encoders of specified rate and memory distribution. The unequal error protection capabilities of convolutional encoders of several rates and memory distributions are determined and discussed.
Insulin/NFκB protects against ischemia-induced necrotic cardiomyocyte death.
Díaz, Ariel; Humeres, Claudio; González, Verónica; Gómez, María Teresa; Montt, Natalia; Sanchez, Gina; Chiong, Mario; García, Lorena
2015-11-13
In the heart, insulin controls key functions such as metabolism, muscle contraction and cell death. However, all studies have been focused on insulin action during reperfusion. Here we explore the cardioprotective action of this hormone during ischemia. Rat hearts were perfused ex vivo with an ischemia/reperfusion Langendorff model in absence or presence of insulin. Additionally, cultured rat cardiomyocytes were exposed to simulated ischemia in the absence or presence of insulin. Cytoprotective effects were measured by myocardial infarct size, trypan blue exclusion, released LDH and DNA fragmentation by flow cytometry. We found that insulin protected against cardiac ischemia ex vivo and in vitro. Moreover, insulin protected cardiomyocytes from simulated ischemia by reducing necrotic cell death. Protective effects of insulin were dependent of Akt and NFκB. These novel results show that insulin reduces ischemia-induced cardiomyocyte necrosis through an Akt/NF-κB dependent mechanism. These novel findings clarify the role of insulin during ischemia and further support its use in early GIK perfusion to treat myocardial infarction. Copyright © 2015 Elsevier Inc. All rights reserved.
Fisetin Protects DNA Against Oxidative Damage and Its Possible Mechanism.
Wang, Tingting; Lin, Huajuan; Tu, Qian; Liu, Jingjing; Li, Xican
2016-06-01
The paper tries to assess the protective effect of fisetin against •OH-induced DNA damage, then to investigate the possible mechanism. The protective effect was evaluated based on the content of malondialdehyde (MDA). The possible mechanism was analyzed using various antioxidant methods in vitro, including •OH scavenging (deoxyribose degradation), •O2 (-) scavenging (pyrogallol autoxidation), DPPH• scavenging, ABTS•(+) scavenging, and Cu(2+)-reducing power assays. Fisetin increased dose-dependently its protective percentages against •OH-induced DNA damage (IC50 value =1535.00±29.60 µM). It also increased its radical-scavenging percentages in a dose-dependent manner in various antioxidants assays. Its IC50 values in •OH scavenging, •O2(-) scavenging, DPPH• scavenging, ABTS•(+) scavenging, and Cu(2+)-reducing power assays, were 47.41±4.50 µM, 34.05±0.87 µM, 9.69±0.53 µM, 2.43±0.14 µM, and 1.49±0.16 µM, respectively. Fisetin can effectively protect DNA against •OH-induced oxidative damage possibly via reactive oxygen species (ROS) scavenging approach, which is assumed to be hydrogen atom (H•) and/or single electron (e) donation (HAT/SET) pathways. In the HAT pathway, the 3',4'-dihydroxyl moiety in B ring of fisetin is thought to play an important role, because it can be ultimately oxidized to a stable ortho-benzoquinone form.
Repeated Nrf2 stimulation using sulforaphane protects fibroblasts from ionizing radiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mathew, Sherin T.; Bergström, Petra; Hammarsten, Ola, E-mail: ola.hammarsten@clinchem.gu.se
2014-05-01
Most of the cytotoxicity induced by ionizing radiation is mediated by radical-induced DNA double-strand breaks. Cellular protection from free radicals can be stimulated several fold by sulforaphane-mediated activation of the transcription factor Nrf2 that regulates more than 50 genes involved in the detoxification of reactive substances and radicals. Here, we report that repeated sulforaphane treatment increases radioresistance in primary human skin fibroblasts. Cells were either treated with sulforaphane for four hours once or with four-hour treatments repeatedly for three consecutive days prior to radiation exposure. Fibroblasts exposed to repeated-sulforaphane treatment showed a more pronounced dose-dependent induction of Nrf2-regulated mRNA andmore » reduced amount of radiation-induced free radicals compared with cells treated once with sulforaphane. In addition, radiation- induced DNA double-strand breaks measured by gamma-H2AX foci were attenuated following repeated sulforaphane treatment. As a result, cellular protection from ionizing radiation measured by the 5-ethynyl-2′-deoxyuridine (EdU) assay was increased, specifically in cells exposed to repeated sulforaphane treatment. Sulforaphane treatment was unable to protect Nrf2 knockout mouse embryonic fibroblasts, indicating that the sulforaphane-induced radioprotection was Nrf2-dependent. Moreover, radioprotection by repeated sulforaphane treatment was dose-dependent with an optimal effect at 10 uM, whereas both lower and higher concentrations resulted in lower levels of radioprotection. Our data indicate that the Nrf2 system can be trained to provide further protection from radical damage. - Highlights: • Repeated treatment with sulforaphane protects fibroblasts from ionizing radiation • Repeated sulforaphane treatment attenuates radiation induced ROS and DNA damage • Sulforaphane mediated protection is Nrf2 dependent.« less
Machuca, Catalina; Mendoza-Milla, Criselda; Córdova, Emilio; Mejía, Salvador; Covarrubias, Luis; Ventura, José; Zentella, Alejandro
2006-02-21
The biochemical bases for hormone dependence in breast cancer have been recognized as an important element in tumor resistance, proliferation and metastasis. On this respect, dexamethasone (Dex) dependent protection against TNF-alpha-mediated cell death in the MCF-7 cell line has been demonstrated to be a useful model for the study of this type of cancer. Recently, cytoplasmic signaling induced by steroid receptors has been described, such as the activation of the PI3K/Akt and NF-kappaB pathways. We evaluated their possible participation in the Dex-dependent protection against TNF-alpha-mediated cell death. Cellular cultures of the MCF-7 cell line were exposed to either, TNF-alpha or TNF-alpha and Dex, and cell viability was evaluated. Next, negative dominants of PI3K and IkappaB-alpha, designed to block the PI3K/Akt and NF-kappaB pathways, respectively, were transfected and selection and evaluation of several clones overexpressing the mutants were examined. Also, correlation with inhibitor of apoptosis proteins (IAPs) expression was examined. Independent inhibition of these two pathways allowed us to test their participation in Dex-dependent protection against TNF-alpha-cytotoxicity in MCF-7 cells. Expression of the PI3K dominant negative mutant did not alter the protection conferred by Dex against TNF-alpha mediated cell death. Contrariwise, clones expressing the IkappaB-alpha dominant negative mutant lost the Dex-conferred protection against TNF-alpha. In these clones degradation of c-IAP was accelerated, while that of XIAP was remained unaffected. NF-kappaB, but not PI3K/Akt activation, is required for the Dex protective effect against TNF-alpha-mediated cell death, and correlates with lack of degradation of the anti-apoptotic protein c-IAP1.
Li, Yan; Chen, Xi; Fan, Chunlin; Pang, Guofang
2012-11-30
A gas chromatography-mass spectrometry (GC-MS) analytical method was developed for simultaneously determining 186 pesticides in tea matrices using analyte protectants to counteract the matrix-induced effect. The matrix effects were evaluated for green, oolong and black tea, representing unfermented, partially fermented and completely fermented teas respectively and depending on the type of tea, 72%, 94% and 94% of the pesticides presented strong response enhancement effect. Several analyte protectants as well as certain combinations of these protectants were evaluated to check their compensation effects. A mixture of triglycerol and d-ribonic acid-γ-lactone (both at 2mg/mL in the injected samples) was found to be the most effective in improving the chromatographic behavior of the 186 pesticides. More than 96% of the 186 pesticides achieved recoveries within the range of 70-120% when using the selected mixture of analyte protectants. The simple addition of analyte protectants offers a more convenient solution to overcome matrix effects, results in less active sites compared to matrix-matched standardization and can be an effective approach to compensate for matrix effects in the GC-MS analysis of pesticide residues. Copyright © 2012 Elsevier B.V. All rights reserved.
Hedayati, Nasim; Annambhotla, Suman; Jiang, Jun; Wang, Xinwen; Chai, Hong; Lin, Peter H.; Yao, Qizhi; Chen, Changyi
2009-01-01
Objective Ghrelin, a novel growth-hormone releasing peptide, is implicated to play a protective role in cardiovascular tissues. However, it is not clear whether ghrelin protects vascular tissues from injury secondary to risk factors such as homocysteine (Hcy). The purpose of this study was to investigate the effect and potential mechanisms of ghrelin on Hcy-induced endothelial dysfunction. Methods Porcine coronary artery rings were incubated for 24 hours with ghrelin (100 ng/mL), Hcy (50 μM), or ghrelin plus Hcy. Endothelial vasomotor function was evaluated using the myograph tension model. The response to thromboxane A2 analog U466419, bradykinin, and sodium nitroprusside (SNP) was analyzed. Endothelial nitric oxide synthase (eNOS) expression was determined using real time PCR and immunohistochemistry staining, and superoxide anion production by lucigenin-enhanced chemiluminescence analysis. Human coronary artery endothelial cells (HCAECs) were treated with different concentrations of Hcy, ghrelin, and/or anti-ghrelin receptor (GHS-R1a) antibody for 24 hours, eNOS protein levels were determined by western blot analysis. Results Maximal contraction with U466419 and endothelium-independent vasorelaxation with SNP were not different among the four groups. However, endothelium-dependent vasorelaxation with bradykinin (10-6M) was significantly reduced by 34% with Hcy compared with controls (P<0.05). Addition of ghrelin to Hcy had a protective effect, with 61.6% relaxation, similar to controls (64.7%). Hcy significantly reduced eNOS expression, while ghrelin co-treatment effectively restored eNOS expression to the control levels. Superoxide anion levels, which were increased by 100% with Hcy, returned to control levels with ghrelin co-treatment. Ghrelin also effectively blocked Hcy-induced decrease of eNOS protein levels in HCAECs in a concentration dependent manner. Anti-ghrelin receptor antibody effectively inhibited ghrelin’s effect. Conclusions Ghrelin has a protective effect in the porcine coronary artery by blocking Hcy-induced endothelial dysfunction, improving eNOS expression, and reducing oxidative stress. Ghrelin also shows protective effect on HCACEs from Hcy-induced decrease in eNOS protein levels. Ghrelin’s effect is receptor-dependent. Thus, ghrelin administration may have beneficial effects in the treatment of vascular disease in hyperhomocysteinemic patients. PMID:19028051
The Neurobiology of Opioid Dependence: Implications for Treatment
Kosten, Thomas R.; George, Tony P.
2002-01-01
Opioid tolerance, dependence, and addiction are all manifestations of brain changes resulting from chronic opioid abuse. The opioid abuser’s struggle for recovery is in great part a struggle to overcome the effects of these changes. Medications such as methadone, LAAM, buprenorphine, and naltrexone act on the same brain structures and processes as addictive opioids, but with protective or normalizing effects. Despite the effectiveness of medications, they must be used in conjunction with appropriate psychosocial treatments. PMID:18567959
Liver protective effects of Morinda citrifolia (Noni).
Wang, Mian-Ying; Nowicki, Diane; Anderson, Gary; Jensen, Jarakae; West, Brett
2008-06-01
This study evaluated the protective effects of Noni fruit juice on acute liver injury induced by carbon tetrachloride (CCl(4)) in female Sprague-Dawley (SD) rats. Liver damage (micro-centrilobular necrosis) was observed in animals pretreated with 20% placebo (drinking water) + CCl(4). However, pretreatment with 20% Noni juice in drinking water + CCl(4) resulted in markedly decreased hepatotoxic lesions. Furthermore, serum alanine aminotransferase and aspartate aminotransferase levels were significantly lower in the Noni group than the placebo group. In a correlative time-dependent study, one dose of CCl(4) (0.25 mL/kg in corn oil, p.o.) in female SD rats, pretreated with 10% placebo for 12 days, caused sequential progressive hepatotoxic lesions over a 24 h period, while a protective effect from 10% Noni juice pretreatment was observed. These results suggest that Noni juice is effective in protecting the liver from extrinsic toxin exposure.
Liver Protective Effects of Morinda citrifolia (Noni)
Nowicki, Diane; Anderson, Gary; Jensen, Jarakae; West, Brett
2008-01-01
This study evaluated the protective effects of Noni fruit juice on acute liver injury induced by carbon tetrachloride (CCl4) in female Sprague-Dawley (SD) rats. Liver damage (micro-centrilobular necrosis) was observed in animals pretreated with 20% placebo (drinking water) + CCl4. However, pretreatment with 20% Noni juice in drinking water + CCl4 resulted in markedly decreased hepatotoxic lesions. Furthermore, serum alanine aminotransferase and aspartate aminotransferase levels were significantly lower in the Noni group than the placebo group. In a correlative time-dependent study, one dose of CCl4 (0.25 mL/kg in corn oil, p.o.) in female SD rats, pretreated with 10% placebo for 12 days, caused sequential progressive hepatotoxic lesions over a 24 h period, while a protective effect from 10% Noni juice pretreatment was observed. These results suggest that Noni juice is effective in protecting the liver from extrinsic toxin exposure. PMID:18317933
Ferraro, Paul J; Pressey, Robert L
2015-11-05
Success in conservation depends on our ability to reduce human pressures in areas that harbour biological diversity and ecosystem services. Legally protecting some of these areas through the creation of protected areas is a key component of conservation efforts globally. To develop effective protected area networks, practitioners need credible, scientific evidence about the degree to which protected areas affect environmental and social outcomes, and how these effects vary with context. Such evidence has been lacking, but the situation is changing as conservation scientists adopt more sophisticated research designs for evaluating protected areas' past impacts and for predicting their future impacts. Complementing these scientific advances, conservation funders and practitioners are paying increasing attention to evaluating their investments with more scientifically rigorous evaluation designs. This theme issue highlights recent advances in the science of protected area evaluations and explores the challenges to developing a more credible evidence base that can help societies achieve their goals of protecting nature while enhancing human welfare. © 2015 The Author(s).
Ferraro, Paul J.; Pressey, Robert L.
2015-01-01
Success in conservation depends on our ability to reduce human pressures in areas that harbour biological diversity and ecosystem services. Legally protecting some of these areas through the creation of protected areas is a key component of conservation efforts globally. To develop effective protected area networks, practitioners need credible, scientific evidence about the degree to which protected areas affect environmental and social outcomes, and how these effects vary with context. Such evidence has been lacking, but the situation is changing as conservation scientists adopt more sophisticated research designs for evaluating protected areas' past impacts and for predicting their future impacts. Complementing these scientific advances, conservation funders and practitioners are paying increasing attention to evaluating their investments with more scientifically rigorous evaluation designs. This theme issue highlights recent advances in the science of protected area evaluations and explores the challenges to developing a more credible evidence base that can help societies achieve their goals of protecting nature while enhancing human welfare. PMID:26460123
Gedan, Keryn B.; Kirwan, Matthew L.; Wolanski, Eric; Barbier, Edward B.; Silliman, Brian R.
2011-01-01
For more than a century, coastal wetlands have been recognized for their ability to stabilize shorelines and protect coastal communities. However, this paradigm has recently been called into question by small-scale experimental evidence. Here, we conduct a literature review and a small meta-analysis of wave attenuation data, and we find overwhelming evidence in support of established theory. Our review suggests that mangrove and salt marsh vegetation afford context-dependent protection from erosion, storm surge, and potentially small tsunami waves. In biophysical models, field tests, and natural experiments, the presence of wetlands reduces wave heights, property damage, and human deaths. Meta-analysis of wave attenuation by vegetated and unvegetated wetland sites highlights the critical role of vegetation in attenuating waves. Although we find coastal wetland vegetation to be an effective shoreline buffer, wetlands cannot protect shorelines in all locations or scenarios; indeed large-scale regional erosion, river meandering, and large tsunami waves and storm surges can overwhelm the attenuation effect of vegetation. However, due to a nonlinear relationship between wave attenuation and wetland size, even small wetlands afford substantial protection from waves. Combining man-made structures with wetlands in ways that mimic nature is likely to increase coastal protection. Oyster domes, for example, can be used in combination with natural wetlands to protect shorelines and restore critical fishery habitat. Finally, coastal wetland vegetation modifies shorelines in ways (e.g. peat accretion) that increase shoreline integrity over long timescales and thus provides a lasting coastal adaptation measure that can protect shorelines against accelerated sea level rise and more frequent storm inundation. We conclude that the shoreline protection paradigm still stands, but that gaps remain in our knowledge about the mechanistic and context-dependent aspects of shoreline protection.
The US Environmental Protection Agency is a regulatory agency of the federal government whose mission it is to protect human health and to safeguard the natural environment -- air, water, land -- upon which life depends. The EPA has several Program and Regional Offices that for...
Okai, Y; Higashi-Okai, K; Yano, Y; Otani, S
1996-08-01
The potentially protective role of chlorophyllin, the sodium and copper salt of chlorophyll a against the initiation and promotion stages in carcinogenesis was studied by in vitro short-term assays. Chlorophyllin showed a dose-dependent suppressive effect on 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indol (Trp-P-1)-induced umu C gene expression of Salmonella typhimurium (TA 1535/pSK 1002) in the presence of metabolizing enzyme mixture. The similar inhibitory effect of chlorophyllin was detected in mitomycin C (MMC)-dependent umu C gene expression in the absence of metabolizing enzyme mixture. Furthermore chlorophyllin also exhibited a dose-dependent inhibition on 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced ornithine decarboxylase (ODC) activity of 3T3 fibroblast cells at the same concentrations. However, when chlorophyll a isolated from Japanese tea leaves was applied on the same assay systems as a comparative experiment, chlorophyll a showed much weaker activity compared with that of chlorophyllin. The significance of this finding is discussed from the viewpoint of the protective role of chlorophyllin against carcinogenesis.
Sen, Abhik; Alkon, Daniel L.; Nelson, Thomas J.
2012-01-01
Synaptic loss is the earliest pathological change in Alzheimer disease (AD) and is the pathological change most directly correlated with the degree of dementia. ApoE4 is the major genetic risk factor for the age-dependent form of AD, which accounts for 95% of cases. Here we show that in synaptic networks formed from primary hippocampal neurons in culture, apoE3, but not apoE4, prevents the loss of synaptic networks produced by amyloid β oligomers (amylospheroids). Specific activators of PKCϵ, such as 8-(2-(2-pentyl-cyclopropylmethyl)-cyclopropyl)-octanoic acid methyl ester and bryostatin 1, protected against synaptic loss by amylospheroids, whereas PKCϵ inhibitors blocked this synaptic protection and also blocked the protection by apoE3. Blocking LRP1, an apoE receptor on the neuronal membrane, also blocked the protection by apoE. ApoE3, but not apoE4, induced the synthesis of PKCϵ mRNA and expression of the PKCϵ protein. Amyloid β specifically blocked the expression of PKCϵ but had no effect on other isoforms. These results suggest that protection against synaptic loss by apoE is mediated by a novel intracellular PKCϵ pathway. This apoE pathway may account for much of the protective effect of apoE and reduced risk for the age-dependent form of AD. This finding supports the potential efficacy of newly developed therapeutics for AD. PMID:22427674
Chen, Frederick; Griffith, Amanda; Cottrell, Allin; Wong, Yue-Ling
2013-01-01
We report the results of a study we conducted using a simple multiplayer online game that simulates the spread of an infectious disease through a population composed of the players. We use our virtual epidemics game to examine how people respond to epidemics. The analysis shows that people's behavior is responsive to the cost of self-protection, the reported prevalence of disease, and their experiences earlier in the epidemic. Specifically, decreasing the cost of self-protection increases the rate of safe behavior. Higher reported prevalence also raises the likelihood that individuals would engage in self-protection, where the magnitude of this effect depends on how much time has elapsed in the epidemic. Individuals' experiences in terms of how often an infection was acquired when they did not engage in self-protection are another factor that determines whether they will invest in preventive measures later on. All else being equal, individuals who were infected at a higher rate are more likely to engage in self-protective behavior compared to those with a lower rate of infection. Lastly, fixing everything else, people's willingness to engage in safe behavior waxes or wanes over time, depending on the severity of an epidemic: when prevalence is high, people are more likely to adopt self-protective measures as time goes by; when prevalence is low, a ‘self-protection fatigue’ effect sets in whereby individuals are less willing to engage in safe behavior over time. PMID:23326360
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takahashi, Kyoko; Department of Nephrology Internal Medicine, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, 390-8621; Kamijo, Yuji, E-mail: yujibeat@shinshu-u.ac.jp
2011-05-01
Development of a preventive strategy against tubular damage associated with proteinuria is of great importance. Recently, free fatty acid (FFA) toxicities accompanying proteinuria were found to be a main cause of tubular damage, which was aggravated by insufficiency of peroxisome proliferator-activated receptor alpha (PPAR{alpha}), suggesting the benefit of PPAR{alpha} activation. However, an earlier study using a murine acute tubular injury model, FFA-overload nephropathy, demonstrated that high-dose treatment of PPAR{alpha} agonist (0.5% clofibrate diet) aggravated the tubular damage as a consequence of excess serum accumulation of clofibrate metabolites due to decreased kidney elimination. To induce the renoprotective effects of PPAR{alpha} agonistsmore » without drug accumulation, we tried a pretreatment study using low-dose clofibrate (0.1% clofibrate diet) using the same murine model. Low-dose clofibrate pretreatment prevented acute tubular injuries without accumulation of its metabolites. The tubular protective effects appeared to be associated with the counteraction of PPAR{alpha} deterioration, resulting in the decrease of FFAs influx to the kidney, maintenance of fatty acid oxidation, diminution of intracellular accumulation of undigested FFAs, and attenuation of disease developmental factors including oxidative stress, apoptosis, and NF{kappa}B activation. These effects are common to other fibrates and dependent on PPAR{alpha} function. Interestingly, however, clofibrate pretreatment also exerted PPAR{alpha}-independent tubular toxicities in PPAR{alpha}-null mice with FFA-overload nephropathy. The favorable properties of fibrates are evident when PPAR{alpha}-dependent tubular protective effects outweigh their PPAR{alpha}-independent tubular toxicities. This delicate balance seems to be easily affected by the drug dose. It will be important to establish the appropriate dosage of fibrates for treatment against kidney disease and to develop a novel PPAR{alpha} activator that has a steady serum concentration regardless of kidney dysfunction. - Graphical Abstract: Massive proteinuria introduces free fatty acid toxicity to proximal tubular epithelial cells (PTECs). PPAR{alpha} activationvia clofibrate pretreatment maintains fatty acid catabolism and attenuates oxidative stress, apoptosis, and NF{kappa}B activation, resulting in protection of PTECs. The favorable properties of fibrates are evident when PPAR{alpha}-dependent tubular protective effects outweigh their PPAR{alpha}-independent tubular toxicities. Display Omitted Highlights: > Clofibrate pretreatment protects against acute FFA-induced tubular toxicity. > PPAR{alpha} activation decreases FFA influx and maintains fatty acid catabolism. > PPAR{alpha} activation attenuates oxidative stress, apoptosis, and NF{kappa}B activation. > Protective effects must outweigh PPAR{alpha}-independent tubular toxicities of fibrates.« less
Melatonin protects chondrocytes from impairment induced by glucocorticoids via NAD+-dependent SIRT1.
Yang, Wei; Kang, Xiaomin; Qin, Na; Li, Feng; Jin, Xinxin; Ma, Zhengmin; Qian, Zhuang; Wu, Shufang
2017-10-01
Intra-articular injection of glucocorticoids is used to relieve pain and inflammation in osteoarthritis patients, which is occasionally accompanied with the serious side effects of glucocorticoids in collagen-producing tissue. Melatonin is the major hormone released from the pineal gland and its beneficial effects on cartilage has been suggested. In the present study, we investigated the protective role of melatonin on matrix degeneration in chondrocytes induced by dexamethasone (Dex). The chondrocytes isolated from mice knee joint were treated with Dex, melatonin, EX527 and siRNA targeted for SIRT6, respectively. Dex treatment induced the loss of the extracellular matrix, NAD + /NADH ratio and NADPH concentration in chondrocytes. Melatonin alone have no effect on the quantity of proteoglycans and collagen type IIa1, however, the pretreatment of melatonin reversed the negative effects induced by Dex. Meanwhile, the significant decrease in NAD + /NADH ratio and NADPH concentration in Dex group were up-regulated by pretreatment of melatonin. Furthermore, it was revealed that inhibition of SIRT1 blocked the protective effects of melatonin. The enhancement of NAD + -dependent SIRT1 activity contributes to the chondroprotecfive effects of melatonin, which has a great benefit to prevent dexamethasone-induced chondrocytes impairment. Copyright © 2017 Elsevier Inc. All rights reserved.
PROTECTION AGAINST TYPHOID-LIKE INFECTIONS BY VACCINATION
Nichols, Henry J.; Stimmel, Clarence O.
1923-01-01
1. A natural infection of guinea pigs with the "mutton" strain of Bacillus aertrycke was used to test the protective power of vaccination against the typhoid group of infections. 2. Under the conditions of the experiment, complete protection was secured by vaccination with full strength fresh saline vaccine, while 100 per cent of deaths occurred among the controls. 3. The immunity acquired is variable and depends on the number of organisms injected. 4. Vaccine kept 10 to 14 months gave less protection than vaccine 8 months old and under. 5. Saline vaccine was more effective than lipovaccine, sensitized vaccine, or supernatant fluid vaccine. 6. Resuspended vaccine was as effective as the original vaccine. 7. In one experiment, group vaccine, made of typhoid Para A and Para B bacilli, was as effective as the original specific vaccine. PMID:19868790
Bhaskaran, Natarajan; Srivastava, Janmejai K; Shukla, Sanjeev; Gupta, Sanjay
2013-01-01
Oxidative stress plays an important role in the development of various human diseases. Aqueous chamomile extract is used as herbal medicine, in the form of tea, demonstrated to possess antiinflammatory and antioxidant properties. We demonstrate the cytoprotective effects of chamomile on hydrogen peroxide (H₂O₂)-induced cellular damage in macrophage RAW 264.7 cells. Pretreatment of cells with chamomile markedly attenuated H₂O₂-induced cell viability loss in a dose-dependent manner. The mechanisms by which chamomile-protected macrophages from oxidative stress was through the induction of several antioxidant enzymes including NAD(P)H:quinone oxidoreductase, superoxide dismutase, and catalase and increase nuclear accumulation of the transcription factor Nrf2 and its binding to antioxidant response elements. Furthermore, chamomile dose-dependently reduced H₂O₂-mediated increase in the intracellular levels of reactive oxygen species. Our results, for the first time, demonstrate that chamomile has protective effects against oxidative stress and might be beneficial to provide defense against cellular damage. Copyright © 2012 John Wiley & Sons, Ltd.
Bhaskaran, Natarajan; Srivastava, Janmejai K.; Shukla, Sanjeev; Gupta, Sanjay
2014-01-01
Oxidative stress plays an important role in the development of various human diseases. Aqueous chamomile extract is used as herbal medicine, in the form of tea, demonstrated to possess antiinflammatory and antioxidant properties. We demonstrate the cytoprotective effects of chamomile on hydrogen peroxide (H2O2)-induced cellular damage in macrophage RAW 264.7 cells. Pretreatment of cells with chamomile markedly attenuated H2O2-induced cell viability loss in a dose-dependent manner. The mechanisms by which chamomile-protected macrophages from oxidative stress was through the induction of several antioxidant enzymes including NAD (P)H:quinone oxidoreductase, superoxide dismutase, and catalase and increase nuclear accumulation of the transcription factor Nrf2 and its binding to antioxidant response elements. Furthermore, chamomile dose-dependently reduced H2O2-mediated increase in the intracellular levels of reactive oxygen species. Our results, for the first time, demonstrate that chamomile has protective effects against oxidative stress and might be beneficial to provide defense against cellular damage. PMID:22511316
Effects of ventilation strategy on distribution of lung inflammatory cell activity
2013-01-01
Introduction Leukocyte infiltration is central to the development of acute lung injury, but it is not known how mechanical ventilation strategy alters the distribution or activation of inflammatory cells. We explored how protective (vs. injurious) ventilation alters the magnitude and distribution of lung leukocyte activation following systemic endotoxin administration. Methods Anesthetized sheep received intravenous endotoxin (10 ng/kg/min) followed by 2 h of either injurious or protective mechanical ventilation (n = 6 per group). We used positron emission tomography to obtain images of regional perfusion and shunting with infused 13N[nitrogen]-saline and images of neutrophilic inflammation with 18F-fluorodeoxyglucose (18F-FDG). The Sokoloff model was used to quantify 18F-FDG uptake (Ki), as well as its components: the phosphorylation rate (k3, a surrogate of hexokinase activity) and the distribution volume of 18F-FDG (Fe) as a fraction of lung volume (Ki = Fe × k3). Regional gas fractions (fgas) were assessed by examining transmission scans. Results Before endotoxin administration, protective (vs. injurious) ventilation was associated with a higher ratio of partial pressure of oxygen in arterial blood to fraction of inspired oxygen (PaO2/FiO2) (351 ± 117 vs. 255 ± 74 mmHg; P < 0.01) and higher whole-lung fgas (0.71 ± 0.12 vs. 0.48 ± 0.08; P = 0.004), as well as, in dependent regions, lower shunt fractions. Following 2 h of endotoxemia, PaO2/FiO2 ratios decreased in both groups, but more so with injurious ventilation, which also increased the shunt fraction in dependent lung. Protective ventilation resulted in less nonaerated lung (20-fold; P < 0.01) and more normally aerated lung (14-fold; P < 0.01). Ki was lower during protective (vs. injurious) ventilation, especially in dependent lung regions (0.0075 ± 0.0043/min vs. 0.0157 ± 0.0072/min; P < 0.01). 18F-FDG phosphorylation rate (k3) was twofold higher with injurious ventilation and accounted for most of the between-group difference in Ki. Dependent regions of the protective ventilation group exhibited lower k3 values per neutrophil than those in the injurious ventilation group (P = 0.01). In contrast, Fe was not affected by ventilation strategy (P = 0.52). Lung neutrophil counts were not different between groups, even when regional inflation was accounted for. Conclusions During systemic endotoxemia, protective ventilation may reduce the magnitude and heterogeneity of pulmonary inflammatory cell metabolic activity in early lung injury and may improve gas exchange through its effects predominantly in dependent lung regions. Such effects are likely related to a reduction in the metabolic activity, but not in the number, of lung-infiltrating neutrophils. PMID:23947920
Park, Sun Haeng; Kim, Ji Hyun; Park, Se Jin; Bae, Sun Sik; Choi, Young Whan; Hong, Jin Woo; Choi, Byung Tae; Shin, Hwa Kyoung
2011-12-08
Uncaria sinensis (US) has been used in traditional Korean medicine to treat vascular disease and to relieve various neurological symptoms. Scientific evidence related to the effectiveness or action mechanism of US on cerebrovascular disease has not been examined experimentally. Here, we investigated the cerebrovascular protective effect of US extracts on photothrombotic ischemic injury in mice. US hexane extracts (HEUS), ethyl acetate extracts (EAEUS) and methanol extracts (MEUS) were administered intraperitoneally 30 min before ischemic insults. Focal cerebral ischemia was induced in C57BL/6J mice and endothelial nitric oxide synthase knockout (eNOS KO) mice by photothrombotic cortical occlusion. We evaluated the infarct volume, neurological score and the activation of Akt and eNOS in ischemic brain. HEUS more significantly reduced infarct volume and edema than did EAEUS and MEUS following photothrombotic cortical occlusion. HEUS produced decreased infarct volume and edema size, and improved neurological function in a concentration-dependent manner (10, 50, and 100 mg/kg). However, HEUS did not reduce brain infarction in eNOS KO mice, suggesting that the protective effect of HEUS is primarily endothelium-dependent. Furthermore, HEUS (10-300 μg/ml) produced a concentration-dependent relaxation in mouse aorta and rat basilar artery, which was not seen in eNOS KO mouse aorta, suggesting that HEUS cause vasodilation via an eNOS-dependent mechanism. This correlated with increased phosphorylation of Akt and eNOS in the brains of HEUS-treated mice. HEUS prevent cerebral ischemic damage by regulating Akt/eNOS signaling. US, herbal medicine, may be the basis of a novel strategy for the therapy of stroke. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Mertins, Omar; Mathews, Patrick D; Gomide, Andreza B; Baptista, Mauricio S; Itri, Rosangela
2015-10-01
We have prepared a chitosan polymer modified with gallic acid in order to develop an efficient protection strategy biological membranes against photodamage. Lipid bilayers were challenged with photoinduced damage by photosensitization with methylene blue, which usually causes formation of hydroperoxides, increasing area per lipid, and afterwards allowing leakage of internal materials. The damage was delayed by a solution of gallic acid in a concentration dependent manner, but further suppressed by the polymer at very low concentrations. The membrane of giant unilamellar vesicles was covered with this modified macromolecule leading to a powerful shield against singlet oxygen and thus effectively protecting the lipid membrane from oxidative stress. The results have proven the discovery of a promising strategy for photo protection of biological membranes. Copyright © 2015 Elsevier B.V. All rights reserved.
Developing Appreciation for Sarcasm and Sarcastic Gossip: It Depends on Perspective
ERIC Educational Resources Information Center
Glenwright, Melanie; Tapley, Brent; Rano, Jacqueline K. S.; Pexman, Penny M.
2017-01-01
Background: Speakers use sarcasm to criticize others and to be funny; the indirectness of sarcasm protects the addressee's face (Brown & Levinson, 1987). Thus, appreciation of sarcasm depends on the ability to consider perspectives. Purpose: We investigated development of this ability from late childhood into adulthood and examined effects of…
Domestic Violence Screening and Service Acceptance among Adult Victims in a Dependency Court Setting
ERIC Educational Resources Information Center
Rivers, James E.; Maze, Candice L.; Hannah, Stefanie A.; Lederman, Cindy S.
2007-01-01
Many child welfare systems are unable to effectively identify and address co-occurring domestic violence and child maltreatment. In response, the Dependency Court Intervention Program for Family Violence implemented a protocol to identify indicators of domestic violence in families involved with child protection proceedings. This article…
Minois, N; Carmona-Gutierrez, D; Bauer, M A; Rockenfeller, P; Eisenberg, T; Brandhorst, S; Sigrist, S J; Kroemer, G; Madeo, F
2012-10-11
The naturally occurring polyamine spermidine (Spd) has recently been shown to promote longevity across species in an autophagy-dependent manner. Here, we demonstrate that Spd improves both survival and locomotor activity of the fruit fly Drosophila melanogaster upon exposure to the superoxide generator and neurotoxic agent paraquat. Although survival to a high paraquat concentration (20 mM) was specifically increased in female flies only, locomotor activity and survival could be rescued in both male and female animals when exposed to lower paraquat levels (5 mM). These effects are dependent on the autophagic machinery, as Spd failed to confer resistance to paraquat-induced toxicity and locomotor impairment in flies deleted for the essential autophagic regulator ATG7 (autophagy-related gene 7). Spd treatment did also protect against mild doses of another oxidative stressor, hydrogen peroxide, but in this case in an autophagy-independent manner. Altogether, this study establishes that the protective effects of Spd can be exerted through different pathways that depending on the oxidative stress scenario do or do not involve autophagy.
Nolte, Christoph; Agrawal, Arun; Silvius, Kirsten M; Soares-Filho, Britaldo S
2013-03-26
Protected areas in tropical countries are managed under different governance regimes, the relative effectiveness of which in avoiding deforestation has been the subject of recent debates. Participants in these debates answer appeals for more strict protection with the argument that sustainable use areas and indigenous lands can balance deforestation pressures by leveraging local support to create and enforce protective regulations. Which protection strategy is more effective can also depend on (i) the level of deforestation pressures to which an area is exposed and (ii) the intensity of government enforcement. We examine this relationship empirically, using data from 292 protected areas in the Brazilian Amazon. We show that, for any given level of deforestation pressure, strictly protected areas consistently avoided more deforestation than sustainable use areas. Indigenous lands were particularly effective at avoiding deforestation in locations with high deforestation pressure. Findings were stable across two time periods featuring major shifts in the intensity of government enforcement. We also observed shifting trends in the location of protected areas, documenting that between 2000 and 2005 strictly protected areas were more likely to be established in high-pressure locations than in sustainable use areas and indigenous lands. Our findings confirm that all protection regimes helped reduce deforestation in the Brazilian Amazon.
Nolte, Christoph; Agrawal, Arun; Silvius, Kirsten M.; Soares-Filho, Britaldo S.
2013-01-01
Protected areas in tropical countries are managed under different governance regimes, the relative effectiveness of which in avoiding deforestation has been the subject of recent debates. Participants in these debates answer appeals for more strict protection with the argument that sustainable use areas and indigenous lands can balance deforestation pressures by leveraging local support to create and enforce protective regulations. Which protection strategy is more effective can also depend on (i) the level of deforestation pressures to which an area is exposed and (ii) the intensity of government enforcement. We examine this relationship empirically, using data from 292 protected areas in the Brazilian Amazon. We show that, for any given level of deforestation pressure, strictly protected areas consistently avoided more deforestation than sustainable use areas. Indigenous lands were particularly effective at avoiding deforestation in locations with high deforestation pressure. Findings were stable across two time periods featuring major shifts in the intensity of government enforcement. We also observed shifting trends in the location of protected areas, documenting that between 2000 and 2005 strictly protected areas were more likely to be established in high-pressure locations than in sustainable use areas and indigenous lands. Our findings confirm that all protection regimes helped reduce deforestation in the Brazilian Amazon. PMID:23479648
Kim, Ji Hoon; Kim, Young Hak; Chung, Won-Sang; Suh, Jung Kook; Kim, Sung Jin
2013-01-01
Background Reactive oxygen species (ROS) are known to be related to cardiovascular diseases. Many studies have demonstrated that angiotensin-converting enzyme inhibitors have beneficial effects against ROS. We investigated the antioxidant effect of captopril and enalapril in nitric oxide mediated vascular endothelium-dependent relaxations. Materials and Methods Isolated rabbit abdominal aorta ring segments were exposed to ROS by electrolysis of the organ bath medium (Krebs-Henseleit solution) after pretreatment with various concentrations (range, 10-5 to 3×10-4 M) of captopril and enalapril. Before and after electrolysis, the endothelial function was measured by preconstricting the vessels with norepinephrine (10-6 M) followed by the cumulative addition of acetylcholine (range, 3×10-8 to 10-6 M). The relevance of the superoxide anion and hydrogen peroxide scavenging effect of captopril and enalapril was investigated using additional pretreatments of diethyldithiocarbamate (DETCA, 0.5 mM), an inhibitor of Cu/Zn superoxide dismutase, and 3-amino-1,2,4-triazole (3AT, 50 mM), an inhibitor of catalase. Results Both captopril and enalapril preserved vascular endothelium-dependent relaxation after exposure to ROS in a dose-dependent manner (p<0.0001). Pretreatment with DETCA attenuated the antioxidant effect of captopril and enalapril (p<0.0001), but pretreatment with 3AT did not have an effect. Conclusion Both captopril and enalapril protect endothelium against ROS in a dose-dependent fashion in isolated rabbit abdominal aortas. This protective effect is related to superoxide anion scavenging. PMID:23422724
Inflammatory Effects of the Plant Protection Product Stifenia (FEN560) on Vertebrates.
Teyssier, Lény; Colussi, Julie; Delemasure, Stéphanie; Chluba, Johanna; Wendehenne, David; Lamotte, Olivier; Connat, Jean-Louis
2017-01-01
Plant defense stimulators (PDSs) rely on the activation of plant innate immunity in order to protect crops against various pests. These molecules are thought to be a safer alternative to classical plant protection products. Given that innate immune systems share common features in plants and vertebrates, PDS can potentially cross-react with innate immunity of non-target organisms. To test this hypothesis, we studied effects of the commercial PDS Stifenia (FEN560), which is composed of crushed fenugreek seeds. We tested various concentrations of Stifenia (0.03-1 mg mL -1 ) on human peripheral blood mononuclear cells and checked, 20 h later, cell metabolic activity (MA) using XTT assay, cell death by flow cytometry analysis, and IL-1β inflammatory cytokine released in the culture medium using ELISA. Stifenia induced a general decrease of the cell MA, which was concomitant with a dose-dependent release of IL-1β. Our results highlight the activation of human immune cells. The inflammatory effect of Stifenia was partially inhibited by pan-caspase inhibitor. Accordingly, Stifenia induced the release of p20 caspase-1 fragment into the culture medium suggesting the involvement of the NLRP3 inflammasome. Furthermore, we observed that Stifenia can induce cell death. We also tested the effect of Stifenia on Zebrafish larvae. After 24 h of exposure, Stifenia induced a dose-dependent IL-1β and TNFα gene expression. The human-cell-based approach developed in this work revealed a high sensitivity concerning inflammatory properties of a plant protection product. These tests could be routinely used to screen the potential adverse effects of this type of compounds. Finally, our results suggest a potential danger of using extensively certain PDS for crop protection.
Inflammatory Effects of the Plant Protection Product Stifenia (FEN560) on Vertebrates
Teyssier, Lény; Colussi, Julie; Delemasure, Stéphanie; Chluba, Johanna; Wendehenne, David; Lamotte, Olivier; Connat, Jean-Louis
2017-01-01
Plant defense stimulators (PDSs) rely on the activation of plant innate immunity in order to protect crops against various pests. These molecules are thought to be a safer alternative to classical plant protection products. Given that innate immune systems share common features in plants and vertebrates, PDS can potentially cross-react with innate immunity of non-target organisms. To test this hypothesis, we studied effects of the commercial PDS Stifenia (FEN560), which is composed of crushed fenugreek seeds. We tested various concentrations of Stifenia (0.03–1 mg mL−1) on human peripheral blood mononuclear cells and checked, 20 h later, cell metabolic activity (MA) using XTT assay, cell death by flow cytometry analysis, and IL-1β inflammatory cytokine released in the culture medium using ELISA. Stifenia induced a general decrease of the cell MA, which was concomitant with a dose-dependent release of IL-1β. Our results highlight the activation of human immune cells. The inflammatory effect of Stifenia was partially inhibited by pan-caspase inhibitor. Accordingly, Stifenia induced the release of p20 caspase-1 fragment into the culture medium suggesting the involvement of the NLRP3 inflammasome. Furthermore, we observed that Stifenia can induce cell death. We also tested the effect of Stifenia on Zebrafish larvae. After 24 h of exposure, Stifenia induced a dose-dependent IL-1β and TNFα gene expression. The human-cell-based approach developed in this work revealed a high sensitivity concerning inflammatory properties of a plant protection product. These tests could be routinely used to screen the potential adverse effects of this type of compounds. Finally, our results suggest a potential danger of using extensively certain PDS for crop protection. PMID:28484691
Fisetin Protects DNA Against Oxidative Damage and Its Possible Mechanism
Wang, Tingting; Lin, Huajuan; Tu, Qian; Liu, Jingjing; Li, Xican
2016-01-01
Purpose: The paper tries to assess the protective effect of fisetin against •OH-induced DNA damage, then to investigate the possible mechanism. Methods: The protective effect was evaluated based on the content of malondialdehyde (MDA). The possible mechanism was analyzed using various antioxidant methods in vitro, including •OH scavenging (deoxyribose degradation), •O2- scavenging (pyrogallol autoxidation), DPPH• scavenging, ABTS•+ scavenging, and Cu2+-reducing power assays. Results: Fisetin increased dose-dependently its protective percentages against •OH-induced DNA damage (IC50 value =1535.00±29.60 µM). It also increased its radical-scavenging percentages in a dose-dependent manner in various antioxidants assays. Its IC50 values in •OH scavenging, •O2- scavenging, DPPH• scavenging, ABTS•+ scavenging, and Cu2+-reducing power assays, were 47.41±4.50 µM, 34.05±0.87 µM, 9.69±0.53 µM, 2.43±0.14 µM, and 1.49±0.16 µM, respectively. Conclusion: Fisetin can effectively protect DNA against •OH-induced oxidative damage possibly via reactive oxygen species (ROS) scavenging approach, which is assumed to be hydrogen atom (H•) and/or single electron (e) donation (HAT/SET) pathways. In the HAT pathway, the 3’,4’-dihydroxyl moiety in B ring of fisetin is thought to play an important role, because it can be ultimately oxidized to a stable ortho-benzoquinone form. PMID:27478791
Hunt, Pamela S
2012-08-01
Supplemental choline during early stages of development can result in long-lasting improvements to memory function. In addition, pre- or postnatal choline has been shown to be protective against some of the adverse effects of early alcohol exposure. The present experiment examined whether supplemental choline given to rats would protect against the effects of posttraining alcohol administration on trace fear conditioning. Posttraining alcohol exposure in adolescent rats results in poor performance in this hippocampus-dependent task, although delay conditioning is unaffected. Here, rats were given an s.c. injection of either saline or choline chloride daily on postnatal days (PD) 15-26. On PD 30 subjects were trained in a trace fear conditioning procedure. For the next 3 days animals were administered 2.5 g/kg ethanol or water control, and conditional stimulus (CS)-elicited freezing was measured on PD 34. Results indicated that posttraining alcohol disrupted the expression of trace conditioning and that supplemental choline on PD 15-26 was protective against this effect. That is, choline-treated animals subsequently given posttraining ethanol performed as well as animals not given ethanol. These results indicate that supplemental choline given during the periweaning period protects against ethanol-induced impairments in a hippocampus-dependent learning task. Findings contribute to the growing literature showing improvements in learning and memory in subjects given extra dietary choline during critical periods of brain development.
Hunt, Pamela S.
2012-01-01
Supplemental choline during early stages of development can result in long-lasting improvements to memory function. In addition, pre- or postnatal choline has been shown to be protective against some of the adverse effects of early alcohol exposure. The present experiment examined whether supplemental choline given to rats would protect against the effects of post-training alcohol administration on trace fear conditioning. Post-training alcohol exposure in adolescent rats results in poor performance in this hippocampus-dependent task, although delay conditioning is unaffected. Here, rats were given an s.c. injection of either saline or choline chloride daily on postnatal days (PD) 15-26. On PD 30 subjects were trained in a trace fear conditioning procedure. For the next three days animals were administered 2.5 g/kg ethanol or water control, and CS-elicited freezing was measured on PD 34. Results indicated that post-training alcohol disrupted the expression of trace conditioning and that supplemental choline on PD 15-26 was protective against this effect. That is, choline-treated animals subsequently given post-training ethanol performed as well as animals not given ethanol. These results indicate that supplemental choline given during the periweaning period protects against ethanol-induced impairments in a hippocampus-dependent learning task. Findings contribute to the growing literature showing improvements in learning and memory in subjects given extra dietary choline during critical periods of brain development. PMID:22687150
Immortal time bias in observational studies of time-to-event outcomes.
Jones, Mark; Fowler, Robert
2016-12-01
The purpose of the study is to show, through simulation and example, the magnitude and direction of immortal time bias when an inappropriate analysis is used. We compare 4 methods of analysis for observational studies of time-to-event outcomes: logistic regression, standard Cox model, landmark analysis, and time-dependent Cox model using an example data set of patients critically ill with influenza and a simulation study. For the example data set, logistic regression, standard Cox model, and landmark analysis all showed some evidence that treatment with oseltamivir provides protection from mortality in patients critically ill with influenza. However, when the time-dependent nature of treatment exposure is taken account of using a time-dependent Cox model, there is no longer evidence of a protective effect of treatment. The simulation study showed that, under various scenarios, the time-dependent Cox model consistently provides unbiased treatment effect estimates, whereas standard Cox model leads to bias in favor of treatment. Logistic regression and landmark analysis may also lead to bias. To minimize the risk of immortal time bias in observational studies of survival outcomes, we strongly suggest time-dependent exposures be included as time-dependent variables in hazard-based analyses. Copyright © 2016 Elsevier Inc. All rights reserved.
The Beach--A Natural Protection from the Sea.
ERIC Educational Resources Information Center
Sensabaugh, William M.
1983-01-01
The beach and sand dunes are the first line of defense protecting the land from the sea. The effectiveness of the beach is caused by its sloping surface which dissipates the energy of waves and by the flexibility of the slope which changes as the waves change. The process and rate of accretion and erosion are dependent on the size and frequency of…
Bogren, Lori K; Drew, Kelly L
2014-01-01
Hibernating mammals are resistant to injury following cardiac arrest. The basis of this protection has been proposed to be due to their ability to lower body temperature or metabolic rate in a seasonally-dependent manner. However, recent studies have shown that neither reduced body temperature nor hibernation season are components this protection.
Li, Chunxiao; Wang, Yu; Li, Yan; Yu, Qing; Jin, Xi; Wang, Xiao; Jia, Anna; Hu, Ying; Han, Linian; Wang, Jian; Yang, Hui; Yan, Dapeng; Bi, Yujing; Liu, Guangwei
2018-02-26
Macrophages are important innate immune defense system cells in the fight against bacterial and fungal pathogenic infections. They exhibit significant plasticity, particularly with their ability to undergo functional differentiation. Additionally, HIF1α is critically involved in the functional differentiation of macrophages during inflammation. However, the role of macrophage HIF1α in protecting against different pathogenic infections remains unclear. In this study, we investigated and compared the roles of HIF1α in different macrophage functional effects of bacterial and fungal infections in vitro and in vivo. We found that bacterial and fungal infections produced similar effects on macrophage functional differentiation. HIF1α deficiency inhibited pro-inflammatory macrophage functional activities when cells were stimulated with LPS or curdlan in vitro or when mice were infected with L. monocytogenes or C. albicans in vivo, thus decreasing pro-inflammatory TNFα and IL-6 secretion associated with pathogenic microorganism survival. Alteration of glycolytic pathway activation was required for the functional differentiation of pro-inflammatory macrophages in protecting against bacterial and fungal infections. Thus, the HIF1α-dependent glycolytic pathway is essential for pro-inflammatory macrophage functional differentiation in protecting against bacterial and fungal infections.
Xu, Kui; Di Luca, Daniel Garbin; Orrú, Marco; Xu, Yuehang; Chen, Jiang-Fan; Schwarzschild, Michael A.
2016-01-01
Considerable epidemiological and laboratory data have suggested that caffeine, a nonselective adenosine receptor antagonist, may protect against the underlying neurodegeneration of Parkinson’s disease (PD). Although both caffeine and more specific antagonists of the A2A subtype of adenosine receptor (A2AR) have been found to confer protection in animal models of PD, the dependence of caffeine’s neuroprotective effects on the A2AR is not known. To definitively determine its A2AR dependence, the effect of caffeine on MPTP neurotoxicity was compared in wild-type (WT) and A2AR gene global knockout (A2A KO) mice, as well as in CNS cell type-specific (conditional) A2AR knockout (cKO) mice that lack the receptor either in postnatal forebrain neurons or in astrocytes. In WT and in heterozygous A2AR KO mice caffeine pretreatment (25 mg/kg ip) significantly attenuated MPTP-induced depletion of striatal dopamine. By contrast in homozygous A2AR global KO mice caffeine had no effect on MPTP toxicity. In forebrain neuron A2AR cKO mice, caffeine lost its locomotor stimulant effect, whereas its neuroprotective effect was mostly preserved. In astrocytic A2AR cKO mice, both caffeine’s locomotor stimulant and protective properties were undiminished. Taken together, these results indicate that neuroprotection by caffeine in the MPTP model of PD relies on the A2AR, although the specific cellular localization of these receptors remains to be determined. PMID:26905951
Protection against peroxynitrite by cocoa polyphenol oligomers.
Arteel, G E; Sies, H
1999-11-26
Flavonoids, natural plant constituents, protect against peroxynitrite and can thereby play a role in defense against this mediator of inflammation. Procyanidin oligomers of different size (monomer through nonamer), isolated from the seeds of Theobroma cacao, were examined for their ability to protect against peroxynitrite-dependent oxidation of dihydrorhodamine 123 and nitration of tyrosine. By molarity, oligomers were more effective than the monomeric epicatechin; the tetramer was particularly efficient at protecting against oxidation and nitration reactions. These results suggest that epicatechin oligomers found in cocoa powder and chocolate may be a potent dietary source for defense against peroxynitrite.
Li, Wenlu; Chen, Zhigang; Yan, Min; He, Ping; Chen, Zhong; Dai, Haibin
2016-02-01
As the first target of stroke, cerebral endothelial cells play a key role in brain vascular repair and maintenance, and their function is impeded in diabetes. Methylglyoxal (MGO), a reactive dicarbonyl produced during glucose metabolism, accumulates in diabetic patients. MGO and MGO-induced advanced glycation end-products (AGEs) could ameliorate stroke-induced brain vascular damage, closely related with ECs dysfunction. Using MGO plus oxygen-glucose deprivation (OGD) to mimic diabetic stroke, we reported the protective effect of isorhamnetin on OGD-induced cytotoxicity after MGO treatment on primary human brain microvascular endothelial cells (HBMEC) and explored the underlying mechanisms. Treatment of MGO for 24 h significantly enhanced 3-h OGD-induced HBMEC toxic effect, which was inhibited by pretreatment of isorhamnetin (100 μmol/L). Moreover, the protective effect of isorhamnetin is multiple function dependent, which includes anti-inflammation, anti-oxidative stress and anti-apoptosis effects. Besides its well-known inhibition on the mitochondria-dependent or intrinsic apoptotic pathway, isorhamnetin also reduced activation of the extrinsic apoptotic pathway, as characterized by the decreased expression and activity of caspase 3 and caspase 8. Furthermore, pretreatment with isorhamnetin specifically inhibited FAS/FASL expression and suppressed nuclear factor-kappa B nuclear translocation. Taken together, our results indicated that isorhamnetin protected against OGD-induced cytotoxicity after MGO treatment in cultured HBMEC due to its multiple protective effects and could inhibit Fas-mediated extrinsic apoptosis. Therefore, isorhamnetin is a promising reagent for the treatment of hyperglycemia and ischemia-induced cerebral vascular degeneration. A proposed model of the potential protective mechanism of isorhamnetin, a metabolite of quercetin, on methylglyoxal (MGO) treatment plus oxygen-glucose deprivation (OGD) exposure-induced cytotoxicity in cultured human brain microvascular endothelial cells. Isorhamnetin inhibits FasL-mediated extrinsic apoptosis and neurotrophic factor κB (NF-κB) nuclear translocation, which can induce the cell DNA damage. Therefore, the protective effect of isorhamnetin occurs through multiple functions, including anti-inflammation, anti-oxidative stress and anti-apoptosis. Therefore, isorhamnetin is a promising reagent for the treatment of hyperglycemia and ischemia-induced cerebral vascular degeneration. © 2015 International Society for Neurochemistry.
Souli, Abdelaziz; Sebai, Hichem; Rtibi, Kais; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel; Marzouki, Lamjed
2015-09-01
The present study was undertaken to determine whether total and methanol juice extracts of two Tunisian Pomegranate (Punica granatum L.) varieties (Garsi and Gabsi) protect against diarrhea as well as their effects on gastrointestinal transit (GIT) in healthy rats. In this respect, male Wistar rats were used and divided into control- and pomegranate-treated groups. The antidiarrheal activity was evaluated using the castor oil-induced diarrhea method and the GIT was assessed using charcoal meal. Our results showed that total and methanol P. granatum juice extracts produced a significant dose-dependent protection against castor oil-induced diarrhea. Pomegranate extracts and juice also decreased the GIT significantly and dose dependently. Importantly, the Garsi variety appeared to be more effective than the Gabsi variety on these two parameters. These findings suggest that pomegranate extracts have a potent antidiarrheal property in rats confirming their efficiency in the Tunisian traditional medicine.
Souli, Abdelaziz; Sebai, Hichem; Rtibi, Kais; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel; Marzouki, Lamjed
2015-01-01
Abstract The present study was undertaken to determine whether total and methanol juice extracts of two Tunisian Pomegranate (Punica granatum L.) varieties (Garsi and Gabsi) protect against diarrhea as well as their effects on gastrointestinal transit (GIT) in healthy rats. In this respect, male Wistar rats were used and divided into control- and pomegranate-treated groups. The antidiarrheal activity was evaluated using the castor oil-induced diarrhea method and the GIT was assessed using charcoal meal. Our results showed that total and methanol P. granatum juice extracts produced a significant dose-dependent protection against castor oil-induced diarrhea. Pomegranate extracts and juice also decreased the GIT significantly and dose dependently. Importantly, the Garsi variety appeared to be more effective than the Gabsi variety on these two parameters. These findings suggest that pomegranate extracts have a potent antidiarrheal property in rats confirming their efficiency in the Tunisian traditional medicine. PMID:25775227
Yu, L; Cherng, C-F G; Chen, C
2002-12-01
The present study aimed to investigate the protective effects of melatonin, ethanol and temperature changes on methamphetamine-induced neurotoxicity in both sexes of mice. Mice exhibited a similar degree of striatal dopamine depletion when methamphetamine was administered during the light and dark cycles. Moreover, 10 mg/kg, but not 5 mg/kg, of methamphetamine, significantly increased body temperature even though dopamine depletions were observed following both doses. Melatonin (80 mg/kg) dissolved in 30% (v/v) ethanol and 30% ethanol alone exerted a moderate to full protection against methamphetamine-induced dopamine depletions in both sexes of mice, whereas the same dose of melatonin in 3% ethanol exerted no protective effect. Furthermore, ethanol attenuated methamphetamine-induced dopamine depletions in a dose-dependent manner with the exception of high efficacy of ethanol at low doses. Finally, the protective effects of ethanol were not blocked by bicuculline. Together, we conclude that ethanol may protect mice against methamphetamine-induced dopamine depletion probably via non-GABAA receptor activation.
Lu, Nai-Hao; Chen, Chao; He, Ying-Jie; Tian, Rong; Xiao, Qiang; Peng, Yi-Yuan
2013-01-01
Flavonoids have been widely reported to protect liver injury in iron-overload diseases, where the mechanism of this therapeutic action is dependent on their antioxidant effects, including free radical scavenging and metal-chelating. In this study, in contrast to the significant decrease in iron content, quercetin (Qu) from lower diet (0.3%, w/w) showed pro-oxidant ability on protein carbonyl formation and exhibited unobvious effect on iron-overload rat liver injury. Furthermore, the anti- and pro-oxidant activities of Qu on hemoglobin (Hb)-dependent redox reactions (i.e. the oxidative stability of Hb and its cytotoxic ferryl intermediate, Hb-induced protein oxidation) were investigated to illustrate the elevated protein oxidation in lower Qu-treated iron-overload rat. It was found that superoxide (O₂·⁻) and hydrogen peroxide (H₂O₂) were generated during the reaction between Qu and Hb. Qu, however, effectively reduced ferryl intermediate back to ferric Hb in a biphasic kinetic reaction. Moreover, Qu could significantly aggravate Hb-H₂O₂-induced protein oxidation at low concentrations and exhibit protective effects at high concentrations. Different from the classic antioxidant mechanisms of Qu, the dual effects on Hb redox reactions in vitro, therefore, may provide new insights into the physiological and pharmacological implications of Qu with iron-overload disease.
Homlong, Lisbeth; Rosvold, Elin Olaug; Sagatun, Åse; Wentzel-Larsen, Tore; Haavet, Ole Rikard
2015-04-22
Living with parents suffering from mental illness can influence adolescents' health and well-being, and adverse effects may persist into adulthood. The aim of this study was to investigate the relationship between parents' mental health problems reported by their 15-16-year-old adolescents, the potential protective effect of social support and long-term dependence on public welfare assistance in young adulthood. The study linked data from a youth health survey conducted during 1999-2004 among approximately 14 000 15-16-year-olds to data from high-quality, compulsory Norwegian registries that followed each participant through February 2010. Cox regression was used to compute hazard ratios for long-term welfare dependence in young adulthood based on several risk factors in 15-16-year-olds, including their parents' mental health problems. Of the total study population, 10% (1397) reported having parents who suffered from some level of mental health problems during the 12 months prior to the baseline survey; 3% (420) reported that their parents had frequent mental health problems. Adolescent report of their parents' mental health problems was associated with the adolescents' long-term welfare dependence during follow-up, with hazard ratios (HRs) of 1.49 (CI 1.29-1.71), 1.82 (1.44-2.31) and 2.13 (CI 1.59-2.85) for some trouble, moderate trouble and frequent trouble, respectively, compared with report of no trouble with mental health problems. The associations remained significant after adjusting for socio-demographic factors, although additionally correcting for the adolescents' own health status accounted for most of the effect. Perceived support from family, friends, classmates and teachers was analysed separately and each was associated with a lower risk of later welfare dependence. Family and classmate support remained a protective factor for welfare dependence after correcting for all study covariates (HR 0.84, CI 0.78-0.90 and 0.80, 0.75-0.85). We did not find evidence supporting a hypothesized buffering effect of social support. Exposure to a parent's mental health problem during adolescence may represent a risk for future welfare dependence in young adulthood. Perceived social support, from family and classmates in particular, may be a protective factor against future long-term welfare dependence.
Improving the Design of a Conservation Reserve for a Critically Endangered Species
2017-01-01
Setting aside protected areas is a key strategy for tackling biodiversity loss. Reserve effectiveness depends on the extent to which protected areas capture both known occurrences and areas likely to support the species. We assessed the effectiveness of the existing reserve network for Leadbeater’s Possum (Gymnobelideus leadbeateri) and other forest-dependent species, and compared the existing reserve system to a set of plausible reserve expansion options based on area targets implied in a recent Population Viability Analysis (PVA). The existing Leadbeater’s Reserve and surrounding reserve system captured 7.6% and 29.6% of cumulative habitat suitability, respectively, across the landscape. Expanded reserve scenarios captured 34% to 62% of cumulative habitat suitability. We found acute trade-offs between conserving Leadbeater’s Possum habitat and conserving habitat of other forest-dependent species. Our analysis provides a template for systematically expanding and evaluating reserve expansion options in terms of trade-offs between priority species’ needs. PMID:28121984
Xiang, Qingqing; Xu, Bofan; Ding, Yilun; Liu, Xiaoyi; Zhou, Ying; Ahmad, Farooq
2018-02-01
The widespread contamination and persistence of the herbicide butachlor in the environment resulted in the exposure of non-target organisms. The present study investigated the toxicity effect of butachlor (1-15 µmol/L) and the protective effect of vitamin C (VC) against butachlor-induced toxicity in zebrafish. It was found that butachlor significantly increased the mortality and malformation rates in a dose-dependent manner, which caused elevation in reactive oxygen species (ROS) and malondialdehyde (MDA) after 72 h exposure. Compared with butachlor treatment group, the protective effect of VC against butachlor-induced toxicity were observed after adding 40, 80 mg/L VC respectively. VC significantly decreased the mortality, malformation rates, ROS, MDA, and normalized antioxidant enzymes activities of zebrafish after 72 h exposure. The result shows VC has mitigative effect on butachlor-induced toxicity and it can be used as an effective antioxidant in aquaculture.
Dependence of Cisplatin-Induced Cell Death In Vitro and In Vivo on Cyclin-Dependent Kinase 2
Price, Peter M.; Yu, Fang; Kaldis, Philipp; Aleem, Eiman; Nowak, Grażyna; Safirstein, Robert L.; Megyesi, Judit
2006-01-01
Cisplatin is one of the most effective chemotherapeutics, but its usefulness is limited by its toxicity to normal tissues, including cells of the kidney proximal tubule. The purpose of these studies was to determine the mechanism of cisplatin cytotoxicity. It was shown in vivo that cisplatin administration induces upregulation of the gene for the p21 cyclin-dependent kinase (cdk) inhibitor in kidney cells. This protein is a positive effector on the fate of cisplatin-exposed renal tubule cells in vivo and in vitro; adenoviral transduction of p21 completely protected proximal tubule cells from cisplatin toxicity. Herein is reported that cdk2 inhibitory drugs protect kidney cells in vivo and in vitro, that transduction of kidney cells in vitro with dominant-negative cdk2 also protected, and that cdk2 knockout cells were resistant to cisplatin. The cdk2 knockout cells regained cisplatin sensitivity after transduction with wild-type cdk2. It is concluded that cisplatin cytotoxicity depends on cdk2 activation and that the mechanism of p21 protection is by direct inhibition of cdk2. This demonstrated the involvement of a protein that previously was associated with cell-cycle progression with pathways of apoptosis. It also was demonstrated that this pathway of cisplatin-induced cell death can be interceded in vivo to prevent nephrotoxicity. PMID:16914540
Multiple mechanisms involved in diabetes protection by lipopolysaccharide in non-obese diabetic mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Jun; Department of Pharmacology, College of Medicine, Wuhan University of Science and Technology, Wuhan; Cao, Hui
Toll-like receptor 4 (TLR4) activation has been proposed to be important for islet cell inflammation and eventually β cell loss in the course of type 1 diabetes (T1D) development. However, according to the “hygiene hypothesis”, bacterial endotoxin lipopolysaccharide (LPS), an agonist on TLR4, inhibits T1D progression. Here we investigated possible mechanisms for the protective effect of LPS on T1D development in non-obese diabetic (NOD) mice. We found that LPS administration to NOD mice during the prediabetic state neither prevented nor reversed insulitis, but delayed the onset and decreased the incidence of diabetes, and that a multiple-injection protocol is more effectivemore » than a single LPS intervention. Further, LPS administration suppressed spleen T lymphocyte proliferation, increased the generation of CD4{sup +}CD25{sup +}Foxp3{sup +} regulatory T cells (Tregs), reduced the synthesis of strong Th1 proinflammatory cytokines, and downregulated TLR4 and its downstream MyD88-dependent signaling pathway. Most importantly, multiple injections of LPS induced a potential tolerogenic dendritic cell (DC) subset with low TLR4 expression without influencing the DC phenotype. Explanting DCs from repeated LPS-treated NOD mice into NOD/SCID diabetic mice conferred sustained protective effects against the progression of diabetes in the recipients. Overall, these results suggest that multiple mechanisms are involved in the protective effects of LPS against the development of diabetes in NOD diabetic mice. These include Treg induction, down-regulation of TLR4 and its downstream MyD88-dependent signaling pathway, and the emergence of a potential tolerogenic DC subset. - Highlights: • Administration of lipopolysaccharide (LPS) prevented type 1 diabetes in NOD mice. • Downregulating TLR4 level and MyD88-dependent pathway contributed to protection of LPS. • LPS administration also hampered DC maturation and promoted Treg differentiation.« less
See Hoe, Louise E.; Schilling, Jan M.; Tarbit, Emiri; Kiessling, Can J.; Busija, Anna R.; Niesman, Ingrid R.; Du Toit, Eugene; Ashton, Kevin J.; Roth, David M.; Headrick, John P.; Patel, Hemal H.
2014-01-01
Cholesterol-rich caveolar microdomains and associated caveolins influence sarcolemmal ion channel and receptor function and protective stress signaling. However, the importance of membrane cholesterol content to cardiovascular function and myocardial responses to ischemia-reperfusion (I/R) and cardioprotective stimuli are unclear. We assessed the effects of graded cholesterol depletion with methyl-β-cyclodextrin (MβCD) and lifelong knockout (KO) or overexpression (OE) of caveolin-3 (Cav-3) on cardiac function, I/R tolerance, and opioid receptor (OR)-mediated protection. Langendorff-perfused hearts from young male C57Bl/6 mice were untreated or treated with 0.02–1.0 mM MβCD for 25 min to deplete membrane cholesterol and disrupt caveolae. Hearts were subjected to 25-min ischemia/45-min reperfusion, and the cardioprotective effects of morphine applied either acutely or chronically [sustained ligand-activated preconditioning (SLP)] were assessed. MβCD concentration dependently reduced normoxic contractile function and postischemic outcomes in association with graded (10–30%) reductions in sarcolemmal cholesterol. Cardioprotection with acute morphine was abolished with ≥20 μM MβCD, whereas SLP was more robust and only inhibited with ≥200 μM MβCD. Deletion of Cav-3 also reduced, whereas Cav-3 OE improved, myocardial I/R tolerance. Protection via SLP remained equally effective in Cav-3 KO mice and was additive with innate protection arising with Cav-3 OE. These data reveal the membrane cholesterol dependence of normoxic myocardial and coronary function, I/R tolerance, and OR-mediated cardioprotection in murine hearts (all declining with cholesterol depletion). In contrast, baseline function appears insensitive to Cav-3, whereas cardiac I/R tolerance parallels Cav-3 expression. Novel SLP appears unique, being less sensitive to cholesterol depletion than acute OR protection and arising independently of Cav-3 expression. PMID:25063791
Al-Rejaie, Salim S; Abuohashish, Hatem M; Ahmed, Mohammed M; Aleisa, Abdulaziz M; Alkhamees, Osama
2012-12-01
Gymnema sylvestre (GS) R. Br. (Gymnema) (Asclepiadaceae) has been used from ancient times as a folk medicine for the treatment of diabetes, obesity, urinary disorder, and stomach stimulation. The present study was designed to investigate the effects of G. sylvestre leaves ethanol extract on gastric mucosal injury in rats. Gastric mucosal damage was induced by 80% ethanol in 36 h fasted rats. The effect of G. sylvestre on gastric secretions induced in Shay rats was estimated. In stomach, wall mucus, non-protein sulfhydryl groups (NP-SH), malondialdehyde (MDA), total proteins and nucleic acids levels were estimated. Histopathological changes were observed. G. sylvestre pretreatment at doses of 100, 200 and 400 mg/kg provided 27, 49, and 63% protection against the ulcerogenic effect of ethanol, respectively. Pylorus ligation accumulated 10.24 mL gastric secretions with 66.56 mEq of acidity in control rats. Pretreatment with G. sylvestre significantly inhibited the secretions volume and acidity in dose-dependent manner. Ethanol caused significant depletion in stomach-wall mucus (p < 0.001), total proteins (p < 0.01), nucleic acids (p < 0.001), and NP-SH (p < 0.001) levels. Pretreatment with G. sylvestre showed protection against these depleted levels in dose-dependent manner. The MDA levels increased from 19.02 to 29.22 nmol/g by ethanol ingestion and decreased with G. sylvestre pretreatments in dose-dependent manner. The protective effect of G. sylvestre observed in the present study is attributed to its effect on mucus production, increase in nucleic acid and NP-SH levels, which appears to be mediated through its free radical scavenging ability and/or possible cytoprotective properties.
Humans are dependent upon the services provided by nature, and unless we effectively account for the range of values from ecosystems in our efforts to protect the environment, we cannot sustain human well-being. In light of this dependence, a national measure of well-being is nee...
Guo, Zhiliang; Liu, Yuanyuan; Cheng, Min
2018-07-01
General anesthesia in spinal cord may lead to unexpected but irreversible neurotoxicity. We investigated whether resveratrol (RSV) may protect bupivacaine (BUP)-induced neuro-apoptosis in spinal cord dorsal root ganglia (DRG). Mouse DRG cells were cultured in vitro, pre-treated with RSV and then 5 mM BUP. A concentration-dependent effect of RSV on reducing BUP-induced apoptosis of DRG neurons (DRGNs) was evaluated using a TUNEL assay. QRT-PCR and western blot assays were also conducted to evaluate gene and protein expressions of tropomyosin receptor kinase A/B/C (TrkA/B/C) and activated (phosphorylated) Trk receptors, phospho-TrkA/B/C. In addition, a functional TrkA blocking antibody MNAC13 was applied in DRG culture to further measure the functional role of Trk receptor in RSV-initiated apoptotic protection on BUP-damaged DRGNs. BUP promoted significant apoptosis in DRG. RSV exhibited protective effects against BUP-induced neuro-apoptosis in a concentration-dependent manner. qRT-PCR and western blot showed that RSV did not alter TrkA/B/C gene or protein expression, but significantly upregulated phospho-TrkA. Conversely, application of MNAC13 decreased phospho-TrkA and reversed RSV-initiated neuro-protection on BUP-induced DRGN apoptosis. Resveratrol may protect anesthesia-induced DRG neuro-apoptosis, and activation of TrkA signaling pathway may be the underlying mechanism in this process. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Brandhorst, Sebastian; Wei, Min; Hwang, Saewon; Morgan, Todd E.; Longo, Valter D.
2013-01-01
Short-term starvation (STS) protects normal cells while simultaneously sensitizing malignant cells to high-dose chemotherapeutic drugs in mice and possibly patients. The fasting-dependent protection of normal cells and sensitization of malignant cells depends, in part, on reduced levels of insulin-like growth factor-1 (IGF-1) and glucose. Calorie restricted diets with defined macronutrient (carbohydrate, protein, fat) ratios were evaluated for the effects on stress sensitization markers and protection in mice treated with high-dose chemotherapy. We show that short-term CR significantly reduced both glucose and IGF-1 levels, but when specific macronutrient deficiencies were tested, only the complete lack of proteins reduced IGF-1 levels. Short-term 50% CR combined with either severe protein-deficiency or ketogenic diets improved chemotoxicity resistance similarly to the standard 50% CR, but did not result in the high protection caused by STS. Notably, a high protein diet reversed the beneficial effects of short-term CR. In a subcutaneous mouse model of glioma, feeding a low protein (4% calories from protein) diet for more than 20 days did not delay tumor progression once the tumor became palpable. Also, cycles of short-term (3 days) 50% CR did not augment the chemotherapy efficacy of cisplatin in a murine breast cancer model. These results indicate that the protection from chemotoxicity and retardation of the progression of certain tumors achieved with fasting is not obtained with short-term calorie and/or macronutrient restriction. PMID:23454633
Inhibition of glycerophosphate-dependent H2O2 generation in brown fat mitochondria by idebenone.
Rauchová, Hana; Vrbacký, Marek; Bergamini, Christian; Fato, Romana; Lenaz, Giorgio; Houstek, Josef; Drahota, Zdenek
2006-01-06
The established protective effect of coenzyme Q (CoQ) analogs is dependent on the location of reactive oxygen species (ROS) generation. One of these analogs--idebenone (hydroxydecyl-ubiquinone) is used as an antioxidative therapeutic drug. We tested its scavenging effect on the glycerophosphate (GP)-dependent ROS production as this enzyme was shown as a new site in the mitochondrial respiratory chain where ROS can be generated. We observed that idebenone inhibits both GP- and succinate-dependent ROS production. Idebenone and CoQ1 were found to be more efficient in the scavenging activity (IC50: 0.052 and 0.075 microM, respectively) than CoQ3 (IC50: 45.8 microM). Idebenone also inhibited ferricyanide (FeCN)-activated, GP-dependent ROS production. Our data thus extend previous findings on the scavenging effect of idebenone and show that it can also eliminate GP-dependent ROS generation.
Wu, Jianjiang; Yang, Long; Xie, Peng; Yu, Jin; Yu, Tian; Wang, Haiying; Maimaitili, Yiliyaer; Wang, Jiang; Ma, Haiping; Yang, Yining; Zheng, Hong
2017-01-01
Previous studies from our group have demonstrated that sevoflurane post-conditioning (SPC) protects against myocardial ischemia reperfusion injury via elevating the intranuclear expression of hypoxia inducible factor-1 alpha (HIF-1α). However, diabetic SPC is associated with decreased myocardial protection and disruption of the HIF-1 signaling pathway. Previous studies have demonstrated that cobalt chloride (CoCl 2 ) can upregulate HIF-1α expression under diabetic conditions, but whether myocardial protection by SPC can be restored afterward remains unclear. We established a rat model of type 2 diabetes and a Langendorff isolated heart model of ischemia-reperfusion injury. Prior to reperfusion, 2.4% sevoflurane was used as a post-conditioning treatment. The diabetic rats were treated with CoCl 2 24 h before the experiment. At the end of reperfusion, tests were performed to assess myocardial function, infarct size, mitochondrial morphology, nitric oxide (NO), Mitochondrial reactive oxygen species (ROS), mitochondrial respiratory function and enzyme activity, HIF-1α, vascular endothelial growth factor (VEGF) and endothelial NO synthase (eNOS) protein levels. In addition, myocardial protection by SPC was monitored after the blood glucose levels were lowered by insulin. The diabetic state was associated with deficient SPC protection and decreased HIF-1α expression. After treating the diabetic rats with CoCl 2 , SPC significantly upregulated the expression of HIF-1α, VEGF and eNOS, which markedly improved cardiac function, NO, mitochondrial respiratory function, and enzyme activity and decreased the infarction areas and ROS. In addition, these effects were not influenced by blood glucose levels. This study proved that CoCl 2 activates the HIF-1α signaling pathway, which restores SPC-dependent myocardial protection under diabetic conditions, and the protective effects of SPC were independent of blood glucose levels.
Rosuvastatin protects against podocyte apoptosis in vitro
Cormack-Aboud, Fionnuala C.; Brinkkoetter, Paul T.; Pippin, Jeffrey W.; Shankland, Stuart J.; Durvasula, Raghu V.
2009-01-01
Background. Clinical studies suggest that statins reduce proteinuria and slow the decline in kidney function in chronic kidney disease. Given a rich literature identifying podocyte apoptosis as an early step in the pathophysiological progression to proteinuria and glomerulosclerosis, we hypothesized that rosuvastatin protects podocytes from undergoing apoptosis. Regarding a potential mechanism, our lab has shown that the cell cycle protein, p21, has a prosurvial role in podocytes and there is literature showing statins upregulate p21 in other renal cells. Therefore, we queried whether rosuvastatin is prosurvival in podocytes through a p21-dependent pathway. Methods. Two independent apoptotic triggers, puromycin aminonucleoside (PA) and adriamycin (ADR), were used to induce apoptosis in p21 +/+ and p21 −/− conditionally immortalized mouse podocytes with or without pre-exposure to rosuvastatin. Apoptosis was measured by two methods: Hoechst 33342 staining and fluorescence-activated cell sorting (FACS). To establish a role for p21, p21 levels were measured by western blotting following rosuvastatin exposure and p21 was stably transduced into p21 −/− mouse podocytes. Results. Rosuvastatin protects against ADR- and PA-induced apoptosis in podocytes. Further, exposure to rosuvastatin increases p21 levels in podocytes in vitro. ADR induces apoptosis in p21 −/− mouse podocytes, but rosuvastatin's protective effect is not seen in the absence of p21. Reconstituting p21 in p21 −/− podocytes restores rosuvastatin's prosurvival effect. Conclusion. Rosuvastatin is prosurvival in injured podocytes. Rosuvastatin exerts its protective effect through a p21-dependent antiapoptotic pathway. These findings suggest that statins decrease proteinuria by protecting against podocyte apoptosis and subsequent podocyte depopulation. PMID:18820279
Liu, Cheng-Ling; Liang, Ai-Ling; Hu, Miao-Lin
2011-10-01
Fucoxanthin is a carotenoid that is rich in some seaweed. Although fucoxanthin has been reported to possess radical-scavenging activities in vitro, little is known whether it may protect against iron-induced oxidative stress in cultured cells. In this study, we examined the protection of fucoxanthin against oxidative damage in BNL CL.2 cells induced by ferric nitrilotriacetate (Fe-NTA). The data show that incubation of BNL CL.2 cells with Fe-NTA for 30 min significantly decreased cell proliferation, whereas pretreatment with fucoxanthin (1-20 μΜ) for 24h significantly recovered cell proliferation in a dose-dependent manner. In addition, fucoxanthin pretreatment significantly decreased intracellular reactive oxygen species (ROS) and DNA damage in BNL CL.2 cells incubated with Fe-NTA for 30 min. Moreover, fucoxanthin markedly decreased the level of thiobarbituric acid-reactive substances (TBARS) and protein carbonyl contents in BNL CL.2 cells induced by Fe-NTA. By contrast, fucoxanthin significantly increased the levels of GSH in a concentration-dependent manner. These results demonstrate that fucoxanthin at 1-20μΜ effectively prevents cytotoxicity in BNL CL.2 cells treated with Fe-NTA, and that the protective effect is likely associated with decreased intracellular ROS, TBARS, protein carbonyl contents and increased GSH levels. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Alvarez, Pedro; Green, Paul G; Levine, Jon D
2018-06-01
Neonatal handling (NH) of male rat pups strongly attenuates stress response and stress-induced persistent muscle hyperalgesia in adults. Because female sex is a well established risk factor for stress-induced chronic muscle pain, we explored whether NH provides resilience to stress-induced hyperalgesia in adult female rats. Rat pups underwent NH, or standard (control) care. Muscle mechanical nociceptive threshold was assessed before and after water avoidance (WA) stress, when they were adults. In contrast to male rats, NH produced only a modest protection against WA stress-induced muscle hyperalgesia in female rats. Gonadectomy completely abolished NH-induced resilience in male rats but produced only a small increase in this protective effect in female rats. The administration of the antiestrogen drug fulvestrant, in addition to gonadectomy, did not enhance the protective effect of NH in female rats. Finally, knockdown of the androgen receptor by intrathecal antisense treatment attenuated the protective effect of NH in intact male rats. Together, these data indicate that androgens play a key role in NH-induced resilience to WA stress-induced muscle hyperalgesia. NH induces androgen-dependent resilience to stress-induced muscle pain. Therefore, androgens may contribute to sex differences observed in chronic musculoskeletal pain and its enhancement by stress. Copyright © 2018 The American Pain Society. Published by Elsevier Inc. All rights reserved.
Zhou, Feng C.; Fang, Yuan; Goodlett, Charles
2009-01-01
Introduction Prenatal alcohol exposure via maternal liquid diet consumption by C57BL/6 (B6) mice causes conspicuous midline neural tube deficit (dysraphia) and disruption of genesis and development of serotonin (5-HT) neurons in the raphe nuclei, together with brain growth retardation. The current study tested the hypothesis that concurrent treatment with either an activity-dependent neurotrophic factor (ADNF) agonist peptide [SALLRSIPA, (SAL)] or an activity-dependent neurotrophic protein (ADNP) agonist peptide [NAPVSIPQ, (NAP)] would protect against these alcohol-induced deficits in brain development. Methods Timed-pregnant B6 dams consumed alcohol from embryonic day 7 (E7, before the onset of neurulation) until E15. Fetuses were obtained on E15 and brain sections processed for 5-HT immunocytochemistry, for evaluation of morphologic development of the brainstem raphe and its 5-HT neurons. Additional groups were treated either with SAL or NAP daily from E7 to E15 to assess the potential protective effects of these peptides. Measures of incomplete occlusion of the ventral canal and the frequency and extent of the openings in the rhombencephalon were obtained to assess fetal dysraphia. Counts of 5-HT-immunostained neurons were also obtained in the rostral and caudal raphe. Results Prenatal alcohol exposure resulted in abnormal openings along the midline and delayed closure of ventral canal in the brainstem. This dysraphia was associated with reductions in the number of 5-HT neurons both in the rostral raphe nuclei (that gives rise to ascending 5-HT projections) and in the caudal raphe (that gives rise to the descending 5-HT projections). Concurrent treatment of the alcohol-consuming dams with SAL prevented dysraphia and protected against the alcohol-induced reductions in 5-HT neurons in both the rostral and caudal raphe. NAP was less effective in protecting against dysraphia and did not protect against 5-HT loss in the rostral raphe, but did protect against loss in the caudal raphe. Conclusions These findings further support the potential usefulness of these peptides for therapeutic interventions in pregnancies at risk for alcohol-induced developmental deficits. Notably, the ascending 5-HT projections of the rostral raphe have profound effects in regulating forebrain development and function, and the descending 5-HT projections of the caudal raphe are critical for regulating respiration. Protection of the rostral 5-HT-system may help prevent structural and functional deficits linked to abnormal forebrain development, and protection of the caudal systems may also reduce the increased risk for sudden infant death syndrome associated with prenatal alcohol exposure. PMID:18565153
Wongprayoon, Pawaris; Govitrapong, Piyarat
2017-01-01
Methamphetamine (METH), a psychostimulant with highly neurotoxic effects, has been known to induce neuronal apoptosis in part through an endoplasmic reticulum (ER) stress pathway. Melatonin is an endogenous antioxidant compound that exerts protective effects against several neurodegenerative conditions, including METH-induced neurotoxicity, via various mechanisms. However, the role of melatonin in ER stress is still relatively unclear. In the present study, we investigated ER stress and neuronal apoptosis following METH treatment and the role of melatonin in METH-mediated ER stress-induced cell death in the SH-SY5Y neuroblastoma cell line. We found that METH caused the overexpression of ER stress-related genes, including C/EBP homologous protein and spliced X-box binding protein 1, in dose- and time-dependent manners. Moreover, METH time-dependently activated caspase-12 and -3, leading to cellular apoptosis. Furthermore, we demonstrated that pretreatment with melatonin attenuated the overexpression of ER stress-related genes and the cleavages of caspase-12 and -3 caused by METH exposure. Flow cytometry revealed that METH-mediated neuronal apoptosis was also prevented by melatonin. These findings suggest the protective effects of melatonin against ER stress and apoptosis caused by METH and other harmful agents.
Effects of Laser Wavelength on Ablator Testing
NASA Technical Reports Server (NTRS)
White, Susan M.
2014-01-01
Wavelength-dependent or spectral radiation effects are potentially significant for thermal protection materials. NASA atmospheric entry simulations include trajectories with significant levels of shock layer radiation which is concentrated in narrow spectral lines. Tests using two different high powered lasers, the 10.6 micron LHMEL I CO2 laser and the near-infrared 1.07 micron fiber laser, on low density ablative thermal protection materials offer a unique opportunity to evaluate spectral effects. Test results indicated that the laser wavelength can impact the thermal response of an ablative material, in terms of bond-line temperatures, penetration times, mass losses, and char layer thicknesses.
Ioannidis, John P A; Contopoulos-Ioannidis, Despina G; Rosenberg, Philip S; Goedert, James J; De Rossi, Anita; Espanol, Teresa; Frenkel, Lisa; Mayaux, Marie-Jeanne; Newell, Marie-Louise; Pahwa, Savita G; Rousseau, Christine; Scarlatti, Gabriella; Sei, Shizuko; Sen, Luisa; O'Brien, Thomas R
2003-07-25
Among perinatally infected children, the effects of certain alleles of the CCR5 and CCR2 genes on the rate of disease progression remain unclear. We addressed the effects of CCR5-delta32 and CCR2-64I in an international meta-analysis. Genotype data were contributed from 10 studies with 1317 HIV-1-infected children (7263 person-years of follow-up). Time-to-event analyses were performed stratified by study and racial group. Endpoints included progression to clinical AIDS, death, and death after the diagnosis of clinical AIDS. The time-dependence of the genetic effects was specifically investigated. There was large heterogeneity in the observed rates of disease progression between different cohorts. For progression to clinical AIDS, both CCR5-delta32 and CCR2-64I showed overall non-significant trends for protection [hazard ratios 0.84, 95% confidence interval (CI) 0.58-1.23; and 0.87, 95% CI 0.67-1.14, respectively]. However, analyses of survival showed statistically significant time-dependence. No deaths occurred among CCR5-delta32 carriers in the first 3 years of life, whereas there was no protective effect (hazard ratio 0.95; 95% CI 0.43-2.10) in later years (P=0.01 for the time-dependent model). For CCR2-64I, the hazard ratio for death was 0.69 (95% CI 0.39-1.21) in the first 6 years of life and 2.56 (95% CI 1.26-5.20) in subsequent years (P<0.01 for the time-dependent model). CCR5-delta32 and CCR2-64I offered no clear protection after clinical AIDS had developed. The CCR5-delta32 and CCR2-64I alleles are associated with a decreased risk of death among perinatally infected children, but only for the first years of life.
Lee, Soo Vin; Choi, Kyung Ha; Choi, Young Whan; Hong, Jin Woo; Baek, Jin Ung; Choi, Byung Tae; Shin, Hwa Kyoung
2014-04-01
Polygonum multiflorum is a traditional Korean medicine that has been utilized widely in East Asian countries as a longevity agent. Clinical studies have demonstrated that Polygonum multiflorum improves hypercholesterolemia, coronary heart disease, neurosis and other diseases commonly associated with aging. However, scientific evidence defining the protective effects and mechanisms of Polygonum multiflorum against ischemic stroke is incomplete. In the present study, we investigated the cerebrovascular protective effects of Polygonum multiflorum against ischemic brain injury using an in vivo photothrombotic mouse model. To examine the underlying mechanism of action, we utilized an in vitro human brain microvascular endothelial cell (HBMEC) culture system. Hexane extracts (HEPM), ethyl acetate extracts (EAEPM) and methanol extracts (MEPM) of Polygonum multiflorum (100 mg/kg) were administered intraperitoneally 30 min prior to ischemic insult. Focal cerebral ischemia was induced in C57BL/6J mice and endothelial nitric oxide synthase knockout (eNOS KO) mice by photothrombotic cortical occlusion. We evaluated the infarct volume, as well as neurological and motor function, 24 h after ischemic brain injury. Following ischemic insult, HEPM induced a significant reduction in infarct volume and subsequent neurological deficits, compared with EAEPM and MEPM. HEPM significantly decreased infarct size and improved neurological and motor function, which was not observed in eNOS KO mice, suggesting that this cerebroprotective effect is primarily an eNOS-dependent mechanism. In vitro, HEPM effectively promoted NO production, however these effects were inhibited by the NOS inhibitor, L-NAME and the PI3K/Akt inhibitor, LY-294002. Furthermore, HEPM treatment resulted in increased phosphorylation-dependent activation of Akt and eNOS in HBMEC, suggesting that HEPM increased NO production via phosphorylation-dependent activation of Akt and eNOS. In conclusion, HEPM prevents cerebral ischemic damage through an eNOS-dependent mechanism, and thus may have clinical applications as a protective agent against neurological injury in stroke.
CNG channel subunit glycosylation regulates MMP-dependent changes in channel gating
Meighan, Starla E.; Meighan, Peter C.; Rich, Elizabeth D.; Brown, R. Lane; Varnum, Michael D.
2013-01-01
Cyclic-nucleotide gated (CNG) channels are essential for phototransduction within retinal photoreceptors. We have demonstrated previously that enzymatic activity of matrix metalloproteinase-2 and -9, members of the MMP family of extracellular, Ca+2- and Zn+2-dependent proteases, enhances the ligand sensitivity of both rod (CNGA1 + CNGB1) and cone CNGA3 + CNGB3) CNG channels. Additionally, we have observed a decrease in maximal CNG channel current (IMAX) that begins late during MMP-directed gating changes. Here we demonstrate that CNG channels become non-conductive after prolonged MMP exposure. Concurrent with the loss of conductive channels is the increased relative contribution of channels exhibiting non-modified gating properties, suggesting the presence of a subpopulation of channels that are protected from MMP-induced gating effects. CNGA subunits are known to possess one extracellular core glycosylation site, located at one of two possible positions within the turret loop near the pore-forming region. Our results indicate that CNGA glycosylation can impede MMP-dependent modification of CNG channels. Furthermore, the relative position of the glycosylation site within the pore turret influences the extent of MMP-dependent proteolysis. Glycosylation at the site found in CNGA3 subunits was found to be protective, while glycosylation at the bovine CNGA1 site was not. Relocating the glycosylation site in CNGA1 to the position found in CNGA3 recapitulated CNGA3-like protection from MMP-dependent processing. Taken together, these data indicate that CNGA glycosylation may protect CNG channels from MMP-dependent proteolysis, consistent with MMP modification of channel function having a requirement for physical access to the extracellular face of the channel. PMID:24164424
Expansion of effective wet bulb globe temperature for vapor impermeable protective clothing.
Sakoi, Tomonori; Mochida, Tohru; Kurazumi, Yoshihito; Sawada, Shin-Ichi; Horiba, Yosuke; Kuwabara, Kohei
2018-01-01
The wet bulb globe temperature (WBGT) is an effective measure for risk screening to prevent heat dISOrders. However, a heat risk evaluation by WBGT requires adjustments depending on the clothing. In this study, we proposed a new effective WBGT (WBGT eff * ) for general vapor permeable clothing ensembles and vapor impermeable protective clothing that is applicable to occupants engaged in moderate intensity work with a metabolic heat production value of around 174W/m 2 . WBGT eff * enables the conversion of heat stress into the scale experienced by the occupant dressed in the basic clothing ensemble (work clothes) based on the heat balances for a human body. We confirmed that WBGT eff * was effective for expressing the critical thermal environments for the prescriptive zones for occupants wearing vapor impermeable protective clothing. Based on WBGT eff * , we succeeded in clarifying how the weights for natural wet bulb, globe, and air temperatures and the intercept changed depending on clothing properties and the surrounding environmental factors when heat stress is expressed by the weighted sum of natural wet bulb, globe, and air temperatures and the intercept. The weight of environmental temperatures (globe and air temperatures) for WBGT eff * for vapor impermeable protective clothing increased compared with that for general vapor permeable clothing, whereas that of the natural wet bulb temperature decreased. For WBGT eff * in outdoor conditions with a solar load, the weighting ratio of globe temperature increased and that of air temperature decreased with air velocity. Approximation equations of WBGT eff * were proposed for both general vapor permeable clothing ensembles and for vapor impermeable protective clothing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nielsen, J B; Andersen, H R
2001-01-01
Dermal exposure has become the major route of human occupational exposure to pesticides. Detergents are used as part of formulated pesticide products and are known to change the barrier properties of human skin in vitro. However, studies on the influence of detergents as well as protective glove materials on dermal penetration of pesticides are scarce. In an experiment using in vitro static diffusion cells mounted with human skin, we evaluated the effect of nonylphenol-ethoxylate on dermal penetration of three extensively used pesticides--methiocarb, paclobutrazol, and pirimicarb--and the protection against dermal penetration offered by protective gloves made of latex or nitrile. There was a general tendency, though not statistically significant for all pesticides, for nonylphenolethoxylate to decrease the percutaneous penetration of the three pesticides. The nitrile generally offered better protection against percutaneous penetration of pesticides than did latex, but the degree of protection decreased over time and depended on the pesticides used. PMID:11266321
[Gonad protective effect of radiation protective apron in chest radiography].
Hashimoto, Masatoshi; Kato, Hideyuki; Fujibuchi, Toshiou; Ochi, Shigehiro; Morita, Fuminori
2004-12-01
Depending on the facility, a radiation protective apron (protector) is used to protect the gonad from radiation exposure in chest radiography. To determine the necessity of using a protector during chest radiography, we measured the effect of the protector on the gonad in this study. First, using a human body phantom, we measured the absorbed dose of the female gonad with and without the protector, using a thermoluminescence dosimeter (TLD), and confirmed its protective effect. Using the protector, the absorbed dose was reduced to 28+/-2% and 39+/-4% for field sizes of 14 x 17 inch and 14 x 14 inch, respectively. Next, we used Monte Carlo simulation and confirmed, not only the validity of the actual measurement values, but also the fact that the influence of radiation on the absorbed dose of the gonad was mostly from scattered radiation from inside the body for the 14 x 17 inch field size, and also from the X-ray tube for the 14 x 14 inch field size. Although a certain protective effect is achieved by using the protector, the radiation dose to the gonad is only a few microGy even without a protector. Thus, the risk of a genetic effect would be as small as 10(-8). Given that acceptable risk is below 10(-6), we conclude the use of a radiation protective apron is not necessary for diagnostic chest radiography.
Mazzocchetti, Petra; Tantucci, Michela; Bastioli, Guendalina; Calabrese, Valeria; Di Filippo, Massimiliano; Tozzi, Alessandro; Calabresi, Paolo; Costa, Cinzia
2018-06-01
Lacosamide ([(R)-2-acetamido-N-benzyl-3-methoxypropanamide], LCM), is an antiepileptic that exerts anticonvulsant activity by selectively enhancing slow sodium channel inactivation. By inhibiting seizures and neuronal excitability it might therefore be a good candidate to stabilize neurons and protect them from energetic insults. Using electrophysiological analyses, we have investigated in mice the possible neuroprotective effect of LCM against in vitro ischemia obtained by oxygen and glucose deprivation (ODG), in striatal and hippocampal tissues, two brain structures particularly susceptible to ischemic injury and of pivotal importance for different form of learning and memory. We also explored in these regions the influence of LCM on firing discharge and on long-term synaptic plasticity. We found that in both areas LCM reduced the neuronal firing activity in a use-dependent manner without influencing the physiological synaptic transmission, confirming its anticonvulsant effects. Moreover, we found that this AED is able to protect, in a dose dependent manner, striatal and hippocampal neurons from energy metabolism failure produced by OGD. This neuroprotective effect does not imply impairment of long-term potentiation of striatal and hippocampal synapses and suggests that LCM might exert additional beneficial therapeutic effects beyond its use as antiepileptic. Copyright © 2018 Elsevier Ltd. All rights reserved.
Fang, Quan; Guo, Songxue; Zhou, Hanlei; Han, Rui; Wu, Pan; Han, Chunmao
2017-01-01
Burn-wound progression can occur in the initial or peri-burn area after a deep burn injury. The stasis zone has a higher risk of deterioration mediated by multiple factors but is also considered salvageable. Astaxanthin (ATX), which is extracted from some marine organisms, is a natural compound with a strong antioxidant effect that has been reported to attenuate organ injuries caused by traumatic injuries. Hence, we investigated the potential effects of ATX on preventing early burn-wound progression. A classic “comb” burn rat model was established in this study for histological and biological assessments, which revealed that ATX, particularly higher doses, alleviated histological deterioration in the stasis zone. Additionally, we observed dose-dependent improvements in oxidative stress and the release of inflammatory mediators after ATX treatment. Furthermore, ATX dose-dependently attenuated burn-induced apoptosis in the wound areas, and this effect was accompanied by increases in Akt and Bad phosphorylation and a downregulation of cytochrome C and caspase expression. In addition, the administration of Ly 294002 further verified the effect of ATX. In summary, we demonstrated that ATX protected against early burn-wound progression in a rat deep-burn model. This protection might be mediated by the attenuation of oxidative stress-induced inflammation and mitochondria-related apoptosis. PMID:28128352
Palacios, B; Montero, M J; Sevilla, M A; Román, L S
1995-05-01
1. JB-9322 is a selective histamine H2-receptor antagonist with gastric antisecretory activity and mucosal protective properties. 2. The affinity of JB-9322 for the guinea-pig atria histamine H2-receptor was approximately 2 times greater than that of ranitidine. 3. In vivo, the ID50 value for the inhibition of gastric acid secretion in pylorus-ligated rats was 5.28 mg kg-1 intraperitoneally. JB-9322 also dose-dependently inhibited gastric juice volume and pepsin secretion. In gastric lumen-perfused rats, intravenous injection of JB-9322 dose-dependently reduced histamine-, pentagastrin- and carbachol-stimulated gastric acid secretion. 4. JB-9322 showed antiulcer activity against aspirin and indomethacin-induced gastric lesions and was more potent than ranitidine. 5. JB-9322 effectively inhibited macroscopic gastric haemorrhagic lesions induced by ethanol. Intraperitoneal injection was effective in preventing the lesions as well as oral treatment. The oral ID50 value for these lesions was 1.33 mg kg-1. By contrast, ranitidine (50 mg kg-1) failed to reduce these lesions. In addition, the protective effect of JB-9322 was independent of prostaglandin synthesis. 6. These results indicate that JB-9322 is a new antiulcer drug that exerts a potent cytoprotective effect in addition to its gastric antisecretory activity.
Paiva, Rodrigo José Oliveira; Brites, Ricardo Seixas; Machado, Ricardo Bomfim
2015-01-01
Global efforts to avoid anthropogenic conversion of natural habitat rely heavily on the establishment of protected areas. Studies that evaluate the effectiveness of these areas with a focus on preserving the natural habitat define effectiveness as a measure of the influence of protected areas on total avoided conversion. Changes in the estimated effectiveness are related to local and regional differences, evaluation methods, restriction categories that include the protected areas, and other characteristics. The overall objective of this study was to evaluate the effectiveness of protected areas to prevent the advance of the conversion of natural areas in the core region of the Brazil’s Cerrado Biome, taking into account the influence of the restriction degree, governmental sphere, time since the establishment of the protected area units, and the size of the area on the performance of protected areas. The evaluation was conducted using matching methods and took into account the following two fundamental issues: control of statistical biases caused by the influence of covariates on the likelihood of anthropogenic conversion and the non-randomness of the allocation of protected areas throughout the territory (spatial correlation effect) and the control of statistical bias caused by the influence of auto-correlation and leakage effect. Using a sample design that is not based on ways to control these biases may result in outcomes that underestimate or overestimate the effectiveness of those units. The matching method accounted for a bias reduction in 94–99% of the estimation of the average effect of protected areas on anthropogenic conversion and allowed us to obtain results with a reduced influence of the auto-correlation and leakage effects. Most protected areas had a positive influence on the maintenance of natural habitats, although wide variation in this effectiveness was dependent on the type, restriction, governmental sphere, size and age group of the unit. PMID:26222140
Li, Huaping; Jiang, Na; Liang, Bihua; Liu, Qing; Zhang, Erting; Peng, Liqian; Deng, Huiyan; Li, Runxiang; Li, Zhenjie; Zhu, Huilan
2017-11-01
Ultraviolet B (UVB) irradiation is the initial etiological factor for various skin disorders, including erythema, sunburn, photoaging, and photocarcinogenesis. Pterostilbene (Pter) displayed remarkable antioxidant, anti-inflammatory, and anticarcinogenic activities. This study aimed to investigate the effective mechanism of Pter against UVB-induced photodamage in immortalized human keratinocytes. Human keratinocytes were pretreated with Pter (5 and 10 μM) for 24 h prior to UVB irradiation (300 mJ/cm 2 ). Harvested cells were analyzed by MTT, DCFH-DA, comet, western blotting, luciferase promoter, small interference RNA transfection, and quantitative real-time polymerase chain reaction assay. Pter significantly attenuated UVB-induced cell death and reactive oxygen species (ROS) generation, and effectively increased nuclear translocation of NF-E2-related factor-2 (Nrf2), expression of Nrf2-dependent antioxidant enzymes, and DNA repair activity. Moreover, the protective effects of Pter were abolished by small interference RNA-mediated Nrf2 silencing. Furthermore, Pter was also found to induce the phosphorylation of Nrf2 and the known phosphatidylinositol-3-kinase (PI3K) phosphorylated kinase, Akt. The specific inhibitor of PI3K, LY294002, successfully abrogated Pter-induced Nrf2 phosphorylation, activation of Nrf2-antioxidant response element pathway, ROS scavenging ability, and DNA repair activity. The present study indicated that Pter effectively protected against UVB-induced photodamage by increasing endogenous defense mechanisms, scavenging UVB-induced ROS, and aiding in damaged DNA repair through a PI3K-dependent activation of Nrf2/ARE pathway.
Holubar, Marisa; Stavroulakis, Maria Christina; Maldonado, Yvonne; Ioannidis, John P A; Contopoulos-Ioannidis, Despina
2017-01-01
Inclusion of vaccine herd-protection effects in cost-effectiveness analyses (CEAs) can impact the CEAs-conclusions. However, empirical epidemiologic data on the size of herd-protection effects from original studies are limited. We performed a quantitative comparative analysis of the impact of herd-protection effects in CEAs for four childhood vaccinations (pneumococcal, meningococcal, rotavirus and influenza). We considered CEAs reporting incremental-cost-effectiveness-ratios (ICERs) (per quality-adjusted-life-years [QALY] gained; per life-years [LY] gained or per disability-adjusted-life-years [DALY] avoided), both with and without herd protection, while keeping all other model parameters stable. We calculated the size of the ICER-differences without vs with-herd-protection and estimated how often inclusion of herd-protection led to crossing of the cost-effectiveness threshold (of an assumed societal-willingness-to-pay) of $50,000 for more-developed countries or X3GDP/capita (WHO-threshold) for less-developed countries. We identified 35 CEA studies (20 pneumococcal, 4 meningococcal, 8 rotavirus and 3 influenza vaccines) with 99 ICER-analyses (55 per-QALY, 27 per-LY and 17 per-DALY). The median ICER-absolute differences per QALY, LY and DALY (without minus with herd-protection) were $15,620 (IQR: $877 to $48,376); $54,871 (IQR: $787 to $115,026) and $49 (IQR: $15 to $1,636) respectively. When the target-vaccination strategy was not cost-saving without herd-protection, inclusion of herd-protection always resulted in more favorable results. In CEAs that had ICERs above the cost-effectiveness threshold without herd-protection, inclusion of herd-protection led to crossing of that threshold in 45% of the cases. This impacted only CEAs for more developed countries, as all but one CEAs for less developed countries had ICERs below the WHO-cost-effectiveness threshold even without herd-protection. In several analyses, recommendation for the adoption of the target vaccination strategy depended on the inclusion of the herd protection effect. Inclusion of herd-protection effects in CEAs had a substantial impact in the estimated ICERs and made target-vaccination strategies more attractive options in almost half of the cases where ICERs were above the societal-willingness to pay threshold without herd-protection. More empirical epidemiologic data are needed to determine the size of herd-protection effects across diverse settings and also the size of negative vaccine effects, e.g. from serotype substitution.
Maldonado, Yvonne; Ioannidis, John P. A.; Contopoulos-Ioannidis, Despina
2017-01-01
Background Inclusion of vaccine herd-protection effects in cost-effectiveness analyses (CEAs) can impact the CEAs-conclusions. However, empirical epidemiologic data on the size of herd-protection effects from original studies are limited. Methods We performed a quantitative comparative analysis of the impact of herd-protection effects in CEAs for four childhood vaccinations (pneumococcal, meningococcal, rotavirus and influenza). We considered CEAs reporting incremental-cost-effectiveness-ratios (ICERs) (per quality-adjusted-life-years [QALY] gained; per life-years [LY] gained or per disability-adjusted-life-years [DALY] avoided), both with and without herd protection, while keeping all other model parameters stable. We calculated the size of the ICER-differences without vs with-herd-protection and estimated how often inclusion of herd-protection led to crossing of the cost-effectiveness threshold (of an assumed societal-willingness-to-pay) of $50,000 for more-developed countries or X3GDP/capita (WHO-threshold) for less-developed countries. Results We identified 35 CEA studies (20 pneumococcal, 4 meningococcal, 8 rotavirus and 3 influenza vaccines) with 99 ICER-analyses (55 per-QALY, 27 per-LY and 17 per-DALY). The median ICER-absolute differences per QALY, LY and DALY (without minus with herd-protection) were $15,620 (IQR: $877 to $48,376); $54,871 (IQR: $787 to $115,026) and $49 (IQR: $15 to $1,636) respectively. When the target-vaccination strategy was not cost-saving without herd-protection, inclusion of herd-protection always resulted in more favorable results. In CEAs that had ICERs above the cost-effectiveness threshold without herd-protection, inclusion of herd-protection led to crossing of that threshold in 45% of the cases. This impacted only CEAs for more developed countries, as all but one CEAs for less developed countries had ICERs below the WHO-cost-effectiveness threshold even without herd-protection. In several analyses, recommendation for the adoption of the target vaccination strategy depended on the inclusion of the herd protection effect. Conclusions Inclusion of herd-protection effects in CEAs had a substantial impact in the estimated ICERs and made target-vaccination strategies more attractive options in almost half of the cases where ICERs were above the societal-willingness to pay threshold without herd-protection. More empirical epidemiologic data are needed to determine the size of herd-protection effects across diverse settings and also the size of negative vaccine effects, e.g. from serotype substitution. PMID:28249046
Sellbrant, I; Brattwall, M; Jildenstål, P; Warren-Stomberg, M; Forsberg, S; Jakobsson, J G
2016-10-01
Available general and local anaesthetics, third generation inhaled anaesthetics, propofol and amide class local anaesthetics are effective and reassuringly safe. They are all associated to low incidence of toxicology and or adverse-effects. There is however a debate whether anaesthetic drug and technique could exhibit effects beyond the primary effects; fully reversible depression of the central nervous system, dose dependent anaesthesia. Anaesthetics may be involved in the progression of neurocognitive side effects seen especially in the elderly after major surgery, so called Postoperative Cognitive Dysfunction. On the other hand anaesthetics may exhibit organ protective potential, reducing ischemia reperfusion injury and improving survival after cardiac surgery. Anaesthetics and anaesthetic technique may also have effects of cancer reoccurrence and risk for metastasis. The present paper provides an update around the evidence base around anaesthesia potential contributing effect on the occurrence of postoperative cognitive adverse-effects, organ protective properties and influence on cancer re-occurrence/metastasis. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.
Campbell, Adam M; Park, Collin R; Zoladz, Phillip R; Muñoz, Carmen; Fleshner, Monika; Diamond, David M
2008-02-01
Extensive research has shown that the antidepressant tianeptine blocks the adverse effects of chronic stress on hippocampal functioning. The current series of experiments extended this area of investigation by examining the influence of tianeptine on acute stress-induced impairments of spatial (hippocampus-dependent) memory. Tianeptine (10 mg/kg, ip) administered to adult male rats before, but not after, water maze training blocked the amnestic effects of predator stress (occurring between training and retrieval) on memory. The protective effects of tianeptine on memory occurred in rats which had extensive pre-stress training, as well as in rats which had only a single day of training. Tianeptine blocked stress effects on memory without altering the stress-induced increase in corticosterone levels. Propranolol, a beta-adrenergic receptor antagonist (5 and 10 mg/kg, ip), in contrast, did not block stress-induced amnesia. These findings indicate that treatment with tianeptine, unlike propanolol, provides an effective means with which to block the adverse effects of stress on cognitive functions of the hippocampus.
Skeer, Margie R; Ballard, Erica L
2013-07-01
Regular family meals have been shown to reduce adolescents' engagement in various risk behaviors. In this article, we comprehensively examine the literature to review the association between family meals and eight adolescent risk outcomes: alcohol, tobacco, marijuana and other drugs; aggressive and/or violent behaviors; poor school performance; sexual behavior; mental health problems; and disordered eating patterns. The majority of the studies reviewed found associations in the relationship between family meals and adolescents' risk profiles. More specifically, studies reporting significant associations found that adolescents who frequently ate meals with their family and/or parents were less likely to engage in risk behaviors when compared to peers who never or rarely ate meals with their families. Additionally, the influence of family meal frequency on youth risk outcomes appears to be dependent on gender, with family meals being a protective factor for females and males differently, depending on the outcome examined. However, the studies available about family meals and adolescent risk only examined the effect of family meal frequency, and not other components of family meals that contribute to the protective effect, and, thus, hinder the understanding of the mechanisms unique to family meals' protective characteristics. Regardless of these limitations, the studies examined indicate that family meals may be protective and, therefore, have practical implications for parents, clinicians, and organizations looking to reduce adolescent risk behaviors. However, further examination is needed to better understand the mechanisms that contribute to the protective effect afforded by family meal frequency on adolescents.
Tasduq, Sheikh A; Kaiser, Peerzada J; Gupta, Bishan D; Gupta, Vijay K; Johri, Rakesh K
2008-01-01
AIM: To evaluate the protective effect of 2'-p-hydroxybenzoylmussaenosidic acid [negundoside (NG), against carbon tetrachloride (CCl4)-induced toxicity in HuH-7 cells. METHODS: CCl4 is a well characterized hepatotoxin, and inducer of cytochrome P450 2E1 (CYP2E1)-mediated oxidative stress. In addition, lipid peroxidation and accumulation of intracellular calcium are important steps in the pathway involved in CCl4 toxicity. Liver cells (HuH-7) were treated with CCl4, and the mechanism of the cytoprotective effect of NG was assessed. Silymarin, a known hepatoprotective drug, was used as control. RESULTS: NG protected HuH-7 cells against CCl4 toxicity and loss of viability without modulating CYP2E1 activity. Prevention of CCl4 toxicity was associated with a reduction in oxidative damage as reflected by decreased generation of reactive oxygen species (ROS), a decrease in lipid peroxidation and accumulation of intracellular Ca2+ levels and maintenance of intracellular glutathione homeostasis. Decreased mitochondrial membrane potential (MMP), induction of caspases mediated DNA fragmentation and cell cycle arrest, as a result of CCl4 treatment, were also blocked by NG. The protection afforded by NG seemed to be mediated by activation of cyclic adenosine monophosphate (cAMP) synthesis and inhibition of phospholipases (cPLA2). CONCLUSION: NG exerts a protective effect on CYP2E1-dependent CCl4 toxicity via inhibition of lipid peroxidation, followed by an improved intracellular calcium homeostasis and inhibition of Ca2+-dependent proteases. PMID:18595136
Hoving, Jennifer C.; Nieuwenhuizen, Natalie; McSorley, Henry J.; Ndlovu, Hlumani; Bobat, Saeeda; Kimberg, Matti; Kirstein, Frank; Cutler, Anthony J.; DeWals, Benjamin; Cunningham, Adam F.; Brombacher, Frank
2013-01-01
In this study, B cell function in protective TH2 immunity against N. brasiliensis infection was investigated. Protection against secondary infection depended on IL-4Rα and IL-13; but not IL-4. Protection did not associate with parasite specific antibody responses. Re-infection of B cell-specific IL-4Rα−/− mice resulted in increased worm burdens compared to control mice, despite their equivalent capacity to control primary infection. Impaired protection correlated with reduced lymphocyte IL-13 production and B cell MHC class II and CD86 surface expression. Adoptive transfer of in vivo N. brasiliensis primed IL-4Rα expressing B cells into naïve BALB/c mice, but not IL-4Rα or IL-13 deficient B cells, conferred protection against primary N. brasiliensis infection. This protection required MHC class II compatibility on B cells suggesting cognate interactions by B cells with CD4+ T cells were important to co-ordinate immunity. Furthermore, the rapid nature of these protective effects by B cells suggested non-BCR mediated mechanisms, such as via Toll Like Receptors, was involved, and this was supported by transfer experiments using antigen pulsed Myd88−/− B cells. These data suggest TLR dependent antigen processing by IL-4Rα-responsive B cells producing IL-13 contribute significantly to CD4+ T cell-mediated protective immunity against N. brasiliensis infection. PMID:24204255
Kok, Lotte; Hillegers, Manon H; Veldhuijzen, Dieuwke S; Boks, Marco Pm; Dieleman, Jan M; van Dijk, Diederik; Joëls, Marian; Vinkers, Christiaan H
2018-08-01
The glucocorticoid receptor (GR) agonist dexamethasone is frequently used for its anti-inflammatory properties. We recently showed that a single high-dose of dexamethasone had long-lasting protective effects on the development of psychopathology after cardiac surgery and postoperative intensive care unit stay. In this study, we investigated whether common genetic variation in the hypothalamic-pituitary-adrenal (HPA)-axis would influence the susceptibility for PTSD and depression after dexamethasone administration. Participants (n = 996) of the Dexamethasone for Cardiac Surgery (DECS) randomized clinical trial were followed after receiving a single high intraoperative dose of dexamethasone (1 mg/kg), a GR agonist, or placebo. PTSD and depressive symptoms were assessed up to four years after cardiac surgery. We focused primarily on five common single nucleotide polymorphisms (SNPs) in the glucocorticoid receptor (GR). Secondarily, we comprehensively assessed common genetic variation in the FK506 binding protein (FKBP5) and the mineralocorticoid receptor (MR). The protective effects of dexamethasone on postoperative PTSD symptoms were dependent on the GR polymorphisms rs41423247 (p = .009), rs10052957 (p = .003), and rs6189 (p = .002), but not on rs6195 (p = .025) or rs6198, (p = .026) after Bonferroni correction. No genotype-dependent effects were found for postoperative depressive symptoms. Also, no associations of FKBP5 and MR polymorphisms were found on PTSD and depression outcomes. Protective effects of dexamethasone on PTSD symptoms after cardiac surgery and ICU stay seem to depend on common genetic variation in its target receptor, the GR. These effects indicate that pre-operative genetic screening could potentially help in stratifying patients for their vulnerability for developing PTSD symptoms after surgery. Copyright © 2018. Published by Elsevier Ltd.
Zeng, Zhiwen; Wang, Haitao; Shang, Fu; Zhou, Lihua; Little, Peter J; Quirion, Remi; Zheng, Wenhua
2016-03-01
Lithium is currently used in the treatment of mental illness. We have previously reported that lithium stimulated the protein kinase B/Forkhead box O1 (Akt/FoxO1) pathway in rats. However, little information is available regarding its neuroprotective role of this pathway and underlying mechanisms. PC12 cells treated with serum deprivation were used as a toxicity model to study the protective effect of lithium and its underlying mechanisms. Cell viability was determined by methyl thiazolyl tetrazolium assay and Hoechst staining. FoxO1 subcellular location and its overexpression were used to study the underlying mechanisms. Various pathway inhibitors were used to investigate the possible pathways, while the phosphorylation of Akt and FoxO1 was analyzed by Western blot. Lithium pretreatment dose-dependently reduced PC12 cell apoptosis induced by serum starvation. The protective effect of lithium was abolished by LY294002, a PI3K-specific inhibitor, and Akt inhibitor Akt inhibitor VIII, whereas mitogen-activated protein kinase kinase (MEK kinase) inhibitor U0126 had no effect. Lithium induced the phosphorylation of Akt and FoxO1 in a time- and concentration-dependent manner. Lithium-induced phosphorylation of Akt and FoxO1 is mediated by the PI3K/Akt pathway. Serum deprivation caused nuclear translocation of FoxO1 while application of lithium reversed the effect of serum deprivation. Moreover, overexpression of FoxO1 enhanced cell apoptosis induced by serum withdrawal. Finally, lithium was found to reduce the exogenous and endogenous FoxO1 protein levels in PC12 cells in a concentration-dependent fashion. The protective effect of lithium against serum starvation cell death is mediated by the PI3K/Akt/FoxO1 pathway.
LL-37 attenuates inflammatory impairment via mTOR signaling-dependent mitochondrial protection.
Sun, Wenyan; Zheng, Yan; Lu, Zhuoyang; Wang, Hui; Feng, Zhihui; Wang, Juan; Xiao, Shengxiang; Liu, Feng; Liu, Jiankang
2014-09-01
The human cationic antimicrobial protein LL-37 is a multifunctional host defense peptide with a wide range of immunomodulatory activities. Previous work has shown that LL-37 exerts both pro- and anti-inflammatory effects. The role of mitochondria in the skin inflammatory effects of LL-37 has not been well studied. Therefore, our aim was to investigate the immunomodulatory effect of LL-37 in HaCaT cells and to delineate the underlying mechanisms related to mitochondrial function. Immunohistochemistry results from tissue microarrays showed strong cytoplasmic LL-37 staining in inflammatory cells in chronic dermatic inflammation. Using exogenous LL-37 stimulation and LL-37 knockdown and overexpression, LL-37 was demonstrated to dramatically reduce the mRNA levels and protein secretion of inflammatory cytokines including IL-6, IL-8, IL-1α and tumor necrosis factor-α (TNF-α), which are induced by lipopolysaccharides (LPS). The anti-inflammatory effects of LL-37 are dependent upon its ability to increase mitochondrial biogenesis and to maintain mitochondrial homeostasis. Furthermore, we observed that LL-37 enhances the LPS-induced phosphorylation of extracellular signal-regulated kinase (ERK1/2) and mammalian target of rapamycin (mTOR). The mTOR inhibitor rapamycin can neutralize the protective effects of LL-37 on mitochondria. In conclusion, these results suggest that high LL-37 expression levels correlate with chronic skin inflammation; mitochondrial dysfunction occurs in HaCaT cells during inflammation; and LL-37 attenuates inflammatory impairment by stimulating mitochondrial biogenesis and protecting mitochondrial function, which are dependent upon mTOR signaling. These findings provide new insights into targeting mitochondria with LL-37 to prevent skin inflammatory reactions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Xu, K; Di Luca, D G; Orrú, M; Xu, Y; Chen, J-F; Schwarzschild, M A
2016-05-13
Considerable epidemiological and laboratory data have suggested that caffeine, a nonselective adenosine receptor antagonist, may protect against the underlying neurodegeneration of parkinson's disease (PD). Although both caffeine and more specific antagonists of the A2A subtype of adenosine receptor (A2AR) have been found to confer protection in animal models of PD, the dependence of caffeine's neuroprotective effects on the A2AR is not known. To definitively determine its A2AR dependence, the effect of caffeine on 1-methyl-4-phenyl-1,2,3,6 tetra-hydropyridine (MPTP) neurotoxicity was compared in wild-type (WT) and A2AR gene global knockout (A2A KO) mice, as well as in central nervous system (CNS) cell type-specific (conditional) A2AR knockout (cKO) mice that lack the receptor either in postnatal forebrain neurons or in astrocytes. In WT and in heterozygous A2AR KO mice caffeine pretreatment (25mg/kgip) significantly attenuated MPTP-induced depletion of striatal dopamine. By contrast in homozygous A2AR global KO mice caffeine had no effect on MPTP toxicity. In forebrain neuron A2AR cKO mice, caffeine lost its locomotor stimulant effect, whereas its neuroprotective effect was mostly preserved. In astrocytic A2AR cKO mice, both caffeine's locomotor stimulant and protective properties were undiminished. Taken together, these results indicate that neuroprotection by caffeine in the MPTP model of PD relies on the A2AR, although the specific cellular localization of these receptors remains to be determined. Copyright © 2016 IBRO. All rights reserved.
Antioxidants in Photosynthesis and Human Nutrition
NASA Astrophysics Data System (ADS)
Demmig-Adams, Barbara; Adams, William W.
2002-12-01
The harnessing of solar energy by photosynthesis depends on a safety valve that effectively eliminates hazardous excess energy and prevents oxidative damage to the plant cells. Many of the compounds that protect plant cells also protect human cells. Improving plant resistance to stress may thus have the beneficial side effect of also improving the nutritional quality of plants in the human diet. The pathways that synthesize these compounds are becoming amenable to genetic manipulation, which may yield benefits as widespread as improved plant stress tolerance and improved human physical and mental health.
The big picture: does colonoscopy work?
Hewett, David G; Rex, Douglas K
2015-04-01
Colonoscopy for average-risk colorectal cancer screening has transformed the practice of gastrointestinal medicine in the United States. However, although the dominant screening strategy, its use is not supported by randomized controlled trials. Observational data do support a protective effect of colonoscopy and polypectomy on colorectal cancer incidence and mortality, but the level of protection in the proximal colon is variable and operator-dependent. Colonoscopy by high-level detectors remains highly effective, and ongoing quality improvement initiatives should consider regulatory factors that motivate changes in physician behavior. Copyright © 2015 Elsevier Inc. All rights reserved.
Salameh, P; Salamé, J; Waked, M; Barbour, B; Zeidan, N; Baldi, I
2014-02-14
The objective of this study was to measure the correlates, including normative beliefs, associated with waterpipe (WP) and cigarette smoking prevalence and dependence. A cross-sectional study was carried out using a proportionate cluster sample of Lebanese students in 17 public and private universities. Of the 4900 distributed questionnaires, 3384 (69.1%) were returned to the field worker. All available students during break times were approached, with no exclusion criteria. sociodemographic variables, detailed active and passive smoking, in addition to items of the tobacco dependence scales were all evaluated. Correlates to WP smoking were studying in a private university (adjusted OR, aOR=1.50 (1.26 to 1.79); p<0.001) and ever smoking cigarettes (aOR=1.80(1.44 to 2.26); p<0.001); friends' and societal influence were found on smoking behaviour and dependence. Although the role of parents was not visible in decreasing the risk of smoking WP, their protective influence seemed more important on WP dependence (β=-1.09(-1.79 to -0.28); p<0.001), a behaviour that is considered more deleterious for health. Parents' and friends' disagreement with smoking had a protective effect on cigarette smoking and dependence (aOR<1; p<0.01), while thinking that idols and successful people smoke increased the risk of both cigarette smoking and dependence (aOR>1; p<0.01). In conclusion, WP smoking and dependence are influenced by parents' and friends' opinions, and idols' smoking status. Future research is necessary to further improve our understanding of motives for WP smoking and dependence.
Su, Hongyan; Li, Jingyuan; Chen, Tongshuai; Li, Na; Xiao, Jie; Wang, Shujian; Guo, Xiaobin; Yang, Yi; Bu, Peili
2016-11-01
Melatonin is well known for its cardioprotective effects; however, whether melatonin exerts therapeutic effects on cardiomyocyte hypertrophy remains to be investigated, as do the mechanisms underlying these effects, if they exist. Cyclophilin A (CyPA) and its corresponding receptor, CD147, which exists in a variety of cells, play crucial roles in modulating reactive oxygen species (ROS) production. In this study, we explored the role of the CyPA/CD147 signaling pathway in angiotensin II (Ang II)-induced cardiomyocyte hypertrophy and the protective effects exerted by melatonin against Ang II-induced injury in cultured H9C2 cells. Cyclosporine A, a specific CyPA/CD147 signaling pathway inhibitor, was used to manipulate CyPA/CD147 activity. H9C2 cells were then subjected to Ang II or CyPA treatment in either the absence or presence of melatonin. Our results indicate that Ang II induces cardiomyocyte hypertrophy through the CyPA/CD147 signaling pathway and promotes ROS production, which can be blocked by melatonin pretreatment in a concentration-dependent manner, in cultured H9C2 cells and that CyPA/CD147 signaling pathway inhibition protects against Ang II-induced cardiomyocyte hypertrophy. The protective effects of melatonin against Ang II-induced cardiomyocyte hypertrophy depend at least partially on CyPA/CD147 inhibition.
Vaur, Pauline; Brugg, Bernard; Mericskay, Mathias; Li, Zhenlin; Schmidt, Mark S; Vivien, Denis; Orset, Cyrille; Jacotot, Etienne; Brenner, Charles; Duplus, Eric
2017-12-01
NAD + depletion is a common phenomenon in neurodegenerative pathologies. Excitotoxicity occurs in multiple neurologic disorders and NAD + was shown to prevent neuronal degeneration in this process through mechanisms that remained to be determined. The activity of nicotinamide riboside (NR) in neuroprotective models and the recent description of extracellular conversion of NAD + to NR prompted us to probe the effects of NAD + and NR in protection against excitotoxicity. Here, we show that intracortical administration of NR but not NAD + reduces brain damage induced by NMDA injection. Using cortical neurons, we found that provision of extracellular NR delays NMDA-induced axonal degeneration (AxD) much more strongly than extracellular NAD + Moreover, the stronger effect of NR compared to NAD + depends of axonal stress since in AxD induced by pharmacological inhibition of nicotinamide salvage, both NAD + and NR prevent neuronal death and AxD in a manner that depends on internalization of NR. Taken together, our findings demonstrate that NR is a better neuroprotective agent than NAD + in excitotoxicity-induced AxD and that axonal protection involves defending intracellular NAD + homeostasis.-Vaur, P., Brugg, B., Mericskay, M., Li, Z., Schmidt, M. S., Vivien, D., Orset, C., Jacotot, E., Brenner, C., Duplus, E. Nicotinamide riboside, a form of vitamin B 3 , protects against excitotoxicity-induced axonal degeneration. © FASEB.
Yu, Liming; Liang, Hongliang; Lu, Zhihong; Zhao, Guolong; Zhai, Mengen; Yang, Yang; Yang, Jian; Yi, Dinghua; Chen, Wensheng; Wang, Xiaowu; Duan, Weixun; Jin, Zhenxiao; Yu, Shiqiang
2015-11-01
Melatonin confers profound protective effect against myocardial ischemia-reperfusion injury (MI/RI). Activation of Notch1/Hairy and enhancer of split 1 (Hes1) signaling also ameliorates MI/RI. We hypothesize that melatonin attenuates MI/RI-induced oxidative damage by activating Notch1/Hes1 signaling pathway with phosphatase and tensin homolog deleted on chromosome 10 (Pten)/Akt acting as the downstream signaling pathway in a melatonin membrane receptor-dependent manner. Male Sprague Dawley rats were treated with melatonin (10 mg/kg/day) for 4 wk and then subjected to MI/R surgery. Melatonin significantly improved cardiac function and decreased myocardial apoptosis and oxidative damage. Furthermore, in cultured H9C2 cardiomyocytes, melatonin (100 μmol/L) attenuated simulated ischemia-reperfusion (SIR)-induced myocardial apoptosis and oxidative damage. Both in vivo and in vitro study demonstrated that melatonin treatment increased Notch1, Notch1 intracellular domain (NICD), Hes1, Bcl-2 expressions, and p-Akt/Akt ratio and decreased Pten, Bax, and caspase-3 expressions. However, these protective effects conferred by melatonin were blocked by DAPT (the specific inhibitor of Notch1 signaling), luzindole (the antagonist of melatonin membrane receptors), Notch1 siRNA, or Hes1 siRNA administration. In summary, our study demonstrates that melatonin treatment protects against MI/RI by modulating Notch1/Hes1 signaling in a receptor-dependent manner and Pten/Akt signaling pathways are key downstream mediators. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Interactions among predators and plant specificity protect herbivores from top predators.
Bosc, Christopher; Pauw, Anton; Roets, Francois; Hui, Cang
2018-05-04
The worldwide loss of top predators from natural and agricultural systems has heightened the need to understand how important they are in controlling herbivore abundance. The effect of top predators on herbivore species is likely to depend on 1) the importance of the consumption of intermediate predators by top predators (intra-guild predation; IGP), but also on 2) plant specificity by herbivores, because specialists may defend themselves better (enemy-free space; EFS). Insectivorous birds, as top predators, are generally known to effectively control herbivorous insects, despite also consuming intermediate predators such as spiders, but how this effect varies among herbivore species in relation to the cascading effects of IGP and EFS is not known. To explore this, we excluded birds from natural fynbos vegetation in South Africa using large netted cages and recorded changes in abundance relative to control plots for 199 plant-dwelling intermediate predator and 341 herbivore morpho-species that varied in their estimated plant specificity. We found a strong negative effect of birds on the total abundance of all intermediate predators, with especially clear effects on spiders (strong IGP). In contrast with previous studies, which document a negative effect of birds on herbivores, we found an overall neutral effect of birds on herbivore abundance, but the effect varied among species: some species were negatively affected by birds, suggesting that they were mainly consumed by birds, whereas others, likely released from spiders by IGP, were positively affected. Some species were also effectively neutrally affected by birds. These tended to be more specialized to plants compared to the other species, which may imply that some plant specialists benefited from protection provided by EFS from both birds and spiders. These results suggest that the response of herbivore species to top predators may depend on cascading effects of interactions among predators and on their degree of plant specificity. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Snail/beta-catenin signaling protects breast cancer cells from hypoxia attack
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scherbakov, Alexander M., E-mail: alex.scherbakov@gmail.com; Stefanova, Lidia B.; Sorokin, Danila V.
2013-12-10
The tolerance of cancer cells to hypoxia depends on the combination of different factors – from increase of glycolysis (Warburg Effect) to activation of intracellular growth/apoptotic pathways. Less is known about the influence of epithelial–mesenchymal transition (EMT) and EMT-associated pathways on the cell sensitivity to hypoxia. The aim of this study was to explore the role of Snail signaling, one of the key EMT pathways, in the mediating of hypoxia response and regulation of cell sensitivity to hypoxia, using as a model in vitro cultured breast cancer cells. Earlier we have shown that estrogen-independent HBL-100 breast cancer cells differ frommore » estrogen-dependent MCF-7 cells with increased expression of Snail1, and demonstrated Snail1 involvement into formation of hormone-resistant phenotype. Because Snail1 belongs to hypoxia-activated proteins, here we studied the influence of Snail1 signaling on the cell tolerance to hypoxia. We found that Snail1-enriched HBL-100 cells were less sensitive to hypoxia-induced growth suppression if compared with MCF-7 line (31% MCF-7 vs. 71% HBL-100 cell viability after 1% O{sub 2} atmosphere for 3 days). Snail1 knock-down enhanced the hypoxia-induced inhibition of cell proliferation giving the direct evidence of Snail1 involvement into cell protection from hypoxia attack. The protective effect of Snail1 was shown to be mediated, at least in a part, via beta-catenin which positively regulated expression of HIF-1-dependent genes. Finally, we found that cell tolerance to hypoxia was accompanied with the failure in the phosphorylation of AMPK – the key energy sensor, and demonstrated an inverse relationship between AMPK and Snail/beta-catenin signaling. Totally, our data show that Snail1 and beta-catenin, besides association with loss of hormone dependence, protect cancer cells from hypoxia and may serve as an important target in the treatment of breast cancer. Moreover, we suggest that the level of these proteins as well the level of AMPK phosphorylation may be considered as predictors of the tumor sensitivity to anti-angiogenic drugs. - Highlights: • Snail1 protects breast cancer cells from hypoxia. • Protective effect of Snail1 is mediated via β-catenin/HIF-1 pathway. • Snail/β-catenin signaling is negatively controlled by the energy sensor – AMPK. • The failure in AMPK phosphorylation drives cells to the hypoxia-tolerant state.« less
2016-11-28
olivocochlear reflex (MOCR), a feedback mechanism that controls gain of the outer hair cells, is thought to provide protection and enhancement for a listener in...effectively reduce the outer hair cell gain, depending on the stimulus frequency, level, and timing. Human Envelope Following Responses (EFRs
The acute toxicity oftoluene, a model volatile organic compound (VOC), depends on the concentration (C) and duration (t) ofexposure, and guidelines for acute exposures have traditionally used ext relationships to extrapolate protective and/or effective concentrations across durat...
A missing dimension in measures of vaccination impacts
Gomes, M. Gabriela M.; Lipsitch, Marc; Wargo, Andrew R.; Kurath, Gael; Rebelo, Carlota; Medley, Graham F.; Coutinho, Antonio
2013-01-01
Immunological protection, acquired from either natural infection or vaccination, varies among hosts, reflecting underlying biological variation and affecting population-level protection. Owing to the nature of resistance mechanisms, distributions of susceptibility and protection entangle with pathogen dose in a way that can be decoupled by adequately representing the dose dimension. Any infectious processes must depend in some fashion on dose, and empirical evidence exists for an effect of exposure dose on the probability of transmission to mumps-vaccinated hosts [1], the case-fatality ratio of measles [2], and the probability of infection and, given infection, of symptoms in cholera [3]. Extreme distributions of vaccine protection have been termed leaky (partially protects all hosts) and all-or-nothing (totally protects a proportion of hosts) [4]. These distributions can be distinguished in vaccine field trials from the time dependence of infections [5]. Frailty mixing models have also been proposed to estimate the distribution of protection from time to event data [6], [7], although the results are not comparable across regions unless there is explicit control for baseline transmission [8]. Distributions of host susceptibility and acquired protection can be estimated from dose-response data generated under controlled experimental conditions [9]–[11] and natural settings [12], [13]. These distributions can guide research on mechanisms of protection, as well as enable model validity across the entire range of transmission intensities. We argue for a shift to a dose-dimension paradigm in infectious disease science and community health.
Effect of emulsification on the skin permeation and UV protection of catechin.
Yoshino, Sachie; Mitoma, Tomoaki; Tsuruta, Keiko; Todo, Hiroaki; Sugibayashi, Kenji
2014-06-01
An anti-aging effect may be obtained by skin application of tea catechins (Camellia sinensis) since they have high ultraviolet (UV)-protection activity. In this study, the skin permeation of catechin (C), epicatechin (EC), epigallocatechin (EGC), epicatechin gallate (ECg) and epigallocatechin gallate (EGCg) was determined and compared, and the effect of emulsification on the skin permeation of C was measured. The UV-protective effect of C was also determined. The in vitro skin permeability of each catechin derivative was determined using side-by-side diffusion of cells. The UV-protective effect of C was determined by applying different concentrations of C to the solution or emulsion on a three-dimensional cultured human skin model or normal human epidermal keratinocytes with UV-irradiation. ECg and EGCg with gallate groups showed lower skin permeability than C, EC and EGC without gallate groups, suggesting that the skin permeability of catechin derivatives may be dependent on the existence of a gallate group. Interestingly, the skin permeation of C was increased by an o/w emulsification. In addition, the C emulsion showed a significantly higher UV-protective effect by C than that with its aqueous solution. These results suggest that the o/w emulsion of catechin derivatives is probably useful as a cosmetic formulation with anti-aging efficacy.
A new approach to characterize the effect of fabric deformation on thermal protective performance
NASA Astrophysics Data System (ADS)
Li, Jun; Li, Xiaohui; Lu, Yehu; Wang, Yunyi
2012-04-01
It is very important to evaluate thermal protective performance (TPP) in laboratory-simulated fire scenes as accurately as possible. For this paper, to thoroughly understand the effect of fabric deformation on basic physical properties and TPP of flame-retardant fabrics exposed to flash fire, a new modified TPP testing apparatus was developed. Different extensions were employed to simulate the various extensions displayed during different body motions. The tests were also carried out with different air gaps. The results showed a significant decrease in air permeability after deformation. However, the change of thickness was slight. The fabric deformation had a complicated effect on thermal protection with different air gaps. The change of TPP depended on the balance between the surface contact area and the thermal insulation. The newly developed testing apparatus could be well employed to evaluate the effect of deformation on TPP of flame-resistant fabrics.
Cannabinoids: between neuroprotection and neurotoxicity.
Sarne, Yosef; Mechoulam, Raphael
2005-12-01
Cannabinoids, such as the delta9-tetrahydrocannabinol (THC), present in the cannabis plant, as well as anandamide and 2-arachidonoyl glycerol, produced by the mammalian body, have been shown to protect the brain from various insults and to improve several neurodegenerative diseases. The current review summarizes the evidence for cannabinoid neuroprotection in vivo, and refers to recent in vitro studies, which help elucidate possible molecular mechanisms underlying this protective effect. Some of these mechanisms involve the activation of CB1 and CB2 cannabinoid receptors, while others are not dependent on them. In some cases, protection is due to a direct effect of the cannabinoids on neuronal cells, while in others, it results from their effects on non-neuronal elements within the brain. In many experimental set-ups, cannabinoid neurotoxicity, particularly by THC, resides side by side with neuroprotection. The current review attempts to shed light on this dual activity, and to dissociate between the two contradictory effects.
Apelin-13 Protects against Ischemic Blood-Brain Barrier Damage through the Effects of Aquaporin-4.
Chu, Heling; Yang, Xiaobo; Huang, Chuyi; Gao, Zidan; Tang, Yuping; Dong, Qiang
2017-01-01
Apelin-13 has been found to have protective effects on many neurological diseases, including cerebral ischemia. However, whether Apelin-13 acts on blood-brain barrier (BBB) disruption following cerebral ischemia is largely unknown. Aquaporin-4 (AQP4) has a close link with BBB due to the high concentration in astrocyte foot processes and regulation of astrocytes function. Here, we aimed to test Apelin-13's effects on ischemic BBB injury and examine whether the effects were dependent on AQP4. We detected the expression of AQP4 induced by Apelin-13 injection at 1, 3, and 7 days after middle cerebral artery occlusion. Meanwhile, we examined the effects of Apelin-13 on neurological function, infarct volume, and BBB disruption owing to cerebral ischemia in wild type mice, and tested whether such effects were AQP4 dependent by using AQP4 knock-out mice. Furthermore, we assessed the possible signal transduction pathways activated by Apelin-13 to regulate AQP4 expression via astrocyte cultures. It was found that Apelin-13 highly increased AQP4 expression as well as reduced neurological scores and infarct volume. Importantly, Apelin-13 played a role of BBB protection in both types of mice by reducing BBB permeability, increased vascular endothelial growth factor, upregulated endothelial nitric oxide synthase, and downregulated inducible NOS. In morphology, we demonstrated Apelin-13 suppressed tight junction opening and endothelial cell swelling via electron microscopy detection. Meanwhile, Apelin-13 also alleviated apoptosis of astrocytes and promoted angiogenesis. Interestingly, effects of AQP4 on neurological function and infarct volume varied with time course, while AQP4 elicited protective effects on BBB at all time points. Statistical analysis of 2-way analysis of variance with replication indicated that AQP4 was required for these effects. In addition, Apelin-13 upregulated phosphorylation of extracellular signal-regulated kinase (ERK) and Akt as well as AQP4 protein in cultured astrocytes. The latter was inhibited by ERK and phosphatidylinositol 3'-kinase (PI3K) inhibitors. Our data suggest that Apelin-13 protects BBB from disruption after cerebral ischemia both morphologically and functionally, which is highly associated with the increased levels of AQP4, possibly through the activation of ERK and PI3K/Akt pathways. This study provides double targets to protection of ischemic BBB damage, which can present new insights to drugs development. © 2017 S. Karger AG, Basel.
Amplitude-dependent topological edge states in nonlinear phononic lattices
NASA Astrophysics Data System (ADS)
Pal, Raj Kumar; Vila, Javier; Leamy, Michael; Ruzzene, Massimo
2018-03-01
This work investigates the effect of nonlinearities on topologically protected edge states in one- and two-dimensional phononic lattices. We first show that localized modes arise at the interface between two spring-mass chains that are inverted copies of each other. Explicit expressions derived for the frequencies of the localized modes guide the study of the effect of cubic nonlinearities on the resonant characteristics of the interface, which are shown to be described by a Duffing-like equation. Nonlinearities produce amplitude-dependent frequency shifts, which in the case of a softening nonlinearity cause the localized mode to migrate to the bulk spectrum. The case of a hexagonal lattice implementing a phononic analog of a crystal exhibiting the quantum spin Hall effect is also investigated in the presence of weakly nonlinear cubic springs. An asymptotic analysis provides estimates of the amplitude dependence of the localized modes, while numerical simulations illustrate how the lattice response transitions from bulk-to-edge mode-dominated by varying the excitation amplitude. In contrast with the interface mode of the first example studies, this occurs both for hardening and softening springs. The results of this study provide a theoretical framework for the investigation of nonlinear effects that induce and control topologically protected wave modes through nonlinear interactions and amplitude tuning.
EBOV Protection Is Supported by T Cell-Dependent Humoral Responses But Is Not Requisite for Survival
2016-06-03
EBOV protection is supported by T cell- dependent humoral responses but is not requisite for survival. 1 Christopher L. Cooper, Karen A. Martins...platforms of a requisite role for antibody-5 dependent protection and extensive efforts in development of antibody therapy against lethal EBOV 6... dependent 12 mechanisms. We show that Hiltonol both augmented and sustained eVLP-mediated GC B cell formation 13 and increased antigen-specific B cell
Zauszniewski, Jaclene A; Bekhet, Abir K; Suresky, M Jane
2009-12-01
This study examined the effects of risk and protective factors on resilience in 60 women family members of adults with serious mental illness. Both the risk factors constituting caregiver burden (strain, stigma, client dependence, and family disruption) and protective factors, including eight positive cognitions were found to predict two indicators of resilience: resourcefulness and sense of coherence. The effects of caregiver burden on resourcefulness and sense of coherence were mediated by positive cognitions, lending support to resilience theory and suggesting the need to develop interventions to encourage positive thinking among women caregivers of adults with mental illness.
Kistler, Andreas D.; Singh, Geetika; Altintas, Mehmet M.; Yu, Hao; Fernandez, Isabel C.; Gu, Changkyu; Wilson, Cory; Srivastava, Sandeep Kumar; Dietrich, Alexander; Walz, Katherina; Kerjaschki, Dontscho; Ruiz, Phillip; Dryer, Stuart; Sever, Sanja; Dinda, Amit K.; Faul, Christian; Reiser, Jochen
2013-01-01
Gain-of-function mutations in the calcium channel TRPC6 lead to autosomal dominant focal segmental glomerulosclerosis and podocyte expression of TRPC6 is increased in some acquired human glomerular diseases, particularly in membranous nephropathy. These observations led to the hypothesis that TRPC6 overactivation is deleterious to podocytes through pathological calcium signaling, both in genetic and acquired diseases. Here, we show that the effects of TRPC6 on podocyte function are context-dependent. Overexpression of TRPC6 alone did not directly affect podocyte morphology and cytoskeletal structure. Unexpectedly, however, overexpression of TRPC6 protected podocytes from complement-mediated injury, whereas genetic or pharmacological TRPC6 inactivation increased podocyte susceptibility to complement. Mechanistically, this effect was mediated by Ca2+/calmodulin-dependent protein kinase II (CaMKII) activation. Podocyte-specific TRPC6 transgenic mice showed stronger CaMKII activation, reduced podocyte foot process effacement and reduced levels of proteinuria during nephrotoxic serum nephritis, whereas TRPC6 null mice exhibited reduced CaMKII activation and higher levels of proteinuria compared with wild type littermates. Human membranous nephropathy biopsy samples showed podocyte staining for active CaMKII, which correlated with the degree of TRPC6 expression. Together, these data suggest a dual and context dependent role of TRPC6 in podocytes where acute activation protects from complement-mediated damage, but chronic overactivation leads to focal segmental glomerulosclerosis. PMID:24194522
Lingonberry anthocyanins protect cardiac cells from oxidative-stress-induced apoptosis.
Isaak, Cara K; Petkau, Jay C; Blewett, Heather; O, Karmin; Siow, Yaw L
2017-08-01
Lingonberry grown in northern Manitoba, Canada, contains exceptionally high levels of anthocyanins and other polyphenols. Previous studies from our lab have shown that lingonberry anthocyanins can protect H9c2 cells from ischemia-reperfusion injury and anthocyanin-rich diets have been shown to be associated with decreased cardiovascular disease and mortality. Oxidative stress can impair function and trigger apoptosis in cardiomyocytes. This study investigated the protective effects of physiologically relevant doses of lingonberry extracts and pure anthocyanins against hydrogen-peroxide-induced cell death. Apoptosis and necrosis were detected in H9c2 cells after hydrogen peroxide treatment via flow cytometry using FLICA 660 caspase 3/7 combined with YO-PRO-1 and then confirmed with Hoechst staining and fluorescence microscopy. Each of the 3 major anthocyanins found in lingonberry (cyanidin-3-galactoside, cyanidin-3-glucoside, and cyanidin-3-arabinoside) was protective against hydrogen-peroxide-induced apoptosis in H9c2 cells at 10 ng·mL -1 (20 nmol·L -1 ) and restored the number of viable cells to match the control group. A combination of the 3 anthocyanins was also protective and a lingonberry extract tested at 3 concentrations produced a dose-dependent protective effect. Lingonberry anthocyanins protected cardiac cells from oxidative-stress-induced apoptosis and may have cardioprotective effects as a dietary modification.
Building Capacity for Protected Area Management in Lao PDR
NASA Astrophysics Data System (ADS)
Rao, Madhu; Johnson, Arlyne; Spence, Kelly; Sypasong, Ahnsany; Bynum, Nora; Sterling, Eleanor; Phimminith, Thavy; Praxaysombath, Bounthob
2014-04-01
Declining biodiversity in protected areas in Laos is attributed to unsustainable exploitation of natural resources. At a basic level, an important need is to develop capacity in academic and professional training institutions to provide relevant training to conservation professionals. The paper (a) describes the capacity building approach undertaken to achieve this goal, (b) evaluates the effectiveness of the approach in building capacity for implementing conservation and (c) reviews implementation outcomes. Strong linkages between organizations implementing field conservation, professional training institutions, and relevant Government agencies are central to enhancing effectiveness of capacity building initiatives aimed at improving the practice of conservation. Protected area management technical capacity needs will need to directly influence curriculum design to insure both relevance and effectiveness of training in improving protected area management. Sustainability of capacity building initiatives is largely dependent on the level of interest and commitment by host-country institutions within a supportive Government policy framework in addition to engagement of organizations implementing conservation.
Building capacity for protected area management in Lao PDR.
Rao, Madhu; Johnson, Arlyne; Spence, Kelly; Sypasong, Ahnsany; Bynum, Nora; Sterling, Eleanor; Phimminith, Thavy; Praxaysombath, Bounthob
2014-04-01
Declining biodiversity in protected areas in Laos is attributed to unsustainable exploitation of natural resources. At a basic level, an important need is to develop capacity in academic and professional training institutions to provide relevant training to conservation professionals. The paper (a) describes the capacity building approach undertaken to achieve this goal, (b) evaluates the effectiveness of the approach in building capacity for implementing conservation and (c) reviews implementation outcomes. Strong linkages between organizations implementing field conservation, professional training institutions, and relevant Government agencies are central to enhancing effectiveness of capacity building initiatives aimed at improving the practice of conservation. Protected area management technical capacity needs will need to directly influence curriculum design to insure both relevance and effectiveness of training in improving protected area management. Sustainability of capacity building initiatives is largely dependent on the level of interest and commitment by host-country institutions within a supportive Government policy framework in addition to engagement of organizations implementing conservation.
Otani, Koichi; Suzuki, Akihito; Matsumoto, Yoshihiko; Shibuya, Naoshi; Sadahiro, Ryoichi; Enokido, Masanori
2013-12-24
It has been suggested that dysfunctional attitudes, cognitive vulnerability to depression, have developmental origins. The present study examined the effects of parental rearing on dysfunctional attitudes in three areas of life with special attention to gender specificity. The subjects were 665 Japanese healthy volunteers. Dysfunctional attitudes were assessed by the 24-item Dysfunctional Attitude Scale, which has the Achievement, Dependency and Self-control subscales. Perceived parental rearing was assessed by the Parental Bonding Instrument, which has the Care and Protection subscales. Higher scores of the Achievement (β = 0.293, p < 0.01) and Dependency (β = 0.224, p < 0.05) subscales were correlated with higher scores of the Protection subscale in the combination of mother and daughter, but not in other combinations of parents and recipients. Scores of the Self-control subscale were not correlated with paternal or maternal rearing scores. The present study suggests that parental overprotection engenders dysfunctional attitudes about achievement and dependency in a gender-specific manner.
Tian, Xin; Zhao, Lei; Song, Xianjing; Yan, Youyou; Liu, Ning; Li, Tianyi; Yan, Bingdi; Liu, Bin
2016-01-01
Objectives. Elevated plasma homocysteine (Hcy) could lead to endothelial dysfunction and is viewed as an independent risk factor for atherosclerosis. Heat shock protein 27 (HSP27), a small heat shock protein, is reported to exert protective effect against atherosclerosis. This study aims to investigate the protective effect of HSP27 against Hcy-induced endothelial cell apoptosis in human umbilical vein endothelial cells (HUVECs) and to determine the underlying mechanisms. Methods. Apoptosis, reactive oxygen species (ROS), and mitochondrial membrane potential (MMP) of normal or HSP27-overexpressing HUVECs in the presence of Hcy were analyzed by flow cytometry. The mRNA and protein expression levels were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot. Results. We found that Hcy could induce cell apoptosis with corresponding decrease of nitric oxide (NO) level, increase of endothelin-1 (ET-1), intracellular adhesion molecule-1 (ICAM-1), vascular cellular adhesion molecule-1 (VCAM-1), and monocyte chemoattractant protein-1 (MCP-1) levels, elevation of ROS, and dissipation of MMP. In addition, HSP27 could protect the cell against Hcy-induced apoptosis and inhibit the effect of Hcy on HUVECs. Furthermore, HSP27 could increase the ratio of Bcl-2/Bax and inhibit caspase-3 activity. Conclusions. Therefore, we concluded that HSP27 played a protective role against Hcy-induced endothelial apoptosis through modulation of ROS production and the mitochondrial caspase-dependent apoptotic pathway.
Spectral analysis of hearing protector impulsive insertion loss.
Fackler, Cameron J; Berger, Elliott H; Murphy, William J; Stergar, Michael E
2017-01-01
To characterise the performance of hearing protection devices (HPDs) in impulsive-noise conditions and to compare various protection metrics between impulsive and steady-state noise sources with different characteristics. HPDs were measured per the impulsive test methods of ANSI/ASA S12.42- 2010 . Protectors were measured with impulses generated by both an acoustic shock tube and an AR-15 rifle. The measured data were analysed for impulse peak insertion loss (IPIL) and impulsive spectral insertion loss (ISIL). These impulsive measurements were compared to insertion loss measured with steady-state noise and with real-ear attenuation at threshold (REAT). Tested HPDs included a foam earplug, a level-dependent earplug and an electronic sound-restoration earmuff. IPIL for a given protector varied between measurements with the two impulse noise sources, but ISIL agreed between the two sources. The level-dependent earplug demonstrated level-dependent effects both in IPIL and ISIL. Steady-state insertion loss and REAT measurements tended to provide a conservative estimate of the impulsively-measured attenuation. Measurements of IPIL depend strongly on the source used to measure them, especially for HPDs with less attenuation at low frequencies. ISIL provides an alternative measurement of impulse protection and appears to be a more complete description of an HPD's performance.
Spectral analysis of hearing protector impulsive insertion loss
Fackler, Cameron J.; Berger, Elliott H.; Murphy, William J.; Stergar, Michael E.
2017-01-01
Objective To characterize the performance of hearing protection devices in impulsive-noise conditions and to compare various protection metrics between impulsive and steady-state noise sources with different characteristics. Design Hearing protectors were measured per the impulsive test methods of ANSI/ASA S12.42-2010. Protectors were measured with impulses generated by both an acoustic shock tube and an AR-15 rifle. The measured data were analyzed for impulse peak insertion loss (IPIL) and impulsive spectral insertion loss (ISIL). These impulsive measurements were compared to insertion loss measured with steady-state noise and with real-ear attenuation at threshold (REAT). Study Sample Tested devices included a foam earplug, a level-dependent earplug, and an electronic sound-restoration earmuff. Results IPIL for a given protector varied between measurements with the two impulse noise sources, but ISIL agreed between the two sources. The level-dependent earplug demonstrated level-dependent effects both in IPIL and ISIL. Steady-state insertion loss and REAT measurements tended to provide a conservative estimate of the impulsively-measured attenuation. Conclusions Measurements of IPIL depend strongly on the source used to measure them, especially for hearing protectors with less attenuation at low frequencies. ISIL provides an alternative measurement of impulse protection and appears to be a more complete description of an HPD’s performance. PMID:27885881
Repeated Nrf2 stimulation using sulforaphane protects fibroblasts from ionizing radiation.
Mathew, Sherin T; Bergström, Petra; Hammarsten, Ola
2014-05-01
Most of the cytotoxicity induced by ionizing radiation is mediated by radical-induced DNA double-strand breaks. Cellular protection from free radicals can be stimulated several fold by sulforaphane-mediated activation of the transcription factor Nrf2 that regulates more than 50 genes involved in the detoxification of reactive substances and radicals. Here, we report that repeated sulforaphane treatment increases radioresistance in primary human skin fibroblasts. Cells were either treated with sulforaphane for four hours once or with four-hour treatments repeatedly for three consecutive days prior to radiation exposure. Fibroblasts exposed to repeated-sulforaphane treatment showed a more pronounced dose-dependent induction of Nrf2-regulated mRNA and reduced amount of radiation-induced free radicals compared with cells treated once with sulforaphane. In addition, radiation- induced DNA double-strand breaks measured by gamma-H2AX foci were attenuated following repeated sulforaphane treatment. As a result, cellular protection from ionizing radiation measured by the 5-ethynyl-2'-deoxyuridine (EdU) assay was increased, specifically in cells exposed to repeated sulforaphane treatment. Sulforaphane treatment was unable to protect Nrf2 knockout mouse embryonic fibroblasts, indicating that the sulforaphane-induced radioprotection was Nrf2-dependent. Moreover, radioprotection by repeated sulforaphane treatment was dose-dependent with an optimal effect at 10 uM, whereas both lower and higher concentrations resulted in lower levels of radioprotection. Our data indicate that the Nrf2 system can be trained to provide further protection from radical damage. Copyright © 2014 Elsevier Inc. All rights reserved.
Yan, Fengxia; Wang, Haitao; Gao, Yang; Xu, Jiangping; Zheng, Wenhua
2017-08-16
Oxidative stress plays a key role in the pathogenesis of age-related macular degeneration (AMD), a leading cause of severe visual loss and blindness in the aging population which lacks any effective treatments currently. In this study, artemisinin, a well-known antimalarial drug was found to suppress hydrogen peroxide (H 2 O 2 )-induced cell death in retinal neuronal RGC-5 cells. Artemisinin, in the therapeutically relevant dosage, concentration-dependently attenuated the accumulation of intracellular reactive oxygen species (ROS), increased mitochondrial membrane potential and decreased cell apoptosis in RGC-5 cells induced by H 2 O 2 . Western blot analysis showed that artemisinin upregulated the phosphorylation of p38 and extracellular signal-regulated kinases1/2 (ERK1/2) and reversed the inhibitory effect of H 2 O 2 on the phosphorylation of these two kinases. Moreover, protective effect of artemisinin was blocked by the p38 kinase inhibitor PD169316 or ERK1/2 kinase pathway inhibitor PD98059, respectively. In contrast, c-Jun N-terminal kinase inhibitor and rapamycin had no effect in the protective effect of artemisinin. Taken together, these results demonstrated that artemisinin promoted the survival of RGC-5 cells from H 2 O 2 toxicity via the activation of the p38 and ERK1/2 pathways. Interestingly, intravitreous injection of artimisinin, concentration-dependently reversed light exposed-damage (a dry AMD animal model) of rat retinal physiological function detected by flash electroretinogram. These results indicate that artemisinin can protect retinal neuronal functions from H 2 O 2 -induced damage in vitro and in vivo and suggest the potential application of artemisinin as a new drug in the treatment of retinal disorders like AMD.
Estrogen Protects Lenses against Cataract Induced by Transforming Growth Factor-β (TGFβ)
Hales, Angela M.; Chamberlain, Coral G.; Murphy, Christopher R.; McAvoy, John W.
1997-01-01
Cataract, already a major cause of visual impairment and blindness, is likely to become an increasing problem as the world population ages. In a previous study, we showed that transforming growth factor-β (TGFβ) induces rat lenses in culture to develop opacities and other changes that have many features of human subcapsular cataracts. Here we show that estrogen protects against cataract. Lenses from female rats are more resistant to TGFβ-induced cataract than those from males. Furthermore, lenses from ovariectomized females show increased sensitivity to the damaging effects of TGFβ and estrogen replacement in vivo, or exposure to estrogen in vitro, restores resistance. Sex-dependent and estrogen-related differences in susceptibility to cataract formation, consistent with a protective role for estrogen, have been noted in some epidemiological studies. The present study in the rat indicates that estrogen provides protection against cataract by countering the damaging effects of TGFβ. It also adds to an increasing body of evidence that hormone replacement therapy protects postmenopausal women against various diseases. PMID:9016876
Heat inactivation of poliovirus in wastewater sludge
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, R.L.; Ashley, C.S.; Moseley, R.H.
1976-09-01
The effect of raw and anaerobically digested sludge on heat inactivation of poliovirus was investigated. Raw sludge was found to be very protective of poliovirus plaque-forming ability at all temperatures studied, but digested sludge had variable effects that were highly dependent upon the experimental conditions. In low concentrations and at relatively low inactivation temperatures, digested sludge is nearly as protective of poliovirus as raw sludge. However, at higher temperatures and concentrations, digested sludge caused a significant acceleration of poliovirus inactivation. The difference between the protective capability of raw and digested sludge is not due to loss of protective material, becausemore » this component is present in the solids of digested sludge as well as in those of raw sludge. Instead, the difference is due to a virucidal agent acquired during digestion. Addition of this agent to the solids of either raw or digested sludge reverses the protective potential of these solids during heat treatment of poliovirus.« less
Li, Shaojing; Wu, Chuanhong; Zhu, Li; Gao, Jian; Fang, Jing; Li, Defeng; Fu, Meihong; Liang, Rixin; Wang, Lan; Cheng, Ming; Yang, Hongjun
2012-11-09
Ischemic stroke is a devastating disease with a complex pathophysiology. Galangin is a natural flavonoid isolated from the rhizome of Alpina officinarum Hance, which has been widely used as an antioxidant agent. However, its effects against ischemic stroke have not been reported and its related neuroprotective mechanism has not really been explored. In this study, neurological behavior, cerebral infarct volumes and the improvement of the regional cortical blood flow (rCBF) were used to evaluate the therapeutic effect of galangin in rats impaired by middle cerebral artery occlusion (MCAO)-induced focal cerebral ischemia. Furthermore, the determination of mitochondrial function and Western blot of apoptosis-related proteins were performed to interpret the neuroprotective mechanism of galangin. The results showed that galangin alleviated the neurologic impairments, reduced cerebral infarct at 24 h after MCAO and exerted a protective effect on the mitochondria with decreased production of mitochondrial reactive oxygen species (ROS). These effects were consistent with improvements in the membrane potential level (Dym), membrane fluidity, and degree of mitochondrial swelling in a dose-dependent manner. Moreover, galangin significantly improved the reduced rCBF after MCAO. Western blot analysis revealed that galangin also inhibited apoptosis in a dose-dependent manner concomitant with the up-regulation of Bcl-2 expression, down-regulation of Bax expression and the Bax/Bcl-2 ratio, a reduction in cytochrome c release from the mitochondria to the cytosol, the reduced expression of activated caspase-3 and the cleavage of poly(ADP-ribose) polymerase (PARP). All these data in this study demonstrated that galangin might have therapeutic potential for ischemic stroke and play its protective role through the improvement in rCBF, mitochondrial protection and inhibiting caspase-dependent mitochondrial cell death pathway for the first time.
Guan, Lianyue; Liu, Hongyu; Fu, Peiyao; Li, Zhuonan; Li, Peidong; Xie, Lijuan; Xin, Mingang; Wang, Zhanpeng
2016-01-01
The aim of this study was to explore the protective effects of ulinastatin (urinary trypsin inhibitor, UTI) on liver ischemia-reperfusion injury (IRI) and graft survival. We employed mouse liver cold IRI and orthotopic liver transplantation (OLTx) models. UTI was added to lactated Ringer's (LR) solution for liver perfusion and preservation in vitro or combined with UTI injection intraperitoneally to the liver graft recipient. Our results indicated that UTI supplementation protected the liver from cold IRI in a dose-dependent manner and prolonged liver graft survival from extended cold preserved liver donors significantly. The underlying mechanism of UTI on liver IRI may be mediated by inhibition of proinflammatory cytokine release, increasing the expression of the antiapoptotic gene Bcl-2 and decreasing the expression of the proapoptosis genes of Caspase-3 and Bax, and further protects hepatocytes from apoptotic death and improves liver function. PMID:26783413
Guan, Lianyue; Liu, Hongyu; Fu, Peiyao; Li, Zhuonan; Li, Peidong; Xie, Lijuan; Xin, Mingang; Wang, Zhanpeng; Li, Wei
2016-01-01
The aim of this study was to explore the protective effects of ulinastatin (urinary trypsin inhibitor, UTI) on liver ischemia-reperfusion injury (IRI) and graft survival. We employed mouse liver cold IRI and orthotopic liver transplantation (OLTx) models. UTI was added to lactated Ringer's (LR) solution for liver perfusion and preservation in vitro or combined with UTI injection intraperitoneally to the liver graft recipient. Our results indicated that UTI supplementation protected the liver from cold IRI in a dose-dependent manner and prolonged liver graft survival from extended cold preserved liver donors significantly. The underlying mechanism of UTI on liver IRI may be mediated by inhibition of proinflammatory cytokine release, increasing the expression of the antiapoptotic gene Bcl-2 and decreasing the expression of the proapoptosis genes of Caspase-3 and Bax, and further protects hepatocytes from apoptotic death and improves liver function.
Oprea, Eliza; Ruta, Lavinia L; Nicolau, Ioana; Popa, Claudia V; Neagoe, Aurora D; Farcasanu, Ileana C
2014-01-01
Blueberries (Vaccinium corymbosum L.) are a rich source of antioxidants and their consumption is believed to contribute to food-related protection against oxidative stress. In the present study, the chemoprotective action of blueberry extracts against cadmium toxicity was investigated using a cadmium-hypersensitive strain of Saccharomyces cerevisiae. Four varieties of blueberries were used in the study, and it was found that the extracts with high content of total anthocyanidins exhibited significant protective effect against the toxicity of cadmium and H2O2. Both the blueberry extracts and pure cyanidin exhibited protective effects against cadmium in a dose-dependent manner, but without significantly interfering with the cadmium accumulation by the yeast cells. The results imply that the blueberry extracts might be a potentially valuable food supplement for individuals exposed to high cadmium. Copyright © 2013 Elsevier Ltd. All rights reserved.
Yoshida, T; Tanaka, M; Okamoto, K
2001-01-05
We evaluated the effect of nicergoline on superoxide production by rat microglias using a 2-methyl-6-(p-methoxyphenyl)-3, 7-dihydroimidazo[1,2-a]pyrazin-3-one-dependent chemiluminescence assay. Nicergoline dose-dependently inhibited superoxide production by microglias stimulated with phorbol myristate acetate or opsonized zymosan, while it had no effect on superoxide production by a hypoxanthine-xanthine oxidase system. These results indicate that nicergoline does not have a scavenging effect, but has an inhibitory effect on superoxide generation by microglias. Although this drug is commonly used for treating chronic cerebral infarction, it may also have a protective effect on progression of Parkinson's disease or Alzheimer's disease.
Bikis, Christos; Moris, Demetrios; Vasileiou, Ioanna; Patsouris, Eustratios; Theocharis, Stamatios
2015-04-01
The focal adhesion kinase (FAK) and the Src families of kinases are subfamilies of the non-receptor protein tyrosine kinases. FAK activity is regulated by gene amplification, alternative splicing and phosporylation/dephosphorylation. FAK/Src complex has been found to participate through various pathways in neuronal models of ischemia-reperfusion injury (IRI) with conflicting results. The aim of the present review is to summarize the currently available data on this subject. The MEDLINE/PubMed database was searched for publications with the medical subject heading IRI and FAK and/or Src, nervous system. We restricted our search till 2014. We identified 93 articles that were available in English as abstracts or/and full-text articles that were deemed appropriate for our review. FAK has been found to have a beneficial preconditioning effect on IRI through activation via the protein kinase C (PKC) pathway by anesthetic agents. Of great importance are the interactions between FAK/Src and VEGF that has been already detected as a protective mean for IRI. The effect of VEGF administration might depend on dose as well as on time of administration. A Ca(2+)/calmodulin-dependent protein kinase II or PKC inhibitors seem to have protective effects on IRI by inhibiting ion channels activation.
Heme oxygenase/carbon monoxide signaling pathways: regulation and functional significance.
Ryter, Stefan W; Otterbein, Leo E; Morse, Danielle; Choi, Augustine M K
2002-01-01
Carbon monoxide (CO), a gaseous second messenger, arises in biological systems during the oxidative catabolism of heme by the heme oxygenase (HO) enzymes. HO exists as constitutive (HO-2, HO-3) and inducible isoforms (HO-1), the latter which responds to regulation by multiple stress-stimuli. HO-1 confers protection in vitro and in vivo against oxidative cellular stress. Although the redox active compounds that are generated from HO activity (i.e. iron, biliverdin-IXalpha, and bilirubin-IXa) potentially modulate oxidative stress resistance, increasing evidence points to cytoprotective roles for CO. Though not reactive, CO regulates vascular processes such as vessel tone, smooth muscle proliferation, and platelet aggregation, and possibly functions as a neurotransmitter. The latter effects of CO depend on the activation of guanylate cyclase activity by direct binding to the heme moiety of the enzyme, stimulating the production of cyclic 3':5'-guanosine monophosphate. CO potentially interacts with other intracellular hemoprotein targets, though little is known about the functional significance of such interactions. Recent progress indicates that CO exerts novel anti-inflammatory and anti-apoptotic effects dependent on the modulation of the p38 mitogen activated protein kinase (MAPK)-signaling pathway. By virtue of these effects, CO confers protection in oxidative lung injury models, and likely plays a role in HO-1 mediated tissue protection.
Zoltowska Nilsson, A M; Lei, Y; Adner, M; Nilsson, G P
2018-03-01
Interleukin-33 (IL-33) and its receptor ST2 have been influentially associated with the pathophysiology of asthma. Due to the divergent roles of IL-33 in regulating mast cell functions, there is a need to further characterize IL-33/ST2-dependent mast cell responses and their significance in the context of asthma. This study aimed to investigate how IL-33/ST2-dependent mast cell responses contribute to the development of airway hyperresponsiveness (AHR) and airway inflammation in a mouse model of house dust mite (HDM)-induced asthma. Mast cell-deficient C57BL/6-Kit W-sh (Wsh) mice engrafted with either wild-type (Wsh + MC-WT) or ST2-deficient bone marrow-derived mast cells (Wsh + MC-ST2KO) were exposed to HDM delivered intranasally. An exacerbated development of AHR in response to HDM was seen in Wsh + MC-ST2KO compared with Wsh + MC-WT mice. The contribution of this IL-33/ST2-dependent mast cell response to AHR seems to reside within the smaller airways in the peripheral parts of the lung, as suggested by the isolated yet marked effect on tissue resistance. Considering the absence of a parallel increase in cellular inflammation in bronchoalveolar lavage fluid (BALF) and lung, the aggravated AHR in Wsh + MC-ST2KO mice seems to be independent of cellular inflammation. We observed an association between the elevated AHR and reduced PGE 2 levels in BALF . Due to the protective properties of PGE 2 in airway responses, it is conceivable that IL-33/ST2-dependent mast cell induction of PGE 2 could be responsible for the dampening effect on AHR. In conclusion, we reveal that IL-33/ST2-dependent mast cell responses can have a protective, rather than causative role, in the development of AHR.
Association of Dietary Quercetin with Reduced Risk of Proximal Colon Cancer
Djuric, Zora; Severson, Richard K.; Kato, Ikuko
2012-01-01
Quercetin is a flavonol that appears to be protective against several cancers, but its possible role in prevention of colorectal cancer is not yet well studied. We evaluated dietary intakes of quercetin and risk of colorectal cancer in a large case-control study conducted in Metropolitan Detroit, MI (n = 2664). The protective effects of quercetin intake, as assessed by food frequency questionnaire, were confined to risk of proximal colon cancer. Stratified analyses showed that the protective effects of quercetin on risk of proximal colon cancer were significant only when fruit intake or the Healthy Eating Index score were high, or when tea intake was low, with odds ratios (OR) for the highest versus the lowest quartile = 0.49, 0.44, and 0.51, respectively. Increased quercetin intake had no protective effects when tea intake was high. Interestingly, increased intake of quercetin was associated with increased risk of distal colon cancer when total fruit intake was low (OR for the highest versus the lowest quartile = 1.99). These results suggest that quercetin can have disparate effects on colon cancer risk depending on whether dietary intakes of fruit or tea are high, and that quercetin had protective effects only on proximal, not distal, colon cancer. PMID:22429001
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meng, Qiang; Chen, Xin-li; Wang, Chang-yuan
2015-03-15
Intrahepatic cholestasis is a clinical syndrome with systemic and intrahepatic accumulation of excessive toxic bile acids that ultimately cause hepatobiliary injury. Appropriate regulation of bile acids in hepatocytes is critically important for protection against liver injury. In the present study, we characterized the protective effect of alisol B 23-acetate (AB23A), a natural triterpenoid, on alpha-naphthylisothiocyanate (ANIT)-induced liver injury and intrahepatic cholestasis in mice and further elucidated the mechanisms in vivo and in vitro. AB23A treatment dose-dependently protected against liver injury induced by ANIT through reducing hepatic uptake and increasing efflux of bile acid via down-regulation of hepatic uptake transporters (Ntcp)more » and up-regulation of efflux transporter (Bsep, Mrp2 and Mdr2) expression. Furthermore, AB23A reduced bile acid synthesis through repressing Cyp7a1 and Cyp8b1, increased bile acid conjugation through inducing Bal, Baat and bile acid metabolism through an induction in gene expression of Sult2a1. We further demonstrate the involvement of farnesoid X receptor (FXR) in the hepatoprotective effect of AB23A. The changes in transporters and enzymes, as well as ameliorative liver histology in AB23A-treated mice were abrogated by FXR antagonist guggulsterone in vivo. In vitro evidences also directly demonstrated the effect of AB23A on FXR activation in a dose-dependent manner using luciferase reporter assay in HepG2 cells. In conclusion, AB23A produces protective effect against ANIT-induced hepatotoxity and cholestasis, due to FXR-mediated regulation of transporters and enzymes. - Highlights: • AB23A has at least three roles in protection against ANIT-induced liver injury. • AB23A decreases Ntcp, and increases Bsep, Mrp2 and Mdr2 expression. • AB23A represses Cyp7a1 and Cyp8b1 through inducing Shp and Fgf15 expression. • AB23A increases bile acid metabolism through inducing Sult2a1 expression. • FXR activation is involved in the hepatoprotective effect of AB23A.« less
Yu, Hyeon-Hee; Hur, Jong-Moon; Seo, Se-Jeong; Moon, Hae-Dalma; Kim, Hyun-Jin; Park, Rae-Kil; You, Yong-Ouk
2009-01-01
The fruits of Cornus officinalis have been used in traditional oriental medicine for treatment of inner ear diseases, such as tinnitus and hearing loss. In the present study, we investigated the protective effect of C. officinalis on hydrogen peroxide-induced cytotoxicity in HEI-OC1 auditory cells. The results from bioassay-guided fractionation of methanol extract of C. officinalis fruits showed that ursolic acid is a major active component. Ursolic acid (0.05-2 microg/ml) had protective effect against the HEI-OC1 cell damage and reduced lipid peroxidation in a dose-dependent manner. In addition, pre-treatment with ursolic acid significantly attenuated the decrease of activities of catalase (CAT) and glutathione peroxidase (GPX), but superoxide dismutase (SOD) activity was not significantly affected by ursolic acid. These results indicate that ursolic acid protects hydrogen peroxide-induced HEI-OC1 cell damage through inhibition of lipid peroxidation and induction of antioxidant enzymes, CAT and GPX, and may be one of the active components responsible for these effects of C. officinalis fruits.
[Transamination in the mechanism of protection of mitochondria from Ca2+ overload].
Saakian, G G; Saakian, I R
2008-01-01
A high sensitivity of the succinate-dependent uptake of Ca2+ by mitochondria to (1) the transamination (TA) substrates glutamate (GLU) and alpha-ketoglutarate (KGL) and (2) the inhibitor of TA aminooxyacetate (AOA) was revealed. The effect of the TA substrates on Ca2+ uptake depends on the ratio (1:10 mM) of their concentrations: 1 mM GLU activates and 10 mM KGL decreases this activation by 35-46%, whereas AOA suppresses the Ca2+ capacity by 60% and the inhibitor of succinate oxidation malonate, by 80-90%. A similarity in the limiting action of KGL and phosphoenolpyruvate (PEP), two sources of oxaloacetate (OAA) and GTP, on Ca2+ capacity was revealed. The differences in the effects of KGL and GLU and the similarity in the effects of KGL and PEP on succinate oxidation are explained by the effect of OAA and GTP on this oxidation. The alternating inflow of OAA in coupled processes of TA, pyruvate cycle, and tricarboxylic acids cycle provides the reciprocal activation and cyclic recurrence of Ca2+ uptake, i. e., protection from the chronic exhausting activation of Ca2+-regulated dehydrogenases, the overload of Ca2+-outgoing channels, and the excessive production of free radicals in mitochondria. The reciprocal regulation of Ca2+ uptake by TA is considered as a mechanism of the maintenance of Ca2+ homeostasis and protection of mitochondria against Ca2+ overload.
Quercetin Potentiates Doxorubicin Mediated Antitumor Effects against Liver Cancer through p53/Bcl-xl
Wang, Guanyu; Sharma, Sherven; Dong, Qinghua
2012-01-01
Background The dose-dependent toxicities of doxorubicin (DOX) limit its clinical applications, particularly in drug-resistant cancers, such as liver cancer. In this study, we investigated the role of quercetin on the antitumor effects of DOX on liver cancer cells and its ability to provide protection against DOX-mediated liver damage in mice. Methodology and Results The MTT and Annexin V/PI staining assay demonstrated that quercetin selectively sensitized DOX-induced cytotoxicity against liver cancer cells while protecting normal liver cells. The increase in DOX-mediated apoptosis in hepatoma cells by quercetin was p53-dependent and occurred by downregulating Bcl-xl expression. Z-VAD-fmk (caspase inhibitor), pifithrin-α (p53 inhibitor), or overexpressed Bcl-xl decreased the effects of quercetin on DOX-mediated apoptosis. The combined treatment of quercetin and DOX significantly reduced the growth of liver cancer xenografts in mice. Moreover, quercetin decreased the serum levels of alanine aminotransferase and aspartate aminotransferase that were increased in DOX-treated mice. Quercetin also reversed the DOX-induced pathological changes in mice livers. Conclusion and Significance These results indicate that quercetin potentiated the antitumor effects of DOX on liver cancer cells while protecting normal liver cells. Therefore, the development of quercetin may be beneficial in a combined treatment with DOX for increased therapeutic efficacy against liver cancer. PMID:23240061
Modification of radiobiological effects of 171 MeV protons by elements of physical protection
NASA Astrophysics Data System (ADS)
Bulinina, Taisia; Shurshakov, Vyacheslav; Ivanov, Alexander; Molokanov, Alexander
2016-07-01
Space radiation includes protons of various energies. Physical protection is effective in the case of low energy protons (50-100 MeV) and becomes insufficient for radiation with a high part of high-energy protons. In the experiment performed on outbred mice, the purpose of the study was to evaluate the radiobiological effect of 171 MeV protons and protons modified by elements of physical protection of the spacecraft, on a complex of indicators of the functional condition of the system hematopoiesis and the central nervous system in 24 hours after irradiation at 20 cGy dose. The spacecraft radiation protection elements used in the experiment were a construction of wet hygiene wipes called a «protective curtain», and a glass plate imitating an ISS window. Mass thickness of the " protective curtain" in terms of water equivalent was ̴ 6,2 g/cm2. Physical shielding along the path of 171 MeV protons increases their linear energy transfer leading to the absorbed dose elevation and strengthening of the radiobiological effect. In the experiment, the two types of shielding together raised the absorbed dose from 20 to 23.2 cGy. Chemically different materials (glass and water in the wipes) were found to exert unequal modifying effects on physical and biological parameters of the proton-irradiated mice. There was a distinct dose-dependent reduction of bone marrow cellularity within the dose range from 20 cGy to 23.2 cGy in 24 hours after exposure. No modifying effect of the radiation protection elements on spontaneous motor activity was discovered when compared with entrance protons. The group of animals protected by the glass plate exhibited normal orientative-trying reactions and weakened grip with the forelimbs. The effects observed in the experiment indicate the necessity to carry out comprehensive radiobiological researches (physical, biological and mathematical) in assessing the effects of physical protection, that are actual for ensuring radiation safety of crews in interplanetary flights.
Jayakumar, Asha; Castilho, Tiago M; Park, Esther; Goldsmith-Pestana, Karen; Blackwell, Jenefer M; McMahon-Pratt, Diane
2011-06-01
Leishmania (Viannia) parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective. Using a newly developed mouse model of chronic L. (Viannia) panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA) boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP) could provide protection against infection/disease. Heterologous prime - boost (DNA/MVA) vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V.) panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses. Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia) to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that CD8 T cells should be targeted for the development of a vaccine against infection caused by Leishmania (Viannia) parasites. Further, TLR1/2 modulation may be useful in vaccines where CD8 T cell responses are critical.
The acute toxicity of toluene, a model volatile organic compound (VOC), depends on the concentration (C) and duration (t) of exposure, and guidelines for acute exposures have traditionally used extrelationships to extrapolate protective and/or effective concentrations across dura...
USING RELATIVE RISK TO COMPARE THE EFFECTS OF AQUATIC STRESSORS AT A REGIONAL SCALE
The regional-scale importance of an aquatic stressor depends both on its regional extent (i.e., how widespread it is) and on the severity of its effects in ecosystems where it is found. Sample surveys, such as those developed by the U.S. Environmental Protection Agency¿s Environm...
Kütting, B; Baumeister, T; Weistenhöfer, W; Pfahlberg, A; Uter, W; Drexler, H
2010-02-01
We recently found a very low adherence to a generally recommended skin protection regimen in a sample of 1355 metalworkers. The present study assessed the effectiveness of skin protection as presently recommended, especially the differential contribution of skin care and skin protection, to the prevention of occupational hand eczema. Methods Of 1355 metalworkers screened, 1020 male volunteers, all fit for work, were recruited for a prospective intervention study with four arms (skin care, skin protection, both combined, and control group, i.e. no recommendation). The study was performed from winter 2006/2007 to spring 2008, following each subject for up for 12 months. Both hands were examined using a quantitative skin score, and a standardized personal interview was performed three times. The change of the objective skin score from baseline to 12 months was used as primary outcome measure. After 12 months 800 subjects were included (78.4% of those recruited). The compliance to follow the randomized measure depended on the recommended measure and ranged from 73.7% to 88.7%. While in the control group a significant deterioration was found, the largest and significant improvement was noted in the group following the generally recommended skin protection programme (skin care + skin protection) followed by skin protection alone as second best. The generally recommended skin protection regimen seems to provide effective prevention of occupational skin disease. Therefore, the compliance to follow the skin protection regimen, especially the use of skin protection, should be enhanced.
Zafar, S; Ahmad, M A; Siddiqui, T A
2001-11-01
Chronic treatment with Delphinium denudatum (Dd) (Jadwar) (family: Ranunculaceae, 200-1600 mg/kg) suppressed morphine withdrawal jumps in a dose-dependent manner, a sign of the development of dependence to opiate as assessed by naloxone (2 mg/kg) precipitation withdrawal on day 10 of testing in mice. Repeated administration of Dd (200-1600 mg/kg) for 9 days attenuated the development of tolerance to the analgesic effect of morphine (10 mg/kg), also produces significant change in tail-flick latency from the saline pretreated group in a dose-dependent manner.
Gomes, Antoniella S; Lima, Lívia M F; Santos, Camila L; Cunha, Fernando Q; Ribeiro, Ronaldo A; Souza, Marcellus H L P
2006-10-10
The effect of lipopolysaccharide (LPS) in gastric protection has not been elucidated, but ATP-sensitive potassium (K(ATP)) channels are known to be involved in gastric defense. We evaluated the effect of LPS administration on indomethacin-induced gastropathy, and the role of K(ATP) channels in this event. Rats received intravenous (i.v.) LPS administration. After 1/2, 6, 24 or 48 h, indomethacin was injected. 3H later, gastric damage and myeloperoxidase activity were determined. Another group received LPS and 5 h later, glibenclamide, diazoxide or glibenclamide plus diazoxide. After 1 h, the rats received indomethacin and 3 h later, gastric damage and myeloperoxidase activity were evaluated. LPS reduced dose dependently gastric damage and myeloperoxidase activity induced by indomethacin. Glibenclamide reversed this LPS effect on indomethacin-induced gastropathy. Glibenclamide plus diazoxide administration did not change this LPS effect. Thus LPS has a protective effect against indomethacin-induced gastropathy, probably through activation of K(ATP) channels.
Protective Effects of Lemon Juice on Alcohol-Induced Liver Injury in Mice
Zhang, Yu-Jie; Xu, Dong-Ping; Wang, Fang; Zhou, Yue; Zheng, Jie; Li, Ya; Zhang, Jiao-Jiao
2017-01-01
Chronic excessive alcohol consumption (more than 40–80 g/day for males and more than 20–40 g/day for females) could induce serious liver injury. In this study, effects of lemon juice on chronic alcohol-induced liver injury in mice were evaluated. The serum biochemical profiles and hepatic lipid peroxidation levels, triacylglycerol (TG) contents, antioxidant enzyme activities, and histopathological changes were examined for evaluating the hepatoprotective effects of lemon juice in mice. In addition, the in vitro antioxidant capacities of lemon juice were determined. The results showed that lemon juice significantly inhibited alcohol-induced increase of alanine transaminase (ALT), aspartate transaminase (AST), hepatic TG, and lipid peroxidation levels in a dose-dependent manner. Histopathological changes induced by alcohol were also remarkably improved by lemon juice treatment. These findings suggest that lemon juice has protective effects on alcohol-induced liver injury in mice. The protective effects might be related to the antioxidant capacity of lemon juice because lemon juice showed in vitro antioxidant capacity. PMID:28567423
Protective Effects of Lemon Juice on Alcohol-Induced Liver Injury in Mice.
Zhou, Tong; Zhang, Yu-Jie; Xu, Dong-Ping; Wang, Fang; Zhou, Yue; Zheng, Jie; Li, Ya; Zhang, Jiao-Jiao; Li, Hua-Bin
2017-01-01
Chronic excessive alcohol consumption (more than 40-80 g/day for males and more than 20-40 g/day for females) could induce serious liver injury. In this study, effects of lemon juice on chronic alcohol-induced liver injury in mice were evaluated. The serum biochemical profiles and hepatic lipid peroxidation levels, triacylglycerol (TG) contents, antioxidant enzyme activities, and histopathological changes were examined for evaluating the hepatoprotective effects of lemon juice in mice. In addition, the in vitro antioxidant capacities of lemon juice were determined. The results showed that lemon juice significantly inhibited alcohol-induced increase of alanine transaminase (ALT), aspartate transaminase (AST), hepatic TG, and lipid peroxidation levels in a dose-dependent manner. Histopathological changes induced by alcohol were also remarkably improved by lemon juice treatment. These findings suggest that lemon juice has protective effects on alcohol-induced liver injury in mice. The protective effects might be related to the antioxidant capacity of lemon juice because lemon juice showed in vitro antioxidant capacity.
Poly(ADP-ribose) polymerase-1 protects from oxidative stress induced endothelial dysfunction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gebhard, Catherine; Staehli, Barbara E.; Zurich Center for Integrative Human Physiology
2011-11-04
Highlights: Black-Right-Pointing-Pointer The nuclear enzyme PARP-1 is a downstream effector of oxidative stress. Black-Right-Pointing-Pointer PARP-1 protects from oxidative stress induced endothelial dysfunction. Black-Right-Pointing-Pointer This effect is mediated through inhibition of vasoconstrictor prostanoid production. Black-Right-Pointing-Pointer Thus, PARP-1 may play a protective role as antioxidant defense mechanism. -- Abstract: Background: Generation of reactive oxygen species (ROS) is a key feature of vascular disease. Activation of the nuclear enzyme poly (adenosine diphosphate [ADP]-ribose) polymerase-1 (PARP-1) is a downstream effector of oxidative stress. Methods: PARP-1(-/-) and PARP-1(+/+) mice were injected with paraquat (PQ; 10 mg/kg i.p.) to induce intracellular oxidative stress. Aortic rings weremore » suspended in organ chambers for isometric tension recording to analyze vascular function. Results: PQ treatment markedly impaired endothelium-dependent relaxations to acetylcholine in PARP-1(-/-), but not PARP-1(+/+) mice (p < 0.0001). Maximal relaxation was 45% in PQ treated PARP-1(-/-) mice compared to 79% in PARP-1(+/+) mice. In contrast, endothelium-independent relaxations to sodium nitroprusside (SNP) were not altered. After PQ treatment, L-NAME enhanced contractions to norepinephrine by 2.0-fold in PARP-1(-/-) mice, and those to acetylcholine by 3.3-fold, respectively, as compared to PARP-1(+/+) mice. PEG-superoxide dismutase (SOD) and PEG-catalase prevented the effect of PQ on endothelium-dependent relaxations to acetylcholine in PARP-1(-/-) mice (p < 0.001 vs. PQ treated PARP-1(+/+) mice. Indomethacin restored endothelium-dependent relaxations to acetylcholine in PQ treated PARP-1(-/-) mice (p < 0.05 vs. PQ treated PARP-1(+/+). Conclusion: PARP-1 protects from acute intracellular oxidative stress induced endothelial dysfunction by inhibiting ROS induced production of vasoconstrictor prostanoids.« less
Hearld, Kristine Ria; Badham, Amy; Budhwani, Henna
2017-08-01
Substance use and abuse, which includes alcohol use, alcohol dependence, drug use, and drug dependence, inflicts a substantial toll on Americans. Although studies have demonstrated the protective effect of social support, such as religious participation and via marriage, understanding their influence on racial and ethnic minorities is limited. Thus, the aim of this study is to assess the impact of social support on substance use and abuse in racial and ethnic minorities. The Collaborative Psychiatric Epidemiology Surveys, sponsored by the National Institute of Mental Health, a repository of race, ethnicity, and mental health data, was leveraged to develop four models using multivariate analysis, specifically logistic regression to estimate the probability of meeting the criteria for substance use and abuse. Racial and ethnic minorities were found to have lower rates of substance use and abuse compared to Whites, and foreign-born individuals were consistently less likely to use or abuse substances compared to American-born minorities. Mental health conditions were highly associated with substance use and abuse, and social support by way of religious participation and marriage was protective against substance use and abuse. In racial and ethnic minorities, nativity and social support were protective against substance use and abuse; however, these protective factors did not completely eliminate risk. Thus, although race and ethnicity are important to understanding health outcomes and health behaviors, such as substance use and abuse, it is the intersection of multiple factors, representing internal and external forces, which may be more informative and offer a more comprehensive picture of the landscape influencing drug and alcohol use and dependence. Targeted interventions should consider leveraging religious spaces and bilingual materials when attempting to reach racial and ethnic minorities.
Alzaharna, Mazen; Alqouqa, Iyad; Cheung, Hon-Yeung
2017-01-01
Andrographolide (Andro) has emerged recently as a potential and effective anticancer agent with induction of apoptosis in some cancer cell lines while induction of G2/M arrest with weak apoptosis in others. Few studies have proved that Andro is also effective in combination therapy. The flavonoid Taxifolin (Taxi) has showed anti-oxidant and antiproliferative effects against different cancer cells. Therefore, the present study investigated the cytotoxic effects of Andro alone or in combination with Taxi on HeLa cells. The combination of Andro with Taxi was synergistic at all tested concentrations and combination ratios. Andro alone induced caspase-dependent apoptosis which was enhanced by the combination with Taxi and attenuated partly by using Z-Vad-Fmk. Andro induced a protective reactive oxygen species (ROS)-dependent autophagy which was attenuated by Taxi. The activation of p53 was involved in Andro-induced autophagy where the use of Taxi or pifithrin-α (PFT-α) decreased it while the activation of JNK was involved in the cell death of HeLa cells but not in the induction of autophagy. The mitochondrial outer-membrane permeabilization (MOMP) plays an important role in Andro-induced cell death in HeLa cells. Andro alone increased the MOMP which was further increased in the case of combination. This led to the increase in AIF and cytochrome c release from mitochondria which consequently increased caspase-dependent and independent cell death. In conclusion, Andro induced a protective autophagy in HeLa cells which was reduced by Taxi and the cell death was increased by increasing the MOMP and subsequently the caspase-dependent and independent cell death. PMID:28182713
Wu, Jianjiang; Yang, Long; Xie, Peng; Yu, Jin; Yu, Tian; Wang, Haiying; Maimaitili, Yiliyaer; Wang, Jiang; Ma, Haiping; Yang, Yining; Zheng, Hong
2017-01-01
Previous studies from our group have demonstrated that sevoflurane post-conditioning (SPC) protects against myocardial ischemia reperfusion injury via elevating the intranuclear expression of hypoxia inducible factor-1 alpha (HIF-1α). However, diabetic SPC is associated with decreased myocardial protection and disruption of the HIF-1 signaling pathway. Previous studies have demonstrated that cobalt chloride (CoCl2) can upregulate HIF-1α expression under diabetic conditions, but whether myocardial protection by SPC can be restored afterward remains unclear. We established a rat model of type 2 diabetes and a Langendorff isolated heart model of ischemia-reperfusion injury. Prior to reperfusion, 2.4% sevoflurane was used as a post-conditioning treatment. The diabetic rats were treated with CoCl2 24 h before the experiment. At the end of reperfusion, tests were performed to assess myocardial function, infarct size, mitochondrial morphology, nitric oxide (NO), Mitochondrial reactive oxygen species (ROS), mitochondrial respiratory function and enzyme activity, HIF-1α, vascular endothelial growth factor (VEGF) and endothelial NO synthase (eNOS) protein levels. In addition, myocardial protection by SPC was monitored after the blood glucose levels were lowered by insulin. The diabetic state was associated with deficient SPC protection and decreased HIF-1α expression. After treating the diabetic rats with CoCl2, SPC significantly upregulated the expression of HIF-1α, VEGF and eNOS, which markedly improved cardiac function, NO, mitochondrial respiratory function, and enzyme activity and decreased the infarction areas and ROS. In addition, these effects were not influenced by blood glucose levels. This study proved that CoCl2activates the HIF-1α signaling pathway, which restores SPC-dependent myocardial protection under diabetic conditions, and the protective effects of SPC were independent of blood glucose levels. PMID:28659817
Vasconcellos, Marne C; Moura, Dinara J; Rosa, Renato M; Machado, Miriana S; Guecheva, Temenouga N; Villela, Izabel; Immich, Bruna F; Montenegro, Raquel C; Fonseca, Aluísio M; Lemos, Telma L G; Moraes, Maria Elisabete A; Saffi, Jenifer; Costa-Lotufo, Letícia V; Moraes, Manoel O; Henriques, João A P
2010-10-01
Biflorin is a natural quinone isolated from Capraria biflora L. Previous studies demonstrated that biflorin inhibits in vitro and in vivo tumor cell growth and presents potent antioxidant activity. In this paper, we report concentration-dependent cytotoxic, genotoxic, antimutagenic, and protective effects of biflorin on Salmonella tiphymurium, yeast Saccharomyces cerevisiae, and V79 mammalian cells, using different approaches. In the Salmonella/microsome assay, biflorin was not mutagenic to TA97a TA98, TA100, and TA102 strains. However, biflorin was able to induce cytotoxicity in haploid S. cerevisiae cells in stationary and exponential phase growth. In diploid yeast cells, biflorin did not induce significant mutagenic and recombinogenic effects at the employed concentration range. In addition, the pre-treatment with biflorin prevented the mutagenic and recombinogenic events induced by hydrogen peroxide (H(2)O(2)) in S. cerevisiae. In V79 mammalian cells, biflorin was cytotoxic at higher concentrations. Moreover, at low concentrations biflorin pre-treatment protected against H(2)O(2)-induced oxidative damage by reducing lipid peroxidation and DNA damage as evaluated by normal and modified comet assay using DNA glycosylases. Our results suggest that biflorin cellular effects are concentration dependent. At lower concentrations, biflorin has significant antioxidant and protective effects against the cytotoxicity, genotoxicity, mutagenicity, and intracellular lipid peroxidation induced by H(2)O(2) in yeast and mammalian cells, which can be attributed to its hydroxyl radical-scavenging property. However, at higher concentrations, biflorin is cytotoxic and genotoxic.
Dose-dependent inhibition of gastric injury by hydrogen in alkaline electrolyzed drinking water
2014-01-01
Background Hydrogen has been reported to relieve damage in many disease models, and is a potential additive in drinking water to provide protective effects for patients as several clinical studies revealed. However, the absence of a dose–response relationship in the application of hydrogen is puzzling. We attempted to identify the dose–response relationship of hydrogen in alkaline electrolyzed drinking water through the aspirin induced gastric injury model. Methods In this study, hydrogen-rich alkaline water was obtained by adding H2 to electrolyzed water at one atmosphere pressure. After 2 weeks of drinking, we detected the gastric mucosal damage together with MPO, MDA and 8-OHdG in rat aspirin induced gastric injury model. Results Hydrogen-dose dependent inhibition was observed in stomach mucosal. Under pH 8.5, 0.07, 0.22 and 0.84 ppm hydrogen exhibited a high correlation with inhibitory effects showed by erosion area, MPO activity and MDA content in the stomach. Gastric histology also demonstrated the inhibition of damage by hydrogen-rich alkaline water. However, 8-OHdG level in serum did not have significant hydrogen-dose dependent effect. pH 9.5 showed higher but not significant inhibitory response compared with pH 8.5. Conclusions Hydrogen is effective in relieving the gastric injury induced by aspirin-HCl, and the inhibitory effect is dose-dependent. The reason behind this may be that hydrogen-rich water directly interacted with the target tissue, while the hydrogen concentration in blood was buffered by liver glycogen, evoking a suppressed dose–response effect. Drinking hydrogen-rich water may protect healthy individuals from gastric damage caused by oxidative stress. PMID:24589018
Dose-dependent inhibition of gastric injury by hydrogen in alkaline electrolyzed drinking water.
Xue, Jinling; Shang, Guodong; Tanaka, Yoshinori; Saihara, Yasuhiro; Hou, Lingyan; Velasquez, Natalia; Liu, Wenjun; Lu, Yun
2014-03-03
Hydrogen has been reported to relieve damage in many disease models, and is a potential additive in drinking water to provide protective effects for patients as several clinical studies revealed. However, the absence of a dose-response relationship in the application of hydrogen is puzzling. We attempted to identify the dose-response relationship of hydrogen in alkaline electrolyzed drinking water through the aspirin induced gastric injury model. In this study, hydrogen-rich alkaline water was obtained by adding H2 to electrolyzed water at one atmosphere pressure. After 2 weeks of drinking, we detected the gastric mucosal damage together with MPO, MDA and 8-OHdG in rat aspirin induced gastric injury model. Hydrogen-dose dependent inhibition was observed in stomach mucosal. Under pH 8.5, 0.07, 0.22 and 0.84 ppm hydrogen exhibited a high correlation with inhibitory effects showed by erosion area, MPO activity and MDA content in the stomach. Gastric histology also demonstrated the inhibition of damage by hydrogen-rich alkaline water. However, 8-OHdG level in serum did not have significant hydrogen-dose dependent effect. pH 9.5 showed higher but not significant inhibitory response compared with pH 8.5. Hydrogen is effective in relieving the gastric injury induced by aspirin-HCl, and the inhibitory effect is dose-dependent. The reason behind this may be that hydrogen-rich water directly interacted with the target tissue, while the hydrogen concentration in blood was buffered by liver glycogen, evoking a suppressed dose-response effect. Drinking hydrogen-rich water may protect healthy individuals from gastric damage caused by oxidative stress.
Pulsed electromagnetic fields promote survival and neuronal differentiation of human BM-MSCs.
Urnukhsaikhan, Enerelt; Cho, Hyunjin; Mishig-Ochir, Tsogbadrakh; Seo, Young-Kwon; Park, Jung-Kueg
2016-04-15
Pulsed electromagnetic fields (PEMF) are known to affect biological properties such as differentiation, regulation of transcription factor and cell proliferation. However, the cell-protective effect of PEMF exposure is largely unknown. The aim of this study is to understand the mechanisms underlying PEMF-mediated suppression of apoptosis and promotion of survival, including PEMF-induced neuronal differentiation. Treatment of induced human BM-MSCs with PEMF increased the expression of neural markers such as NF-L, NeuroD1 and Tau. Moreover, treatment of induced human BM-MSCs with PEMF greatly decreased cell death in a dose- and time-dependent manner. There is evidence that Akt and Ras are involved in neuronal survival and protection. Activation of Akt and Ras results in the regulation of survival proteins such as Bad and Bcl-xL. Thus, the Akt/Ras signaling pathway may be a desirable target for enhancing cell survival and treatment of neurological disease. Our analyses indicated that PEMF exposure dramatically increased the activity of Akt, Rsk, Creb, Erk, Bcl-xL and Bad via phosphorylation. PEMF-dependent cell protection was reversed by pretreatment with LY294002, a specific inhibitor of phosphatidylinositol 3-kinase (PI3K). Our data suggest that the PI3K/Akt/Bad signaling pathway may be a possible mechanism for the cell-protective effects of PEMF. Copyright © 2016 Elsevier Inc. All rights reserved.
Far red/near infrared light-induced cardioprotection under normal and diabetic conditions
NASA Astrophysics Data System (ADS)
Keszler, Agnes; Baumgardt, Shelley; Hwe, Christopher; Bienengraeber, Martin
2015-03-01
Far red/near infrared light (NIR) is beneficial against cardiac ischemia and reperfusion injury (I/R), although the exact underlying mechanism is unknown. Previously we established that NIR enhanced the cardioprotective effect of nitrite in the rabbit heart. Furthermore, we observed that the nitrosyl myoglobin (MbNO) level in ischemic tissue decreased upon irradiation of the heart. Our hypothesis was that protection against I/R is dependent on nitric oxide (NO)-release from heme-proteins, and remains present during diabetes. When mice were subjected to I/R NIR (660 nm) applied during the beginning of reperfusion reduced infarct size dose dependently compared to untreated animals. Similarly, the isolated (Langendorff) heart model resulted in sustained left ventricular diastolic pressure after I/R in NIR-treated hearts. NIRinduced protection was preserved in a diabetic mouse model (db/db) and during acute hyperglycemia. NIR liberated NO from nitrosyl hemoglobin (HbNO) and MbNO as well as from HbNO isolated from the blood of diabetic animals. In the Langendorff model, after application of the nitrosylated form of a hemoglobin-based oxygen carrier as an NO donor NIR induced an increase in NADH level, suggesting a mild inhibition of mitochondrial respiration by NO during reperfusion. Taken together, NIR applied during reperfusion protects the myocardium against I/R in a NO-dependent and mitochondrion-targeted manner. This unique mechanism is conserved under diabetic conditions where other protective strategies fail.
Erdmann, Hanna; Behrends, Jochen; Hölscher, Christoph
2016-09-21
Protective immunity against Trypanosoma cruzi, the causative agent of Chagas disease, depends on the activation of macrophages by IFN-γ and IL-17A. In contrast, IL-10 prevents immunopathology. IL-22 belongs to the IL-10 cytokine family and has pleiotropic effects during host defense and immunopathology, however its role in protection and pathology during T. cruzi infection has not been analyzed yet. Therefore, we examined the role of IL-22 in experimental Chagas disease using the reticulotropic Tulahuen strain of T. cruzi. During infection, IL-22 is secreted by CD4-positive cells in an IL-23-dependent fashion. Infected IL-22(-/-) mice exhibited an increased production of IFN-γ and TNF and displayed enhanced numbers of activated IFN-γ-producing T cells in their spleens. Additionally, the production of IL-10 was increased in IL-22(-/-) mice upon infection. Macrophage activation and by association the parasitemia was not affected in the absence of IL-22. Apart from a transient increase in the body weight loss, infected IL-22(-/-) mice did not show any signs for an altered immunopathology during the first fourteen days of infection. Taken together, although IL-22 is expressed, it seems to play a minor role in protection and pathology during the acute systemic infection with the reticulotropic Tulahuen strain of T. cruzi.
Senevirathne, Mahinda; Kim, Soo-Hyun
2010-01-01
Blueberry was enzymatically hydrolyzed using selected commercial food grade carbohydrases (AMG, Celluclast, Termamyl, Ultraflo and Viscozyme) and proteases (Alcalase, Flavourzyme, Kojizyme, Neutrase and Protamex) to obtain water soluble compounds, and their protective effect was investigated against H2O2-induced damage in Chinese hamster lung fibroblast cell line (V79-4) via various published methods. Both AMG and Alcalase hydrolysates showed higher total phenolic content as well as higher cell viability and ROS scavenging activities, and hence, selected for further antioxidant assays. Both AMG and Alcalase hydrolysates also showed higher protective effects against lipid peroxidation, DNA damage and apoptotic body formation in a dose-dependent fashion. Thus, the results indicated that water soluble compounds obtained by enzymatic hydrolysis of blueberry possess good antioxidant activity against H2O2-induced cell damage in vitro. PMID:20607062
Senevirathne, Mahinda; Kim, Soo-Hyun; Jeon, You-Jin
2010-06-01
Blueberry was enzymatically hydrolyzed using selected commercial food grade carbohydrases (AMG, Celluclast, Termamyl, Ultraflo and Viscozyme) and proteases (Alcalase, Flavourzyme, Kojizyme, Neutrase and Protamex) to obtain water soluble compounds, and their protective effect was investigated against H(2)O(2)-induced damage in Chinese hamster lung fibroblast cell line (V79-4) via various published methods. Both AMG and Alcalase hydrolysates showed higher total phenolic content as well as higher cell viability and ROS scavenging activities, and hence, selected for further antioxidant assays. Both AMG and Alcalase hydrolysates also showed higher protective effects against lipid peroxidation, DNA damage and apoptotic body formation in a dose-dependent fashion. Thus, the results indicated that water soluble compounds obtained by enzymatic hydrolysis of blueberry possess good antioxidant activity against H(2)O(2)-induced cell damage in vitro.
Yoo, Jinhee; Park, Kimoon; Yoo, Youngji; Kim, Jongkeun; Yang, Heejin; Shin, Youngjae
2014-01-01
This study was conducted to examine the effects of eggshell membrane hydrolysates (ESMH) on the anti-inflammatory, anti-wrinkle, anti-microbial activity, and moisture-protection for cosmetic use. Whole ESMH (before fractionation), and fraction I (>10 kDa), fraction II (3-10 kDa), and fraction III (<3 kDa) of the hydrolysates were assessed in this experiment. As lipopolysaccharide (LPS) and IFN-γ caused the inflammation on Raw264.7 cell, whole ESMH and fraction I showed to be effective in inhibiting the induction of cell inflammation depending on the concentration, and also showed outstanding effect to suppress the skin inflammation. Fraction I inhibited collagenase and elastase activities to a greater extent than the other fractions, while all fractions had antibiotic effects at concentrations of 10 mg/disc and 20 mg/disc. In addition, it showed the moisture protection effects of skin on the holding amount and losing amount of moisture in upper-inner arm of the human body with a relatively low loss rate in skin, which confirmed that the hydrolyzed fractions of ESM helps to form the superior protective layer of moisture. It was concluded that ESMH fractions with different molecular weights, especially the 10 kDa fraction, have anti-lipopolysaccharide, anti-IFN-γ-induced inflammation, anti- collagenase and elastase activities, and thus can be used as a cosmetic agent to protect skin.
Yu, Bang-wei; Li, Jin-long; Guo, Bin-bin; Fan, Hui-min; Zhao, Wei-min; Wang, He-yao
2016-01-01
Aim: Chlorogenic acid has shown protective effect on cardiomyocytes against oxidative stress-induced damage. Herein, we evaluated nine caffeoylquinic acid analogues (1–9) isolated from the leaves of Gynura nepalensis for their protective effect against H2O2-induced H9c2 cardiomyoblast damage and explored the underlying mechanisms. Methods: H9c2 cardiomyoblasts were exposed to H2O2 (0.3 mmol/L) for 3 h, and cell viability was detected with MTT assay. Hoechst 33342 staining was performed to evaluate cell apoptosis. MMPs (mitochondrial membrane potentials) were measured using a JC-1 assay kit, and ROS (reactive oxygen species) generation was measured using CM-H2 DCFDA. The expression levels of relevant proteins were detected using Western blot analysis. Results: Exposure to H2O2 markedly decreased the viability of H9c2 cells and catalase activity, and increased LDH release and intracellular ROS production; accompanied by a loss of MMP and increased apoptotic rate. Among the 9 chlorogenic acid analogues as well as the positive control drug epigallocatechin gallate (EGCG) tested, compound 6 (3,5-dicaffeoylquinic acid ethyl ester) was the most effective in protecting H9c2 cells from H2O2-induced cell death. Pretreatment with compound 6 (1.56–100 μmol/L) dose-dependently alleviated all the H2O2-induced detrimental effects. Moreover, exposure to H2O2 significantly increased the levels of Bax, p53, cleaved caspase-8, and cleaved caspase-9, and decreased the level of Bcl-2, resulting in cell apoptosis. Exposure to H2O2 also significantly increased the phosphorylation of p38, JNK and ERK in the H9c2 cells. Pretreatment with compound 6 (12.5 and 25 μmol/L) dose-dependently inhibited the H2O2-induced increase in the level of cleaved caspase-9 but not of cleaved caspase-8. It also dose-dependently suppressed the H2O2-induced phosphorylation of JNK and ERK but not that of p38. Conclusion: Compound 6 isolated from the leaves of Gynura nepalensis potently protects H9c2 cardiomyoblasts against H2O2-induced apoptosis, possibly by inhibiting intrinsic apoptosis and the ERK/JNK pathway. PMID:27593219
Cost-effectiveness of new-generation oral cholera vaccines: a multisite analysis.
Jeuland, Marc; Cook, Joseph; Poulos, Christine; Clemens, John; Whittington, Dale
2009-09-01
We evaluated the cost-effectiveness of a low-cost cholera vaccine licensed and used in Vietnam, using recently collected data from four developing countries where cholera is endemic. Our analysis incorporated new findings on vaccine herd protective effects. Using data from Matlab, Bangladesh, Kolkata, India, North Jakarta, Indonesia, and Beira, Mozambique, we calculated the net public cost per disability-adjusted life year avoided for three immunization strategies: 1) school-based vaccination of children 5 to 14 years of age; 2) school-based vaccination of school children plus use of the schools to vaccinate children aged 1 to 4 years; and 3) community-based vaccination of persons aged 1 year and older. We determined cost-effectiveness when vaccine herd protection was or was not considered, and compared this with commonly accepted cutoffs of gross domestic product (GDP) per person to classify interventions as cost-effective or very-cost effective. Without including herd protective effects, deployment of this vaccine would be cost-effective only in school-based programs in Kolkata and Beira. In contrast, after considering vaccine herd protection, all three programs were judged very cost-effective in Kolkata and Beira. Because these cost-effectiveness calculations include herd protection, the results are dependent on assumed vaccination coverage rates. Ignoring the indirect effects of cholera vaccination has led to underestimation of the cost-effectiveness of vaccination programs with oral cholera vaccines. Once these effects are included, use of the oral killed whole cell vaccine in programs to control endemic cholera meets the per capita GDP criterion in several developing country settings.
El Sayed, S M; El-Magd, R M Abou; Shishido, Y; Chung, S P; Diem, T H; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-02-01
Oxidative stress-energy depletion therapy using oxidative stress induced by D-amino acid oxidase (DAO) and energy depletion induced by 3-bromopyruvate (3BP) was reported recently (El Sayed et al., Cancer Gene Ther., 19, 1-18, 2012). Even in the presence of oxygen, cancer cells oxidize glucose preferentially to produce lactate (Warburg effect) which seems vital for cancer microenvironment and progression. 3BP is a closely related structure to lactate and pyruvate and may antagonize their effects as a novel mechanism of its action. Pyruvate exerted a potent H(2)O(2) scavenging effect to exogenous H(2)O(2), while lactate had no scavenging effect. 3BP induced H(2)O(2) production. Pyruvate protected against H(2)O(2)-induced C6 glioma cell death, 3BP-induced C6 glioma cell death but not against DAO/D-serine-induced cell death, while lactate had no protecting effect. Lactate and pyruvate protected against 3BP-induced C6 glioma cell death and energy depletion which were overcome with higher doses of 3BP. Lactate and pyruvate enhanced migratory power of C6 glioma which was blocked by 3BP. Pyruvate and lactate did not protect against C6 glioma cell death induced by other glycolytic inhibitors e.g. citrate (inhibitor of phosphofructokinase) and sodium fluoride (inhibitor of enolase). Serial doses of 3BP were synergistic with citrate in decreasing viability of C6 glioma cells and spheroids. Glycolysis subjected to double inhibition using 3BP with citrate depleted ATP, clonogenic power and migratory power of C6 glioma cells. 3BP induced a caspase-dependent cell death in C6 glioma. 3BP was powerful in decreasing viability of human glioblastoma multiforme cells (U373MG) and C6 glioma in a dose- and time-dependent manner.
NASA Astrophysics Data System (ADS)
Sidnyaev, N. I.
2018-05-01
The results of studying the high-velocity impact interactions of a particle flux of space's meteoric background with satellites have been presented. The effects that arises during the microparticle motion in the material have been described; the models of solid particle interactions with spacecraft's onboard hardware protection have been presented. The experimental and analytical dependences have been given. The basic factors have been revealed, and their effect on the erosion wear of satellite's surface has been estimated. The dependences for calculating the rectilinear (horizontal, inclined and vertical) sections of satellite's surface have been given. The presented dependences represent the results of experimental and analytical studies.
Skin protection against UV light by dietary antioxidants.
Fernández-García, Elisabet
2014-09-01
There is considerable interest in the concept of additional endogenous photoprotection by dietary antioxidants. A number of efficient micronutrients are capable of contributing to the prevention of UV damage in humans. These compounds protect molecular targets by scavenging reactive oxygen species, including excited singlet oxygen and triplet state molecules, and also modulate stress-dependent signaling and/or suppress cellular and tissue responses like inflammation. Micronutrients present in the diet such as carotenoids, vitamins E and C, and polyphenols contribute to antioxidant defense and may also contribute to endogenous photoprotection. This review summarizes the literature concerning the use of dietary antioxidants as systemic photoprotective agents towards skin damage induced by UVA and UVB. Intervention studies in humans with carotenoid-rich diets have shown photoprotection. Interestingly, rather long treatment periods (a minimum of 10 weeks) were required to achieve this effect. Likewise, dietary carotenoids exert their protective antioxidant function in several in vitro and in vivo studies when present at sufficiently high concentration. A combination of vitamins E and C protects the skin against UV damage. It is suggested that daily consumption of dietary polyphenols may provide efficient protection against the harmful effects of solar UV radiation in humans. Furthermore, the use of these micronutrients in combination may provide an effective strategy for protecting human skin from damage by UV exposure.
Park, Moo Suk; He, Qianbin; Edwards, Michael G; Sergew, Amen; Riches, David W H; Albert, Richard K; Douglas, Ivor S
2012-07-01
Mechanical ventilation induces heterogeneous lung injury by mitogen-activated protein kinase (MAPK) and nuclear factor-κB. Mechanisms regulating regional injury and protective effects of prone positioning are unclear. To determine the key regulators of the lung regional protective effects of prone positioning in rodent lungs exposed to injurious ventilation. Adult rats were ventilated with high (18 ml/kg, positive end-expiratory pressure [PEEP] 0) or low Vt (6 ml/kg; PEEP 3 cm H(2)O; 3 h) in supine or prone position. Dorsal-caudal lung mRNA was analyzed by microarray and MAPK phosphatases (MKP)-1 quantitative polymerase chain reaction. MKP-1(-/-) or wild-type mice were ventilated with very high (24 ml/kg; PEEP 0) or low Vt (6-7 ml/kg; PEEP 3 cm H(2)O). The MKP-1 regulator PG490-88 (MRx-108; 0.75 mg/kg) or phosphate-buffered saline was administered preventilation. Injury was assessed by lung mechanics, bronchioalveolar lavage cell counts, protein content, and lung injury scoring. Immunoblotting for MKP-1, and IκBα and cytokine ELISAs were performed on lung lysates. Prone positioning was protective against injurious ventilation in rats. Expression profiling demonstrated MKP-1 20-fold higher in rats ventilated prone rather than supine and regional reduction in p38 and c-jun N-terminal kinase activation. MKP-1(-/-) mice experienced amplified injury. PG490-88 improved static lung compliance and injury scores, reduced bronchioalveolar lavage cell counts and cytokine levels, and induced MKP-1 and IκBα. Injurious ventilation induces MAPK in an MKP-1-dependent fashion. Prone positioning is protective and induces MKP-1. PG490-88 induced MKP-1 and was protective against high Vt in a nuclear factor-κB-dependent manner. MKP-1 is a potential target for modulating regional effects of injurious ventilation.
Ichikawa, Atsuko; Nakahara, Tsutomu; Kurauchi, Yuki; Mori, Asami; Sakamoto, Kenji; Ishii, Kunio
2014-06-01
Recent studies have demonstrated that inhibition of the mammalian target of rapamycin (mTOR) protects against neuronal injury, but the mechanisms underlying this protection are not fully understood. The present study investigates whether rapamycin, an inhibitor of the mTOR pathway, protects against N-methyl-D-aspartate (NMDA)-induced retinal neurotoxicity and whether the extracellular signal-regulated kinase (ERK) pathway contributes to this protective effect in rats. Significant cell loss in the ganglion cell layer and a reduction in thickness of the inner plexiform layer were observed 7 days after a single intravitreal injection of NMDA (200 nmol/eye). These NMDA-induced morphological changes were significantly reduced by rapamycin (20 nmol/eye). The number of terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling-positive apoptotic cells had increased 6 hr after NMDA injection, an effect that was significantly attenuated by rapamycin. The ERK inhibitor U0126 (1 nmol/eye) almost completely abolished rapamycin's inhibition of NMDA-induced apoptosis. Immunohistochemical studies showed that NMDA caused a time-dependent increase in levels of the phosphorylated form of the ribosomal protein S6 (pS6), a downstream indicator of mTOR activity. The increased pS6 levels were markedly decreased by rapamycin. Both NMDA and rapamycin increased the level of phosphorylated ERK (pERK) in Müller cells, and coinjection of both agents further increased pERK levels. These results suggest that rapamycin has a neuroprotective effect against NMDA-induced retinal neurotoxicity and that this effect could be patially mediated by activation of the ERK pathway in retinal Müller cells. Copyright © 2014 Wiley Periodicals, Inc.
Li, Hao; Wang, Xing-Xing; Wang, Bin; Fu, Lei; Liu, Guan; Lu, Yu; Cao, Min; Huang, Hairong; Javid, Babak
2017-05-09
The role of Igs in natural protection against infection by Mycobacterium tuberculosis (Mtb), the causative agent of TB, is controversial. Although passive immunization with mAbs generated against mycobacterial antigens has shown protective efficacy in murine models of infection, studies in B cell-depleted animals only showed modest phenotypes. We do not know if humans make protective antibody responses. Here, we investigated whether healthcare workers in a Beijing TB hospital-who, although exposed to suprainfectious doses of pathogenic Mtb, remain healthy-make antibody responses that are effective in protecting against infection by Mtb. We tested antibodies isolated from 48 healthcare workers and compared these with 12 patients with active TB. We found that antibodies from 7 of 48 healthcare workers but none from active TB patients showed moderate protection against Mtb in an aerosol mouse challenge model. Intriguingly, three of seven healthcare workers who made protective antibody responses had no evidence of prior TB infection by IFN-γ release assay. There was also good correlation between protection observed in vivo and neutralization of Mtb in an in vitro human whole-blood assay. Antibodies mediating protection were directed against the surface of Mtb and depended on both immune complexes and CD4+ T cells for efficacy. Our results indicate that certain individuals make protective antibodies against Mtb and challenge paradigms about the nature of an effective immune response to TB.
Design and evaluation of steering protection for avoiding collisions during a lane change.
Itoh, Makoto; Inagaki, Toshiyuki
2014-01-01
This paper discusses the design of a driver assistance system for avoiding collisions with vehicles in blind spots. The following three types of support systems are compared: (1) a warning system that provides the driver with an auditory alert, (2) a 'soft' protection system that makes the steering wheel stiffer to tell the driver that a lane-change manoeuvre is not recommended and (3) a 'hard' protection system that cancels the driver's input and controls the tyre angle autonomously to prevent lane departure. The results of an experiment showed that the hard protection system was more effective for collision avoidance than either the warning or the soft protection system. The warning and soft protection systems were almost the same in terms of collision avoidance. The results suggest that the human-centred automation principle, which requires the human to have the final authority over the automation, can be violated depending on the context.
Jabri, Mohamed-Amine; Rtibi, Kais; Tounsi, Haifa; Hosni, Karim; Marzouki, Lamjed; Sakly, Mohsen; Sebai, Hichem
2017-05-01
This study aimed to investigate the antiulcer and antioxidant activities of myrtle berry seed aqueous extract (MBSAE) in a peptic ulcer model induced by ethanol in male Wistar rats. MBSAE is rich in total polyphenols, total flavonoids, and unsaturated fatty acids, particularly linoleic (18:2) and oleic (18:1) acids. MBSAE also exhibited in vitro antioxidant activity using 2,2-diphenyl-1-picrylhydrazyl (DPPH) (IC 50 = 172.1 μg/mL) and superoxide anion (IC 50 = 200.24 μg/mL) scavenging activities. In vivo, MBSAE provided dose-dependent protection against ethanol-induced gastric and duodenal macroscopic and histological alterations. Also, it inhibited secretory profile disturbances and lipid peroxidation, and preserved normal antioxidant enzyme activities and nonenzymatic antioxidant levels. More importantly, we showed that acute alcohol intoxication increased gastric and duodenal calcium, hydrogen peroxide, and free iron levels, whereas MBSAE treatment protected against intracellular mediator deregulation. In conclusion, we suggest that MBSAE has potent protective effects against alcohol-induced peptic ulcer in rat. This protection might be related in part to its antioxidant properties as well as its opposite effects on some studied intracellular mediators.
Lambrecht, N; Trautmann, M; Korolkiewicz, R; Liszkay, M; Peskar, B M
1993-01-01
The mechanism underlying the mucosal protective effect of antacids is still unclear. This study shows that in rats the aluminum containing antacid, hydrotalcit, induces dose dependent protection against gastric mucosal damage caused by ethanol or indomethacin which is considerably enhanced by acidification. Hydrotalcit did not increase gastric mucosal formation or the intraluminal release of prostaglandins, and did not prevent the increase in mucosal leukotriene C4 formation in response to ethanol. Pretreatment with indomethacin did not attenuate the protective effect of unmodified or acidified hydrotalcit. Furthermore, hydrotalcit significantly reduced the gastric damage caused by indomethacin even when it was administered up to 2 hours after the ulcerogen. In indomethacin treated rats, simultaneous administration of hydrotalcit did not affect the concentrations of indomethacin in serum or inflammatory exudates nor did it attenuate the inhibition of prostaglandin release into the exudates. In hydrotalcit treated rats there was no attenuation of the increase in sulphidopeptide leukotriene release or decrease in leukocyte influx into inflammatory exudates elicited by indomethacin administration. Functional ablation of afferent neurons and inhibition of endogenous nitric oxide partially antagonised the protective effect of unmodified, but not of acidified, hydrotalcit. It is concluded that (i) the protective effect of unmodified and acidified hydrotalcit is independent of the eicosanoid system; (ii) protection against indomethacin induced gastric lesions does not require treatment before dosing of the ulcerogen and does not interfere with absorption and anti-inflammatory actions of indomethacin; (iii) endogenous nitric oxide and afferent neurons contribute partly to the effect of unmodified, but not of acidified, hydrotalcit suggesting that different mechanisms mediate their mucosal protective activity. PMID:8472979
Is the pathogenic ergot fungus a conditional defensive mutualist for its host grass?
Wäli, Pauliina P; Wäli, Piippa R; Saikkonen, Kari; Tuomi, Juha
2013-01-01
It is well recognized, that outcomes of mutualistic plant-microorganism interactions are often context dependent and can range from mutualistic to antagonistic depending on conditions. Instead, seemingly pathogenic associations are generally considered only harmful to plants. The ergot fungus (Claviceps purpurea) is a common seed pathogen of grasses and cereals. Ergot sclerotia contain alkaloids which can cause severe toxicity in mammals when ingested, and thus the fungal infection might provide protection for the host plant against mammalian herbivores. Theoretically, the net effect of ergot infection would positively affect host seed set if the cost is not too high and the defensive effect is strong enough. According to our empirical data, this situation is plausible. First, we found no statistically significant seed loss in wild red fescue (Festuca rubra) inflorescences due to ergot infection, but the seed succession decreased along increasing number of sclerotia. Second, in a food choice experiment, sheep showed avoidance against forage containing ergot. Third, the frequency of ergot-infected inflorescences was higher in sheep pastures than surrounding ungrazed areas, indicating a protective effect against mammalian grazing. We conclude that, although ergot can primarily be categorized as a plant pathogen, ergot infection may sometimes represent indirect beneficial effects for the host plant. Ergot may thus serve as a conditional defensive mutualist for its host grass, and the pathogenic interaction may range from antagonistic to mutualistic depending on the situation.
Is the Pathogenic Ergot Fungus a Conditional Defensive Mutualist for Its Host Grass?
Wäli, Pauliina P.; Wäli, Piippa R.; Saikkonen, Kari; Tuomi, Juha
2013-01-01
It is well recognized, that outcomes of mutualistic plant-microorganism interactions are often context dependent and can range from mutualistic to antagonistic depending on conditions. Instead, seemingly pathogenic associations are generally considered only harmful to plants. The ergot fungus (Claviceps purpurea) is a common seed pathogen of grasses and cereals. Ergot sclerotia contain alkaloids which can cause severe toxicity in mammals when ingested, and thus the fungal infection might provide protection for the host plant against mammalian herbivores. Theoretically, the net effect of ergot infection would positively affect host seed set if the cost is not too high and the defensive effect is strong enough. According to our empirical data, this situation is plausible. First, we found no statistically significant seed loss in wild red fescue (Festuca rubra) inflorescences due to ergot infection, but the seed succession decreased along increasing number of sclerotia. Second, in a food choice experiment, sheep showed avoidance against forage containing ergot. Third, the frequency of ergot-infected inflorescences was higher in sheep pastures than surrounding ungrazed areas, indicating a protective effect against mammalian grazing. We conclude that, although ergot can primarily be categorized as a plant pathogen, ergot infection may sometimes represent indirect beneficial effects for the host plant. Ergot may thus serve as a conditional defensive mutualist for its host grass, and the pathogenic interaction may range from antagonistic to mutualistic depending on the situation. PMID:23874924
Research on laser protection: an overview of 20 years of activities at Fraunhofer IOSB
NASA Astrophysics Data System (ADS)
Ritt, G.; Walter, D.; Eberle, B.
2013-10-01
Since the advent of the laser in 1960, the protection of human eyes and sensors against intended or unintended damage by laser radiation is a hot research topic. As long as the parameters of a laser source such as the wavelength and the output power are known, adequate laser safety can be ensured simply by utilizing conventional laser protection filters which are based on absorption or interference effects. This is typically the case in cooperative environments like a laboratory or industrial facilities. A very different situation prevails in military defense or civil security. There, the parameters of encountering laser threats are usually unknown. Protection measures, helping against all types of laser threats, are the long desired objective of countless research activities. The biggest challenge in finding an effective measure arises from single laser pulses of unknown wavelength. The problem demands for a passive protection concept and may be based for example on intensity dependent effects. Moreover, the requested solutions shall comprise add-on possibilities like thin films to be put on existing optics, windshields or glasses. Unfortunately, such an all-embracing solution is still far out of reach. The Fraunhofer IOSB has been working on the evaluation and development of non-conventional laser protection methods for more than 20 years. An overview of the past and present research activities shall be presented, comprising protection measures against laser damaging and laser dazzling.
Shibu, Marthandam Asokan; Kuo, Chia-Hua; Chen, Bih-Cheng; Ju, Da-Tong; Chen, Ray-Jade; Lai, Chao-Hung; Huang, Pei-Jane; Viswanadha, Vijaya Padma; Kuo, Wei-Wen; Huang, Chih-Yang
2018-02-01
Tea, the most widely consumed natural beverage has been associated with reduced mortality risk from cardiovascular disease. Oolong tea is a partially fermented tea containing high levels of catechins, their degree of oxidation varies between 20%-80% causing differences in their active metabolites. In this study we examined the effect of oolong tea extract (OTE) obtained by oxidation at low-temperature for short-time against hypoxic injury and found that oolong tea provides cyto-protective effects by suppressing the JNK mediated hypertrophic effects and by enhancing the innate antioxidant mechanisms in neonatal cardiomyocytes and in H9c2 cells. OTE effectively attenuates 24 h hypoxia-triggered cardiomyocyte loss by suppressing caspase-3-cleavage and apoptosis in a dose-dependent manner. OTE also enhances the IGFIR/p-Akt associated survival-mechanism involving the elevation of p-Bad ser136 in a dose-dependent manner to aid cellular adaptations against hypoxic challenge. The results show the effects and mechanism of Oolong tea to provide cardio-protective benefits during hypoxic conditions. © 2017 Wiley Periodicals, Inc.
Lee, Ji Yeon
2016-10-01
Transmission of tuberculosis (TB) is a recognized risk to patients and healthcare workers in healthcare settings. The literature review suggests that implementation of combination control measures reduces the risk of TB transmission. Guidelines suggest a three-level hierarchy of controls including administrative, environmental, and respiratory protection. Among environmental controls, installation of ventilation systems is a priority because ventilation reduces the number of infectious particles in the air. Natural ventilation is cost-effective but depends on climatic conditions. Supplemented intervention such as air-cleaning methods including high efficiency particulate air filtration and ultraviolet germicidal irradiation should be considered in areas where adequate ventilation is difficult to achieve. Personal protective equipment including particulate respirators provides additional benefit when administrative and environmental controls cannot assure protection.
Liu, Peiyi; Lin, Hongkun; Xu, Yanyan; Zhou, Feng; Wang, Jing; Liu, Jingjing; Zhu, Xinhong; Guo, Xiaoping; Tang, Yuhan; Yao, Ping
2018-06-23
Naturally occurring quercetin has been found to induce mitophagy and prevent non-alcoholic fatty liver disease (NAFLD). However, it still remains elusive whether frataxin upregulation by quercetin contributes to the beneficial effect through mitophagy or not. Adult male C57BL/J mice were fed a high fat diet (HFD, 60% of energy from fat) with quercetin (100 mg/kg.bw) or not for 10 weeks. Quercetin alleviated HFD-induced histopathological changes, disorders of lipid metabolism, mitochondrial damage. Moreover, quercetin blocked mitophagy suppression by HFD based on the increased LC3II, PINK1 and Beclin1 expressions, as well as decreased p62 levels. Quercetin also improved the Parkin translocation to mitochondria confirmed by immunofluorescence. Specifically, frataxin was lowered in the liver of HFD-fed mice or HepG2 cell incubated with oleate/palmitate but restored by quercetin. And quercetin's regulation of frataxin may depend on p53. Furthermore, lentivirus-mediated stable knockdown of frataxin in HepG2 inhibited PINK1- Parkin-associated mitophagy and resulted in lipid accumulation. Frataxin was further decreased by free fatty acids in knockdown cells concomitantly with depressed PINK1-Parkin-associated mitophagy, which was partially normalized by quercetin. Quercetin alleviated hepatic steatosis by enhancing frataxin-mediated PINK1/Parkin-dependent mitophagy, highlighting a promising preventive strategy and mechanism for NAFLD by quercetin. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Sun, Wei; Roland, Kenneth L; Kuang, Xiaoying; Branger, Christine G; Curtiss, Roy
2010-03-01
Two mutant strains of Yersinia pestis KIM5+, a Deltacrp mutant and a mutant with arabinose-dependent regulated delayed-shutoff crp expression (araC P(BAD) crp), were constructed, characterized in vitro, and evaluated for virulence, immunogenicity, and protective efficacy in mice. Both strains were highly attenuated by the subcutaneous (s.c.) route. The 50% lethal doses (LD(50)s) of the Deltacrp and araC P(BAD) crp mutants were approximately 1,000,000-fold and 10,000-fold higher than those of Y. pestis KIM5+, respectively, indicating that both strains were highly attenuated. Mice vaccinated s.c. with 3.8 x 10(7) CFU of the Deltacrp mutant developed high anti-Y. pestis and anti-LcrV serum IgG titers, both with a strong Th2 bias, and induced protective immunity against subcutaneous challenge with virulent Y. pestis (80% survival) but no protection against pulmonary challenge. Mice vaccinated with 3.0 x 10(4) CFU of the araC P(BAD) crp mutant also developed high anti-Y. pestis and anti-LcrV serum IgG titers but with a more balanced Th1/Th2 response. This strain induced complete protection against s.c. challenge and partial protection (70% survival) against pulmonary challenge. Our results demonstrate that arabinose-dependent regulated crp expression is an effective strategy to attenuate Y. pestis while retaining strong immunogenicity, leading to protection against the pneumonic and bubonic forms of plague.
Meek, Stephanie M; Williams, Matthew A
2018-02-13
While CD8⁺ memory T cells can promote long-lived protection from secondary exposure to intracellular pathogens, less is known regarding the direct protective mechanisms of CD4⁺ T cells. We utilized a prime/boost model in which mice are initially exposed to an acutely infecting strain of lymphocytic choriomeningitis virus (LCMV), followed by a heterologous rechallenge with Listeria monocytogenes recombinantly expressing the MHC Class II-restricted LCMV epitope, GP 61-80 (Lm-gp61). We found that heterologous Lm-gp61 rechallenge resulted in robust activation of CD4⁺ memory T cells and that they were required for rapid bacterial clearance. We further assessed the relative roles of TNF and IFNγ in the direct anti-bacterial function of CD4⁺ memory T cells. We found that disruption of TNF resulted in a complete loss of protection mediated by CD4⁺ memory T cells, whereas disruption of IFNγ signaling to macrophages results in only a partial loss of protection. The protective effect mediated by CD4⁺ T cells corresponded to the rapid accumulation of pro-inflammatory macrophages in the spleen and an altered inflammatory environment in vivo. Overall, we conclude that protection mediated by CD4⁺ memory T cells from heterologous Listeria challenge is most directly dependent on TNF, whereas IFNγ only plays a minor role.
Liposomes composed of unsaturated lipids for membrane modification of human erythrocytes.
Stoll, Christoph; Holovati, Jelena L; Acker, Jason P; Wolkers, Willem F
2011-01-01
Previous studies have shown that certain saturated lipids protect red blood cells (RBCs) during hypothermic storage but provide little protection during freezing or freeze-drying, whereas various unsaturated lipids destabilize RBCs during hypothermic storage but protect during freezing and freeze-drying. The protective effect of liposomes has been attributed to membrane modifications. We have previously shown that cholesterol exchange and lipid transfer between liposomes composed of saturated lipids and RBCs critically depends on the length of the lipid acyl chains. In this study the effect of unsaturated lipids with differences in their number of unsaturated bonds (18:0/18:1, 18:1/18:1, 18:2/18:2) on RBC membrane properties has been studied. RBCs were incubated in the presence of liposomes and both the liposomal and RBC fraction were analyzed by Fourier transform infrared spectroscopy (FTIR) after incubation. The liposomes caused an increase in RBC membrane conformational disorder at suprazero temperatures. The fluidizing effect of the liposomes on the RBC membranes, however, was found to be similar for the different lipids irrespective of their unsaturation level. The gel to liquid crystalline phase transition temperature of the liposomes increased after incubation with RBCs. RBC membrane fluidity increased linearly during the first 8 hours of incubation in the presence of liposomes. The increase in RBC membrane fluidity was found to be temperature dependent and displayed Arrhenius behaviour between 20 and 40°C, with an activation energy of 88 kJ mol⁻¹. Taken together, liposomes composed of unsaturated lipids increase RBC membrane conformational disorder, which could explain their cryoprotective action.
Qi, Di; Tang, Xumao; He, Jing; Wang, Daoxin; Zhao, Yan; Deng, Wang; Deng, Xinyu; Zhou, Guoqi; Xia, Jing; Zhong, Xi; Pu, Shenglan
2016-09-08
Acute respiratory distress syndrome (ARDS) is characterized by increased pulmonary inflammation and endothelial barrier permeability. Omentin has been shown to benefit obesity-related systemic vascular diseases; however, its effects on ARDS are unknown. In the present study, the level of circulating omentin in patients with ARDS was assessed to appraise its clinical significance in ARDS. Mice were subjected to systemic administration of adenoviral vector expressing omentin (Ad-omentin) and one-shot treatment of recombinant human omentin (rh-omentin) to examine omentin's effects on lipopolysaccharide (LPS)-induced ARDS. Pulmonary endothelial cells (ECs) were treated with rh-omentin to further investigate its underlying mechanism. We found that a decreased level of circulating omentin negatively correlated with white blood cells and procalcitonin in patients with ARDS. Ad-omentin protected against LPS-induced ARDS by alleviating the pulmonary inflammatory response and endothelial barrier injury in mice, accompanied by Akt/eNOS pathway activation. Treatment of pulmonary ECs with rh-omentin attenuated inflammatory response and restored adherens junctions (AJs), and cytoskeleton organization promoted endothelial barrier after LPS insult. Moreover, the omentin-mediated enhancement of EC survival and differentiation was blocked by the Akt/eNOS pathway inactivation. Therapeutic rh-omentin treatment also effectively protected against LPS-induced ARDS via the Akt/eNOS pathway. Collectively, these data indicated that omentin protects against LPS-induced ARDS by suppressing inflammation and promoting the pulmonary endothelial barrier, at least partially, through an Akt/eNOS-dependent mechanism. Therapeutic strategies aiming to restore omentin levels may be valuable for the prevention or treatment of ARDS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu Xuan; Tian Feng; Okagaki, Peter
2005-10-01
Organophosphorus (OP) compounds, used as insecticides and chemical warfare agents, are potent neurotoxins. We examined the neurotoxic effect of paraoxon (O,O-diethyl O-p-nitrophenyl phosphate), an organophosphate compound, and the role of NMDA receptors as a mechanism of action in cultured cerebellar granule cells. Paraoxon is neurotoxic to cultured rat cerebellar granule cells in a time- and concentration-dependent manner. Cerebellar granule cells are less sensitive to the neurotoxic effects of paraoxon on day in vitro (DIV) 4 than neurons treated on DIV 8. Surprisingly, the N-methyl-D-aspartate (NMDA) receptor antagonist, MK-801, enhances paraoxon-mediated neurotoxicity suggesting that NMDA receptors may play a protective role.more » Pretreatment with a subtoxic concentration of N-methyl-D-aspartate (NMDA) [100 {mu}M] protects about 40% of the vulnerable neurons that would otherwise die from paraoxon-induced neurotoxicity. Moreover, addition of a neuroprotective concentration of NMDA 3 h after treatment with paraoxon provides the same level of protection. Because paraoxon-mediated neuronal cell death is time-dependent, we hypothesized that apoptosis may be involved. Paraoxon increases apoptosis about 10-fold compared to basal levels. The broad-spectrum caspase inhibitor (Boc-D-FMK) and the caspase-9-specific inhibitor (Z-LEHD-FMK) protect against paraoxon-mediated apoptosis, paraoxon-stimulated caspase-3 activity and neuronal cell death. MK-801 increases, whereas NMDA blocks paraoxon-induced apoptosis and paraoxon-stimulated caspase-3 activity. These results suggest that activation of NMDA receptors protect neurons against paraoxon-induced neurotoxicity by blocking apoptosis initiated by paraoxon.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Lei; Wu, Zhong; Yin, Gang
2014-12-12
Highlights: • SCF receptor c-Kit is functionally expressed in primary and transformed osteoblasts. • SCF protects primary and transformed osteoblasts from H{sub 2}O{sub 2}. • SCF activation of c-Kit in osteoblasts, required for its cyto-protective effects. • c-Kit mediates SCF-induced Akt activation in cultured osteoblasts. • Akt activation is required for SCF-regulated cyto-protective effects in osteoblasts. - Abstract: Osteoblasts regulate bone formation and remodeling, and are main target cells of oxidative stress in the progression of osteonecrosis. The stem cell factor (SCF)-c-Kit pathway plays important roles in the proliferation, differentiation and survival in a range of cell types, but littlemore » is known about its functions in osteoblasts. In this study, we found that c-Kit is functionally expressed in both osteoblastic-like MC3T3-E1 cells and primary murine osteoblasts. Its ligand SCF exerted significant cyto-protective effects against hydrogen peroxide (H{sub 2}O{sub 2}). SCF activated its receptor c-Kit in osteoblasts, which was required for its cyto-protective effects against H{sub 2}O{sub 2}. Pharmacological inhibition (by Imatinib and Dasatinib) or shRNA-mediated knockdown of c-Kit thus inhibited SCF-mediated osteoblast protection. Further investigations showed that protection by SCF against H{sub 2}O{sub 2} was mediated via activation of c-Kit-dependent Akt pathway. Inhibition of Akt activation, through pharmacological or genetic means, suppressed SCF-mediated anti-H{sub 2}O{sub 2} activity in osteoblasts. In summary, we have identified a new SCF-c-Kit-Akt physiologic pathway that protects osteoblasts from H{sub 2}O{sub 2}-induced damages, and might minimize the risk of osteonecrosis caused by oxidative stress.« less
A case study of risk factors for lymphatic filariasis in the Republic of Congo.
Chesnais, Cédric B; Missamou, François; Pion, Sébastien D; Bopda, Jean; Louya, Frédéric; Majewski, Andrew C; Fischer, Peter U; Weil, Gary J; Boussinesq, Michel
2014-07-01
Little is known regarding risk factors for lymphatic filariasis (LF) in Central Africa. We studied the epidemiology of LF in an endemic village in the Republic of Congo. Dependent variables were Wuchereria bancrofti antigenemia (ICT card test) and microfilaremia (night blood smears). The following factors were investigated: sex, age, bed net, latrines, source of water, uptake of anthelmintic drugs, hunting/fishing activities, and occasionally sleeping in the bush. Mixed multivariate logistic regression models were used. 134 of 774 subjects aged ≥ 5 years (17.3%) had W. bancrofti antigenemia and 41 (5.3%) had microfilaremia (mf). Infection rates increased with age up to roughly 20 years and remained stable thereafter. Multivariate analysis of antigenemia demonstrated an increased risk for males (OR = 2.0 [1.3-3.0]) and for people who hunt or fish (OR = 1.5 [1.0-2.4]) and a protective effect of latrines (OR = 0.5 [0.4-0.8]). Among males, those hunting or fishing at night had an increased risk for antigenemia (OR = 1.9 [1.1-3.5]), and use of latrines was protective (OR = 0.5 [0.3-0.9]). For females, bed nets were protective (OR = 0.4 [0.1-0.9]), and there was a strong household effect (intraclass correlation coefficient [ICC]: 0.24). When mf was used as the dependent variable, males had a higher risk for infection (OR = 5.4 [2.1-13.4]), latrines had a protective effect (OR = 0.4 [0.1-0.9]) and there was a marked household effect (ICC = 0.49). Age, sex, and occupation-dependent exposure to mosquitoes were important risk factors for infection with W. bancrofti in this study. It is likely that men often acquire infection in high transmission areas outside of the village, while children and women are infected in areas with lower transmission inside or near the village. Additional studies are needed to determine whether these findings apply to other areas in Central Africa.
A case study of risk factors for lymphatic filariasis in the Republic of Congo
2014-01-01
Background Little is known regarding risk factors for lymphatic filariasis (LF) in Central Africa. We studied the epidemiology of LF in an endemic village in the Republic of Congo. Methods Dependent variables were Wuchereria bancrofti antigenemia (ICT card test) and microfilaremia (night blood smears). The following factors were investigated: sex, age, bed net, latrines, source of water, uptake of anthelmintic drugs, hunting/fishing activities, and occasionally sleeping in the bush. Mixed multivariate logistic regression models were used. Results 134 of 774 subjects aged ≥ 5 years (17.3%) had W. bancrofti antigenemia and 41 (5.3%) had microfilaremia (mf). Infection rates increased with age up to roughly 20 years and remained stable thereafter. Multivariate analysis of antigenemia demonstrated an increased risk for males (OR = 2.0 [1.3-3.0]) and for people who hunt or fish (OR = 1.5 [1.0-2.4]) and a protective effect of latrines (OR = 0.5 [0.4-0.8]). Among males, those hunting or fishing at night had an increased risk for antigenemia (OR = 1.9 [1.1-3.5]), and use of latrines was protective (OR = 0.5 [0.3-0.9]). For females, bed nets were protective (OR = 0.4 [0.1-0.9]), and there was a strong household effect (intraclass correlation coefficient [ICC]: 0.24). When mf was used as the dependent variable, males had a higher risk for infection (OR = 5.4 [2.1-13.4]), latrines had a protective effect (OR = 0.4 [0.1-0.9]) and there was a marked household effect (ICC = 0.49). Conclusions Age, sex, and occupation-dependent exposure to mosquitoes were important risk factors for infection with W. bancrofti in this study. It is likely that men often acquire infection in high transmission areas outside of the village, while children and women are infected in areas with lower transmission inside or near the village. Additional studies are needed to determine whether these findings apply to other areas in Central Africa. PMID:24984769
Fructose and tagatose protect against oxidative cell injury by iron chelation.
Valeri, F; Boess, F; Wolf, A; Göldlin, C; Boelsterli, U A
1997-01-01
To further investigate the mechanism by which fructose affords protection against oxidative cell injury, cultured rat hepatocytes were exposed to cocaine (300 microM) or nitrofurantoin (400 microM). Both drugs elicited massively increased lactate dehydrogenase release. The addition of the ketohexoses D-fructose (metabolized via glycolysis) or D-tagatose (poor glycolytic substrate) significantly attenuated cocaine- and nitrofurantoin-induced cell injury, although both fructose and tagatose caused a rapid depletion of ATP and compromised the cellular energy charge. Furthermore, fructose, tagatose, and sorbose all inhibited in a concentration-dependent manner (0-16 mM) luminolenhanced chemiluminescence (CL) in cell homogenates, indicating that these compounds inhibit the iron-dependent reactive oxygen species (ROS)-mediated peroxidation of luminol. Indeed, both Fe2+ and Fe3+ further increased cocaine-stimulated CL, which was markedly quenched following addition of the ketohexoses. The iron-independent formation of superoxide anion radicals (acetylated cytochrome c reduction) induced by the prooxidant drugs remained unaffected by fructose or tagatose. The iron-chelator deferoxamine similarly protected against prooxidant-induced cell injury. In contrast, the nonchelating aldohexoses D-glucose and D-galactose did not inhibit luminol CL nor did they protect against oxidative cell injury. These data indicate that ketohexoses can effectively protect against prooxidant-induced cell injury, independent of their glycolytic metabolism, by suppressing the iron-catalyzed formation of ROS.
Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.
1999-01-01
Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206
Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan
2013-01-01
To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296
Skin-resident memory CD4+ T cells enhance protection against Leishmania major infection.
Glennie, Nelson D; Yeramilli, Venkata A; Beiting, Daniel P; Volk, Susan W; Weaver, Casey T; Scott, Phillip
2015-08-24
Leishmaniasis causes a significant disease burden worldwide. Although Leishmania-infected patients become refractory to reinfection after disease resolution, effective immune protection has not yet been achieved by human vaccines. Although circulating Leishmania-specific T cells are known to play a critical role in immunity, the role of memory T cells present in peripheral tissues has not been explored. Here, we identify a population of skin-resident Leishmania-specific memory CD4+ T cells. These cells produce IFN-γ and remain resident in the skin when transplanted by skin graft onto naive mice. They function to recruit circulating T cells to the skin in a CXCR3-dependent manner, resulting in better control of the parasites. Our findings are the first to demonstrate that CD4+ TRM cells form in response to a parasitic infection, and indicate that optimal protective immunity to Leishmania, and thus the success of a vaccine, may depend on generating both circulating and skin-resident memory T cells. © 2015 Glennie et al.
Skin-resident memory CD4+ T cells enhance protection against Leishmania major infection
Glennie, Nelson D.; Yeramilli, Venkata A.; Beiting, Daniel P.; Volk, Susan W.; Weaver, Casey T.
2015-01-01
Leishmaniasis causes a significant disease burden worldwide. Although Leishmania-infected patients become refractory to reinfection after disease resolution, effective immune protection has not yet been achieved by human vaccines. Although circulating Leishmania-specific T cells are known to play a critical role in immunity, the role of memory T cells present in peripheral tissues has not been explored. Here, we identify a population of skin-resident Leishmania-specific memory CD4+ T cells. These cells produce IFN-γ and remain resident in the skin when transplanted by skin graft onto naive mice. They function to recruit circulating T cells to the skin in a CXCR3-dependent manner, resulting in better control of the parasites. Our findings are the first to demonstrate that CD4+ TRM cells form in response to a parasitic infection, and indicate that optimal protective immunity to Leishmania, and thus the success of a vaccine, may depend on generating both circulating and skin-resident memory T cells. PMID:26216123
Hault, K; Rönsch, H; Beissert, S; Knuschke, P; Bauer, A
2016-04-01
The most important but influenceable risk factor in the development of skin cancer is the unprotected exposure to solar ultraviolet (UV) radiation. In order to assure adequate and effective protection against UV exposure, a level of knowledge about solar radiation and its effects is required. The objective of this study was to assess the knowledge of workers in outdoor professions on the effects of natural UV radiation and methods of protection against exposure. Forty outdoor workers were given a standardized questionnaire designed to ascertain their level of knowledge. The majority of participants knew exposure to solar radiation can be detrimental depending on exposure time. Eighty-three percentage recognized that people working regularly in an outdoor environment may be at risk due to high exposure. Long-sleeved clothing plus headgear and sunscreen containing sun-protecting substances were deemed adequate methods of protection by 83% and 85% respectively. Seventy percentage of the outdoor workers were familiar with the definition of the sun protection factor (SPF), yet only 25% correctly identified the amount of sunscreen needed to achieve the SPF as indicated on the product. A mere 8% of participants knew that symptoms of a sunburn first became apparent 3 h after sun exposure and only 18% were able to accurately gauge the amount of time they could spend in the sun before developing one. Although 30% had heard of the ultraviolet index (UVI), only 13% understood that protecting your skin using additional measures is recommended as of UVI 3. Overall, 30% of the outdoor workers thought themselves sufficiently protected against the harmful effects of the sun. While the participants of this study had a basic fundamental understanding of the effects of solar radiation and methods of protection against exposure, there remains an urgent need for further clarification across all demographic groups. © 2016 European Academy of Dermatology and Venereology.
Wu, Xianmin; Cai, Jing; Li, Xiaofei; Li, He; Li, Jianfeng; Bai, Xiaohui; Liu, Wenwen; Han, Yuechen; Xu, Lei; Zhang, Daogong; Wang, Haibo; Fan, Zhaomin
2017-06-15
Cisplatin is an anticancer drug that causes the impairment of inner ear function as side effects, including hearing loss and balance dysfunction. The purpose of this study was to investigate the effects of allicin against cisplatin-induced vestibular dysfunction in mice and to make clear the mechanism underlying the protective effects of allicin on oto-vestibulotoxicity. Mice intraperitoneally injected with cisplatin exhibited vestibular dysfunction in swimming test, which agreed with impairment in vestibule. However, these impairments were significantly prevented by pre-treatment with allicin. Allicin markedly reduced cisplatin-activated expression of cleaved-caspase-3 in hair cells and vascular layer cells of utricule, saccule and ampulla, but also decreased AIF nuclear translocation of hair cells in utricule, saccule and ampulla. These results showed that allicin played an effective role in protecting vestibular dysfunction induced by cisplatin via inhibiting caspase-dependent and caspase-independent apoptotic pathways. Therefore, allicin may be useful in preventing oto-vestibulotoxicity mediated by cisplatin. Copyright © 2017. Published by Elsevier B.V.
Reactions of peroxynitrite with cocoa procyanidin oligomers.
Arteel, G E; Schroeder, P; Sies, H
2000-08-01
Peroxynitrite is a mediator molecule in inflammation, and its biological properties are being studied extensively. Flavonoids, which are natural plant constituents, protect against peroxynitrite and thereby could play an anti-inflammatory role. Procyanidin oligomers of different sizes (monomer through nonamer), isolated from the seeds of Theobroma cacao, were recently examined for their ability to protect against peroxynitrite-dependent oxidation of dihydrorhodamine 123 and nitration of tyrosine and were found to be effective in attenuating these reactions. The tetramer was particularly efficient at protecting against oxidation and nitration reactions. Epicatechin oligomers found in cocoa powder and chocolate may be a potent dietary source for defense against peroxynitrite.
Disabling Radiological Dispersal Terror
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hart, M
Terror resulting from the use of a radiological dispersal device (RDD) relies upon an individual's lack of knowledge and understanding regarding its significance. Disabling this terror will depend upon realistic reviews of the current conservative radiation protection regulatory standards. It will also depend upon individuals being able to make their own informed decisions merging perceived risks with reality. Preparation in these areas will reduce the effectiveness of the RDD and may even reduce the possibility of its use.
Peroral Immunization of Rats with Escherichia coli Heat-Labile Enterotoxin Delivered by Microspheres
Klipstein, Frederick A.; Engert, Richard F.; Sherman, William T.
1983-01-01
The antigenicity of the Escherichia coli heat-labile enterotoxin was not protected against the adverse effect of gastric acidity when the toxin was given together with bicarbonate for peroral immunization to rats, but immunization with the heat-labile enterotoxin encapsulated in pH-dependent microspheres aroused the same strong degree of serum and mucosal antitoxin responses and of protection against challenge as was achieved by peroral immunization after ablation of gastric secretions by pretreatment with cimetidine. PMID:6339378
James, Lisa M; Christova, Peka; Lewis, Scott M; Engdahl, Brian E; Georgopoulos, Angeliki; Georgopoulos, Apostolos P
2018-03-01
Reduction of brain volume (brain atrophy) during healthy brain aging is well documented and dependent on genetic, lifestyle and environmental factors. Here we investigated the possible dependence of brain gray matter volume reduction in the absence of the Human Leukocyte Antigen (HLA) allele DRB1*13:02 which prevents brain atrophy in Gulf War Illness (James et al., 2017). Seventy-one cognitively healthy women (32-69years old) underwent a structural Magnetic Resonance Imaging (sMRI) scan to measure the volumes of total gray matter, cerebrocortical gray matter, and subcortical gray matter. Participants were assigned to two groups, depending on whether they lacked the DRB1*13:02 allele (No DRB1*13:02 group, N=60) or carried the DRB1*13:02 allele (N=11). We assessed the change of brain gray matter volume with age in each group by performing a linear regression where the brain volume (adjusted for total intracranial volume) was the dependent variable and age was the independent variable. In the No DRB1*13:02 group, the volumes of total gray matter, cerebrocortical gray matter, and subcortical gray matter were reduced highly significantly. In contrast, none of these volumes showed a statistically significant reduction with age in the DRB1*13:02 group. These findings document the protective effect of DRB1*13:02 on age-dependent reduction of brain gray matter in healthy individuals. Since the role of this allele is to connect to matching epitopes of external antigens for the subsequent production of antibodies and elimination of the offending antigen, we hypothesize that its protective effect may be due to the successful elimination of such antigens to which we are exposed during the lifespan, antigens that otherwise would persist causing gradual brain atrophy. In addition, we consider a possible beneficial role of DRB1*13:02 attributed to its binding to cathepsin S, a known harmful substance in brain aging (Wendt et al., 2008). Of course, other factors covarying with the presence of DRB1*13:02 could be involved. Published by Elsevier B.V.
2018-01-01
Background: Blacks’ diminished return is defined as smaller protective effects of socioeconomic status (SES) on health of African Americans compared to Whites. Aim: Using a nationally representative sample, the current study aimed to examine if the protective effect of income on chronic medical conditions (CMC) differs for African Americans compared to Whites. Methods: With a cross-sectional design, the National Survey of American Life (NSAL), 2003, included 3570 non-Hispanic African Americans and 891 non-Hispanic Whites. The dependent variable was CMC, treated as a continuous measure. The independent variable was income. Race was the focal moderator. Age, education, and marital status were covariates. Linear regressions were used to test if the protective effect of income against CMC varies by race. Results: High income was associated with a lower number of CMC in the pooled sample. We found a significant interaction between race and income, suggesting that income has a smaller protective effect against CMC for African Americans than it does for Whites. Conclusion: Blacks’ diminished return also holds for the effects of income on CMC. Blacks’ diminished return is a contributing mechanism to the racial disparities in health in the United States that is often overlooked. More research is needed on the role of diminished health return of SES resources among other minority groups. PMID:29315227
Radioprotection of mouse skin vasculature and the RIF-1 fibrosarcoma by WR-2721
DOE Office of Scientific and Technical Information (OSTI.GOV)
Penhaligon, M.
1984-09-01
The degree of radioprotection obtained with WR-2721 is critically dependent upon the oxygen tension of the tissue concerned. It was therefore considered of interest to examine the response of vascular tissue, which would be supposedly well oxygenated, to treatment with WR-2721 plus X rays. The response of this tissue is of interest because of its role in late radiation damage. In addition, for therapeutic gain an agent must protect normal tissue without concomitant tumor protection. However, data on tumor radioprotection have been conflicting and therefore the effect of WR-2721 on an experimental tumor was also tested. Vascular damage was assessedmore » using the fact that tumors grow more slowly in irradiated beds (Tumor Bed Effect). WR-2721 injected 30 minutes before 5 to 30 Gy X rays protected skin stroma by a factor of 1.6. However, WR-2721 given 10 to 60 minutes before 20 Gy X rays to the RIF-1 tumor had either no effect or was protective, according to the method of immobilizing the mice during irradiation.« less
Park, Jimin; Woo, Jong Shin; Leem, Jungtae; Park, Jun Hyeong; Lee, Sanghoon; Chung, Hyemoon; Lee, Jung Myung; Kim, Jin-Bae; Kim, Woo-Shik; Kim, Kwon Sam; Kim, Weon
2017-01-01
Objective Exploring clinically effective methods to reduce ischemia-reperfusion (IR) injury in humans is critical. Several drugs have shown protective effects, but studies using other interventions have been rare. Electroacupuncture (EA) has induced similar protection in several animal studies but no study has investigated how the effects could be translated and reproduced in humans. This study aimed to explore the potential effect and mechanisms of EA in IR-induced endothelial dysfunction in humans. Methods This is a prospective, randomized, crossover, sham-controlled trial consisting of two protocols. Protocol 1 was a crossover study to investigate the effect of EA on IR-induced endothelial dysfunction. Twenty healthy volunteers were randomly assigned to EA or sham EA (sham). Flow mediated dilation (FMD) of the brachial artery (BA), nitroglycerin-mediated endothelial independent dilation, blood pressure before and after IR were measured. In protocol 2, seven volunteers were administered COX-2 inhibitor celecoxib (200 mg orally twice daily) for five days. After consumption, volunteers underwent FMD before and after IR identical to protocol 1. Results In protocol 1, baseline BA diameter, Pre-IR BA diameter and FMD were similar between the two groups (p = NS). After IR, sham group showed significantly blunted FMD (Pre-IR: 11.41 ± 3.10%, Post-IR: 4.49 ± 2.04%, p < 0.001). However, EA protected this blunted FMD (Pre-IR: 10.96 ± 5.30%, Post-IR: 9.47 ± 5.23%, p = NS, p < 0.05 compared with sham EA after IR). In protocol 2, this protective effect was completely abolished by pre-treatment with celecoxib (Pre-IR: 11.05 ± 3.27%; Post-IR: 4.20 ± 1.68%, p = 0.001). Conclusion EA may prevent IR-induced endothelial dysfunction via a COX-2 dependent mechanism. PMID:28591155
Protective effect of acetyl-L-carnitine on propofol-induced toxicity in embryonic neural stem cells.
Liu, Fang; Rainosek, Shuo W; Sadovova, Natalya; Fogle, Charles M; Patterson, Tucker A; Hanig, Joseph P; Paule, Merle G; Slikker, William; Wang, Cheng
2014-05-01
Propofol is a widely used general anesthetic. A growing body of data suggests that perinatal exposure to general anesthetics can result in long-term deleterious effects on brain function. In the developing brain there is evidence that general anesthetics can cause cell death, synaptic remodeling, and altered brain cell morphology. Acetyl-L-carnitine (L-Ca), an anti-oxidant dietary supplement, has been reported to prevent neuronal damage from a variety of causes. To evaluate the ability of L-Ca to protect against propofol-induced neuronal toxicity, neural stem cells were isolated from gestational day 14 rat fetuses and on the eighth day in culture were exposed for 24h to propofol at 10, 50, 100, 300 and 600 μM, with or without L-Ca (10 μM). Markers of cellular proliferation, mitochondrial health, cell death/damage and oxidative damage were monitored to determine: (1) the effects of propofol on neural stem cell proliferation; (2) the nature of propofol-induced neurotoxicity; (3) the degree of protection afforded by L-Ca; and (4) to provide information regarding possible mechanisms underlying protection. After propofol exposure at a clinically relevant concentration (50 μM), the number of dividing cells was significantly decreased, oxidative DNA damage was increased and a significant dose-dependent reduction in mitochondrial function/health was observed. No significant effect on lactase dehydrogenase (LDH) release was observed at propofol concentrations up to 100 μM. The oxidative damage at 50 μM propofol was blocked by L-Ca. Thus, clinically relevant concentrations of propofol induce dose-dependent adverse effects on rat embryonic neural stem cells by slowing or stopping cell division/proliferation and causing cellular damage. Elevated levels of 8-oxoguanine suggest enhanced oxidative damage [reactive oxygen species (ROS) generation] and L-Ca effectively blocks at least some of the toxicity of propofol, presumably by scavenging oxidative species and/or reducing their production. Published by Elsevier B.V.
Yadav, Mukesh Kumar; Choi, June; Song, Jae-Jun
2014-03-01
Gentamicin (GM) is a commonly used aminoglycoside antibiotic that generates free oxygen radicals within the inner ear, which can cause vestibulo-cochlear toxicity and permanent damage to the sensory hair cells and neurons. Piper longum L. (PL) is a well-known spice and traditional medicine in Asia and Pacific islands, which has been reported to exhibit a wide spectrum of activity, including antioxidant activity. In this study, we evaluated the effect of hexane:ethanol (2:8) PL extract (subfraction of PL [SPL] extract) on GM-induced hair cell loss in basal, middle and apical regions in a neonatal cochlea cultures. The protective effects of SPL extract were measured by phalloidin staining of cultures from postnatal day 2-3 mice with GM-induced hair cell loss. The anti-apoptosis activity of SPL extract was measured using double labeling by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and myosin-7a staining. The radical-scavenging activity of SPL extract was assessed using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) assay. SPL extract at a concentration of 1 µg/mL significantly inhibited GM-induced hair cell loss at basal and middle region of cochlea, while 5 µg/mL was effective against apical region hair cell loss. The protective effect of SPL extract was concentration dependent and hair cells retained their stereocilia in explants treated with SPL extract prior to treatment with 0.3 mM GM. SPL extract decreased GM-induced apoptosis of hair cells as assessed by TUNEL staining. The outer hair and inner hair counts were not decreased in SPL extract treated groups in compare to GM treated explants. Additionally, SPL extract showed concentration dependent radical scavenging activity in a DPPH assay. An anti-apoptosis effect and potent radical scavenger activity of SPL extract protects from GM-induced hair cell loss at basal, middle and apical regions in neonatal cochlea cultures.
Anti-Aging Potential of Phytoextract Loaded-Pharmaceutical Creams for Human Skin Cell Longetivity.
Jadoon, Saima; Karim, Sabiha; Bin Asad, Muhammad Hassham Hassan; Akram, Muhammad Rouf; Khan, Abida Kalsoom; Malik, Arif; Chen, Chunye; Murtaza, Ghulam
2015-01-01
The exposure to ultraviolet radiations (UVR) is the key source of skin sunburn; it may produce harmful entities, reactive oxygen species (ROS), leading to aging. The skin can be treated and protected from the injurious effects of ROS by using various pharmaceutical formulations, such as cream. Cream can be loaded with antioxidants to quench ROS leading to photo-protective effects. Moreover, modern medicines depend on ethnobotanicals for protection or treatment of human diseases. This review article summarizes various in vivo antioxidant studies on herbal creams loaded with phyto-extracts. These formulations may serve as cosmeceuticals to protect skin against injurious effects of UVR. The botanicals studied for dermatologic use in cream form include Acacia nilotica, Benincasa hispida, Calendula officinalis, Camellia sinensis, Camellia sinensis, Nelumbo nucifera, Capparis decidua, Castanea sativa, Coffea arabica, Crocus sativus, Emblica officinalis Gaertn, Foeniculum vulgare, Hippophae rhamnoides, Lithospermum erythrorhizon, Malus domestica, Matricaria chamomilla L., Moringa oleifera, Morus alba, Ocimum basilicum, Oryza sativa, Polygonum minus, Punica granatum, Silybum marianum, Tagetes erecta Linn., Terminalia chebula, Trigonella foenum-graecum, and Vitis vinifera. The observed anti-aging effects of cream formulations could be an outcome of a coordinating action of multiple constituents. Of numerous botanicals, the phenolic acids and flavonoids appear effective against UVR-induced damage; however the evidence-based studies for their anti-aging effects are still needed.
Todorović, Nevena; Filipović, Dragana
2017-07-04
Chronic psychosocial stress modulates brain antioxidant systems and causes neuroinflammation that plays a role in the pathophysiology of depression. Although the antidepressant fluoxetine (FLX) represents the first-line treatment for depression and the atypical antipsychotic clozapine (CLZ) is considered as a second-line treatment for psychotic disorders, the downstream mechanisms of action of these treatments, beyond serotonergic or dopaminergic signaling, remain elusive. We examined behavioral changes, glutathione (GSH)-dependent defense and levels of proinflammatory mediators in the prefrontal cortex (PFC) of adult male Wistar rats exposed to 21days of chronic social isolation (CSIS). We also tested the ability of FLX (15mg/kg/day) or CLZ (20mg/kg/day), applied during CSIS, to prevent stress-induced changes. CSIS caused depressive- and anxiety-like behaviors, compromised GSH-dependent defense, and induced nuclear factor-kappa B (NF-κB) activation with a concomitant increase in cytosolic levels of proinflammatory mediators cyclooxigenase-2, interleukin-1beta and tumor necrosis factor-alpha in the PFC. NF-κB activation and proinflammatory response in the PFC were not found in CSIS rats treated with FLX or CLZ. In contrast, only FLX preserved GSH content in CSIS rats. CLZ not only failed to protect against CSIS-induced GSH depletion, but it diminished its levels when applied to non-stressed rats. In conclusion, prefrontal cortical GSH depletion and the proinflammatory response underlying depressive- and anxiety-like states induced by CSIS were prevented by FLX. The protective effect of CLZ, which was equally effective as FLX on the behavioral level, was limited to proinflammatory components. Hence, different mechanisms underlie the protective effects of these two drugs in CSIS rats. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.
2013-01-01
Background It has been suggested that dysfunctional attitudes, cognitive vulnerability to depression, have developmental origins. The present study examined the effects of parental rearing on dysfunctional attitudes in three areas of life with special attention to gender specificity. Methods The subjects were 665 Japanese healthy volunteers. Dysfunctional attitudes were assessed by the 24-item Dysfunctional Attitude Scale, which has the Achievement, Dependency and Self-control subscales. Perceived parental rearing was assessed by the Parental Bonding Instrument, which has the Care and Protection subscales. Results Higher scores of the Achievement (β = 0.293, p < 0.01) and Dependency (β = 0.224, p < 0.05) subscales were correlated with higher scores of the Protection subscale in the combination of mother and daughter, but not in other combinations of parents and recipients. Scores of the Self-control subscale were not correlated with paternal or maternal rearing scores. Conclusions The present study suggests that parental overprotection engenders dysfunctional attitudes about achievement and dependency in a gender-specific manner. PMID:24365104
Chamberlain, Scott A; Holland, J Nathaniel
2008-05-01
Interspecific interactions are often mediated by the interplay between resource supply and consumer density. The supply of a resource and a consumer's density response to it may in turn yield context-dependent use of other resources. Such consumer-resource interactions occur not only for predator-prey and competitive interactions, but for mutualistic ones as well. For example, consumer-resource interactions between ants and extrafloral nectar (EFN) plants are often mutualistic, as EFN resources attract and reward ants which protect plants from herbivory. Yet, ants also commonly exploit floral resources, leading to antagonistic consumer-resource interactions by disrupting pollination and plant reproduction. EFN resources associated with mutualistic ant-plant interactions may also mediate antagonistic ant-flower interactions through the aggregative density response of ants on plants, which could either exacerbate ant-flower interactions or alternatively satiate and distract ants from floral resources. In this study, we examined how EFN resources mediate the density response of ants on senita cacti in the Sonoran Desert and their context-dependent use of floral resources. Removal of EFN resources reduced the aggregative density of ants on plants, both on hourly and daily time scales. Yet, the increased aggregative ant density on plants with EFN resources decreased rather than increased ant use of floral resources, including contacts with and time spent in flowers. Behavioral assays showed no confounding effect of floral deterrents on ant-flower interactions. Thus, ant use of floral resources depends on the supply of EFN resources, which mediates the potential for both mutualistic and antagonistic interactions by increasing the aggregative density of ants protecting plants, while concurrently distracting ants from floral resources. Nevertheless, only certain years and populations of study showed an increase in plant reproduction through herbivore protection or ant distraction from floral resources. Despite pronounced effects of EFN resources mediating the aggregative density of ants on plants and their context-dependent use of floral resources, consumer-resource interactions remained largely commensalistic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Ying; Li, Jianguo, E-mail: 2010lijianguo@sina.cn
Highlights: Black-Right-Pointing-Pointer Carbachol reduced the lipopolysaccharide-induced intestinal barrier breakdown. Black-Right-Pointing-Pointer Carbachol ameliorated the lipopolysaccharide-induced ileal tight junction damage. Black-Right-Pointing-Pointer Carbachol prevented the LPS-induced NF-{kappa}{beta} and myosin light-chain kinase activation. Black-Right-Pointing-Pointer Carbachol exerted its beneficial effects in an {alpha}7 nicotinic receptor-dependent manner. -- Abstract: Carbachol is a cholinergic agonist that protects the intestines after trauma or burn injury. The present study determines the beneficial effects of carbachol and the mechanisms by which it ameliorates the lipopolysaccharide (LPS)-induced intestinal barrier breakdown. Rats were injected intraperitoneally with 10 mg/kg LPS. Results showed that the gut barrier permeability was reduced, the ultrastructural disruption ofmore » tight junctions (TJs) was prevented, the redistribution of zonula occludens-1 and claudin-2 proteins was partially reversed, and the nuclear factor-kappa beta (NF-{kappa}{beta}) and myosin light-chain kinase (MLCK) activation in the intestinal epithelium were suppressed after carbachol administration in LPS-exposed rats. Pretreatment with the {alpha}7 nicotinic acetylcholine receptor ({alpha}7nAchR) antagonist {alpha}-bungarotoxin blocked the protective action of carbachol. These results suggested that carbachol treatment can protect LPS-induced intestinal barrier dysfunction. Carbachol exerts its beneficial effect on the amelioration of the TJ damage by inhibiting the NF-{kappa}{beta} and MLCK pathways in an {alpha}7nAchR-dependent manner.« less
Chen, R H; Su, Y H; Chuang, R L; Chang, T Y
1998-10-15
Insulin and insulin receptor substrate 1 (IRS-1) are capable of protecting liver cells from apoptosis induced by transforming growth factor-beta1 (TGF-beta). The Ras/mitogen-activated protein kinase (MAP kinase) and the phosphatidylinositol 3-kinase (PI 3-kinase)/Akt pathways are both activated upon insulin stimulation and can protect against apoptosis under certain circumstances. We investigated which of these pathways is responsible for the protective effect of insulin on TGF-beta-induced apoptosis. An activated Ras, although elicited a strong mitogenic effect, could not protect Hep3B cells from TGF-beta-induced apoptosis. Furthermore, PD98059, a selective inhibitor of MEK, did not suppress the antiapoptotic effect of insulin. In contrast, the PI 3-kinase inhibitor, LY294002, efficiently blocked the effect of insulin. Protection against TGF-beta-induced apoptosis conferred by PI 3-kinase was further verified by stable transfection of an activated PI 3-kinase. Downstream targets of PI 3-kinase involved in this protection was further investigated. An activated Akt mimicked the antiapoptotic effect of insulin, whereas a dominant-negative Akt inhibited such effect. However, rapamycin, the p70S6 kinase inhibitor, had no effect on the protectivity of insulin against TGF-beta-induced apoptosis, suggesting that the antiapoptotic target of PI 3-kinase/Akt pathway is independent or lies upstream of the p70S6 kinase. The mechanism by which PI 3-kinase/Akt pathway interferes with the apoptotic signaling of TGF-beta was explored. Activation of PI 3-kinase did not lead to a suppression of Smad hetero-oligomerization or nuclear translocation but blocked TGF-beta-induced caspase-3-like activity. In summary, the PI 3-kinase/Akt pathway, but not the Ras/MAP kinase pathway, protects against TGF-beta-induced apoptosis by inhibiting a step downstream of Smad but upstream of caspase-3.
Yaakoubi, Hnia; Hamdani, Saber; Bekalé, Laurent; Carpentier, Robert
2014-01-01
The photo-stability of photosystem I (PSI) is of high importance for the photosynthetic processes. For this reason, we studied the protective action of two biogenic polyamines (PAs) spermine (Spm) and spermidine (Spd) on PSI activity in isolated thylakoid membranes subjected to photoinhibition. Our results show that pre-loading thylakoid membranes with Spm and Spd reduced considerably the inhibition of O2 uptake rates, P700 photooxidation and the accumulation of superoxide anions (O2 −) induced by light stress. Spm seems to be more effective than Spd in preserving PSI photo-stability. The correlation of the extent of PSI protection, photosystem II (PSII) inhibition and O2 − generation with increasing Spm doses revealed that PSI photo-protection is assumed by two mechanisms depending on the PAs concentration. Given their antioxidant character, PAs scavenge directly the O2 − generated in thylakoid membranes at physiological concentration (1 mM). However, for non-physiological concentration, the ability of PAs to protect PSI is due to their inhibitory effect on PSII electron transfer. PMID:25420109
Kannanganat, Sunil; Wyatt, Linda S; Gangadhara, Sailaja; Chamcha, Venkateswarlu; Chea, Lynette S.; Kozlowski, Pamela A; LaBranche, Celia C; Chennareddi, Lakshmi; Lawson, Benton; Reddy, Pradeep B. J.; Styles, Tiffany M.; Vanderford, Thomas H; Montefiori, David C; Moss, Bernard; Robinson, Harriet L; Amara, Rama Rao
2016-01-01
Here, we test in rhesus macaques the effects of a 500-fold range of an admixed recombinant modified vaccinia Ankara (MVA) expressing rhesus GM-CSF (MVA/GM-CSF) on the immunogenicity and protection elicited by an MVA/simian immunodeficiency macaque 239 (SIVmac239) vaccine. High doses of the MVA/GM-CSF did not affect the levels of systemic Env-specific Ab but did decrease the expression of the gut homing receptor α4β7 on plasmacytoid dendritic cells (p<0.01) and the magnitudes of Env-specific IgA (p=0.01) and IgG (p<0.05) in rectal secretions. The protective effect of the vaccine was evaluated using 12 weekly rectal challenges in rhesus subgrouped by tripartite motif-containing protein 5α (TRIM5α) genotypes that are restrictive or permissive for infection by the challenge virus, SIVsmE660. Eight of 9 TRIM5α-restrictive animals receiving no, or the lowest dose [1×105 plaque forming units (pfu)] of MVA/GM-CSF resisted all 12 challenges. In the comparable TRIM5α-permissive group only 1 of 12 animals resisted all 12 challenges. In the TRIM5α restrictive, but not permissive animals, the number of challenges to infection directly correlated with the magnitudes of Env-specific rectal IgG (r=0.6) and IgA (r=0.6), the avidity of Env-specific serum IgG (r=0.5), and antibody dependent cell-mediated virus inhibition (r=0.6). Titers of neutralizing Ab did not correlate with protection. We conclude that (i) protection elicited by MVA/SIVmac239 is strongly dependent on the presence of the TRIM5α restriction, (ii) in TRIM5α restrictive animals, non-neutralizing Ab responses contribute to protection against SIVsmE660, and (iii) high doses of co-expressed MVA/GM-CSF inhibit mucosal Ab responses and MVA/SIV239-elicited protection. PMID:27683750
Lin, Heng; Yu, Chun-Hsien; Jen, Chih-Yu; Cheng, Ching-Feng; Chou, Ying; Chang, Chih-Cheng; Juan, Shu-Hui
2010-01-01
Protective effects of adiponectin (APN; an adipocytokine) were shown against various oxidative challenges; however, its therapeutic implications and the mechanisms underlying hepatic iron overload remain unclear. Herein, we show that the deleterious effects of iron dextran on liver function and iron deposition were significantly reversed by adiponectin gene therapy, which was accompanied by AMP-activated protein kinase (AMPK) phosphorylation and heme oxygenase (HO)-1 induction. Furthermore, AMPK-mediated peroxisome proliferator-activated receptor-α (PPARα) activation by APN was ascribable to HO-1 induction. Additionally, we revealed direct transcriptional regulation of HO-1 by the binding of PPARα to a PPAR-responsive element (PPRE) by various experimental assessments. Interestingly, overexpression of HO-1 in hepatocytes mimicked the protective effect of APN in attenuating iron-mediated injury, whereas it was abolished by SnPP and small interfering HO-1. Furthermore, bilirubin, the end-product of the HO-1 reaction, but not CO, protected hepatocytes from iron dextran-mediated caspase activation. Herein, we demonstrate a novel functional PPRE in the promoter regions of HO-1, and APN-mediated HO-1 induction elicited an antiapoptotic effect and a decrease in iron deposition in hepatocytes subjected to iron challenge. PMID:20709802
Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.
Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P
2017-10-01
Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.
MÓDIS, KATALIN; GERŐ, DOMOKOS; STANGL, RITA; ROSERO, OLIVÉR; SZIJÁRTÓ, ATTILA; LOTZ, GÁBOR; MOHÁCSIK, PETRA; SZOLECZKY, PETRA; COLETTA, CIRO; SZABÓ, CSABA
2013-01-01
Liver ischemia represents a common clinical problem. In the present study, using an in vitro model of hepatic ischemia-reperfusion injury, we evaluated the potential cytoprotective effect of the purine metabolites, such as adenosine and inosine, and studied the mode of their pharmacological actions. The human hepatocellular carcinoma-derived cell line HepG2 was subjected to combined oxygen-glucose deprivation (COGD; 0-14-24 h), followed by re-oxygenation (0-4-24 h). Adenosine or inosine (300–1,000 μM) were applied in pretreatment. Cell viability and cytotoxicity were measured by the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide and lactate dehydrogenase methods, respectively. The results showed that both adenosine and inosine exerted cytoprotective effects, and these effects were not related to receptor-mediated actions, since they were not prevented by selective adenosine receptor antagonists. On the other hand, the adenosine deaminase inhibitor erythro-9-(2-hydroxy-3-nonyl) adenine hydrochloride (EHNA, 10 μM) markedly and almost fully reversed the protective effect of adenosine during COGD, while it did not influence the cytoprotective effect of inosine in the same assay conditions. These results suggest that the cytoprotective effects are related to intracellular actions, and, in the case of adenosine also involve intracellular conversion to inosine. The likely interpretation of these findings is that inosine serves as an alternative source of energy to produce ATP during hypoxic conditions. The protective effects are also partially dependent on adenosine kinase, as the inhibitor 4-amino-5-(3-bromophenyl)-7-(6-morpholino-pyridin-3-yl)pyrido[2,3-d]pyrimidine, 2HCl (ABT 702, 30 μM) significantly reversed the protective effect of both adenosine and inosine during hypoxia and re-oxygenation. Collectively, the current results support the view that during hypoxia, adenosine and inosine exert cytoprotective effects via receptor-independent, intracellular modes of action, which, in part, depend on the restoration of cellular bioenergetics. The present study supports the view that testing of inosine for protection against various forms of warm and cold liver ischemia is relevant. PMID:23232950
Módis, Katalin; Gerő, Domokos; Stangl, Rita; Rosero, Olivér; Szijártó, Attila; Lotz, Gábor; Mohácsik, Petra; Szoleczky, Petra; Coletta, Ciro; Szabó, Csaba
2013-02-01
Liver ischemia represents a common clinical problem. In the present study, using an in vitro model of hepatic ischemia-reperfusion injury, we evaluated the potential cytoprotective effect of the purine metabolites, such as adenosine and inosine, and studied the mode of their pharmacological actions. The human hepatocellular carcinoma-derived cell line HepG2 was subjected to combined oxygen-glucose deprivation (COGD; 0-14-24 h), followed by re-oxygenation (0-4-24 h). Adenosine or inosine (300-1,000 µM) were applied in pretreatment. Cell viability and cytotoxicity were measured by the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide and lactate dehydrogenase methods, respectively. The results showed that both adenosine and inosine exerted cytoprotective effects, and these effects were not related to receptor-mediated actions, since they were not prevented by selective adenosine receptor antagonists. On the other hand, the adenosine deaminase inhibitor erythro-9-(2-hydroxy-3-nonyl) adenine hydrochloride (EHNA, 10 µM) markedly and almost fully reversed the protective effect of adenosine during COGD, while it did not influence the cytoprotective effect of inosine in the same assay conditions. These results suggest that the cytoprotective effects are related to intracellular actions, and, in the case of adenosine also involve intracellular conversion to inosine. The likely interpretation of these findings is that inosine serves as an alternative source of energy to produce ATP during hypoxic conditions. The protective effects are also partially dependent on adenosine kinase, as the inhibitor 4-amino-5-(3-bromophenyl)-7-(6‑morpholino-pyridin-3-yl)pyrido[2,3-d]pyrimidine, 2HCl (ABT 702, 30 µM) significantly reversed the protective effect of both adenosine and inosine during hypoxia and re-oxygenation. Collectively, the current results support the view that during hypoxia, adenosine and inosine exert cytoprotective effects via receptor-independent, intracellular modes of action, which, in part, depend on the restoration of cellular bioenergetics. The present study supports the view that testing of inosine for protection against various forms of warm and cold liver ischemia is relevant.
COST-EFFECTIVE ALLOCATION OF WATERSHED MANAGEMENT PRACTICES USING A GENETIC ALGORITHM
Implementation of conservation programs are perceived as being crucial for restoring and protecting waters and watersheds from non-point source pollution. Success of these programs depends to a great extent on planning tools that can assist the watershed management process. Here-...
Social Capital and Child Welfare.
ERIC Educational Resources Information Center
Jack, Gordon; Jordan, Bill
1999-01-01
Examines social and economic inequalities in the United Kingdom. Demonstrates how children's welfare and family functioning are crucially dependent upon locally available social support. Argues that building social capital in poor communities is more effective in promoting children's welfare than is present emphasis on formal child-protection and…
Antiviral Activity of Chlorite-Oxidized Oxyamylose, a Polyacetal Carboxylic Acid
Billiau, A.; Desmyter, J.; De Somer, P.
1970-01-01
Intraperitoneal injection of chlorite-oxidized oxyamylose (COAM) protected mice against mengo, vaccinia, Semliki Forest, and influenza APR8 viruses. Topical administration in the eye of rabbits partially inhibited the development of experimental herpetic keratoconjunctivitis. COAM resembled polyacrylic acid in many aspects, but it was markedly less toxic. For systemic administration, the therapeutic index was on the order of magnitude of 1:300 to 1:500. Although the in vivo antiviral effect of COAM wore off faster than that of polyacrylic acid, protection lasted for several weeks. Against mengovirus, such prolonged protection was achieved only when polymer and virus were injected intraperitoneally. Protection against intravenous vaccinia virus was not dependent on the injection route of COAM. Experiments on the mode of action of COAM pointed to macrophages as possible mediators of the antiviral effect. The fact that small amounts of interferon appeared in the serum after administration of high doses of COAM suggests that interferon may play a role in the induction of antiviral resistance by COAM. PMID:4314554
On the Effectiveness of Security Countermeasures for Critical Infrastructures.
Hausken, Kjell; He, Fei
2016-04-01
A game-theoretic model is developed where an infrastructure of N targets is protected against terrorism threats. An original threat score is determined by the terrorist's threat against each target and the government's inherent protection level and original protection. The final threat score is impacted by the government's additional protection. We investigate and verify the effectiveness of countermeasures using empirical data and two methods. The first is to estimate the model's parameter values to minimize the sum of the squared differences between the government's additional resource investment predicted by the model and the empirical data. The second is to develop a multivariate regression model where the final threat score varies approximately linearly relative to the original threat score, sectors, and threat scenarios, and depends nonlinearly on the additional resource investment. The model and method are offered as tools, and as a way of thinking, to determine optimal resource investments across vulnerable targets subject to terrorism threats. © 2014 Society for Risk Analysis.
Das, Anup K; Dewanjee, Saikat; Sahu, Ranabir; Dua, Tarun K; Gangopadhyay, Moumita; Sinha, Mohit K
2010-01-01
The present study was undertaken to evaluate the protective effect of an aqueous extract of Corchorus olitorius leaves (AECO) against NaAsO(2) induced brain toxicity in experimental rats. The animals exposed to NaAsO(2) (10mg/kg, p.o.) for 10 days exhibited a significant inhibition (p<0.01) of superoxide dismutase, catalase, glutathione-S-transferase, glutathione peroxidase, glutathione reductase and reduced glutathione levels in rat brain. In addition, the toxin increased (p<0.01) the levels of oxidized glutathione and thiobarbituric acid reactive substances in the brain tissue of experimental rats. Treatment with AECO (50 and 100mg/kg, p.o.) for 15 days prior to arsenic intoxication significantly improved antioxidant markers in a dose dependant manner. Histological studies on the ultrastructural changes of brain tissue supported the protective activity of the AECO. The results suggest that treatment with AECO prior to arsenic intoxication has a significant role in protecting animals from arsenic-induced toxicity. Copyright © 2009 Elsevier B.V. All rights reserved.
Castro, G A; Carvalho, J E; Tinti, S V; Possenti, A; Sgarbieri, V C
2010-02-01
The effect of the administration of a whey protein isolate (WPI) and collagen hydrolysates on ethanol-induced ulcerative lesions was studied in rats. WPI and bovine or porcine collagen hydrolysate (BCH and PCH, respectively) were given to rats by gavage. In acute experiments, (single-dose) physiological saline (10 mL/kg of body weight) was used as the negative control, and carbenoxolone (200 mg/kg of body weight) was used as a positive control. Ethanol (1 mL per 250-g rat) was also given by gavage. These treatments reduced the ulcerative lesion index (ULI) in a range of 40-77%, depending on the dosage. Some mixtures of WPI with either PCH or BCH provided results that suggested synergisms between WPI and the collagen hydrolysates. For example, WPI/BCH (in the proportion of 375:375 mg/kg of body weight) decreased ULI by 64%. The mechanism for mucosal protection involved a decrease in plasma gastrin (approximately 40%), a significant increase (50-267%) in mucus production, and a reduction in ULI (percentage) when intragastric administrations were performed after in vivo alkylation by N-ethylmaleimide. Results suggest that gastrin, sulfhydryl substances, and some mechanisms related to mucus production are all involved in gastric ulcer protection against ethanol. The collagen hydrolysates (both PCH and BCH) presented a stronger effect on mucus production; on the other hand, the effect of WPI was also dependent on sulfhydryl compounds, resulting in a more protective effect when the two proteins were administered together.
Zhang, Yi; Chen, Guo; Liu, Zuqiang; Tian, Shenghe; Zhang, Jiying; Carey, Cara D; Murphy, Kenneth M; Storkus, Walter J; Falo, Louis D; You, Zhaoyang
2015-06-15
The development of effective cancer vaccines remains an urgent, but as yet unmet, clinical need. This deficiency is in part due to an incomplete understanding of how to best invoke dendritic cells (DC) that are crucial for the induction of tumor-specific CD8(+) T cells capable of mediating durable protective immunity. In this regard, elevated expression of the transcription factor X box-binding protein 1 (XBP1) in DC appears to play a decisive role in promoting the ability of DC to cross-present Ags to CD8(+) T cells in the therapeutic setting. Delivery of DNA vaccines encoding XBP1 and tumor Ag to skin DC resulted in increased IFN-α production by plasmacytoid DC (pDC) from skin/tumor draining lymph nodes and the cross-priming of Ag-specific CD8(+) T cell responses associated with therapeutic benefit. Antitumor protection was dependent on cross-presenting Batf3(+) DC, pDC, and CD8(+) T cells. CD103(+) DC from the skin/tumor draining lymph nodes of the immunized mice appeared responsible for activation of Ag-specific naive CD8(+) T cells, but were dependent on pDC for optimal effectiveness. Similarly, human XBP1 improved the capacity of human blood- and skin-derived DC to activate human T cells. These data support an important intrinsic role for XBP1 in DC for effective cross-priming and orchestration of Batf3(+) DC-pDC interactions, thereby enabling effective vaccine induction of protective antitumor immunity. Copyright © 2015 by The American Association of Immunologists, Inc.
A Pharmacokinetic Study of the Effects of Stress and Exercise on Chemical Exposure
2001-03-20
Organophosphates such as diazinon and malathion are considered cholinesterase inhibitors, while carbamates such as physostigmine and pyridostigmine...bromide (PB) are considered reversible cholinesterase inhibitors. The possible Gulf War exposures to organophosphates such as diazinon and malathion...indicate that the physiological and protective effects of carbamates such as PB may depend on a narrow range of cholinesterase inhibition. Blood
USDA-ARS?s Scientific Manuscript database
The H9 subtype of avian influenza virus is wide-spread in the areas of Asia and Middle East. Selection of effective vaccines that provide effective protection mainly depends on the antigenic match of the hemagglutinin protein (HA), between the vaccine and the field strain. To determine how the ant...
Schisandrae Fructus Supplementation Ameliorates Sciatic Neurectomy-Induced Muscle Atrophy in Mice
Kim, Joo Wan; Ku, Sae-Kwang; Kim, Ki Young; Kim, Sung Goo; Han, Min Ho; Kim, Gi-Young; Hwang, Hye Jin; Kim, Byung Woo; Kim, Cheol Min
2015-01-01
The objective of this study was to assess the possible beneficial skeletal muscle preserving effects of ethanol extract of Schisandrae Fructus (EESF) on sciatic neurectomy- (NTX-) induced hindlimb muscle atrophy in mice. Here, calf muscle atrophy was induced by unilateral right sciatic NTX. In order to investigate whether administration of EESF prevents or improves sciatic NTX-induced muscle atrophy, EESF was administered orally. Our results indicated that EESF dose-dependently diminished the decreases in markers of muscle mass and activity levels, and the increases in markers of muscle damage and fibrosis, inflammatory cell infiltration, cytokines, and apoptotic events in the gastrocnemius muscle bundles are induced by NTX. Additionally, destruction of gastrocnemius antioxidant defense systems after NTX was dose-dependently protected by treatment with EESF. EESF also upregulated muscle-specific mRNAs involved in muscle protein synthesis but downregulated those involved in protein degradation. The overall effects of 500 mg/kg EESF were similar to those of 50 mg/kg oxymetholone, but it showed more favorable antioxidant effects. The present results suggested that EESF exerts a favorable ameliorating effect on muscle atrophy induced by NTX, through anti-inflammatory and antioxidant effects related to muscle fiber protective effects and via an increase in protein synthesis and a decrease in protein degradation. PMID:26064425
Panneerselvam, Mathivadhani; Tsutsumi, Yasuo M; Bonds, Jacqueline A; Horikawa, Yousuke T; Saldana, Michelle; Dalton, Nancy D; Head, Brian P; Patel, Piyush M; Roth, David M; Patel, Hemal H
2010-11-01
Epicatechin, a flavonoid, is a well-known antioxidant linked to a variety of protective effects in both humans and animals. In particular, its role in protection against cardiovascular disease has been demonstrated by epidemiologic studies. Low-dose epicatechin, which does not have significant antioxidant activity, is also protective; however, the mechanism by which low-dose epicatechin induces this effect is unknown. Our laboratory tested the hypothesis that low-dose epicatechin mediates cardiac protection via opioid receptor activation. C57BL/6 mice were randomly assigned to 1 of 10 groups: control, epicatechin, naloxone (nonselective opioid receptor antagonist), epicatechin + naloxone, naltrindole (δ-specific opioid receptor antagonist), epicatechin + naltrindole, norbinaltorphimine (nor-BNI, κ-specific opioid receptor antagonist), epicatechin + nor-BNI, 5-hydroxydecanoic acid [5-HD, ATP-sensitive potassium channel antagonist], and epicatechin + 5-HD. Epicatechin (1 mg/kg) or other inhibitors (5 mg/kg) were administered by oral gavage or intraperitoneal injection, respectively, daily for 10 days. Mice were subjected to 30 min coronary artery occlusion followed by 2 h of reperfusion, and infarct size was determined via planimetry. Whole heart homogenates were assayed for downstream opioid receptor signaling targets. Infarct size was significantly reduced in epicatechin- and epicatechin + nor-BNI-treated mice compared with control mice. This protection was blocked by naloxone, naltrindole, and 5-HD. Epicatechin and epicatechin + nor-BNI increased the phosphorylation of Src, Akt, and IκBα, while simultaneously decreasing the expression of c-Jun NH(2)-terminal kinase and caspase-activated DNase. All signaling effects are consistent with opioid receptor stimulation and subsequent cardiac protection. Naloxone, naltrindole, and 5-HD attenuated these effects. In conclusion, epicatechin acts via opioid receptors and more specifically through the δ-opioid receptor to produce cardiac protection from ischemia-reperfusion injury.
Sostaric, Joe Z; Miyoshi, Norio; Cheng, Jason Y; Riesz, Peter
2008-10-09
Suspensions of human leukemia (HL-60) cells readily undergo cytolysis when exposed to ultrasound above the acoustic cavitation threshold. However, n-alkyl glucopyranosides (hexyl, heptyl, and octyl) completely inhibit ultrasound-induced (1057 kHz) cytolysis (Sostaric, et al. Free Radical Biol. Med. 2005, 39, 1539-1548). The efficacy of protection from ultrasound-induced cytolysis was determined by the n-alkyl chain length of the glucopyranosides, indicating that protection efficacy depended on adsorption of n-alkyl glucopyranosides to the gas/solution interface of cavitation bubbles and/or the lipid membrane of cells. The current study tests the hypothesis that "sonoprotection" (i.e., protection of cells from ultrasound-induced cytolysis) in vitro depends on the adsorption of glucopyranosides at the gas/solution interface of cavitation bubbles. To test this hypothesis, the effect of ultrasound frequency (from 42 kHz to 1 MHz) on the ability of a homologous series of n-alkyl glucopyranosides to protect cells from ultrasound-induced cytolysis was investigated. It is expected that ultrasound frequency will affect sonoprotection ability since the nature of the cavitation bubble field will change. This will affect the relative importance of the possible mechanisms for ultrasound-induced cytolysis. Additionally, ultrasound frequency will affect the lifetime and rate of change of the surface area of cavitation bubbles, hence the dynamically controlled adsorption of glucopyranosides to their surface. The data support the hypothesis that sonoprotection efficiency depends on the ability of glucopyranosides to adsorb at the gas/solution interface of cavitation bubbles.
Protection against Recurrent Stroke with Resveratrol: Endothelial Protection
Clark, Darren; Tuor, Ursula I.; Thompson, Roger; Institoris, Adam; Kulynych, Angela; Zhang, Xu; Kinniburgh, David W.; Bari, Ferenc; Busija, David W.; Barber, Philip A.
2012-01-01
Despite increased risk of a recurrent stroke following a minor stroke, information is minimal regarding the interaction between injurious mild cerebral ischemic episodes and the possible treatments which might be effective. The aim of the current study was to investigate recurrent ischemic stroke and whether resveratrol, a nutritive polyphenol with promising cardio- and neuro- protective properties, could ameliorate the associated brain damage. Experiments in adult rats demonstrated that a mild ischemic stroke followed by a second mild cerebral ischemia exacerbated brain damage, and, daily oral resveratrol treatment after the first ischemic insult reduced ischemic cell death with the recurrent insult (P<0.002). Further investigation demonstrated reduction of both inflammatory changes and markers of oxidative stress in resveratrol treated animals. The protection observed with resveratrol treatment could not be explained by systemic effects of resveratrol treatment including effects either on blood pressure or body temperature measured telemetrically. Investigation of resveratrol effects on the blood-brain barrier in vivo demonstrated that resveratrol treatment reduced blood-brain barrier disruption and edema following recurrent stroke without affecting regional cerebral blood flow. Investigation of the mechanism in primary cell culture studies demonstrated that resveratrol treatment significantly protected endothelial cells against an in vitro ‘ischemia’ resulting in improved viability against oxygen and glucose deprivation (39.6±6.6% and 81.3±9.5% in vehicle and resveratrol treated cells, respectively). An inhibition of nitric oxide synthesis did not prevent the improved cell viability following oxygen glucose deprivation but SIRT-1 inhibition with sirtinol partially blocked the protection (P<0.001) suggesting endothelial protection is to some extent SIRT-1 dependent. Collectively, the results support that oral resveratrol treatment provides a low risk strategy to protect the brain from enhanced damage produced by recurrent stroke which is mediated in part by a protective effect of resveratrol on the endothelium of the cerebrovasculature. PMID:23082218
Hypertension and vascular dementia in the elderly: the potential role of anti-hypertensive agents.
Coca, Antonio
2013-09-01
Vascular dementia (VaD) - a severe form of vascular cognitive impairment - and cognitive decline are associated with hypertension and therefore it seems logical to consider that reducing BP with anti-hypertensive therapy may protect against the development/onset of cognitive function impairment or dementia. This narrative, non-systematic review discusses the available evidence on the potential correlation between the use of anti-hypertensive agents and the risk of VaD and cognitive decline. MEDLINE was searched for inclusion of relevant studies. No limitations in time were considered. A consensus on the potential effects of anti-hypertensive treatment in the reduction of VaD and associated cognitive decline has not been reached. A protective effect of anti-hypertensive agents has been observed in a number of studies although it is still unclear whether different classes of anti-hypertensive agents have a different effect on the development of VaD. The protective effect of anti-hypertensive agents appears to depend on the specific drug used - positive effects have been observed with calcium channel blockers (CCBs), such as lercanidipine and nitrendipine, the combination perindopril-indapamide and telmisartan.
Leptin: a potential mediator for protective effects of fat mass on bone tissue.
Thomas, Thierry
2003-02-01
Body weight is among the most powerful predictors of bone status, and adipose tissue plays a substantial role in weight-related protective effects on bone. An understanding of the mechanisms underlying the relation between adipose tissue and bone may open up new perspectives for treatment. Leptin, which is known to regulate appetite and energy expenditures, may also contribute to mediate the effects of fat mass on bone. Although reported data are somewhat conflicting, there is some evidence that leptin may decrease bone formation via a central nervous effect and may stimulate both bone formation and bone resorption via direct peripheral effects on stromal precursor cells. The net result of these central and peripheral effects may depend on serum leptin levels and blood-brain barrier permeability, of which the first increase and the second decrease as obesity develops. Further work is needed to improve our understanding of these effects.
Dong, Wenpeng; Zhang, Zhen; Liu, Zhengjun; Liu, Hao; Wang, Xianyue; Bi, Shenghui; Wang, Xiaowu; Ma, Tao; Zhang, Weida
2013-06-01
Intestinal ischemia/reperfusion (I/R) injury is considered to be associated with high morbidity and mortality rates. Osthole, a natural derivative of coumarin, has been shown to exert a variety of pharmacological and therapeutic effects under physiological and pathological conditions. In the present study, to investigate the protective effects of osthole against intestinal I/R injury, various doses of osthole (5, 10, 25 and 50 mg/kg) were pre-administered to mice subjected to intestinal I/R injury. A dose-dependent increase in the survival rate was observed in the osthole-treated mice. Pre-treatment with osthole (50 mg/kg) attenuated the destruction of epithelial cells within the villi induced by intestinal I/R injury, and suppressed oxidative stress, neutrophil infiltration and modulated nitric oxide (NO) levels. Moreover, the increased IκBα phosphorylation and nuclear factor (NF)-κB nuclear translocation induced by I/R injury were significantly decreased following pre-treatment with osthole. Taken together, our data demonstrate that osthole exerts protective effects against intestinal I/R injury in mice by suppressing oxidative stress, neutrophil infiltration and NO levels, partly through the inhibition of NF-κB nuclear translocation. Hence, the findings of the present study provide insight into the mechanisms through which osthole exerts its protective effects against intestinal I/R injury.
Condello, Salvatore; Currò, Monica; Ferlazzo, Nadia; Caccamo, Daniela; Satriano, Joseph; Ientile, Riccardo
2011-01-01
Agmatine, an endogenous arginine metabolite, has been proposed as a novel neuromodulator that plays protective roles in the CNS in several models of cellular damage. However, the mechanisms involved in these protective effects in neurodegenerative diseases are poorly understood. The present study was undertaken to investigate the effects of agmatine on cell injury induced by rotenone, commonly used in establishing in vivo and in vitro models of Parkinson's disease, in human-derived dopaminergic neuroblastoma cell line (SH-SY5Y). We report that agmatine dose-dependently suppressed rotenone-induced cellular injury through a reduction of oxidative stress. Similar effects were obtained by spermine, suggesting a scavenging effect for these compounds. However, unlike spermine, agmatine also prevented rotenone-induced nuclear factor-κB nuclear translocation and mitochondrial membrane potential dissipation. Furthermore, rotenone-induced increase in apoptotic markers, such as caspase 3 activity, Bax expression and cytochrome c release, was significantly attenuated with agmatine treatment. These findings demonstrate mitochondrial preservation with agmatine in a rotenone model of apoptotic cell death, and that the neuroprotective action of agmatine appears because of suppressing apoptotic signalling mechanisms. Thus, agmatine may have therapeutic potential in the treatment of Parkinson's disease by protecting dopaminergic neurons.
Poyntz, Hazel C; Stylianou, Elena; Griffiths, Kristin L; Marsay, Leanne; Checkley, Anna M; McShane, Helen
2014-05-01
The efficacy of Bacillus Calmette-Guerin (BCG) vaccination in protection against pulmonary tuberculosis (TB) is highly variable between populations. One possible explanation for this variability is increased exposure of certain populations to non-tuberculous mycobacteria (NTM). This study used a murine model to determine the effect that exposure to NTM after BCG vaccination had on the efficacy of BCG against aerosol Mycobacterium tuberculosis challenge. The effects of administering live Mycobacterium avium (MA) by an oral route and killed MA by a systemic route on BCG-induced protection were evaluated. CD4+ and CD8+ T cell responses were profiled to define the immunological mechanisms underlying any effect on BCG efficacy. BCG efficacy was enhanced by exposure to killed MA administered by a systemic route; T helper 1 and T helper 17 responses were associated with increased protection. BCG efficacy was reduced by exposure to live MA administered by the oral route; T helper 2 cells were associated with reduced protection. These findings demonstrate that exposure to NTM can induce opposite effects on BCG efficacy depending on route of exposure and viability of NTM. A reproducible model of NTM exposure would be valuable in the evaluation of novel TB vaccine candidates. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Dal-Cim, Tharine; Molz, Simone; Egea, Javier; Parada, Esther; Romero, Alejandro; Budni, Josiane; Martín de Saavedra, Maria D; del Barrio, Laura; Tasca, Carla I; López, Manuela G
2012-08-01
Mitochondrial perturbation and oxidative stress are key factors in neuronal vulnerability in several neurodegenerative diseases or during brain ischemia. Here we have investigated the protective mechanism of action of guanosine, the guanine nucleoside, in a human neuroblastoma cell line, SH-SY5Y, subjected to mitochondrial oxidative stress. Blockade of mitochondrial complexes I and V with rotenone plus oligomycin (Rot/oligo) caused a significant decrease in cell viability and an increase in ROS production. Guanosine that the protective effect of guanosine incubated concomitantly with Rot/oligo abolished Rot/oligo-induced cell death and ROS production in a concentration dependent manner; maximum protection was achieved at the concentration of 1mM. The cytoprotective effect afforded by guanosine was abolished by adenosine A(1) or A(2A) receptor antagonists (DPCPX or ZM241385, respectively), or by a large (big) conductance Ca(2+)-activated K(+) channel (BK) blocker (charybdotoxin). Evaluation of signaling pathways showed that the protective effect of guanosine was not abolished by a MEK inhibitor (PD98059), by a p38(MAPK) inhibitor (SB203580), or by a PKC inhibitor (cheleritrine). However, when blocking the PI3K/Akt pathway with LY294002, the neuroprotective effect of guanosine was abolished. Guanosine increased Akt and p-Ser-9-GSK-3β phosphorylation confirming this pathway plays a key role in guanosine's neuroprotective effect. Guanosine induced the antioxidant enzyme heme oxygenase-1 (HO-1) expression. The protective effects of guanosine were prevented by heme oxygenase-1 inhibitor, SnPP. Moreover, bilirubin, an antioxidant and physiologic product of HO-1, is protective against mitochondrial oxidative stress. In conclusion, our results show that guanosine can afford protection against mitochondrial oxidative stress by a signaling pathway that implicates PI3K/Akt/GSK-3β proteins and induction of the antioxidant enzyme HO-1. Copyright © 2012 Elsevier Ltd. All rights reserved.
Blutt, Sarah E.; Warfield, Kelly L.; Estes, Mary K.; Conner, Margaret E.
2008-01-01
Correlates of protection from rotavirus infection are controversial. We compared the roles of B and T lymphocytes in protective immunity induced either by intranasally administered nonreplicating viruslike particles or inactivated virus or by orally administered murine rotavirus. We found that protection induced by nonreplicating vaccines requires CD4+ T cells and CD40/CD40L. In contrast, T cells were not required for short-term protective immunity induced by infection, but both T-cell-dependent and -independent mechanisms contributed to long-term maintenance of protection. Our findings indicate that more than one marker of protective immunity exists and that these markers depend on the vaccine that is administered. PMID:18184712
Sampling alien species inside and outside protected areas: Does it matter?
NASA Astrophysics Data System (ADS)
Moustakas, Aristides; Voutsela, Anneta; Katsanevakis, Stelios
2018-06-01
Data of alien species presences are generally more readily available in protected than non-protected areas due to higher sampling efforts inside protected areas. Are the results and conclusions based on analyses of data collected in protected areas representative of wider non-protected regions? We address this question by analysing some recently published data of alien plants in Greece. Mixed effects models were used with alien species presences in 8.25 x 8.25 km cells as dependent variable and the percentage of protected area, as well as the agricultural and artificial land cover types richness (as indicators of human presence) as independent variables. In addition, the spatial cross-correlation between the percentage of protected area and alien species richness was examined across scales. Results indicated that the percentage of protected area per cell is a poor predictor of alien species richness. Spatial analysis indicated that cells with higher percentage of protected areas have slightly less alien species than cells with lower percentage of protected areas. This result is likely to be driven by the overall negative correlation between habitat protection and anthropogenic activities. Thus, the conclusions deduced by data deriving from protected areas are likely to hold true for patterns of alien species in non-protected areas when the human pressures are accounted for.
Zaaijer, Eline R; Bruijel, Jessica; Blanken, Peter; Hendriks, Vincent; Koeter, Maarten W J; Kreek, Mary Jeanne; Booij, Jan; Goudriaan, Anna E; van Ree, Jan M; van den Brink, Wim
2014-12-01
Most studies investigating the role of personality as a risk factor for the development of opioid dependence compare dependent opioid users with healthy controls who never used heroin. In order to understand the potential protective role of personality, it is crucial to compare illicit opioid users who never became dependent with dependent opioid users. This study aims to examine the role of personality as a risk factor for opioid use and as a protective factor for the development of opioid dependence. Comparing personality factors between three groups: (1) 161 never-dependent illicit opioid users who have been using illicit opioids but never became opioid dependent; (2) 402 dependent opioid users in methadone maintenance treatment or heroin-assisted treatment; and (3) 135 healthy controls who never used heroin. Personality was assessed with a short version of Cloninger's Temperament and Character Inventory. Never-dependent opioid users reported more Novelty Seeking and Harm Avoidance and less Self-Directedness and Cooperativeness than healthy controls and more Reward Dependence and Self-Directedness, and less Harm Avoidance than dependent opioid users. Furthermore, never-dependent opioid users reported more Self-Transcendence than both dependent opioid users and healthy controls. Never-dependent opioid users may have started to use opioids partly due to their tendency to seek novel and/or spiritual experiences (high Novelty Seeking, high Self-Transcendence) and their tendency to avoid aversive stimuli (high Harm Avoidance), whereas they may have been protected against the development of dependence by their need for social approval (high Reward Dependence) and their self-efficacy (high Self-Directedness). Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Life-stage dependent response in zebrafish (Danio rerio) to phototoxicity of TiO2 nanoparticles
The Zebrafish, and especially its embryo stage, has been increasingly used as a model to evaluate toxicity of manufactured nanomaterials. However, many studies have indicated that the chorion may protect developing embroys from the toxic effects of nanomaterials, suggesting that ...
RESEARCH PLAN: EFFECTS OF CHEMICAL HERBICIDES AND GENE FLOW ON NON-TARGET PLANTS
This project supports EPA's mission to protect human health and to safeguard the natural environment ? air, water, and land ? upon which life depends. Specifically, we address EPA's responsibility to prevent pollution and reduce the impacts from pollution to communities and ecos...
14 CFR § 1216.203 - Definition of key terms.
Code of Federal Regulations, 2014 CFR
2014-01-01
... Section § 1216.203 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION ENVIRONMENTAL..., and their contents to protect against structural failure, to keep water out or to reduce the effects... practicable depends upon the situation and includes consideration of the pertinent factors, such as...
The increased availability of catalytically active iron after silica exposure can present an oxidative injury to a living system. Sequestration of reactive iron would, therefore, confer a protective effect. The intracellular storage of iron by ferritin within macrophages can limi...
78 FR 4211 - Setting and Adjusting Patent Fees
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-18
... United States economy depends on high quality and timely patents to protect new ideas and investments for... described in Part III of this final rule, namely, fostering innovation, facilitating effective... recovering revenue from back-end fees, the final fee schedule continues to foster innovation and ease access...
Influence of repetitive UVA stimulation on skin protection capacity and antioxidant efficacy.
Rohr, Mathias; Rieger, Ingrid; Jain, Anil; Schrader, Andreas
2011-01-01
Topically applied antioxidants (AOs) are widely used in cosmetic products - especially in day and sun care - to help reduce oxidative stress caused by exogenous influences such as ultraviolet (UV) radiation. Despite several advances in recent years, little is known about the duration of protective effects by application of topical AOs, AO protection capacity (APC) or the activation of an endogenous protection capacity (EPC). By measuring oxidative-stress-induced photon emission of human skin in vivo with the ICL-S method (induced chemiluminescence of human skin), the protective effect of daily AO treatment for 2 weeks was examined on 4 consecutive days after treatment. UVA-dose-independent effects were investigated by decay curve intersection point analysis. In addition, chemiluminescence signal integration was used to investigate the influence of different UVA doses for stimulation on the determined APC as well as the modulation of the EPC by repetitive UVA stimulation both forming the skin protection capacity (SPC). The SPC showed a strong dependency on the UVA dose used for stimulation. AO pretreatment was more effective against lower UVA doses. Over the course of 4 days, the AO-induced SPC did not change significantly for a given UVA dose. Analyzing the decay curve intersection point for 2 different UVA doses, however, revealed a decrease in SPC with time. In addition, we found that a repetitive UVA irradiation of 1 J/cm(2) caused a statistically significant protective effect against UVA irradiation by stimulation of endogenous mechanisms. Topically supplemented AOs provide a protective effect against oxidative stress for at least 3 days, supporting their widespread use in cosmetic products. Especially their interaction with cutaneous protective mechanisms should be investigated in more detail for maximal protection, as endogenous defense mechanisms are already triggered by 2 low-dose UVA irradiations within 24 h. In summary, the in vivo measurement of UVA-induced cutaneous chemiluminescence permits the UVA-dose-independent determination of the AO efficacy for better comparability of the results while also taking endogenous defense mechanisms into account. Copyright © 2011 S. Karger AG, Basel.
β-Hydroxybutyrate protects from alcohol-induced liver injury via a Hcar2-cAMP dependent pathway.
Chen, Yonglin; Ouyang, Xinshou; Hoque, Rafaz; Garcia-Martinez, Irma; Yousaf, Muhammad Nadeem; Tonack, Sarah; Offermanns, Stefan; Dubuquoy, Laurent; Louvet, Alexandre; Mathurin, Philippe; Massey, Veronica; Schnabl, Bernd; Bataller, Ramon Alberola; Mehal, Wajahat Zafar
2018-04-27
Sterile inflammation resulting in alcoholic hepatitis (AH) occurs unpredictably after many years of excess alcohol intake. The factors responsible for the development of AH are not known but mitochondrial damage with loss of mitochondrial function are common features. Hcar2 is a G-protein coupled receptor which is activated by β-hydroxybutyrate (BHB). We aimed to determine the relevance of the BHB-Hcar2 pathway in alcoholic liver disease. We tested if loss of BHB production can result in increased liver inflammation. We further tested if BHB supplementation is protective in AH through interaction with Hcar2, and analyzed the immune and cellular basis for protection. Humans with AH have reduced hepatic BHB, and inhibition of BHB production in mice aggravated ethanol-induced AH, with higher plasma alanine aminotransferase levels, increased steatosis and greater neutrophil influx. Conversely supplementation of BHB had the opposite effects with reduced alanine aminotransferase levels, reduced steatosis and neutrophil influx. This therapeutic effect of BHB is dependent on the receptor Hcar2. BHB treatment increased liver Il10 transcripts, and promoted the M2 phenotype of intrahepatic macrophages. BHB also increased the transcriptional level of M2 related genes in vitro bone marrow derived macrophages. This skewing towards M2 related genes is dependent on lower mitochondrial membrane potential (Δψ) induced by BHB. Collectively, our data shows that BHB production during excess alcohol consumption has an anti-inflammatory and hepatoprotective role through an Hcar2 dependent pathway. This introduces the concept of metabolite-based therapy for AH. Alcoholic hepatitis is a life-threatening condition with no approved therapy that occurs unexpectedly in people who consume excess alcohol. The liver makes many metabolites, and we demonstrate that loss of one such metabolite β-hydroxybutyrate occurs in patients with alcoholic hepatitis. This loss can increase alcohol-induced liver injury, and β-hydroxybutyrate can protect from alcohol-induced liver injury via a receptor on liver macrophages. This opens the possibility of metabolite-based therapy for alcoholic hepatitis. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Shimasaki, Noriko; Shinohara, Katsuaki; Morikawa, Hideki
2017-12-07
For occupational safety, healthcare workers must select and wear appropriate personal protective equipment (PPE), protective clothing, and masks as countermeasures against exposure to infectious body fluids and blood splash. It is important for healthcare workers to ensure the protective performance of each PPE against penetration of pathogens. The International Standards Organization (ISO) 22609 test evaluates the effectiveness of medical facemasks to protect against penetration of splashed synthetic blood. However, in this method, the protective performance is determined only visually, without quantification of leaked liquid volume. Therefore, in this study, we modified the ISO 22609 test method to quantify the volume of leaked liquid and obtain a more accurate assessment of the protection performance. We tested non-woven and woven materials used for masks or protective clothing, and the performance of each material was classified using this new method. We found that the quantity of leaked synthetic blood was dependent on the structural characteristics of each material. These findings will allow healthcare workers to select the most appropriate PPE for a given situation or task.
SHIMASAKI, Noriko; SHINOHARA, Katsuaki; MORIKAWA, Hideki
2017-01-01
For occupational safety, healthcare workers must select and wear appropriate personal protective equipment (PPE), protective clothing, and masks as countermeasures against exposure to infectious body fluids and blood splash. It is important for healthcare workers to ensure the protective performance of each PPE against penetration of pathogens. The International Standards Organization (ISO) 22609 test evaluates the effectiveness of medical facemasks to protect against penetration of splashed synthetic blood. However, in this method, the protective performance is determined only visually, without quantification of leaked liquid volume. Therefore, in this study, we modified the ISO 22609 test method to quantify the volume of leaked liquid and obtain a more accurate assessment of the protection performance. We tested non-woven and woven materials used for masks or protective clothing, and the performance of each material was classified using this new method. We found that the quantity of leaked synthetic blood was dependent on the structural characteristics of each material. These findings will allow healthcare workers to select the most appropriate PPE for a given situation or task. PMID:28978815
DOE Office of Scientific and Technical Information (OSTI.GOV)
Toyama, Kensuke; Nakamura, Taishi; Kataoka, Keiichiro
2011-07-08
Highlights: {yields} Telmisartan, an angiotensin receptor blocker, acts as a partial PPAR{gamma} agonist. {yields} The protective effects of telmisartan against diabetic vascular injury were associated with attenuation of vascular NF{kappa}B activation and TNF {alpha}. {yields} PPAR{gamma} activity of telmisartan was involved in the normalization of vascular PPAR{gamma} downregulation in diabetic mice. {yields} We provided the first evidence indicating that PPAR{gamma} activity of telmisartan contributed to the protective effects of telmisartan against diabetic vascular complication. -- Abstract: Experimental and clinical data support the notion that peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) activation is associated with anti-atherosclerosis as well as anti-diabetic effect. Telmisartan,more » an angiotensin receptor blocker (ARB), acts as a partial PPAR{gamma} agonist. We hypothesized that telmisartan protects against diabetic vascular complications, through PPAR{gamma} activation. We compared the effects of telmisartan, telmisartan combined with GW9662 (a PPAR{gamma} antagonist), and losartan with no PPAR{gamma} activity on vascular injury in obese type 2 diabetic db/db mice. Compared to losartan, telmisartan significantly ameliorated vascular endothelial dysfunction, downregulation of phospho-eNOS, and coronary arterial remodeling in db/db mice. More vascular protective effects of telmisartan than losartan were associated with greater anti-inflammatory effects of telmisartan, as shown by attenuation of vascular nuclear factor kappa B (NF{kappa}B) activation and tumor necrosis factor {alpha}. Coadministration of GW9662 with telmisartan abolished the above mentioned greater protective effects of telmisartan against vascular injury than losartan in db/db mice. Thus, PPAR{gamma} activity appears to be involved in the vascular protective effects of telmisartan in db/db mice. Moreover, telmisartan, but not losartan, prevented the downregulation of vascular PPAR{gamma} in db/db mice and this effect of telmisartan was cancelled by the coadministration of GW9662. Our data provided the first evidence indicating that PPAR{gamma} activity of telmisartan contributed to the protective effects of telmisartan against diabetic vascular complication. PPAR{gamma} activity of telmisartan was involved in the normalization of vascular PPAR{gamma} downregulation in diabetic mice. Thus, telmisartan seems to exert vascular protective effects in hypertensive patients with diabetes.« less
Kaisar, Mohammad Abul; Prasad, Shikha; Cucullo, Luca
2015-01-01
Blood Brain Barrier (BBB) exposed to realistic concentrations (comparable to a chronic heavy smoker) of Cigarette Smoke Extract (CSE) triggers a strong endothelial inflammatory which can lead to the onset of neurological disorders. The involvement of Reactive Oxygen Species (ROS) in this inflammatory cascade is evident from the up-regulation of nuclear factor erythroid 2 related factor 2 (Nrf-2), a transcription factor involved in anti-oxidant response signaling in CSE exposed endothelial cells. We have shown that pre-treatment with α-tocopherol and/or ascorbic acid is highly protective for the BBB, thus suggesting that, prophylactic administration of antioxidants can reduce CSE and/or inflammatory-dependent BBB damage. We have assessed and ranked the protective effects of 5 popular OTC antioxidants (Coenzyme Q10, Melatonin, Glutathione, Lipoic acid and Resveratrol) against CSE-induced BBB endothelial damage using hCMEC/D3 cells. The analysis of pro-inflammatory cytokines release by ELISA revealed that, resveratrol, lipoic acid melatonin and Co-Q10 inhibited the BBB endothelial release of pro-inflammatory cytokines IL-6 & IL-8, reduced (not Co-Q10) CSE-induced up-regulation of Platelet Endothelial Cell Adhesion Molecule -1 (PECAM-1), Vascular Endothelial Cell Adhesion Molecule-1 (VCAM-1) & E-selectin and inhibited monocytes-endothelial cell adhesion. The anti-inflammatory effects correlated with the anti-oxidative protection endowed by these compounds as evidenced by upregulation of NADPH: Quinone Oxidoreductase 1 (NQO1) and reduced cellular oxidative stress. CSE-induced release of Vascular Endothelial Growth Factor (VEGF) was inhibited by all tested compounds although the effect was not strictly dose-dependent. Further in vivo studies are required to validate our results and expand our current study to include combinatorial treatments. PMID:26410779
The indirect antioxidant sulforaphane protects against thiopurine-mediated photooxidative stress
Benedict, Andrea L.; Knatko, Elena V.; Dinkova-Kostova, Albena T.
2012-01-01
Long-term treatment with thiopurines, such as the widely used anticancer, immunosuppressive and anti-inflammatory agent azathioprine, combined with exposure to ultraviolet (UV) radiation is associated with increased oxidative stress, hyperphotosensitivity and high risk for development of aggressive squamous cell carcinomas of the skin. Sulforaphane, an isothiocyanate derived from broccoli, is a potent inducer of endogenous cellular defenses regulated by transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), including cytoprotective enzymes and glutathione, which in turn act as efficient indirect and direct antioxidants that have long-lasting effects. Treatment with 6-thioguanine, a surrogate for azathioprine, leads to profound sensitization to oxidative stress and glutathione depletion upon exposure to UVA radiation, the damaging effects of which are primarily mediated by generation of reactive oxygen species. The degree of sensitization is greater for irradiation exposures spanning the absorption spectrum of 6-thioguanine, and is dependent on the length of treatment and the level of guanine substitution with 6-thioguanine, suggesting that the 6-thioguanine that is incorporated in genomic DNA is largely responsible for this sensitization. Sulforaphane provides protection against UVA, but not UVB, radiation without affecting the levels of 6-thioguanine incorporation into DNA. The protective effect is lost under conditions of Nrf2 deficiency, implying that it is due to induction of Nrf2-dependent cytoprotective proteins, and that this strategy could provide protection against any potentially photosensitizing drugs that generate electrophilic or reactive oxygen species. Thus, our findings support the development of Nrf2 activators as protectors against drug-mediated photooxidative stress and encourage future clinical trials in populations at high risk for cutaneous photodamage and photocarcinogenesis. PMID:22983983
Neocarzinostatin as a probe for DNA protection activity--molecular interaction with caffeine.
Chin, Der-Hang; Li, Huang-Hsien; Kuo, Hsiu-Maan; Chao, Pei-Dawn Lee; Liu, Chia-Wen
2012-04-01
Neocarzinostatin (NCS), a potent mutagen and carcinogen, consists of an enediyne prodrug and a protein carrier. It has a unique double role in that it intercalates into DNA and imposes radical-mediated damage after thiol activation. Here we employed NCS as a probe to examine the DNA-protection capability of caffeine, one of common dietary phytochemicals with potential cancer-chemopreventive activity. NCS at the nanomolar concentration range could induce significant single- and double-strand lesions in DNA, but up to 75 ± 5% of such lesions were found to be efficiently inhibited by caffeine. The percentage of inhibition was caffeine-concentration dependent, but was not sensitive to the DNA-lesion types. The well-characterized activation reactions of NCS allowed us to explore the effect of caffeine on the enediyne-generated radicals. Postactivation analyses by chromatographic and mass spectroscopic methods identified a caffeine-quenched enediyne-radical adduct, but the yield was too small to fully account for the large inhibition effect on DNA lesions. The affinity between NCS chromophore and DNA was characterized by a fluorescence-based kinetic method. The drug-DNA intercalation was hampered by caffeine, and the caffeine-induced increases in DNA-drug dissociation constant was caffeine-concentration dependent, suggesting importance of binding affinity in the protection mechanism. Caffeine has been shown to be both an effective free radical scavenger and an intercalation inhibitor. Our results demonstrated that caffeine ingeniously protected DNA against the enediyne-induced damages mainly by inhibiting DNA intercalation beforehand. The direct scavenging of the DNA-bound NCS free radicals by caffeine played only a minor role. Copyright © 2011 Wiley Periodicals, Inc.
Protective Effects of Pertussis Immunoglobulin (P-IGIV) in the Aerosol Challenge Model
Bruss, Jon B.; Siber, George R.
1999-01-01
Pertussis in infants is often severe, resulting in prolonged hospitalization. Treatment is limited to supportive care. Antibiotics do not significantly alter the course of the disease unless administered during the catarrhal phase. Therapies directed at pertussis toxin, a major virulence factor of Bordetella pertussis, may be beneficial. This study uses the aerosol challenge model to further examine the protective effects of P-IGIV, a new intravenous immunoglobulin product, which has high levels of pertussis toxin antibodies. P-IGIV was prepared as a 4% immunoglobulin G (IgG) solution from the pooled donor plasma from donors immunized with inactivated pertussis toxoid. The IgG pertussis toxin antibody concentration in P-IGIV is >7-fold higher than conventional intravenous immunoglobulin products. In the aerosol challenge model, P-IGIV-treated mice exhibited a dose-dependent decrease in mortality when monitored for 28 days postchallenge. P-IGIV in doses of 2,800, 1,400, and 350 mg/kg significantly reduced mortality compared to saline (P < 0.01)- and human IGIV (P < 0.01)-treated controls. The 50% protective dose of pertussis toxin antibodies in P-IGIV was 147 μg/ml. Recovery of weight gain and normalization of leukocyte counts occurred in all P-IGIV-treated groups but did not exhibit dose-dependent characteristics. Even after 7 days of infection, P-IGIV reversed the effects of pertussis in mice. This study provides further evidence that pertussis toxin antibodies not only play a role in passive protection but can also reverse symptoms of established disease in mice. We feel that P-IGIV deserves further evaluation in children hospitalized with severe pertussis. PMID:10391844
In vivo radioprotection by alpha-TMG: preliminary studies.
Satyamitra, M; Devi, P U; Murase, H; Kagiya, V T
2001-08-08
alpha-TMG is a novel water-soluble derivative of Vitamin E that has shown excellent antioxidant activity. The parent compound has demonstrated protection against radiation induced chromosomal damage in vivo. Hence, the preliminary experiments to determine the radioprotective activity of alpha-TMG were carried out in adult Swiss albino mice. Acute toxicity of the drug was studied taking 24h, 72 h and 30 day mortality after a single intraperitoneal injection of 500-2000 mg/kg body weight of the drug. The drug LD(50) for 24h and 72 h/30 day survival were found to be 1120 and 1000 mg/kg body weight, respectively. The optimum time of drug administration and drug dose-dependent effect on in vivo radiation protection of bone marrow chromosomes was studied in mice. Injection of 600 mg/kg of the drug 15 min before or within 5, 15 or 30min after 3Gy whole body gamma radiation resulted in a significant decrease in the aberrant metaphases percent at 24h post-irradiation; the maximum effect was seen when the drug was given immediately after irradiation. Injection of 200-800 mg/kg TMG within 5 min of irradiation with 3 Gy produced a significant dose-dependent reduction in the radiation induced percent aberrant metaphases and in the frequency of micronucleated erythrocytes at 24h after exposure, with a corresponding decrease in the different types of aberrations. The optimum dose for protection without drug toxicity was 600 mg/kg body weight. At this dose, TMG produced 70 and >60% reduction in the radiation induced percent aberrant metaphases and micronucleated erythrocytes, respectively. The high water solubility and effectiveness when administered post-irradiation favor TMG as a likely candidate for protection in case of accidental exposures.
NASA Astrophysics Data System (ADS)
Wu, Z. H.; Zhang, H.; Wang, X. Y.; Yang, R.; Liu, B.; Liu, Y.; Zhao, W. P.; Feng, H. Y.; Xue, L. G.; Hao, J. F.; Niu, B. T.; Wang, Z. H.
2012-01-01
The purpose of this experiment was to estimate the protective effects of melatonin against radiation-induced brain damages in mice induced by heavy ion beams. Kun-Ming mice were randomly divided into five groups: normal control group, irradiation control group, and three different doses of melatonin (5, 10, and 20 mg/kg, i.p.) treated groups. Apart from the normal control group, the other four groups were exposed to whole-body 4.0 Gy carbon ion beam irradiation (approximately 0.5 Gy/min) after i.p. administration of normal saline or melatonin 1 h before irradiation. The oxidative redox status of brain tissue was assessed by measurement of malondiadehyde (MDA) levels, total superoxide dismutase (T-SOD), cytosolic superoxide dismutase (Cu/ZnSOD, SOD1) and mitochondrial superoxide dismutase (MnSOD, SOD2) activities at 8 h after irradiation. DNA damages were determined using the Comet assay and apoptosis and cell cycle distribution were detected by flow cytometric analyses. A dramatic dose-dependent decrease in MDA levels, tail moment, rates of tailing cells, and apoptosis, and a dose-dependent increase in T-SOD and SOD2 activities, in brain tissues in the melatonin-treated groups were detected compared with the irradiation only group. Furthermore, flow cytometric analysis demonstrated that the percentage of brain cells in the G0/G1 phase decreased significantly, while those in the S and G2/M stage increased dramatically, with mice pretreated with melatonin compared to the irradiation control group. These data indicate that melatonin has protective effects against irradiation-induced brain injury, and that its underlying protective mechanisms may relate to modulation of oxidative stress induced by heavy ionirradiation.
Scutellarin’s Cardiovascular Endothelium Protective Mechanism: Important Role of PKG-Iα
Chen, Chen; Yang, Jian; Li, Jiaxun; Hu, Na; Li, Yang; Zhang, Dongmei; Guo, Tao; Liu, Xuan; Yang, Weimin
2015-01-01
Scutellarin (SCU), a flavonoid glycoside compound, has been successfully used in clinic for treatment of ischemic diseases in China. In this report, we checked the effects of SCU on endothelium dysfunction (ED) of coronary artery (CA) against myocardial ischemia reperfusion (MIR) injury in vivo. The involvement of PKG-Iα was further studied using cultured endothelial cells subjected to hypoxia reoxygenation (HR) injury in vitro. In rat MIR model, SCU (45 and 90 mg/kg, iv) significantly reduced ischemic size and restored the endothelium-dependent vasodilation of isolated CA rings. PKG inhibitor Rp-8-Br-cGMP (50 μg/kg, iv) could ameliorate the protective effects of SCU. Increase in phosphorylation of vasodilator-stimulated phosphoprotein (VASP), a main substrate of PKG, at Ser 239 was observed in both heart tissue and serum of SCU-treated animals. In cultured human cardiac microvascular endothelial cells (HCMECs), SCU (1 and 10 μM) dose-dependently protected cell viability and increased the mRNA and protein level of PKG-Iα against HR injury. The activity of PKG was also increased by SCU treatment. The activation of PKG–1α was then studied using targeted proteomic analysis (MRM-MS) checking the phosphorylation state of the autophosphorylation domain (aa42-94). Significant decrease in phosphorylation of PKG-Iα at Ser50, Ser72, Ser89 was induced by HR injury while SCU treatment significantly increased the phosphorylation of PKG-Iα, not only at Ser50, Ser72 and Ser89, but also at Ser44 and Thr58 (two novel phosphorylation domains). Our results demonstrate PKG-Iα might play an important role in the protective effects of SCU on ED against MIR injury. PMID:26440524
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deusing, Dorothé Jenni, E-mail: Dorothe.J.Deusing@ernaehrung.uni-giessen.de; Beyrer, Melanie, E-mail: m.beyrer@web.de; Fitzenberger, Elena, E-mail: Elena.Fitzenberger@ernaehrung.uni-giessen.de
Besides its function in transport of fatty acids into mitochondria in order to provide substrates for β-oxidation, carnitine has been shown to affect also glucose metabolism and to inhibit several mechanisms associated with diabetic complications. In the present study we used the mev-1 mutant of the nematode Caenorhabditis elegans fed on a high glucose concentration in liquid media as a diabetes model and tested the effects of carnitine supplementation on their survival under heat-stress. Carnitine at 100 μM completely prevented the survival reduction that was caused by the application of 10 mM glucose. RNA-interference for sir-2.1, a candidate genes mediating the effectsmore » of carnitine revealed no contribution of the sirtuin for the rescue of survival. Under daf-12 RNAi rescue of survival by carnitine was abolished. RNA-interference for γ-butyrobetaine hydroxylase 2, encoding the key enzyme for carnitine biosynthesis did neither increase glucose toxicity nor prevent the rescue of survival by carnitine, suggesting that the effects of carnitine supplementation on carnitine levels were significant. Finally, it was demonstrated that neither the amount of lysosomes nor the proteasomal activity were increased by carnitine, excluding that protein degradation pathways, such as autophagy or proteasomal degradation, are involved in the protective carnitine effects. In conclusion, carnitine supplementation prevents the reduction of survival caused by glucose in C. elegans in dependence on a nuclear hormone receptor which displays high homologies to the vertebrate peroxisomal proliferator activated receptors. - Highlights: • Carnitine protects from glucose-induced reduction of stress-resistance. • Carnitine acts via the PPAR homolog DAF-12 on glucose toxicity. • Carnitine protects from glucose toxicity independent of protein degradation.« less
Bonum vinum laetificat cor hominum.
Stoclet, J C
2001-01-01
Beneficial effects of wine consumption on health have been suspected since the antiquity. Recent epidemiological studies show that coronary heart disease mortality markedly decreases from northern to southern Europe and is lower in Mediterranean than in other developed countries. Because wine is a component of the Mediterranean diet, it has been suggested that moderate wine especially red wine consumption may produce additional beneficial effects on cardiovascular morbidity and mortality compared to consuming the same quantity of alcohol in other beverages. Polyphenols are good candidates to explain the putative cardiovascular protective effect of wine, because they are abundant in wine especially red wine, and possess antioxidant and superoxide ion scavenging properties. Because it is readily accessible from blood and produces cardioprotective agents like nitric oxide (NO) the endothelial cell may be a privileged target for wine polyphenols. Polyphenols from red wine can prevent oxidation of low density lipoproteins (LDL). As oxidized LDL inhibit agonist-activated NO release from endothelial cells and subsequent endothelium-dependent relaxation of arteries, wine polyphenols might prevent LDL-induced alterations of endothelial function. Furthermore some wine polyphenols contained in oligomeric condensed tannins- and anthocyaninsD enriched fractions can act directly on endothelial cells to cause calcium-dependent release of NO. The latter effect is independent from superoxide scavenging and antioxidant properties of the polyphenols, and it is produced by compounds with specific structures only. Thus, decreased oxidation of LDL and enhanced release of NO from endothelium caused by polyphenols from red wine may result in cardiovascular protection. However further studies are required to demonstrate whether or not these effects are involved in the putative protective effect of wine on cardiovascular morbidity and mortality.
Rossoni, G; Pompilio, G; Biglioli, P; Alamanni, F; Tartara, P; Rona, P; Porqueddu, M; Berti, F
1999-01-01
Previous studies have shown that defibrotide, a polydeoxyribonucleotide obtained by depolymerization of DNA from porcine tissues, has important protective effects on myocardial ischemia, which may be associated with a prostacyclin-related mechanism. The purpose of this study was to investigate the direct effects of defibrotide (given in cardioplegia or after ischemia) on a model of rat heart recovery after cardioplegia followed by ischemia/reperfusion injury. Isolated rat hearts, undergoing 5 minutes of warm cardioplegic arrest followed by 20 minutes of global ischemia and 30 minutes of reperfusion, were studied using the modified Langendorff model. The cardioplegia consisted of St. Thomas' Hospital solution augmented with defibrotide (50, 100, and 200 microg/mL) or without defibrotide (controls). Left ventricular mechanical function and the levels of creatine kinase, lactate dehydrogenase, and 6-keto-prostaglandin F1alpha (6-keto-PGF1alpha; the stable metabolite of prostacyclin) were measured during preischemic and reperfusion periods. After global ischemia, hearts receiving defibrotide in the cardioplegic solution (n = 8) manifested in a concentration-dependent fashion lower left ventricular end-diastolic pressure (p < 0.001), higher left ventricular developed pressure (p < 0.01), and lower coronary perfusion pressure (p < 0.001) compared to the control group. After reperfusion, hearts receiving defibrotide in the cardioplegic solution also had, in a dose-dependent way, lower levels of creatine-kinase (p < 0.01), lactate dehydrogenase (p < 0.001), and higher levels of 6-keto-PGF1alpha (p < 0.001) compared to the control group. Furthermore, when defibrotide was given alone to the hearts at the beginning of reperfusion (n = 7), the recovery of postischemic left ventricular function was inferior (p < 0.05) to that obtained when defibrotide was given in cardioplegia. Defibrotide confers to conventional crystalloid cardioplegia a potent concentration-dependent protective effect on the recovery of isolated rat heart undergoing ischemia/reperfusion injury. The low cost and the absence of contraindications (cardiac toxicity and hemodynamic effects) make defibrotide a promising augmentation to cardioplegia.
Urata, Yoshishige; Ihara, Yoshito; Murata, Hiroaki; Goto, Shinji; Koji, Takehiko; Yodoi, Junji; Inoue, Satoshi; Kondo, Takahito
2006-05-12
The GSH/glutaredoxin (GRX) system is involved in the redox regulation of certain enzyme activities, and this system protects cells from H2O2-induced apoptosis by regulating the redox state of Akt (Murata, H., Ihara, Y., Nakamura, H., Yodoi, J., Sumikawa, K., and Kondo, T. (2003) J. Biol. Chem. 278, 50226-50233). Estrogens, such as 17beta-estradiol (E2), play an important role in development, growth, and differentiation and appear to have protective effects on oxidative stress mediated by estrogen receptor alpha (ERalpha). However, the role of the ERbeta-mediated pathway in this cytoprotection and the involvement of E2 in the redox regulation are not well understood. In the present study, we demonstrated that E2 protected cardiac H9c2 cells, expressing ERbeta from H2O2-induced apoptosis concomitant with an increase in the activity of Akt. E2 induced the expression of glutaredoxin (GRX) as well as gamma-glutamylcysteine synthetase, a rate-limiting enzyme for the synthesis of GSH. Inhibitors for both gamma-glutamylcysteine synthetase and GRX and ICI182,780, a specific inhibitor of ERs, abolished the protective effect of E2 on cell survival as well as the activity of Akt, suggesting that ERbeta is involved in the cytoprotection and redox regulation by E2. Transcription of the GRX gene was enhanced by E2. The promoter activity of GRX was up-regulated by an ERbeta-dependent element. These results suggest that the GRX/GSH system is involved in the cytoprotective and genomic effects of E2 on the redox state of Akt, a pathway that is mediated, at least in part, by ERbeta. This mechanism may also play an antiapoptotic role in cancer cells during carcinogenesis or chemotherapy.
Workshop 5 (synthesis): water pollution abatement as related to ecosystem protection.
Hagebro, C
2004-01-01
Water pollution exerts major stress on water systems and the challenge is to ensure security in river basins for both water-dependent activities and for the aquatic ecosystems. The workshop focused on protection of good ecological status, quality criteria, priorities for action, and on achievement of sustainable improvements. The three keynote speakers presented the concept applied in the EU Water Framework Directive, the need for a multi-stakeholder collaboration in order to reach a good ecological status of waters and a concrete example of interactive planning of water protection measures in a transboundary lake. The additional paper presentations addressed specific pollution problems in catchments, the effect of environmental user fees and ecosystem indicators.
Charoenvit, Yupin; Brice, Gary T.; Bacon, David; Majam, Victoria; Williams, Jackie; Abot, Esteban; Ganeshan, Harini; Sedegah, Martha; Doolan, Denise L.; Carucci, Daniel J.; Zimmerman, Daniel H.
2004-01-01
CEL-1000 (DGQEEKAGVVSTGLIGGG) is a novel potential preventative and therapeutic agent. We report that CEL-1000 confers a high degree of protection against Plasmodium sporozoite challenge in a murine model of malaria, as shown by the total absence of blood stage infection following challenge with 100 sporozoites (100% protection) and by a substantial reduction (400-fold) of liver stage parasite RNA following challenge with 50,000 sporozoites. CEL-1000 protection was demonstrated in A/J (H-2a) and C3H/HeJ (H-2k) mice but not in BALB/c (H-2d) or CAF1 (A/J × BALB/c F1 hybrid) mice. In CEL-1000-treated and protected mice, high levels of gamma interferon (IFN-γ) in serum and elevated frequencies of hepatic and splenic CD4+ IFN-γ-positive T cells were detected 24 h after administration of an additional dose of CEL-1000. Treatment of A/J mice that received CEL-1000 with antibodies against IFN-γ just prior to challenge abolished the protection, and a similar treatment with antibodies against CD4+ T cells partially reduced the level of protection, while treatment with control antibodies or antibodies specific for interleukin-12 (IL-12), CD8+ T cells, or NK cells had no effect. Our data establish that the protection induced by CEL-1000 is dependent on IFN-γ and is partially dependent on CD4+ T cells but is independent of CD8+ T cells, NK cells, and IL-12 at the effector phase and does not induce a detectable antibody response. PMID:15215094
Charoenvit, Yupin; Brice, Gary T; Bacon, David; Majam, Victoria; Williams, Jackie; Abot, Esteban; Ganeshan, Harini; Sedegah, Martha; Doolan, Denise L; Carucci, Daniel J; Zimmerman, Daniel H
2004-07-01
CEL-1000 (DGQEEKAGVVSTGLIGGG) is a novel potential preventative and therapeutic agent. We report that CEL-1000 confers a high degree of protection against Plasmodium sporozoite challenge in a murine model of malaria, as shown by the total absence of blood stage infection following challenge with 100 sporozoites (100% protection) and by a substantial reduction (400-fold) of liver stage parasite RNA following challenge with 50,000 sporozoites. CEL-1000 protection was demonstrated in A/J (H-2(a)) and C3H/HeJ (H-2(k)) mice but not in BALB/c (H-2(d)) or CAF1 (A/J x BALB/c F(1) hybrid) mice. In CEL-1000-treated and protected mice, high levels of gamma interferon (IFN-gamma) in serum and elevated frequencies of hepatic and splenic CD4+ IFN-gamma-positive T cells were detected 24 h after administration of an additional dose of CEL-1000. Treatment of A/J mice that received CEL-1000 with antibodies against IFN-gamma just prior to challenge abolished the protection, and a similar treatment with antibodies against CD4+ T cells partially reduced the level of protection, while treatment with control antibodies or antibodies specific for interleukin-12 (IL-12), CD8+ T cells, or NK cells had no effect. Our data establish that the protection induced by CEL-1000 is dependent on IFN-gamma and is partially dependent on CD4+ T cells but is independent of CD8+ T cells, NK cells, and IL-12 at the effector phase and does not induce a detectable antibody response.
Lee, Chrono K.; Huang, Haibin; Hester, Maureen M.; Liu, Jianhua; Luckie, Bridget A.; Torres Santana, Melanie A.; Mirza, Zeynep; Khoshkenar, Payam; Abraham, Ambily; Shen, Zu T.; Lodge, Jennifer K.; Akalin, Ali; Homan, Jane; Ostroff, Gary R.
2017-01-01
ABSTRACT Development of a vaccine to protect against cryptococcosis is a priority given the enormous global burden of disease in at-risk individuals. Using glucan particles (GPs) as a delivery system, we previously demonstrated that mice vaccinated with crude Cryptococcus-derived alkaline extracts were protected against lethal challenge with Cryptococcus neoformans and Cryptococcus gattii. The goal of the present study was to identify protective protein antigens that could be used in a subunit vaccine. Using biased and unbiased approaches, six candidate antigens (Cda1, Cda2, Cda3, Fpd1, MP88, and Sod1) were selected, recombinantly expressed in Escherichia coli, purified, and loaded into GPs. Three mouse strains (C57BL/6, BALB/c, and DR4) were then vaccinated with the antigen-laden GPs, following which they received a pulmonary challenge with virulent C. neoformans and C. gattii strains. Four candidate vaccines (GP-Cda1, GP-Cda2, GP-Cda3, and GP-Sod1) afforded a significant survival advantage in at least one mouse model; some vaccine combinations provided added protection over that seen with either antigen alone. Vaccine-mediated protection against C. neoformans did not necessarily predict protection against C. gattii. Vaccinated mice developed pulmonary inflammatory responses that effectively contained the infection; many surviving mice developed sterilizing immunity. Predicted T helper cell epitopes differed between mouse strains and in the degree to which they matched epitopes predicted in humans. Thus, we have discovered cryptococcal proteins that make promising candidate vaccine antigens. Protection varied depending on the mouse strain and cryptococcal species, suggesting that a successful human subunit vaccine will need to contain multiple antigens, including ones that are species specific. PMID:29184017
Li, Xuan; Yin, Daqiang; Li, Jiang; Wang, Rui
2014-07-01
Selenium (Se) has been recognized as one key to understanding mercury (Hg) exposure risks. To explore the effects of Se on Hg-induced immunotoxicity, female Balb/c mice were exposed to HgCl2- or MeHgCl-contaminated drinking water (0.001, 0.01, and 0.1 mM as Hg) with coexisting Na2SeO3 at different Se/Hg molar ratios (0:1, 1/3:1, 1:1 and 3:1). The potential immunotoxicity induced by Na2SeO3 exposure alone (by way of drinking water) was also determined within a wide range of concentrations. After 14 days' exposure, the effects of Hg or Se on the immune system of Balb/c mice were investigated by determining the proliferation of T and B lymphocytes and the activity of natural killer cells. Hg exposure alone induced a dose-dependent suppression effect, whereas Se provided promotion effects at low exposure level (<0.01 mM) and inhibition effects at high exposure level (>0.03 mM). Under Hg and Se coexposure condition, the effects on immunotoxicity depended on the Hg species, Se/Hg ratio, and exposure concentration. At low Hg concentration (0.001 mM), greater Se ingestion exhibited stronger protective effects on Hg-induced suppression effect mainly by way of decreasing Hg concentrations in target organs. At greater Hg concentration (0.01 and 0.1 mM), immunotoxicity induced by Se (>0.03 mM) became evident, and the protective effects appeared more significant at an Se/Hg molar ratio of 1:1. The complex antagonistic effects between Se and Hg suggested that both Se/Hg molar ratio and concentration should be considered when evaluating the potential health risk of Hg-contaminated biota.
Protective effect of Cassia fistula fruit extract on bromobenzene-induced nephrotoxicity in mice.
Kalantari, Heibatullah; Jalali, Mohammadtaha; Jalali, Amir; Salimi, Abobakr; Alhalvachi, Foad; Varga, Balazs; Juhasz, Bela; Jakab, Anita; Kemeny-Beke, Adam; Gesztelyi, Rudolf; Tosaki, Arpad; Zsuga, Judit
2011-10-01
The efficacy of a crude hydro-alcoholic extract of Cassia fistula (golden shower tree) fruit to protect the kidney against bromobenzene-induced toxicity was studied. Negative control mice received normal saline; positive control mice were given 460 mg/kg of bromobenzene; Cassia fistula treated mice received 200, 400, 600 and 800 mg/kg of Cassia fistula fruit extract followed by 460 mg/kg bromobenzene (daily by oral gavage for 10 days). On the 11th day, the mice were sacrificed, blood samples were obtained to assess blood urea nitrogen (BUN) and creatinine levels, and kidneys were removed for histological examination. We found that bromobenzene induced significant nephrotoxicity reflected by an increase in levels of BUN and creatinine that was dose dependently prevented by the Cassia fistula fruit extract. The nephroprotective effect of the Cassia fistula fruit extract was confirmed by the histological examination of the kidneys. To the best of our knowledge, this is the first study to demonstrate the protective effect of Cassia fistula in nephrotoxicity.
Brown, Kevin D; Maqsood, Sadia; Huang, Jing-Yi; Pan, Yong; Harkcom, William; Li, Wei; Sauve, Anthony; Verdin, Eric; Jaffrey, Samie R
2014-12-02
Intense noise exposure causes hearing loss by inducing degeneration of spiral ganglia neurites that innervate cochlear hair cells. Nicotinamide adenine dinucleotide (NAD(+)) exhibits axon-protective effects in cultured neurons; however, its ability to block degeneration in vivo has been difficult to establish due to its poor cell permeability and serum instability. Here, we describe a strategy to increase cochlear NAD(+) levels in mice by administering nicotinamide riboside (NR), a recently described NAD(+) precursor. We find that administration of NR, even after noise exposure, prevents noise-induced hearing loss (NIHL) and spiral ganglia neurite degeneration. These effects are mediated by the NAD(+)-dependent mitochondrial sirtuin, SIRT3, since SIRT3-overexpressing mice are resistant to NIHL and SIRT3 deletion abrogates the protective effects of NR and expression of NAD(+) biosynthetic enzymes. These findings reveal that administration of NR activates a NAD(+)-SIRT3 pathway that reduces neurite degeneration caused by noise exposure. Copyright © 2014 Elsevier Inc. All rights reserved.
Lee, Seon-Mi; Choi, Youngmin; Sung, Jeehye; Kim, Younghwa; Jeong, Heon-Sang; Lee, Junsoo
2014-01-01
Black rice contains many biologically active compounds. The aim of this study was to investigate the protective effects of black rice extracts (whole grain extract, WGE and rice bran extract, RBE) on tert-butyl hydroperoxide (TBHP)-induced oxidative injury in HepG2 cells. Cellular reactive oxygen species (ROS), antioxidant enzyme activities, malondialdehyde (MDA) and glutathione (GSH) concentrations were evaluated as biomarkers of cellular oxidative status. Cells pretreated with 50 and 100 μg/mL of WGE or RBE were more resistant to oxidative stress in a dose-dependent manner. The highest WGE and BRE concentrations enhanced GSH concentrations and modulated antioxidant enzyme activities (glutathione reductase, glutathione-S-transferase, catalase, and superoxide dismutase) compared to TBHP-treated cells. Cells treated with RBE showed higher protective effect compared to cells treated with WGE against oxidative insult. Black rice extracts attenuated oxidative insult by inhibiting cellular ROS and MDA increase and by modulating antioxidant enzyme activities in HepG2 cells. PMID:25580401
Kawashima, Keiko; Fujimura, Yu; Makino, Toshiaki; Kano, Yoshihiro
2006-09-01
The protective effect of Hangeshashinto (HST) and its major constituents, baicalin (BA), berberine (BE), saponin fraction of ginseng (GS) and glycyrrhizin (GL) on rat gastric lesion induced by ethanol was examined to clarify its active ingredients and action mechanism. Oral treatment with HST at the doses of 125 and 250 mg/kg suppressed ethanol-induced gastric lesions. The mixture of BA, BE, GL and GS (4M), each of BE, GL and GS at the dosage corresponded to HST (125 mg/kg) also suppressed the ethanol-induced gastric lesion in rats, but BA did not. Treatment of ethanol augmented the activity of myeloperoxidase (MPO) in the stomach, which was significantly suppressed by the administration of HST, BE, GL and GS. These results suggest that the protective effect of HST on ethanol-induced gastric lesion was depended on BE, GL and GS, by, in part, the reduction of MPO activity in stomach.
Wang, Xue-Feng; Song, Shun-de; Li, Ya-Jun; Hu, Zheng Qiang; Zhang, Zhe-Wen; Yan, Chun-Guang; Li, Zi-Gang; Tang, Hui-Fang
2018-06-01
Quercetin (Que) as an abundant flavonol element possesses potent antioxidative properties and has protective effect in lipopolysaccharide (LPS)-induced acute lung injury (ALI), but the specific mechanism is still unclear, so we investigated the effect of Que from in vivo and in vitro studies and the related mechanism of cAMP-PKA/Epac pathway. The results in mice suggested that Que can inhibit the release of inflammatory cytokine, block neutrophil recruitment, and decrease the albumin leakage in dose-dependent manners. At the same time, Que can increase the cAMP content of lung tissue, and Epac content, except PKA. The results in epithelial cell (MLE-12) suggested that Que also can inhibit the inflammatory mediators keratinocyte-derived chemokines release after LPS stimulation; Epac inhibitor ESI-09 functionally antagonizes the inhibitory effect of Que; meanwhile, PKA inhibitor H89 functionally enhances the inhibitory effect of Que. Overexpression of Epac1 in MLE-12 suggested that Epac1 enhance the effect of Que. All those results suggested that the protective effect of quercetin in ALI is involved in cAMP-Epac pathway.
Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W
2012-11-01
Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.
Yoo, Ok-Kyung; Choi, Bu Young; Park, Jin-Oh; Lee, Ji-Won; Park, Byoung-Kwon; Joo, Chul Gue; Heo, Hyo-Jung; Keum, Young-Sam
2016-03-01
Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression.
Antiinflammatory activity of lymphomyosot during chronic deseases.
Ratiani, L; Terunashvili, G; Sanikidze, T
2012-04-01
Every pathology generally refers to an inadequate response to the influence brought by endo- and exotoxins, which is carried out via natural compensative and protective pathways of the body. Scientific conception of bioregulative therapy and homotoxicology implies treatment by modulation of own protective mechanisms and neutralization of already existing toxins. This endo- and exogenic homotoxins influence on the development of various immune responses of immunocompetent cells. Lymphomyosot, a complex nutural detoxifier drug, providing the effective detoxication of extracellular matrix via lymphatic system. As a huge amount of immunocompetent cells are located in the lymphatic system are, regulation of their immune responses by Lymphomyosot is very the essence of the treatment applicable to different chronic pathologies. determining of dose-dependent immunomodulating activity of Lymphomyosot on T lymphocytes modelled system of Jurkat cells. The modelled systems of Jurkat cells, incubated under moderate oxidative stress conditions inherent chronic inflammatory processes, and stimulated with mytogene Phytohemaglutinine (PHA) was used. Effectiveness of Lypmhomyosot was studied by regulatory capacity of the cells bioviability (MTT test) immunological activity (cytokine expression, respiratory burst) and of mytogene-induced apoptosis intensity of Jurkat cells. Lymphomyosot shows antioxidant effect and dose-dependent immunomodulatory activity. Lymphomyosot, as anti-inflammatory, recovering agent is effective for profilactic aims. Low (therapeutic) doses of lymphomyosot are effective for the treatment of.
Sharifi, Rouhallah; Ryu, Choong-Min
2016-01-01
Biological control (biocontrol) agents act on plants via numerous mechanisms, and can be used to protect plants from pathogens. Biocontrol agents can act directly as pathogen antagonists or competitors or indirectly to promote plant induced systemic resistance (ISR). Whether a biocontrol agent acts directly or indirectly depends on the specific strain and the pathosystem type. We reported previously that bacterial volatile organic compounds (VOCs) are determinants for eliciting plant ISR. Emerging data suggest that bacterial VOCs also can directly inhibit fungal and plant growth. The aim of the current study was to differentiate direct and indirect mechanisms of bacterial VOC effects against Botrytis cinerea infection of Arabidopsis. Volatile emissions from Bacillus subtilis GB03 successfully protected Arabidopsis seedlings against B. cinerea. First, we investigated the direct effects of bacterial VOCs on symptom development and different phenological stages of B. cinerea including spore germination, mycelial attachment to the leaf surface, mycelial growth, and sporulation in vitro and in planta. Volatile emissions inhibited hyphal growth in a dose-dependent manner in vitro, and interfered with fungal attachment on the hydrophobic leaf surface. Second, the optimized bacterial concentration that did not directly inhibit fungal growth successfully protected Arabidopsis from fungal infection, which indicates that bacterial VOC-elicited plant ISR has a more important role in biocontrol than direct inhibition of fungal growth on Arabidopsis. We performed qRT-PCR to investigate the priming of the defense-related genes PR1, PDF1.2, and ChiB at 0, 12, 24, and 36 h post-infection and 14 days after the start of plant exposure to bacterial VOCs. The results indicate that bacterial VOCs potentiate expression of PR1 and PDF1.2 but not ChiB, which stimulates SA- and JA-dependent signaling pathways in plant ISR and protects plants against pathogen colonization. This study provides new evidence for bacterial VOC-elicited plant ISR that protects Arabidopsis plants from infection by the necrotrophic fungus B. cinerea. Our work reveals that bacterial VOCs primarily act via an indirect mechanism to elicit plant ISR, and have a major role in biocontrol against fungal pathogens. PMID:26941721
Retrospective study of the iodine-131 contamination of workers in the radiopharmaceutical industry.
Gaburo, J C; Lipsztein, J L; Rabelo, D M; Stabin, M
2003-01-01
A dose reconstruction study was performed for personnel occupationally exposed to 131I in radiopharmaceutical production, during the years 1981 to 1994, with the objective of estimating committed effective doses and critically reviewing the main causes of their exposures. The workers were selected from a group responsible for the production, labelling and distribution of all radiopharmaceutical material in Brazil. Best estimates of intakes and doses were derived from the examination of the individual monitoring records and the reports from the radiation protection supervisor, complemented by interviews with the workers and with radiation protection officers. Over this time period workers had chronic as well as acute intakes of 131I. Committed effective doses were found to be dependent on the task performed by the worker and the site of operation and inversely correlated with the amounts of iodine handled. Intakes in general were a consequence of inadequate radiation protection control.
Díaz, Dafne I; Beristain, Cesar I; Azuara, Ebner; Luna, Guadalupe; Jimenez, Maribel
2015-01-01
Blackberry (Rubus fruticosus) juice possesses compounds with antioxidant activity, which can be protected by different biopolymers used in the microencapsulation. Therefore, the effects of cell wall material including maltodextrin (MD), Arabic gum (GA) and whey protein concentrate (WPC) were evaluated on the physicochemical and antioxidant properties of encapsulated blackberries using a spray-drying technique. Anthocyanin concentration, polymeric colour, total polyphenols, radical scavenging activity of the 1,1-diphenyl-2-picrilhydrazil radical, reducing power and the stability at different storage conditions were evaluated. GA and MD conferred a similar protection to the antioxidant compounds when the microcapsules were stored at low water activities (aw < 0.515) in contrast to at a high moisture content (aw > 0.902), whereas WPC presented a high protection. Therefore, the selection of the best wall material for blackberry juice encapsulation depends of the conditions of storage of the powder.
Exterior spacecraft subsystem protective shielding analysis and design
NASA Technical Reports Server (NTRS)
Schonberg, William P.; Taylor, Roy A.
1990-01-01
All spacecraft are susceptible to impacts by meteoroids and pieces of orbiting space debris. An effective mechanism is developed to protect external spacecraft subsystems against damage by ricochet particles formed during such impacts. Equations and design procedures for protective shield panels are developed based on observed ricochet phenomena and calculated ricochet particle sizes and speeds. It is found that the diameter of the most damaging ricochet debris particle can be as large as 40 percent of the original project tile diameter, and can travel at speeds between 24 and 36 percent of the original projectile impact velocity. Panel dimensions are shown to be strongly dependent on their inclination to the impact velocity vector and on their distribution around a spacecraft module. It is concluded that obliquity effects of high-speed impacts must be considered in the design of any structure exposed to the meteoroid and space debris environment.
Trace elements have beneficial, as well as detrimental effects on bone homeostasis.
Zofkova, I; Davis, M; Blahos, J
2017-07-18
The protective role of nutrition factors such as calcium, vitamin D and vitamin K for the integrity of the skeleton is well understood. In addition, integrity of the skeleton is positively influenced by certain trace elements (e.g. zinc, copper, manganese, magnesium, iron, selenium, boron and fluoride) and negatively by others (lead, cadmium, cobalt). Deficiency or excess of these elements influence bone mass and bone quality in adulthood as well as in childhood and adolescence. However, some protective elements may become toxic under certain conditions, depending on dosage (serum concentration), duration of treatment and interactions among individual elements. We review the beneficial and toxic effects of key elements on bone homeostasis.
Phototoxicity of TiO2 nanoparticles to zebrafish (Danio rerio) is dependent on life stage
The zebrafish (Danio rerio) embryo has been increasingly used as a model to evaluate toxicity of manufactured nanomaterials. Many studies indicate that the embryo chorion may protect animals from toxic effects of nanomaterials, suggesting that post-hatch life stages may be more s...
An age-dependent interaction with leptin unmasks ghrelin's bone-protective effects
USDA-ARS?s Scientific Manuscript database
The mutual interplay between energy homeostasis and bone metabolism is an important emerging concept. Ghrelin and leptin antagonize each other in regulating energy balance, but the role of this interaction in bone metabolism is unknown. Using ghrelin receptor and leptin-deficient mice, we show that ...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Tuberculosis. 3.959..., Compensation, and Dependency and Indemnity Compensation Protection § 3.959 Tuberculosis. Any veteran who, on...) tuberculosis may receive compensation under 38 U.S.C. 1114(q) and 1156 as in effect before August 20, 1968...
USDA-ARS?s Scientific Manuscript database
The honey bee (Apis mellifera) contributes approximately $17 billion annually in pollination services performed for major agricultural crops in the United States including almond, which is completely dependent on honey bee pollination for nut set. Almond growers face challenges to crop productivity ...
W. J. Bond; Robert Keane
2017-01-01
Fire is both a natural and anthropogenic disturbance influencing the distribution, structure, and functioning of terrestrial ecosystems around the world. Many plants and animals depend on fire for their continued existence. Others species, such as rainforest plants species, are extremely intolerant of burning and need protection from fire. The properties of a fire...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2014-07-01 2014-07-01 false Tuberculosis. 3.959..., Compensation, and Dependency and Indemnity Compensation Protection § 3.959 Tuberculosis. Any veteran who, on...) tuberculosis may receive compensation under 38 U.S.C. 1114(q) and 1156 as in effect before August 20, 1968...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2011-07-01 2011-07-01 false Tuberculosis. 3.959..., Compensation, and Dependency and Indemnity Compensation Protection § 3.959 Tuberculosis. Any veteran who, on...) tuberculosis may receive compensation under 38 U.S.C. 1114(q) and 1156 as in effect before August 20, 1968...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2012-07-01 2012-07-01 false Tuberculosis. 3.959..., Compensation, and Dependency and Indemnity Compensation Protection § 3.959 Tuberculosis. Any veteran who, on...) tuberculosis may receive compensation under 38 U.S.C. 1114(q) and 1156 as in effect before August 20, 1968...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2013-07-01 2013-07-01 false Tuberculosis. 3.959..., Compensation, and Dependency and Indemnity Compensation Protection § 3.959 Tuberculosis. Any veteran who, on...) tuberculosis may receive compensation under 38 U.S.C. 1114(q) and 1156 as in effect before August 20, 1968...
Deans, J. A.; Cohen, S.
1979-01-01
The identification of malarial antigens that induce protective immunity could provide a rational basis for developing an effective antimalarial vaccine as well as specific serodiagnostic tests indicative of clinical immune status. Since protective immunity is probably induced by stage-dependent rather than stage-independent antigens, the antigenic composition of different stages of Plasmodium knowlesi has been compared, and a limited chemical characterization undertaken. This information should provide some insight into the types of preparative procedure appropriate for the purification of functionally important malarial antigens. PMID:120777
A Case Study on the Development and Implementation of Cyber Capabilities in the United States
ERIC Educational Resources Information Center
Walton, Marquetta
2016-01-01
The effectiveness of U.S. cyber-capabilities can have a serious effect on the cyber-security stance of the US and significantly impact how well U.S. critical infrastructures are protected. The problem is that the state of the U.S. cyber-security could be negatively impacted by the dependency that the US displays in its use of defensive…
2013-01-29
Time- dependence of calculated LD50. The data shown in Panel A were submitted to probit analysis to determine the LD50 of ricin at every 0.5-day...degenerate neutrophils and necrotic debris evident; (C) Only a limited region of the epithelium lining a bronchus remains viable (arrowheads); the...quantitative analysis of the dose dependent protective effects of the immunizations. All vaccine doses (2.5, 10 or 40 μg immunogen) resulted in significant
Anti-Aging Potential of Phytoextract Loaded-Pharmaceutical Creams for Human Skin Cell Longetivity
Karim, Sabiha; Asad, Muhammad Hassham Hassan Bin; Kalsoom Khan, Abida; Malik, Arif; Chen, Chunye
2015-01-01
The exposure to ultraviolet radiations (UVR) is the key source of skin sunburn; it may produce harmful entities, reactive oxygen species (ROS), leading to aging. The skin can be treated and protected from the injurious effects of ROS by using various pharmaceutical formulations, such as cream. Cream can be loaded with antioxidants to quench ROS leading to photo-protective effects. Moreover, modern medicines depend on ethnobotanicals for protection or treatment of human diseases. This review article summarizes various in vivo antioxidant studies on herbal creams loaded with phyto-extracts. These formulations may serve as cosmeceuticals to protect skin against injurious effects of UVR. The botanicals studied for dermatologic use in cream form include Acacia nilotica, Benincasa hispida, Calendula officinalis, Camellia sinensis, Camellia sinensis, Nelumbo nucifera, Capparis decidua, Castanea sativa, Coffea arabica, Crocus sativus, Emblica officinalis Gaertn, Foeniculum vulgare, Hippophae rhamnoides, Lithospermum erythrorhizon, Malus domestica, Matricaria chamomilla L., Moringa oleifera, Morus alba, Ocimum basilicum, Oryza sativa, Polygonum minus, Punica granatum, Silybum marianum, Tagetes erecta Linn., Terminalia chebula, Trigonella foenum-graecum, and Vitis vinifera. The observed anti-aging effects of cream formulations could be an outcome of a coordinating action of multiple constituents. Of numerous botanicals, the phenolic acids and flavonoids appear effective against UVR-induced damage; however the evidence-based studies for their anti-aging effects are still needed. PMID:26448818
Lehmann, J; Bellmann, S; Werner, C; Schröder, R; Schütze, N; Alber, G
2001-11-01
To study a potential IL-12p40-dependent but IL-12p75-independent agonistic activity regulating the immune response against Salmonella Enteritidis, the course of infection in IL-12p35-deficient mice (IL-12p35(-/-), capable of producing IL-12p40) was compared with that of IL-12p40(-/-) mice. Mice lacking IL-12p40 revealed a higher mortality rate and higher bacterial organ burden than mice capable of producing IL-12p40. This phenotype was found in both genetically susceptible (BALB/c, Ity(s)) and resistant mice (129Sv/Ev, Ity(r)) indicating Ity-independent mechanisms. The more effective control of bacteria in the IL-12p35(-/-) mice was associated with elevated serum IFN-gamma and TNF-alpha levels. In contrast, IL-12p40(-/-) mice showed reduced IFN-gamma production, which was associated with significantly elevated serum IgE levels. Early during infection (days 3 and 4 postinfection), as well as late (day 20 postinfection), the number of infected phagocytes was strongly increased in the absence of IL-12p40 indicating impaired bactericidal activity when IL-12p40 was missing. Liver histopathology revealed a decreased number of mononuclear granulomas in IL-12p40(-/-) mice. Depletion of CD4(+) or CD8(+) T lymphocytes in vivo suggested that both T cell subpopulations contribute to the IL-12p40-dependent protective functions. Analysis of IL-12p40 vs IL-23p19 mRNA expression revealed an up-regulation of only IL-12p40 mRNA during Salmonella infection. Together these data indicate that IL-12p40 can induce protective mechanisms during both the innate and the adaptive type 1 immune response in Salmonella infection. This novel activity of IL-12p40 complements the well described dominant and essential role of IL-12p75 in protective immunity to Salmonella infection.
Wang, Hong; Sim, Meng-Kwoon; Loke, Weng Keong; Chinnathambi, Arunachalam; Alharbi, Sulaiman Ali; Tang, Feng Ru; Sethi, Gautam
2017-01-01
This study was aimed to evaluate the possible protective effects of ursolic acid (UA) against gamma radiation induced damage both in vitro as well as in vivo. It was observed that the exposure to gamma radiation dose- and time-dependently caused a significant decrease in the cell viability, while the treatment of UA attenuated this cytotoxicity. The production of free radicals including reactive oxygen species (ROS) and NO increased significantly post-irradiation and further induced lipid peroxidation and oxidative DNA damage in cells. These deleterious effects could also be effectively blocked by UA treatment. In addition, UA also reversed gamma irradiation induced inflammatory responses, as indicated by the decreased production of TNF-α, IL-6, and IL-1β. NF-κB signaling pathway has been reported to be a key mediator involved in gamma radiation-induced cellular damage. Our results further demonstrated that gamma radiation dose- and time-dependently enhanced NF-κB DNA binding activity, which was significantly attenuated upon UA treatment. The post-irradiation increase in the expression of both phospho-p65, and phospho-IκBα was also blocked by UA. Moreover, the treatment of UA was found to significantly prolong overall survival in mice exposed to whole body gamma irradiation, and reduce the excessive inflammatory responses. Given its radioprotective efficacy as described here, UA as an antioxidant and NF-κB pathway blocker, may function as an important pharmacological agent in protecting against gamma irradiation-induced injury. PMID:28670276
Winfree, C J; Coombs, D W; DeLeo, J A; Colburn, R W
1992-01-01
Recent studies in animals have demonstrated that the steroid, 3 alpha-hydroxy-5 alpha-pregnan-20-one (3A5P), is a potent analgesic when given intracerebroventricularly. Several studies in humans report that spinal steroids are effective in the treatment of chronic low-back pain when given in combination with morphine. The spinal antinociceptive effect of steroids, in particular a progesterone metabolite has not been studied in a visceral pain model. The experiments in the following study were designed to test, first, if the intrathecally-administered (i.t.) steroid, 3A5P, has analgesic properties in a mechanical visceral nociceptive assay, and second, if the intrathecal coadministration of this steroid and morphine is more effective than either therapy alone. Our mechanical visceral pain model (VPM) consists of a chronic indwelling duodenal balloon catheter implanted in the rat. The balloon is inflated to elicit a writhing response. Protection values are defined as the percentage of rats in each group which did not writhe. In this model, 3A5P was found to provide a dose-independent, though significant (p less than 0.01), antinociception when administered alone (33-67% protection vs. 0-25% for controls). Yet, protection offered by the coadministration of 3A5P and morphine (79%) was not significantly greater than that offered by morphine alone (85%). Unlike a dose and time-dependent response observed in a thermal cutaneous nociceptive assay, the antinociception of 3A5P was not dose-dependent when challenged with a mechanical visceral noxious stimulus.
Evaluation of jamming efficiency for the protection of a single ground object
NASA Astrophysics Data System (ADS)
Matuszewski, Jan
2018-04-01
The electronic countermeasures (ECM) include methods to completely prevent or restrict the effective use of the electromagnetic spectrum by the opponent. The most widespread means of disorganizing the operation of electronic devices is to create active and passive radio-electronic jamming. The paper presents the way of jamming efficiency calculations for protecting ground objects against the radars mounted on the airborne platforms. The basic mathematical formulas for calculating the efficiency of active radar jamming are presented. The numerical calculations for ground object protection are made for two different electronic warfare scenarios: the jammer is placed very closely and in a determined distance from the protecting object. The results of these calculations are presented in the appropriate figures showing the minimal distance of effective jamming. The realization of effective radar jamming in electronic warfare systems depends mainly on the precise knowledge of radar and the jammer's technical parameters, the distance between them, the assumed value of the degradation coefficient, the conditions of electromagnetic energy propagation and the applied jamming method. The conclusions from these calculations facilitate making a decision regarding how jamming should be conducted to achieve high efficiency during the electronic warfare training.
Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Giannini, Valentina; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta
2012-01-01
Isoflavones exist in nature predominantly as glucosides such as daidzin or genistin and are rarely found in their corresponding aglycone forms daidzein and genistein. The metabolism and absorption of isoflavones ingested with food is well documented, but little is known about their use as topical photo-protective agents. The aim of this study was to investigate in a comparative analysis the photo-protective effects of isoflavones in both their aglycone and glucoside forms. In human skin fibroblasts irradiated with 60 mJ/cm2 ultraviolet B (UVB), we measured the expression levels of COX-2 and Gadd45, which are involved in inflammation and DNA repair, respectively. We also determined the cellular response to UVB-induced DNA damage using the comet assay. Our findings suggest that both the isoflavone glucosides at a specific concentration and combination with an aglycone mixture exerted an anti-inflammatory and photo-protective effect that prevented 41% and 71% of UVB-induced DNA damage, respectively. The advantages of using either isoflavone glucosides or an aglycone mixture in applications in the field of dermatology will depend on their properties and their different potential uses. PMID:23211668
Edaravone suppresses degradation of type II collagen.
Huang, Chen; Liao, Guangjun; Han, Jian; Zhang, Guofeng; Zou, Benguo
2016-05-13
Osteoarthritis (OA) is a degenerative joint disease affecting millions of people. The degradation and loss of type II collagen induced by proinflammatory cytokines secreted by chondrocytes, such as factor-α (TNF-α) is an important pathological mechanism to the progression of OA. Edaravone is a potent free radical scavenger, which has been clinically used to treat the neuronal damage following acute ischemic stroke. However, whether Edaravone has a protective effect in articular cartilage hasn't been reported before. In this study, we investigated the chondrocyte protective effects of Edaravone on TNF-α induced degradation of type Ⅱ collagen. And our results indicated that TNF-α treatment resulted in degradation of type Ⅱ collagen, which can be ameliorated by treatment with Edaravone in a dose dependent manner. Notably, it was found that the inhibitory effects of Edaravone on TNF-α-induced reduction of type Ⅱ collagen were mediated by MMP-3 and MMP-13. Mechanistically, we found that Edaravone alleviated TNF-α induced activation of STAT1 and expression of IRF-1. These findings suggest a potential protective effect of Edaravone in OA. Copyright © 2016. Published by Elsevier Inc.
Kefiran antagonizes cytopathic effects of Bacillus cereus extracellular factors.
Medrano, Micaela; Pérez, Pablo Fernando; Abraham, Analía Graciela
2008-02-29
Kefiran, the polysaccharide produced by microorganisms present in kefir grains, is a water-soluble branched glucogalactan containing equal amounts of D-glucose and D-galactose. In this study, the effect of kefiran on the biological activity of Bacillus cereus strain B10502 extracellular factors was assessed by using cultured human enterocytes (Caco-2 cells) and human erythrocytes. In the presence of kefiran concentrations ranging from 300 to 1000 mg/L, the ability of B. cereus B10502 spent culture supernatants to detach and damage cultured human enterocytes was significantly abrogated. In addition, mitochondrial dehydrogenase activity was higher when kefiran was present during the cell toxicity assays. Protection was also demonstrated in hemolysis and apoptosis/necrosis assays. Scanning electron microscopy showed the protective effect of kefiran against structural cell damages produced by factors synthesized by B. cereus strain B10502. Protective effect of kefiran depended on strain of B. cereus. Our findings demonstrate the ability of kefiran to antagonize key events of B. cereus B10502 virulence. This property, although strain-specific, gives new perspectives for the role of bacterial exopolysaccharides in functional foods.
Protective effect of grape seed extracts on human lymphocytes: a preliminary study.
Szeto, Yim Tong; Lee, Kit Yee; Kalle, Wouter; Pak, Sok Cheon
2013-03-01
Grape seed extracts (GSEs) possess a broad spectrum of antioxidative properties that protects various cells from free radicals and oxidative stress. In this study, the genoprotective effect of GSE on human lymphocytic DNA was studied using standard and lysed cell comet assays. Lymphocytes from 5 healthy subjects were pretreated with GSE in different concentrations. The standard and lysed cell comet assays were performed on treated, untreated, challenged, and unchallenged cells in parallel. Cells were then subjected to an oxidant challenge induced with 5-min exposures to hydrogen peroxide. In the standard comet assay, GSE significantly diminished hydrogen-peroxide-induced DNA damage in a dose-dependent manner. In the lysed cell assay, however, the antioxidant effect was diminished at a higher GSE concentration. Data indicate that the cell membrane might play a role in limiting cellular access to antioxidants, which directly affects the genoprotective or potential pro-oxidant effect of antioxidants on human DNA. Using both standard and lysed cell comet assays in parallel could be a useful way to elucidate the mechanism of protection or damage by antioxidants.
Liu, Lei; Gao, Yanxiang; McClements, David Julian; Decker, Eric Andrew
2016-11-01
The chemical instability of β-carotene limits its utilization as a nutraceutical ingredient in foods. In this research, the effect of continuous phase alpha-lactalbumin (α-LA) and (-)-epigallocatechin-3-gallate (EGCG) on β-carotene degradation in medium chain triacylglycerol (MCT)- and corn oil-in-water emulsions was examined. EGCG significantly inhibited β-carotene degradation in both MCT and corn oil-in-water emulsions in a dose dependent manner. α-LA was not able to protect β-carotene in MCT emulsions and the combination of EGCG and α-LA had a similar effect as EGCG alone. EGCG had no effect on lipid oxidation in corn oil-in-water emulsions but can protect β-carotene. β-Carotene was more stable in corn oil emulsions stabilized by α-LA compared to emulsions stabilized by Tween 20. These results show that EGCG is effective at protecting β-carotene in different emulsion systems without negatively impacting lipid oxidation suggesting that it could be utilized to increase the incorporation of β-carotene into food emulsions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wright, Laura E; Frye, Jennifer B; Timmermann, Barbara N; Funk, Janet L
2010-09-08
Extracts prepared from turmeric (Curcuma longa L., [Zingiberaceae]) containing bioactive phenolic curcuminoids were evaluated for bone-protective effects in a hypogonadal rat model of postmenopausal osteoporosis. Three-month female Sprague-Dawley rats were ovariectomized (OVX) and treated with a chemically complex turmeric fraction (41% curcuminoids by weight) or a curcuminoid-enriched turmeric fraction (94% curcuminoids by weight), both dosed at 60 mg/kg 3x per week, or vehicle alone. Effects of two months of treatment on OVX-induced bone loss were followed prospectively by serial assessment of bone mineral density (BMD) of the distal femur using dual-energy X-ray absorptiometry (DXA), while treatment effects on trabecular bone microarchitecture were assessed at two months by microcomputerized tomography (microCT). Chemically complex turmeric did not prevent bone loss, however, the curcuminoid-enriched turmeric prevented up to 50% of OVX-induced loss of trabecular bone and also preserved the number and connectedness of the strut-like trabeculae. These results suggest that turmeric may have bone-protective effects but that extract composition is a critical factor.
Wright, Laura E.; Frye, Jennifer B.; Timmermann, Barbara N.; Funk, Janet L.
2010-01-01
Extracts prepared from turmeric (Curcuma longa L., [Zingiberaceae]) containing bioactive phenolic curcuminoids were evaluated for bone-protective effects in a hypogonadal rat model of postmenopausal osteoporosis. Three-month female Sprague Dawley rats were ovariectomized (OVX) and treated with a chemically complex turmeric fraction (41% curcuminoids by weight) or a curcuminoid-enriched turmeric fraction (94% curcuminoids by weight), both dosed at 60mg/kg 3x per week, or vehicle alone. Effects of two months of treatment on OVX-induced bone loss were followed prospectively by serial assessment of bone mineral density (BMD) of the distal femur using dual-energy x-ray absorptiometry (DXA), while treatment effects on trabecular bone microarchitecture were assessed at two months by micro-computerized tomography (μCT). Chemically complex turmeric did not prevent bone loss, however, the curcuminoid-enriched turmeric prevented up to 50% of OVX-induced loss of trabecular bone and also preserved the number and connectedness of the strut-like trabeculae. These results suggest that turmeric may have bone-protective effects but that extract composition is a critical factor. PMID:20695490
Hu, Qing-Ping; Cao, Xin-Ming; Hao, Dong-Lin; Zhang, Liang-Liang
2017-01-01
Cyperus rotundus L. (Cyperaceae) is a medicinal herb traditionally used to treat various clinical conditions at home. In this study, chemical composition of Cyperus rotundus rhizomes essential oil, and in vitro antioxidant, DNA damage protective and cytotoxic activities as well as antibacterial activity against foodborne pathogens were investigated. Results showed that α-cyperone (38.46%), cyperene (12.84%) and α-selinene (11.66%) were the major components of the essential oil. The essential oil had an excellent antioxidant activity, the protective effect against DNA damage, and cytotoxic effects on the human neuroblastoma SH-SY5Y cell, as well as antibacterial activity against several foodborne pathogens. These biological activities were dose-dependent, increasing with higher dosage in a certain concentration range. The antibacterial effects of essential oil were greater against Gram-positive bacteria as compared to Gram-negative bacteria, and the antibacterial effects were significantly influenced by incubation time and concentration. These results may provide biological evidence for the practical application of the C. rotundus rhizomes essential oil in food and pharmaceutical industries. PMID:28338066
NASA Astrophysics Data System (ADS)
Rodak, C. M.; Silliman, S. E.; Bolster, D.
2012-12-01
A hypothetical case study of groundwater contaminant protection was carried out using time-dependent health risk calculations. The case study focuses on a hypothetical zoning project for parcels of land around a well field in northern Indiana, where the control of cancer risk relative to a mandated cancer risk threshold is of concern in the management strategy. Within our analysis, we include both uncertainty in the subsurface transport and variability in population behavior in the calculation of time-dependent health risks. From these results we introduce risk maps, a visual representation of the probability of an unacceptable health risk as a function of population behavior and the time at which exposure to the contaminant begins. We also evaluate the time-dependent risks with three criteria from water resource literature: reliability, resilience, and vulnerability (RRV). With respect to health risk from a groundwater well, the three criteria determine: the probability that a well produces safe water (reliability), the probability that a contaminated well returns to an uncontaminated state within a specified time interval (resilience), and the overall severity in terms of health impact of the contamination at a well head (vulnerability). The results demonstrate that the distributions of RRV values for each parcel of land are linked to the time-dependent concentration profile of the contaminant at the well, and the toxicological characteristics of the contaminant. The proposed time-dependent risk calculation expands on current techniques to include a continuous exposure start time, capable of reproducing the maximum risk while providing information on the severity and duration of health risks. Overall this study suggests that, especially in light of the inherent complexity of health-groundwater systems, RRV are viable criteria for relatively simple and effective evaluation of time-dependent health risk. It is argued that the RRV approach, as applied to consideration of potential health impact, allows for more informed, health-based decisions regarding zoning for wellhead protection.
Blumenfeld, H J; Tohn, R; Haeryfar, S M M; Liu, Y; Savage, P B; Delovitch, T L
2011-01-01
Because invariant natural killer T (iNK T) cells link innate and adaptive immunity, the structure-dependent design of iNK T cell agonists may have therapeutic value as vaccines for many indications, including autoimmune disease. Previously, we showed that treatment of non-obese diabetic (NOD) mice with the iNK T cell activating prototypic glycolipid α-galactosylceramide (α-GalCer) protects them from type 1 diabetes (T1D). However, α-GalCer is a strong agonist that can hyperactivate iNK T cells, elicit several side effects and has shown only limited success in clinical trials. Here, we used a structure-guided design approach to identify an iNK T cell agonist that optimally protects from T1D with minimal side effects. Analyses of the kinetics and function of a panel of synthetic α-GalCer fatty acyl chain derivatives (C8:0-C16:0) were performed in NOD mice. C16:0 elicited the highest protection from insulitis and T1D, which was associated with a higher frequency and survival of iNK T cells and enhanced activity of tolerogenic dendritic cells (DCs) in draining pancreatic lymph nodes (PLN), inability to transactivate NK cells and a more rapid kinetics of induction and recovery of iNK T cells from anergy. We conclude that the length and structure of the acyl chain of α-GalCer regulates the level of protection against T1D in mice, and propose that the extent of this protection depends on the relative capacity of the acyl chain to accommodate an endogenous spacer lipid of appropriate length and structure. Thus, our findings with the α-GalCer C16:0 derivative suggest strongly that it be considered as a lead glycolipid candidate in clinical trials of T1D. PMID:21910729
Chen, Ta-Fu; Tang, Ming-Chi; Chou, Chia-Hui; Chiu, Ming-Jang; Huang, R-F S
2013-12-01
Increased dietary folic acid (FA) is associated with reduced risks of Alzheimer's disease (AD). The AD drug memantine (Mn) has had limited therapeutic effects for the treatment of patients with moderate to severe AD. This study investigated whether and the underlying mechanisms by which the combination of Mn and FA may have synergistic or additive effects in protecting against amyloid-β(25-35) peptide (Aβ)-induced neurocytotoxicity. Aβ treatment of human neuroblastoma SH-SY5Y cells significantly induced a 6-fold increase of apoptotic cells compared with the Aβ-untreated group. Preincubation of Aβ-exposed cells with FA (500 μM) or Mn (20 μM) caused a 22% and 10% reduction of apoptotic cells, respectively, whereas the combo-treatments at such doses synergistically alleviated Aβ-induced apoptosis by 60% (P<0.05). The apoptotic protection by the combo-treatments coincided with attenuating Aβ-elicited mitochondrial (mt) membrane depolarization and abolishing Aβ-induced mt cytochrome c release to the cytosol. Increased levels of FA at 1000 μM in combination with 20 μM Mn exerted an additive protection against Aβ(25-35)-induced-apoptosis as compared to the isolate Mn group (P<0.05). The combo-treatments reversed Aβ-elicited mt membrane depolarization, attenuated Aβ-elicited mt cytochrome c release to the cytosol, and diminished Aβ-promoted superoxide generation. The apoptotic-protection by such combo-treatments was partially abolished by carbonyl cyanide 3-chlorophenylhydrazone (mt membrane potential uncoupler) and sodium azide (mt cytochrome c oxidase inhibitor). Taken together, the data demonstrated that dose-dependent FA and Mn synergistically or additively protected SH-SY5Y cells against Aβ-induced apoptosis, which was partially, if not completely, mediated by mt stress-associated death signals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Current status of photoprotection by window glass, automobile glass, window films, and sunglasses.
Almutawa, Fahad; Vandal, Robert; Wang, Steven Q; Lim, Henry W
2013-04-01
Ultraviolet radiation (UVR) has known adverse effects on the skin and eyes. Practitioners are becoming more aware of the importance of outdoor photoprotection. However, little attention is directed to the exposure of the skin and eyes to UVR through the window glass or sunglasses. The amount of ultraviolet transmission through glass depends mainly on the type of the glass. All types of commercial and automobile glass block the majority of ultraviolet-B; however, the degree of ultraviolet-A transmission depends on the type of glass. Laminated glass offers better UVA protection than tempered glass; new safety regulations for automobiles may result in increased use of laminated glass for side windows. Window films can be applied to glass to increase UVR protection. Sunglasses need to be compliant with one of the national standards; a wraparound style or side shields offer the best protection. Increased understanding by practitioners on the transmission of UVR through glass, window films, and sunglasses would allow them to better educate the public and to better manage photosensitive patients. © 2013 John Wiley & Sons A/S.
Artificial reef effect in relation to offshore renewable energy conversion: state of the art.
Langhamer, Olivia
2012-01-01
The rapid worldwide growth of offshore renewable energy production will provide marine organisms with new hard substrate for colonization, thus acting as artificial reefs. The artificial reef effect is important when constructing, for example, scour protections since it can generate an enhanced habitat. Specifically, artificial structures can create increased heterogeneity in the area important for species diversity and density. Offshore energy installations also have the positive side effect as they are a sanctuary area for trawled organisms. Higher survival of fish and bigger fish is an expected outcome that can contribute to a spillover to outer areas. One negative side effect is that invasive species can find new habitats in artificial reefs and thus influence the native habitats and their associated environment negatively. Different scour protections in offshore wind farms can create new habitats compensating for habitat loss by offshore energy installations. These created habitats differ from the lost habitat in species composition substantially. A positive reef effect is dependent on the nature and the location of the reef and the characteristics of the native populations. An increase in surface area of scour protections by using specially designed material can also support the reef effect and its productivity.
Artificial Reef Effect in relation to Offshore Renewable Energy Conversion: State of the Art
2012-01-01
The rapid worldwide growth of offshore renewable energy production will provide marine organisms with new hard substrate for colonization, thus acting as artificial reefs. The artificial reef effect is important when constructing, for example, scour protections since it can generate an enhanced habitat. Specifically, artificial structures can create increased heterogeneity in the area important for species diversity and density. Offshore energy installations also have the positive side effect as they are a sanctuary area for trawled organisms. Higher survival of fish and bigger fish is an expected outcome that can contribute to a spillover to outer areas. One negative side effect is that invasive species can find new habitats in artificial reefs and thus influence the native habitats and their associated environment negatively. Different scour protections in offshore wind farms can create new habitats compensating for habitat loss by offshore energy installations. These created habitats differ from the lost habitat in species composition substantially. A positive reef effect is dependent on the nature and the location of the reef and the characteristics of the native populations. An increase in surface area of scour protections by using specially designed material can also support the reef effect and its productivity. PMID:23326215
NASA Astrophysics Data System (ADS)
Kim, Cheol-man; Kim, Woo-sik; Kho, Young-tai
2002-04-01
For the corrosion protection of natural gas transmission pipelines, two methods are used, cathodic protection and a coating technique. In the case of cathodic protection, defects are embrittled by hydrogen occurring at crack tips or surfaces of materials. It is, however, very important to evaluate whether cracks in the embrittled area can grow or not, especially in weld metal. In this work, on the basis of elastic plastic fracture mechanics, we performed CTOD testing under various test conditions, such as potential and current density. The CTOD of the base steel and weld metal showed a strong dependence on the test conditions. The CTOD decreased with increasing cathodic potential and current density. The morphology of the fracture surface showed quasi-cleavage. Cathodic overprotection results in hydrogen embrittlement at the crack tip.
Algar, Elena; Gutierrez-Mañero, F Javier; Garcia-Villaraco, Ana; García-Seco, Daniel; Lucas, J Antonio; Ramos-Solano, Beatriz
2014-09-01
Glycine max (L.) Merr. plays a crucial role in both the field of food and the pharmaceutical industry due to their input as plant protein and to the benefits of isoflavones (IF) for health. In addition, IF play a key role in nodulation and plant defense and therefore, an increase in IF would be desirable for better field performance. IF are secondary metabolites and therefore, inducible, so finding effective agents to increase IF contents is interesting. Among these agents, plant growth promoting rhizobacteria (PGPR) have been used to trigger systemic induction of plant's secondary metabolism through their microbe associated molecular patterns (MAMPs) that fit in the plant's receptors to start a systemic response. The aim of this study was to evaluate the ability of 4 PGPR that had a contrasted effect on IF metabolism, to protect plants against biotic stress and to establish the relation between IF profile and the systemic response triggered by the bacteria. Apparently, the response involves a lower sensitivity to ethylene and despite the decrease in effective photosynthesis, growth is only compromised in the case of M84, the most effective in protection. All strains protected soybean against Xanthomonas axonopodis pv. glycines (M84 > N5.18 > Aur9>N21.4) and only M84 and N5.18 involved IF. N5.18 stimulated accumulation of IF before pathogen challenge. M84 caused a significant increase on IF only after pathogen challenge and N21.4 caused a significant increase on IF content irrespective of pathogen challenge. Aur9 did not affect IF. These results point out that all 4 strains have MAMPs that trigger defensive metabolism in soybean. Protection induced by N21.4 and Aur9 involves other metabolites different to IF and the role of IF in defence depends on the previous metabolic status of the plant and on the bacterial MAMP. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Moussavian, Mohammed R; Slotta, Jan E; Kollmar, Otto; Menger, Michael D; Gronow, Gernot; Schilling, Martin K
2008-05-01
Cellular stress during reoxygenation is a common phenomenon in solid organ transplantation and is characterized by production of reactive oxygen species. Herein, we studied in isolated tubular segments of rat kidney cortex the impact of oxygen radical scavengers and an iron chelator on post-hypoxic recovery. Tubules, suspended in Ringer's solution containing 5 mM glycine, underwent 30 min hypoxia and 60 min reoxygenation. Untreated tubules served as controls. Hypoxia-reoxygenation injury was measured by membrane leakage, lipid peroxidation and cellular functions. In hypoxia-reoxygenated-isolated tubular segments, protective effects of different scavengers and of the iron chelator deferoxamine on hypoxia-reoxygenation injury were analyzed. Scavengers protected isolated tubular segments from hypoxia-reoxygenation-induced cellular disintegration and dysfunction. Deferoxamine was found to exert the most distinct protection. It was further found to exert a dose-dependent protection on hypoxia-reoxygenation damage in isolated tubular segments, which was critically mediated by chelating tissue and bond iron. Our data demonstrate that radical scavengers effectively protect from hypoxia-reoxygenation injury in isolated tubular segments and that the iron chelator deferoxamine is especially a potent inhibitor of iron ion-mediated hypoxia-reoxygenation damage. Thus, inclusion of this iron chelator in organ storage solutions might improve post-transplant organ function and protect from reperfusion injury.
Pan, Lei; Zhou, Ying; Li, Xiu-Fang; Wan, Qing-Jia; Yu, Le-Hua
2017-04-01
Astaxanthin, a natural antioxidant carotenoid, has been shown to reduce cerebral ischemic injury in rodents. However, there have not been any studies specifically addressing whether preventive administration of astaxanthin can protect against cerebral ischemia. The purpose of this study was to examine whether pretreatment of astaxanthin can protect against ischemic injuries in the adult rats. The rats were pre-administered intragastrically with astaxanthin for seven days (once a day), and middle cerebral artery occlusion was performed at 1h after the final administration. It was found that astaxanthin prevented neurological deficits and reduced cerebral infarction volume. To evaluate the mechanisms underlying this protection, brain tissues were assayed for free radical damage, antioxidant gene expression, cell apoptosis and regeneration. The results showed that the mechanisms involved suppression of reactive oxygen species, activation of antioxidant defense pathway, and inhibition of apoptosis as well as promotion of neural regeneration. Astaxanthin did not alter body weights and the protective effect was found to be dose-dependent. Collectively, our data suggest that pretreatment of astaxanthin can protect against ischemia-related damages in brain tissue through multiple mechanisms, hinting that astaxanthin may have significant protective effects for patients vulnerable or prone to ischemic events. Copyright © 2017 Elsevier Inc. All rights reserved.
Printz, Gordana; Yoshio, Hiroyuki; Alvelius, Gunvor; Lagercrantz, Hugo; Strömberg, Roger; Jörnvall, Hans; Gudmundsson, Gudmundur H.; Agerberth, Birgitta
2013-01-01
Postpartum, infants have not yet established a fully functional adaptive immune system and are at risk of acquiring infections. Hence, newborns are dependent on the innate immune system with its antimicrobial peptides (AMPs) and proteins expressed at epithelial surfaces. Several factors in breast milk are known to confer immune protection, but which the decisive factors are and through which manner they work is unknown. Here, we isolated an AMP-inducing factor from human milk and identified it by electrospray mass spectrometry and NMR to be lactose. It induces the gene (CAMP) that encodes the only human cathelicidin LL-37 in colonic epithelial cells in a dose- and time-dependent manner. The induction was suppressed by two different p38 antagonists, indicating an effect via the p38-dependent pathway. Lactose also induced CAMP in the colonic epithelial cell line T84 and in THP-1 monocytes and macrophages. It further exhibited a synergistic effect with butyrate and phenylbutyrate on CAMP induction. Together, these results suggest an additional function of lactose in innate immunity by upregulating gastrointestinal AMPs that may lead to protection of the neonatal gut against pathogens and regulation of the microbiota of the infant. PMID:23326523
Dietary Phytochemicals Promote Health by Enhancing Antioxidant Defence in a Pig Model.
Selby-Pham, Sophie N B; Cottrell, Jeremy J; Dunshea, Frank R; Ng, Ken; Bennett, Louise E; Howell, Kate S
2017-07-14
Phytochemical-rich diets are protective against chronic diseases and mediate their protective effect by regulation of oxidative stress (OS). However, it is proposed that under some circumstances, phytochemicals can promote production of reactive oxygen species (ROS) in vitro, which might drive OS-mediated signalling. Here, we investigated the effects of administering single doses of extracts of red cabbage and grape skin to pigs. Blood samples taken at baseline and 30 min intervals for 4 hours following intake were analyzed by measures of antioxidant status in plasma, including Trolox equivalent antioxidant capacity (TEAC) and glutathione peroxidase (GPx) activity. In addition, dose-dependent production of hydrogen peroxide (H₂O₂) by the same extracts was measured in untreated commercial pig plasma in vitro. Plasma from treated pigs showed extract dose-dependent increases in non-enzymatic (plasma TEAC) and enzymatic (GPx) antioxidant capacities. Similarly, extract dose-dependent increases in H₂O₂ were observed in commercial pig plasma in vitro. The antioxidant responses to extracts by treated pigs were highly correlated with their respective yields of H₂O₂ production in vitro. These results support that dietary phytochemicals regulate OS via direct and indirect antioxidant mechanisms. The latter may be attributed to the ability to produce H₂O₂ and to thereby stimulate cellular antioxidant defence systems.
Error control techniques for satellite and space communications
NASA Technical Reports Server (NTRS)
Costello, Daniel J., Jr.
1994-01-01
The unequal error protection capabilities of convolutional and trellis codes are studied. In certain environments, a discrepancy in the amount of error protection placed on different information bits is desirable. Examples of environments which have data of varying importance are a number of speech coding algorithms, packet switched networks, multi-user systems, embedded coding systems, and high definition television. Encoders which provide more than one level of error protection to information bits are called unequal error protection (UEP) codes. In this work, the effective free distance vector, d, is defined as an alternative to the free distance as a primary performance parameter for UEP convolutional and trellis encoders. For a given (n, k), convolutional encoder, G, the effective free distance vector is defined as the k-dimensional vector d = (d(sub 0), d(sub 1), ..., d(sub k-1)), where d(sub j), the j(exp th) effective free distance, is the lowest Hamming weight among all code sequences that are generated by input sequences with at least one '1' in the j(exp th) position. It is shown that, although the free distance for a code is unique to the code and independent of the encoder realization, the effective distance vector is dependent on the encoder realization.
Administration Dependent Antioxidant Effect of Carica papaya Seeds Water Extract
Panzarini, Elisa; Dwikat, Majdi; Mariano, Stefania; Vergallo, Cristian; Dini, Luciana
2014-01-01
Carica papaya is widely used in folk medicine as herbal remedy to prevent, protect against, and cure several diseases. These curative properties are based on the presence in different parts of the plant of phytochemical nutrients with antioxidant effect. Seeds are the less exploited part; thus this study is aimed at assessing the antioxidant activities of the C. papaya seeds water extract against hydrogen peroxide (H2O2) oxidative stress in human skin Detroit 550 fibroblasts. C. papaya seeds water extract is not toxic and acts as a potent free radical scavenger, providing protection to Detroit 550 fibroblasts that underwent H2O2 oxidative stress. Data show that (i) the maximum protective effect is achieved by the simultaneous administration of the extract with 1 mM H2O2; (ii) the extract in presence of an oxidative stress does not increase catalase activity and prevents the release of cytochrome C and the inner mitochondrial transmembrane potential (Δψ m) loss; (iii) the extract is more efficient than vitamin C to hamper the oxidative damage; (iv) the purified subfractions of the seeds water extract exert the same antioxidant effect of whole extract. In conclusion, C. papaya seeds water extract is potentially useful for protection against oxidative stress. PMID:24795765
Zhang, Chao; Wang, Deng-Feng; Zhang, Zhuang; Han, Dong; Yang, Kan
2017-03-28
Ginkgo bilob a extract (EGb 761) has been widely used clinically to reduce myocardial ischemia reperfusion injury (MIRI). Microvascular endothelial cells (MVECs) may be a proper cellular model in vitro for the effect and mechanism study against MIRI. However, the protective effect of EGb 761 on MVECs resisting hypoxia/reoxygenation (H/R) injury is little reported. In this study, H/R-injured MVECs were treated with EGb 761, and then the cell viability, apoptosis, ROS production, SOD activity, caspase-3 activity, and protein level of ATM, γ-H2AX, p53, and Bax were measured. ATM siRNA was transfected to study the changes of protein in the ATM pathway. EGb 761 presented protective effect on H/R-injured MVECs, with decreasing cell death, apoptosis, and ROS, and elevated SOD activity. Next, EGb 761 could inhibit H/R-induced ATM, γ-H2AX, p53, and Bax in a dose-dependent manner. Moreover, ATM siRNA also could inhibit H/R-induced ATM, γ-H2AX, p53, and Bax. Overall, these findings verify that EGb 761 protects cardiac MVECs from H/R injury, and for the first time, illustrate the influence on the ATM pathway and apoptosis by EGb 761 via dampening ROS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nanao-Hamai, Michiko; Son, Bo-Kyung; Institute of Gerontology, The University of Tokyo, Tokyo
Vascular calcification is one of the major complications of cardiovascular disease and is an independent risk factor for myocardial infarction and cardiac death. Postmenopausal women have a higher prevalence of vascular calcification compared with premenopausal women, suggesting protective effects of estrogen (E2). However, the underlying mechanisms of its beneficial effects remain unclear. In the present study, we examined the inhibitory effects of E2 on vascular smooth muscle cell (VSMC) calcification, and found that growth arrest-specific gene 6 (Gas6), a crucial molecule in vascular calcification, is transactivated by estrogen receptor α (ERα) in response to E2. In human aortic smooth musclemore » cells, physiological levels of E2 inhibited inorganic phosphate (Pi)-induced calcification in a concentration-dependent manner. This inhibitory effect was significantly abolished by MPP, an ERα-selective antagonist, and ERα siRNA, but not by PHTPP, an ERβ-selective antagonist, and ERβ siRNA, implicating an ERα-dependent action. Apoptosis, an essential process for Pi-induced VSMC calcification, was inhibited by E2 in a concentration-dependent manner and further, MPP abolished this inhibition. Mechanistically, E2 restored the inhibited expression of Gas6 and phospho-Akt in Pi-induced apoptosis through ERα. Furthermore, E2 significantly activated Gas6 transcription, and MPP abrogated this E2-dependent Gas6 transactivation. E2-BSA failed to activate Gas6 transcription and to inhibit Ca deposition in VSMC, suggesting beneficial actions of genomic signaling by E2/nuclear ERα. Taken together, these results indicate that E2 exerts inhibitory effects on VSMC apoptosis and calcification through ERα-mediated Gas6 transactivation. These findings indicate a potential therapeutic strategy for the prevention of vascular calcification, especially in postmenopausal women. - Highlights: • E2 inhibits Pi-induced calcification in vascular smooth muscles cells. • E2 inhibits Pi-induced apoptosis by restoration of Gas6-mediated survival pathway. • Gas6 transactivation by E2 is mediated by ERα.« less
Newman, Amy E M; Foerster, Melody; Shoemaker, Kelly L; Robertson, R Meldrum
2003-11-01
Ventilation is a crucial motor activity that provides organisms with an adequate circulation of respiratory gases. For animals that exist in harsh environments, an important goal is to protect ventilation under extreme conditions. Heat shock, anoxia, and cold shock are environmental stresses that have previously been shown to trigger protective responses. We used the locust to examine stress-induced thermotolerance by monitoring the ability of the central nervous system to generate ventilatory motor patterns during a subsequent heat exposure. Preparations from pre-stressed animals had an increased incidence of motor pattern recovery following heat-induced failure, however, prior stress did not alter the characteristics of the ventilatory motor pattern. During constant heat exposure at sub-lethal temperatures, we observed a protective effect of heat shock pre-treatment. Serotonin application had similar effects on motor patterns when compared to prior heat shock. These studies are consistent with previous studies that indicate prior exposure to extreme temperatures and hypoxia can protect neural operation against high temperature stress. They further suggest that the protective mechanism is a time-dependent process best revealed during prolonged exposure to extreme temperatures and is mediated by a neuromodulator such as serotonin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Onopiuk, Marta; Wierzbicka, Katarzyna; Brutkowski, Wojciech
Activation of T-cells triggers store-operated Ca{sup 2+} entry, which begins a signaling cascade leading to induction of appropriate gene expression and eventually lymphocyte proliferation and differentiation. The simultaneous enhancement of Fas ligand gene expression in activated cells allows the immune response to be limited by committing the activated cells to apoptosis. In apoptotic cells the store-operated calcium entry is significantly inhibited. It has been documented that moderate activation of Fas receptor may cause reversible inhibition of store-operated channels by ceramide released from hydrolyzed sphingomyelin. Here we show that activation of Fas receptor in T-cells results in caspase-dependent decrease of cellularmore » STIM1 and Orai1 protein content. This effect may be responsible for the substantial inhibition of Ca{sup 2+} entry into Jurkat cells undergoing apoptosis. In turn, this inhibition might prevent overloading of cells with calcium and protect them against necrosis. -- Research highlights: {yields} Fas activation reduces STIM1 and Orai1 protein content in caspase dependent manner. {yields} Fas activation partially reduces mitochondrial potential in caspase dependent manner. {yields} Fas stimulation inhibits of store-operated Ca{sup 2+} entry in caspase dependent manner. {yields} Inhibition of Ca{sup 2+} entry in apoptotic cells may protect them from secondary necrosis.« less
Mok, Jee Won; Chang, Dong-Jin; Joo, Choun-Ki
2014-11-01
To describe the protective effect of anthocyanin from black soybean in human lens epithelial cell line (HLE-B3) under H2O2-induced oxidative stress. Cytotoxicity of anthocyanin and H2O2 were determined by Cell Counting Kit-8 test. Viability of HLE-B3 cells under various H2O2 concentration (0, 50 and 100 μM) with or without pretreatment of anthocyanin (0, 50, 100 and 200 μg/ml) was measured. After quantifying the percentage of the apoptosis by Annexin V assay and APO-BrdU TUNEL assay, we conducted western blot and immunostaining of apoptosis-related molecules; Bcl2, BAD, BAX, p53 and caspase-3. To confirm the effect of anthocyanin on an ex vivo model, its effect on cultures of the lenses of porcine were examined. Anthocyanin reduced cell death of HLE-B3 under H2O2-induced oxidative stress in a dose-dependent manner. In Annexin V analysis, anthocyanin protected HLE-B3 cells from apoptosis. H2O2 increased the expression of BAX, BAD, p53 and caspase-3 in a time-dependent manner, those of which anthocyanin significantly decreased. On the other hand, Bcl2 was increased from anthocyanin-treated lens cells. And in anthocyanin-treated lens organ culture, transparency was maintained. This study showed that anthocyanin protects HLE-B3 cells under oxidative stress from apoptosis, and the mechanism of the effect is related to the intrinsic pathway of apoptosis. Anthocyanin has a potential in prevention of cataract.
Szabo, Imre L.; Czimmer, Jozsef; Mozsik, Gyula
2016-01-01
Background The authors, as internists, registered significant difference in the long lasting actions of surgical and chemical (atropine treatment) vagotomy in patients with peptic ulcer during second half of the last century (efficency, gastric acid secretion, gastrointestinal side effects, briefly benefical and harmful actions were examined). Aims 1. Since the authors participated in the establishing of human clinical pharmacology in this field, they wanted to know more and more facts of the acute and chronic effects of surgical and chemical (atropine treatment) on the gastrointestinal mucosal biochemisms and their actions altered by bioactive compounds and scavengers regarding the development of gastric mucosal damage and protection. Methods The observations were carried out in animals under various experimental conditions (in intact, pylorus-ligated rats, in different experimental ulcer models, together with application of various mucosal protecting compounds) without and with surgical vagotomy and chemical vagotomy produced by atropine treatment. Results 1. No changes were obtained in the cellular energy systems (ATP, ADP, AMP, cAMP, “adenylate pool”, “energy charge“ [(ATP+ 0.5 ADP)/ (ATP+ADP+AMP)] of stomach (glandular part, forestomach) in pylorus ligated rats after surgical vagotomy in contrast to those produced by only chemical vagotomy; 2. The effects of the gastric mucosal protective compounds [atropine, cimetidine, prostaglandins, scavengers (like vitamin A, β-carotene), capsaicin] disappeared after surgical vagotomy; 3. The extents of different chemical agents induced mucosal damaging effects were enhanced by surgical vagotomy and was not altered by chemical vagotomy; 4. The existence of feedback mechanisms of pharmacological (cellular and intracellular) regulatory mechanisms between the membrane-bound ATP-dependent energy systems exists in the gastric mucosa of intact animals, and after chemical vagotomy, but not after surgical vagotomy. Conclusions 1. Increased vagal nerve activity takes place in the gastric mucosal damage; 2 both surgical and chemical vagotomy result mucosal protective affect on the gastric mucosal in different damaging experimental models; 3. The capsaicin-induced gastric mucosal damage depends on the applied doses, presence of anatomically intact vagal nerve (but independent from the chemical vagotomy), 4. The central and pheripheral neural regulations differ during gastric mucosal damage and protection induced by drugs, bioactive compounds, scavengers. PMID:27440445
2015-01-01
Numerous clinical and preclinical studies have suggested several health promoting effects for the dietary consumption of extra-virgin olive oil (EVOO) that could protect and decrease the risk of developing Alzheimer’s disease (AD). Moreover, recent studies have linked this protective effect to oleocanthal, a phenolic secoiridoid component of EVOO. This protective effect of oleocanthal against AD has been related to its ability to prevent amyloid-β (Aβ) and tau aggregation in vitro, and enhance Aβ clearance from the brains of wild type mice in vivo; however, its effect in a mouse model of AD is not known. In the current study, we investigated the effect of oleocanthal on pathological hallmarks of AD in TgSwDI, an animal model of AD. Mice treatment for 4 weeks with oleocanthal significantly decreased amyloid load in the hippocampal parenchyma and microvessels. This reduction was associated with enhanced cerebral clearance of Aβ across the blood-brain barrier (BBB). Further mechanistic studies demonstrated oleocanthal to increase the expression of important amyloid clearance proteins at the BBB including P-glycoprotein and LRP1, and to activate the ApoE-dependent amyloid clearance pathway in the mice brains. The anti-inflammatory effect of oleocanthal in the brains of these mice was also obvious where it was able to reduce astrocytes activation and IL-1β levels. Finally, we could recapitulate the observed protective effect of oleocanthal in an in vitro human-based model, which could argue against species difference in response to oleocanthal. In conclusion, findings from in vivo and in vitro studies provide further support for the protective effect of oleocanthal against the progression of AD. PMID:26348065
Skin cell protection against UVA by Sideroxyl, a new antioxidant complementary to sunscreens.
Pygmalion, Marie-Jocelyne; Ruiz, Laetitia; Popovic, Evelyne; Gizard, Julie; Portes, Pascal; Marat, Xavier; Lucet-Levannier, Karine; Muller, Benoit; Galey, Jean-Baptiste
2010-12-01
Oxidative stress resulting from photosensitized ROS production in skin is widely accepted as the main contributor to the deleterious effects of UVA exposure. Among the mechanisms known to be involved in UVA-induced oxidative damage, iron plays a central role. UVA radiation of skin cells induces an immediate release of iron, which can then act as a catalyst for uncontrolled oxidation reactions of cell components. Such site-specific damage can scarcely be counteracted by classical antioxidants. In contrast, iron chelators potentially offer an effective way to protect skin against UVA insults. However, iron chelation is very difficult to achieve without disturbing iron homeostasis or inducing iron depletion. A novel compound was developed to avoid these potentially harmful side effects. Sideroxyl was designed to acquire its strong chelating capability only during oxidative stress according to an original process of intramolecular hydroxylation. Herein, we describe in vitro results demonstrating the protective efficiency of Sideroxyl against deleterious effects of UVA at the molecular, cellular, and tissular levels. First, the Sideroxyl diacid form protects a model protein against UVA-induced photosensitized carbonylation. Second, intracellular ROS are dose-dependently decreased in the presence of Sideroxyl in both human cultured fibroblasts and human keratinocytes. Third, Sideroxyl protects normal human fibroblasts against UVA-induced DNA damage as measured by the comet assay and MMP-1 production. Finally, Sideroxyl provides protection against UVA-induced alterations in human reconstructed skin. These results suggest that Sideroxyl may prevent UVA-induced damage in human skin as a complement to sunscreens, especially in the long-wavelength UVA range. Copyright © 2010 Elsevier Inc. All rights reserved.
McNally, Catherine G.; Uchida, Emi; Gold, Arthur J.
2011-01-01
Protected areas are used to sustain biodiversity and ecosystem services. However, protected areas can create tradeoffs spatially and temporally among ecosystem services, which can affect the welfare of dependent local communities. This study examines the effect of a protected area on the tradeoff between two extractive ecosystem services from mangrove forests: cutting mangroves (fuelwood) and harvesting the shrimp and fish that thrive if mangroves are not cut. We demonstrate the effect in the context of Saadani National Park (SANAPA) in Tanzania, where enforcement of prohibition of mangrove harvesting was strengthened to preserve biodiversity. Remote sensing data of mangrove cover over time are integrated with georeferenced household survey data in an econometric framework to identify the causal effect of mangrove protection on income components directly linked to mangrove ecosystem services. Our findings suggest that many households experienced an immediate loss in the consumption of mangrove firewood, with the loss most prevalent in richer households. However, all wealth classes appear to benefit from long-term sustainability gains in shrimping and fishing that result from mangrove protection. On average, we find that a 10% increase in the mangrove cover within SANAPA boundaries in a 5-km2 radius of the subvillage increases shrimping income by approximately twofold. The creation of SANAPA shifted the future trajectory of the area from one in which mangroves were experiencing uncontrolled cutting to one in which mangrove conservation is providing gains in income for the local villages as a result of the preservation of nursery habitat and biodiversity. PMID:21873182
NASA Astrophysics Data System (ADS)
Tacnet, Jean-Marc; Carladous, Simon; Dezert, Jean; Batton-Hubert, Mireille
2017-04-01
Mountain natural phenomena (e.g. torrential floods) put people and buildings at risk. Civil engineering protection works such as torrent check-dams are designed to mitigate those natural risks. Protection works act on both causes and effects of phenomena to reduce consequences and therefore risks. For instance, check-dams control sediment production and liquid/solid flow of torrential floods: several series of dams are located in the headwaters of a watershed, each having specific functions. All those works are damaged by time passing and flood impacts. Effectiveness assessment is needed to define, compare or choose strategies for investment and maintenance which are essential issues in risk management process. Decision support tools are expected to analyze at different scales both their technical effectiveness (related to their structural state and functional effects on phenomena such as stopping, braking, guiding, etc.) and their economic efficiency through comparison between benefits and costs. Several methods, often based on expert knowledge, have already been developed to care about decision under risk. But uncertainty has also to be considered, since decisions are indeed often taken in a context of lack of information and knowledge on natural phenomena, heterogeneity of available information and, finally, reliability of sources. First methods derived from classical industrial contexts, such as dependability analysis, are used to formalize expert knowledge used for decision-making. After having defined the concept of effectiveness, dependability analysis are used to identify decision contexts and problems: criteria and indicators are identified in relation with structural or functional features. Then, innovative and multi-scales multi-criteria decision-making methods (MCDMs) and frameworks are proposed to help assessing protection works effectiveness. They combine classical MCDM approaches, belief function, fuzzy sets and possibility theories. Those methods allow to make decisions based on heterogeneous, imprecise and uncertain evaluation of criteria provided by more or less reliable sources in an uncertain context: COWA-ER (Cautious Ordered Weighted Averaging with Evidential Reasoning), Fuzzy-Cautious OWA or ER-MCDA (Evidential Reasoning for Multi Criteria Decision Analysis) are thus applied to several scales of torrent check-dams' effectiveness assessment. Those methods are then improved for a better knowledge representation and final decision. Enhanced methods are then associated together. Finally, individual problems and associated methods are integrated in a generic methodology to move from torrential protective single measure effectiveness assessment to complete protection systems at watershed scale.
Use of mechanical devices for distal hemoperfusion during balloon catheter coronary angioplasty.
Heibig, J; Angelini, P; Leachman, D R; Beall, M M; Beall, A C
1988-01-01
Previous attempts to protect the dependent myocardium during balloon catheter coronary angioplasty in animals and humans have had generally unsatisfactory results. This paper summarizes the authors' experience in investigating commercially available mechanical pumps for distal coronary hemoperfusion during balloon angioplasty. Both roller and piston pumps can attain adequate distal perfusion without significant side effects in the majority of patients. Our goal was to suppress angina for at least 5 min to prolong balloon inflation in awake patients. Minor T-wave changes without concomitant angina pectoris can be expected when the distal coronary bed is perfused with hypothermic blood. Side branch occlusion by the inflated balloon prevents effective protection of the corresponding part of the dependent myocardium during distal hemoperfusion, which may result in persistent angina and ST-T changes uncorrected by increasing the hemoperfusion rate. Distal coronary diffuse spasm, rare and transient, was the only immediate complication of this procedure. It is suggested that intense local wall stimulation could occur with a higher flow rate (jet effect). Improved balloon catheter pressure/flow characteristics and on-line continuous mechanical pumps should soon make distal coronary hemoperfusion through balloon catheters an accepted clinical technique.
Kumar, Ramadhar; Balaji, S; Sripriya, R; Nithya, N; Uma, T S; Sehgal, P K
2010-02-10
The antioxidant activity of the total aqueous extract (TAE) and total phenolic extract (TPE) of Momordica charantia fruits was assayed by radical-scavenging methods and cytoprotective effects on hydrogen peroxide (H(2)O(2))- and hypoxanthin-xanthin oxidase (HX-XO)-induced damage to rat cardiac fibroblasts (RCFs), NIH 3T3, and keratinocyte (A431). Cell viability was monitored by a 3-[4,5-dimethyltriazol-2-yl]-2,5-diphenyltretrazolium (MTT) assay. For fibroblasts, TPE at 200 and 300 microg/mL showed maximum and consistent cytoprotection against oxidants. The extract at 50 microg/mL also had significant and slightly protective effects on fibroblasts against H(2)O(2)- and HX-XO-induced damage, respectively. RCF was more tolerant toward the damage. For keratinocytes, a dose-dependent relationship of oxidant toxicity was only seen with H(2)O(2) but the protective action of the extract correlated with oxidant dosage. At 200 and 300 microg/mL TPE, cytoprotection was dose-dependent against oxidants. Extracts had no effect on HX-XO toxicity at 50 microg/mL. Pretreatment with both the extracts did not show any cytoprotection.
Franco, Rodrigo
2013-01-01
Controversial reports on the role of autophagy as a survival or cell death mechanism in dopaminergic cell death induced by parkinsonian toxins exist. We investigated the alterations in autophagic flux and the role of autophagy protein 5 (Atg5)-dependent autophagy in dopaminergic cell death induced by parkinsonian toxins. Dopaminergic cell death induced by the mitochondrial complex I inhibitors 1-methyl-4-phenylpyridinium (MPP+) and rotenone, the pesticide paraquat, and the dopamine analog 6-hydroxydopamine (6-OHDA) was paralleled by increased autophagosome accumulation. However, when compared with basal autophagy levels using chloroquine, autophagosome accumulation was a result of impaired autophagic flux. Only 6-OHDA induced an increase in autophagosome formation. Overexpression of a dominant negative form of Atg5 increased paraquat- and MPP+-induced cell death. Stimulation of mammalian target of rapamycin (mTOR)-dependent signaling protected against cell death induced by paraquat, whereas MPP+-induced toxicity was enhanced by wortmannin, a phosphoinositide 3-kinase class III inhibitor, rapamycin, and trehalose, an mTOR-independent autophagy activator. Modulation of autophagy by either pharmacological or genetic approaches had no effect on rotenone or 6-OHDA toxicity. Cell death induced by parkinsonian neurotoxins was inhibited by the pan caspase inhibitor (Z-VAD), but only caspase-3 inhibition was able to decrease MPP+-induced cell death. Finally, inhibition of the lysosomal hydrolases, cathepsins, increased the toxicity by paraquat and MPP+, supporting a protective role of Atg5-dependent autophagy and lysosomes degradation pathways on dopaminegic cell death. These results demonstrate that in dopaminergic cells, Atg5-dependent autophagy acts as a protective mechanism during apoptotic cell death induced by paraquat and MPP+ but not during rotenone or 6-OHDA toxicity. PMID:23997112
Ruane, Darren; Chorny, Alejo; Lee, Haekyung; Faith, Jeremiah; Pandey, Gaurav; Shan, Meimei; Simchoni, Noa; Rahman, Adeeb; Garg, Aakash; Weinstein, Erica G.; Oropallo, Michael; Gaylord, Michelle; Ungaro, Ryan; Cunningham-Rundles, Charlotte; Alexandropoulos, Konstantina; Mucida, Daniel; Merad, Miriam; Cerutti, Andrea
2016-01-01
Protective immunoglobulin A (IgA) responses to oral antigens are usually orchestrated by gut dendritic cells (DCs). Here, we show that lung CD103+ and CD24+CD11b+ DCs induced IgA class-switch recombination (CSR) by activating B cells through T cell–dependent or –independent pathways. Compared with lung DCs (LDC), lung CD64+ macrophages had decreased expression of B cell activation genes and induced significantly less IgA production. Microbial stimuli, acting through Toll-like receptors, induced transforming growth factor-β (TGF-β) production by LDCs and exerted a profound influence on LDC-mediated IgA CSR. After intranasal immunization with inactive cholera toxin (CT), LDCs stimulated retinoic acid–dependent up-regulation of α4β7 and CCR9 gut-homing receptors on local IgA-expressing B cells. Migration of these B cells to the gut resulted in IgA-mediated protection against an oral challenge with active CT. However, in germ-free mice, the levels of LDC-induced, CT–specific IgA in the gut are significantly reduced. Herein, we demonstrate an unexpected role of the microbiota in modulating the protective efficacy of intranasal vaccination through their effect on the IgA class-switching function of LDCs. PMID:26712806
Zeng, Zhiwen; Wang, Xue; Bhardwaj, Sanjeev K; Zhou, Xuanhe; Little, Peter J; Quirion, Remi; Srivastava, Lalit K; Zheng, Wenhua
2017-07-01
Schizophrenia is one of the most severe psychiatric disorders. Increasing evidence implicates that neurodegeneration is a component of schizophrenia pathology and some atypical antipsychotics are neuroprotective and successful in slowing the progressive morphological brain changes. As an antipsychotic agent, clozapine has superior and unique effects, but the intracellular signaling pathways that mediate clozapine action remain to be elucidated. The phosphatidylinositol-3-kinase/protein kinase B/Forkhead box O3 (PI3K/Akt/FoxO3a) pathway is crucial for neuronal survival. However, little information is available regarding this pathway with clozapine. In the present study, we investigated the protective effect of clozapine on the PC12 cells against corticosterone toxicity. Our results showed that corticosterone decreases the phosphorylation of Akt and FoxO3a, leading to the nuclear localization of FoxO3a and the apoptosis of PC12 cells, while clozapine concentration dependently protected PC12 cells against corticosterone insult. Pathway inhibitors studies displayed that the protective effect of clozapine was reversed by LY294002 and wortmannin, two PI3K inhibitors, or Akt inhibitor VIII although several other inhibitors had no effect. The shRNA knockdown results displayed that downregulated Akt1 or FoxO3a attenuated the protective effect of clozapine. Western blot analyses revealed that clozapine induced the phosphorylation of Akt and FoxO3a by the PI3K/Akt pathway and reversed the reduction of the phosphorylated Akt and FoxO3a and the nuclear translocation of FoxO3a evoked by corticosterone. Together, our data indicates that clozapine protects PC12 cells against corticosterone-induced cell death by modulating activity of the PI3K/Akt/FoxO3a pathway.
Scheuer, Cecilie; Pommergaard, Hans-Christian; Rosenberg, Jacob; Gögenur, Ismail
2016-11-01
Ultraviolet radiation (UVR) by sunlight results in an increasing number of skin conditions. Earlier studies have suggested a protective effect of topical treatment with the pineal hormone melatonin. However, this protective effect has never been evaluated in natural sunlight, and the optimal dosing has not been clarified. The aim of this study was to investigate the sun protective effect of topical treatment with three different doses of melatonin (0.5%, 2.5%, 12.5%) against erythema induced by natural sunlight. The study was a randomized, placebo-controlled, double-blind study in healthy volunteers. Twenty-three healthy volunteers, 8 male and 15 female, were enrolled. The protective effect of three different doses of melatonin cream (0.5%, 2.5%, 12.5%) against erythema induced by natural sunlight was tested. All participants had their backs exposed to sun from 1:22 PM to 2:02 PM local time and UV-index was 9. Primary outcome was reduction in erythema evaluated by chromatography after sun exposure, when treated with topical melatonin cream (0.5%, 2.5%, 12.5%) versus placebo and no treatment. The erythema reaction was evaluated with chromatography and visual scoring at baseline, one, four, eight and 24h after exposure. Significant difference in erythema formation was found between areas treated with melatonin cream 12.5% and areas receiving placebo or no treatment (repeated measures ANOVA p=0.001). No differences were found between placebo and the 0.5% and 2.5% concentrations. Application of melatonin cream 12.5% protects against natural sunlight induced erythema. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
A Protective Hsp70-TLR4 Pathway in Lethal Oxidant Lung Injury
Zhang, Yi; Zhang, Xuchen; Shan, Peiying; Hunt, Clayton R.; Pandita, Tej K.; Lee, Patty J.
2013-01-01
Administering high levels of inspired oxygen, or hyperoxia, is commonly used as a life-sustaining measure in critically ill patients. However, prolonged exposures can exacerbate respiratory failure. Our previous study showed that toll-like receptor 4 (TLR4) confers protection against hyperoxia-induced lung injury and mortality. Hsp70 has potent cytoprotective properties and has been described as a TLR4 ligand in cell lines. We sought to elucidate the relationship between TLR4 and Hsp70 in hyperoxia-induced lung injury in vitro and in vivo and to define the signaling mechanisms involved. Wild type, TLR4−/− and Trif−/− (a TLR4 adapter protein) murine lung endothelial cells (MLEC) were exposed to hyperoxia. We found markedly elevated levels of intracellular and secreted Hsp70 from mice lung and MLEC after hyperoxia. We confirmed that Hsp70 and TLR4 co-immunoprecipitate in lung tissue and MLEC. Hsp70-mediated NFκB activation appears to depend upon TLR4. In the absence of TLR4, Hsp70 loses its protective effects in endothelial cells. Furthermore, these protective properties of Hsp70 are TLR4 adapter Trif-dependent, MyD88-independent. Hsp70-deficient mice have increased mortality during hyperoxia and lung-targeted adenoviral delivery of Hsp70 effectively rescues both Hsp70-deficient and wild type mice. Our studies are the first to define an Hsp70-TLR4-Trif cytoprotective axis in the lung and endothelial cells. This pathway is a potential therapeutic target against a range of oxidant-induced lung injuries. PMID:23817427
Management of arthropod pathogen vectors in North America: Minimizing adverse effects on pollinators
Ginsberg, Howard; Bargar, Timothy A.; Hladik, Michelle L.; Lubelczyk, Charles
2017-01-01
Tick and mosquito management is important to public health protection. At the same time, growing concerns about declines of pollinator species raise the question of whether vector control practices might affect pollinator populations. We report the results of a task force of the North American Pollinator Protection Campaign (NAPPC) that examined potential effects of vector management practices on pollinators, and how these programs could be adjusted to minimize negative effects on pollinating species. The main types of vector control practices that might affect pollinators are landscape manipulation, biocontrol, and pesticide applications. Some current practices already minimize effects of vector control on pollinators (e.g., short-lived pesticides and application-targeting technologies). Nontarget effects can be further diminished by taking pollinator protection into account in the planning stages of vector management programs. Effects of vector control on pollinator species often depend on specific local conditions (e.g., proximity of locations with abundant vectors to concentrations of floral resources), so planning is most effective when it includes collaborations of local vector management professionals with local experts on pollinators. Interventions can then be designed to avoid pollinators (e.g., targeting applications to avoid blooming times and pollinator nesting habitats), while still optimizing public health protection. Research on efficient targeting of interventions, and on effects on pollinators of emerging technologies, will help mitigate potential deleterious effects on pollinators in future management programs. In particular, models that can predict effects of integrated pest management on vector-borne pathogen transmission, along with effects on pollinator populations, would be useful for collaborative decision-making.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing
2014-08-08
Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2. AS-2 also protected mice that had been exposed to a lethal dose of ionizing radiation. Our findings indicate that some types of bidentate 8HQ chelators could serve as radioprotectors with no substantial toxicity in vivo.« less
JV Task 96 - Phase 2 - Investigating the Importance of the Mercury-Selenium Interaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicholas Ralston; Laura Raymond
2008-03-01
In order to improve the understanding of the mercury issue, it is vital to study mercury's effects on selenium physiology. While mercury present in the environment or food sources may pose health risks, the protective effects of selenium have not been adequately considered in establishing regulatory policy. Numerous studies report that vulnerability to mercury toxicity is inversely proportional to selenium status or level. However, selenium status has not been considered in the development of the reference dosage levels for mercury exposure. Experimental animals fed low-selenium diets are far more vulnerable to mercury toxicity than animals fed normal selenium, and animalsmore » fed selenium-rich diets are even more resistant. Selenium-dependent enzymes in brain and endocrine tissues can be impaired by excessive mercury exposure, apparently because mercury has an extremely high binding affinity for selenium. When selenium becomes bound to mercury, it is unable to participate in the metabolic cycling of selenoprotein synthesis. Because of mercury-dependent impairments of selenoprotein synthesis, various antioxidant and regulatory functions in brain biochemistry are compromised. This report details a 2-year multiclient-funded research program designed to examine the interactions between mercury and selenium in animal models. The studies explored the effects of dietary intakes of toxic amounts of methylmercury and the protective effects of the normal dietary range of selenium in counteracting mercury toxicity. This study finds that the amounts of selenium present in ocean fish are sufficient to protect against far larger quantities of methylmercury than those present in typical seafoods. Toxic effects of methylmercury exposure were not directly proportional to mercury concentrations in blood, brain, or any other tissues. Instead, mercury toxicity was proportional to molar ratios of mercury relative to selenium. In order to accurately assess risk associated with methylmercury or mercury exposures, mercury-selenium ratios appear to be far more accurate and effective in identifying risk and protecting human and environmental health. This study also finds that methylmercury toxicity can be effectively treated by dietary selenium, preventing the death and progressive disabilities that otherwise occur in methylmercury-treated subjects. Remarkably, the positive response to selenium therapy was essentially equivalent regardless of whether or not toxic amounts of methylmercury were still administered. The findings of the Physiologically Oriented Integration of Nutrients and Toxins (POINT) models of the effects of mercury and selenium developed in this project are consistent with the hypothesis that mercury toxicity arises because of mercury-dependent inhibition of selenium availability in brain and endocrine tissues. This appears to occur through synergistic effects of mercury-dependent inhibition of selenium transport to these tissues and selective sequestration of the selenium present in the tissues. Compromised transport of selenium to the brain and endocrine tissues would be particularly hazardous to the developing fetus because the rapidly growing tissues of the child have no selenium reserves. Therefore, maternal consumption of foods with high mercury-selenium ratios is hazardous. In summation, methylmercury exposure is unlikely to cause harm in populations that eat selenium-rich diets but may cause harm among populations that consume certain foods that have methylmercury present in excess of selenium.« less
Chen, Xiao-Song; Zhang, Ming; Xu, Long-Mei; Zhang, Jian-Jun; Xia, Qiang
2012-01-01
Although the protective effect of transient ureteral obstruction (UO) prior to ischemia on subsequent renal ischemia/reperfusion (I/R) injury has been documented, the underlying molecular mechanism remains to be understood. We showed in the current study that 24 h of UO led to renal tubular hypoxia in the ipsilateral kidney in mice, with the accumulation of hypoxia-inducible factor (HIF)-2α, which lasted for a week after the release of UO. To address the functions of HIF-2α in UO-mediated protection of renal IRI, we utilized the Mx-Cre/loxP recombination system to knock out target genes. Inactivation of HIF-2α, but not HIF-1α blunted the renal protective effects of UO, as demonstrated by much higher serum creatinine level and severer histological damage. UO failed to prevent postischemic neutrophil infiltration and apoptosis induction in HIF-2α knockout mice, which also diminished the postobstructive up-regulation of the protective molecule, heat shock protein (HSP)-27. The renal protective effects of UO were associated with the improvement of the postischemic recovery of intra-renal microvascular blood flow, which was also dependent on the activation of HIF-2α. Our results demonstrated that UO protected the kidney via activation of HIF-2α, which reduced tubular damages via preservation of adequate renal microvascular perfusion after ischemia. Thus, preconditional HIF-2α activation might serve as a novel therapeutic strategy for the treatment of ischemic acute renal failure. PMID:22295069
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-01-01
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14–Cre–ERT2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14–Cre–ERT2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte–stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn. PMID:28878021
Zou, Jun; Chassaing, Benoit; Singh, Vishal; Pellizzon, Michael; Ricci, Matthew; Fythe, Michael D; Kumar, Matam Vijay; Gewirtz, Andrew T
2018-01-10
Dietary supplementation with fermentable fiber suppresses adiposity and the associated parameters of metabolic syndrome. Microbiota-generated fiber-derived short-chain fatty acids (SCFAs) and free fatty acid receptors including GPR43 are thought to mediate these effects. We find that while fermentable (inulin), but not insoluble (cellulose), fiber markedly protected mice against high-fat diet (HFD)-induced metabolic syndrome, the effect was not significantly impaired by either inhibiting SCFA production or genetic ablation of GPR43. Rather, HFD decimates gut microbiota, resulting in loss of enterocyte proliferation, leading to microbiota encroachment, low-grade inflammation (LGI), and metabolic syndrome. Enriching HFD with inulin restored microbiota loads, interleukin-22 (IL-22) production, enterocyte proliferation, and antimicrobial gene expression in a microbiota-dependent manner, as assessed by antibiotic and germ-free approaches. Inulin-induced IL-22 expression, which required innate lymphoid cells, prevented microbiota encroachment and protected against LGI and metabolic syndrome. Thus, fermentable fiber protects against metabolic syndrome by nourishing microbiota to restore IL-22-mediated enterocyte function. Copyright © 2017 Elsevier Inc. All rights reserved.
38 CFR 3.952 - Protected ratings.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2014-07-01 2014-07-01 false Protected ratings. 3.952..., Compensation, and Dependency and Indemnity Compensation Protection § 3.952 Protected ratings. Ratings under the... evaluation and award are protected. [26 FR 12766, Dec. 30, 1961] ...
38 CFR 3.952 - Protected ratings.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2012-07-01 2012-07-01 false Protected ratings. 3.952..., Compensation, and Dependency and Indemnity Compensation Protection § 3.952 Protected ratings. Ratings under the... evaluation and award are protected. [26 FR 12766, Dec. 30, 1961] ...
38 CFR 3.952 - Protected ratings.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2011-07-01 2011-07-01 false Protected ratings. 3.952..., Compensation, and Dependency and Indemnity Compensation Protection § 3.952 Protected ratings. Ratings under the... evaluation and award are protected. [26 FR 12766, Dec. 30, 1961] ...
38 CFR 3.952 - Protected ratings.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2013-07-01 2013-07-01 false Protected ratings. 3.952..., Compensation, and Dependency and Indemnity Compensation Protection § 3.952 Protected ratings. Ratings under the... evaluation and award are protected. [26 FR 12766, Dec. 30, 1961] ...
Si, Jin; Ge, Yan; Zhuang, Shougang; Juan Wang, Li; Chen, Shan; Gong, Rujun
2013-01-01
Adrenocorticotropic hormone (ACTH) has a renoprotective effect in chronic kidney disease; however, its effect on acute kidney injury (AKI) remains unknown. In a rat model of tumor necrosis factor (TNF)–induced AKI, we found that ACTH gel prevented kidney injury, corrected acute renal dysfunction, and improved survival. Morphologically, ACTH gel ameliorated TNF-induced acute tubular necrosis, associated with a reduction in tubular apoptosis. While the steroidogenic response to ACTH gel plateaued, the kidney-protective effect continued to increase at even higher doses, suggesting steroid-independent mechanisms. Of note, ACTH also acts as a key agonist of the melanocortin system, with its cognate melanocortin 1 receptor (MC1R) abundantly expressed in renal tubules. In TNF-injured tubular epithelial cells in vitro, ACTH reinstated cellular viability and eliminated apoptosis. This beneficial effect was blunted in MC1R-silenced cells, suggesting that this receptor mediates the anti-apoptotic signaling of ACTH. Moreover, ACTH gel protected mice against cecal ligation puncture–induced septic AKI better than α-melanocyte-stimulating hormone: a protein equal in biological activity to ACTH except for steroidogenesis. Thus, ACTH has additive renoprotective actions achieved by both steroid-dependent mechanisms and MC1R-directed anti-apoptosis. ACTH may represent a novel therapeutic strategy to prevent or treat AKI. PMID:23325074
Cornelissen, Lisette A. H. M.; de Vries, Robert P.; de Boer-Luijtze, Els A.; Rigter, Alan; Rottier, Peter J. M.; de Haan, Cornelis A. M.
2010-01-01
Background The highly pathogenic avian influenza (HPAI) virus H5N1 causes multi-organ disease and death in poultry, resulting in significant economic losses in the poultry industry. In addition, it poses a major public health threat as it can be transmitted directly from infected poultry to humans with very high (60%) mortality rate. Effective vaccination against HPAI H5N1 would protect commercial poultry and would thus provide an important control measure by reducing the likelihood of bird-to-bird and bird-to-human transmission. Methodology/Principal Findings In the present study we evaluated the vaccine potential of recombinant soluble trimeric subtype 5 hemagglutinin (sH53) produced in mammalian cells. The secreted, purified sH53 was biologically active as demonstrated by its binding to ligands in a sialic acid-dependent manner. It was shown to protect chickens, in a dose-dependent manner, against a lethal challenge with H5N1 after a single vaccination. Protected animals did not shed challenge virus as determined by a quantitative RT-PCR on RNA isolated from trachea and cloaca swabs. Also in mice, vaccination with sH53 provided complete protection against challenge with HPAI H5N1. Conclusions/Significance Our results demonstrate that sH53 constitutes an attractive vaccine antigen for protection of chickens and mammals against HPAI H5N1. As these recombinant soluble hemagglutinin preparations can be produced with high yields and with relatively short lead time, they enable a rapid response to circulating and potentially pandemic influenza viruses. PMID:20498717
First Remote Measurements Of Smoke On The Ground At Night
Gary L. Achtemeier
1998-01-01
1. IntroductionFire is recognized as a fundamental ecological process in many forest and rangeland ecosystems throughout the U.S. Ecosystems depend upon fire for health, reproduction, and protection from invading species. The Southern States are leaders in using prescribed fire and understanding its effects. Approximately 200 million acres of forest land are...
[Thymus dependent immunity against Tyzzer's disease in the mouse].
Fujiwara, K; Machii, K; Nakayama, M; Tamura, T; Ueda, K
1977-01-01
Nude (nu/nu) mice fail to resist to challenge infection of Tyzzer's disease after pretreatment with formalin-killed organisms that was effective for protecting heterozygous haired (nu/ł) mice from challenge. Resistance was induced nu/nu mice after the transfer of spleen cells from immunized nu/ł and concomitant formalin vaccine treatment.
Tolerance to insect defoliation: biocenotic aspects
Andrey A. Pleshanov; Victor I. Voronin; Elena S. Khlimankova; Valentina I. Epova
1991-01-01
Woody plant resistance to insect damage is of great importance in forest protection, and tree tolerance is an important element of this resistance. The compensating mechanisms responsible for tolerance are nonspecific as a rule and develop after damage has been caused by phytophagous animals or other unfavorable effects. Beyond that, plant tolerance depends on duration...
The Continuing Evolution of Effective IT Security Practices
ERIC Educational Resources Information Center
Voloudakis, John
2006-01-01
In the past three years, higher education institutions have made a number of moves to secure their critical systems and protect their users, resulting in a marked change in the techniques used to combat security threats. Today, continued progress may depend on the development of an enterprise IT security program. (Contains 10 notes.)
Less-toxic corrosion inhibitors
NASA Technical Reports Server (NTRS)
Humphries, T. S.
1981-01-01
Combinations of borates, nitrates, phosphates, silicates, and sodium MBT protect aluminum from corrosion in fresh water. Most effective combinations contained sodium phosphate and were alkaline. These inhibitors replace toxic chromates which are subject to governmental restrictions, but must be used in larger quantities. Experimental exposure times varied from 1 to 14 months depending upon nature of submersion solution.
Chen, Chunxiang; Peng, Shaorong; Chen, Fanghui; Liu, Lili; Li, Zhouxue; Zeng, Guohua; Huang, Qiren
2017-12-01
PIO, a synthetic ligand for PPARγ, is used clinically to treat T2DM. However, little is known about its protective effects on endothelium and the underlying mechanisms. In this study, we sought to investigate the protective effects of PIO on endothelium and its probable mechanisms: 95% confluent wild type (WT) HUVECs and PPARγ Low -HUVECs that we first injured with HG (33 mmol·L -1 ) were first pretreated with 10 μmol·L -1 of GW9662 for 30 min, and then treated the cells with different concentrations of PIO (5, 10, or 20 μmol·L -1 ) for 24 h. Finally, we measured the levels of NO, ET1, TNFα, and IL6 in the cell culture supernatant. These cells were then used to determine cell viability, caspase3 activity, the levels of IKKα/β mRNA, IKKα/β, and NFκB-p65. Severe dysfunction and activation of IKKα/β-NFκB signaling occurred after we exposed HUVECs to HG. Conversely, treatment with PIO significantly attenuated the dysfunction and the activation of IKKα/β-NFκB signaling induced by HG in a dose-dependent manner. Moreover, the protective effects of PIO were completely abrogated by GW9662 or down-regulation of PPARγ. Taken together, the results indicate that PIO protects HUVECs against the HG-induced dysfunction through the inhibition of IKKα/β-NFκB signaling mediated by PPARγ.
NASA Astrophysics Data System (ADS)
Rudenko, O. V.; Tsyuryupa, S. N.; Sarvazyan, A. P.
2016-09-01
We develop a theory of the elasticity moduli and dissipative properties of a composite material: a phantom simulating muscle tissue anisotropy. The model used in the experiments was made of a waterlike polymer with embedded elastic filaments imitating muscle fiber. In contrast to the earlier developed phenomenological theory of the anisotropic properties of muscle tissue, here we obtain the relationship of the moduli with characteristic sizes and moduli making up the composite. We introduce the effective elasticity moduli and viscosity tensor components, which depend on stretching of the fibers. We measure the propagation velocity of shear waves and the shear viscosity of the model for regulated tension. Waves were excited by pulsed radiation pressure generated by modulated focused ultrasound. We show that with increased stretching of fibers imitating muscle contraction, an increase in both elasticity and viscosity takes place, and this effect depends on the wave propagation direction. The results of theoretical and experimental studies support our hypothesis on the protective function of stretched skeletal muscle, which protects bones and joints from trauma.
Protective Effect of ECQ on Rat Reflux Esophagitis Model.
Jang, Hyeon-Soon; Han, Jeong Hoon; Jeong, Jun Yeong; Sohn, Uy Dong
2012-12-01
This study was designed to determine the protective effect of Rumex Aquaticus Herba extracts containing quercetin-3-β-D-glucuronopyranoside (ECQ) on experimental reflux esophagitis. Reflux esophagitis was induced by surgical procedure. The rats were divided into seven groups, namely normal group, control group, ECQ (1, 3, 10, 30 mg/kg) group and omeprazole (30 mg/kg) group. ECQ and omeprazole groups received intraduodenal administration. The Rats were starved for 24 hours before the experiments, but were freely allowed to drink water. ECQ group attenuated the gross esophagitis significantly compared to that treated with omeprazole in a dose-dependent manner. ECQ decreased the volume of gastric juice and increased the gastric pH, which are similar to those of omeprazole group. In addition, ECQ inhibited the acid output effectively in reflux esophagitis. Significantly increased amounts of malondialdehyde (MDA), myeloperoxidase (MPO) activity and the mucosal depletion of reduced glutathione (GSH) were observed in the reflux esophagitis. ECQ administration attenuated the decrement of the GSH levels and affected the MDA levels and MPO activity. These results suggest that the ECQ has a protective effect which may be attributed to its multiple effects including anti-secretory, anti-oxidative and anti-inflammatory actions on reflux esophagitis in rats.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Kannanganat, Sunil; Wyatt, Linda S; Gangadhara, Sailaja; Chamcha, Venkatesarlu; Chea, Lynette S; Kozlowski, Pamela A; LaBranche, Celia C; Chennareddi, Lakshmi; Lawson, Benton; Reddy, Pradeep B J; Styles, Tiffany M; Vanderford, Thomas H; Montefiori, David C; Moss, Bernard; Robinson, Harriet L; Amara, Rama Rao
2016-11-01
We tested, in rhesus macaques, the effects of a 500-fold range of an admixed recombinant modified vaccinia Ankara (MVA) expressing rhesus GM-CSF (MVA/GM-CSF) on the immunogenicity and protection elicited by an MVA/SIV macaque 239 vaccine. High doses of MVA/GM-CSF did not affect the levels of systemic envelope (Env)-specific Ab, but it did decrease the expression of the gut-homing receptor α4β7 on plasmacytoid dendritic cells (p < 0.01) and the magnitudes of Env-specific IgA (p = 0.01) and IgG (p < 0.05) in rectal secretions. The protective effect of the vaccine was evaluated using 12 weekly rectal challenges in rhesus macaques subgrouped by tripartite motif-containing protein 5α (TRIM5α) genotypes that are restrictive or permissive for infection by the challenge virus SIVsmE660. Eight of nine TRIM5α-restrictive animals receiving no or the lowest dose (1 × 10 5 PFU) of MVA/GM-CSF resisted all 12 challenges. In the comparable TRIM5α-permissive group, only 1 of 12 animals resisted all 12 challenges. In the TRIM5α-restrictive animals, but not in the TRIM5α-permissive animals, the number of challenges to infection directly correlated with the magnitudes of Env-specific rectal IgG (r = +0.6) and IgA (r = +0.6), the avidity of Env-specific serum IgG (r = +0.5), and Ab dependent cell-mediated virus inhibition (r = +0.6). Titers of neutralizing Ab did not correlate with protection. We conclude that 1) protection elicited by MVA/SIVmac239 is strongly dependent on the presence of TRIM5α restriction, 2) nonneutralizing Ab responses contribute to protection against SIVsmE660 in TRIM5α-restrictive animals, and 3) high doses of codelivered MVA/GM-CSF inhibit mucosal Ab responses and the protection elicited by MVA expressing noninfectious SIV macaque 239 virus-like particles. Copyright © 2016 by The American Association of Immunologists, Inc.
Nwokocha, Chukwuemeka; Younger-Coleman, Novie; Nwokocha, Magdalene; Owu, Daniel; Iwuala, Moses
2014-01-01
Context and Objectives: Lead (Pb) toxicity leads to cell damage in many organs of the body. Using different treatment interventions and modes of administration we comparatively examined the protective ability of some medicinal plants on liver Pb accumulation. Materials and Methods: Rats were fed on either 7% w/w Zingiber officinale, 7% w/w Allium sativum, 10% w/w Lycopersicon esculentum, 5%, w/w Garcinia kola (all in rat chow), while Pb (100 ppm) was given in drinking water. The additives were administered together with (mode 1), a week after exposure to (mode 2) or a week before metal exposure to (mode 3) the metal for a period of 6 weeks. The metal accumulations in the liver were determined using atomic absorption spectrometry and compared using analysis of variance. Results: Some additives significantly (P < 0.05) reduced, while others enhanced Pb accumulation. Mode 2 yielded the highest mean % protection and mode 3 the lowest, no significant interaction between modes of administration and time of measurement in their relationships to percentage protection, but there was statistically significant (P < 0.05) interaction between modes of administration and additive used in their relationships to percentage protection. Conclusion: Protective effects of medicinal plants are varied and depend on the nature of lead exposure. PMID:25276068
Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M
2017-02-17
Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Peerapanyasut, Wachirasek
2018-01-01
This study investigates the effects of bisphenol A (BPA) contamination on the kidney and the possible protection by melatonin in experimental rats and isolated mitochondrial models. Rats exposed to BPA (50, 100, and 150 mg/kg, i.p.) for 5 weeks demonstrated renal damages as evident by increased serum urea and creatinine and decreased creatinine clearance, together with the presence of proteinuria and glomerular injuries in a dose-dependent manner. These changes were associated with increased lipid peroxidation and decreased antioxidant glutathione and superoxide dismutase. Mitochondrial dysfunction was also evident as indicated by increased reactive oxygen species production, decreased membrane potential change, and mitochondrial swelling. Coadministration of melatonin resulted in the reversal of all the changes caused by BPA. Studies using isolated mitochondria showed that BPA incubation produced dose-dependent impairment in mitochondrial function. Preincubation with melatonin was able to sustain mitochondrial function and architecture and decreases oxidative stress upon exposure to BPA. The findings indicated that BPA is capable of acting directly on the kidney mitochondria, causing mitochondrial oxidative stress, dysfunction, and subsequently, leading to whole organ damage. Emerging evidence further suggests the protective benefits of melatonin against BPA nephrotoxicity, which may be mediated, in part, by its ability to diminish oxidative stress and maintain redox equilibrium within the mitochondria. PMID:29670679
Wang, Mingming; Chen, Minchun; Ding, Yi; Zhu, Zhihui; Zhang, Yikai; Wei, Peifeng; Wang, Jingwen; Qiao, Yi; Li, Liang; Li, Yuwen; Wen, Aidong
2015-01-01
Vascular endothelial cells play an important role in modulating anti-thrombus and maintaining the natural function of vascular by secreting many active substances. β-boswellic acid (β-BA) is an active triterpenoid compound from the extract of boswellia serrate. In this study, it is demonstrated that β-BA ameliorates plasma coagulation parameters, protects endothelium from blood stasis induced injury and prevents blood stasis induced impairment of endothelium-dependent vasodilatation. Moreover, it is found that β-BA significantly increases nitric oxide (NO) and cyclic guanosine 3’, 5’-monophosphate (cGMP) levels in carotid aortas of blood stasis rats. To stimulate blood stasis-like conditions in vitro, human umbilical vein endothelial cells (HUVECs) were exposed to transient oxygen and glucose deprivation (OGD). Treatment of β-BA significantly increased intracellular NO level. Western blot and immunofluorescence as well as immunohistochemistry reveal that β-BA increases phosphorylation of enzyme nitric oxide synthase (eNOS) at Ser1177. In addition, β-BA mediated endothelium-dependent vasodilatation can be markedly blocked by eNOS inhibitor L-NAME in blood stasis rats. In OGD treated HUEVCs, the protective effect of β-BA is attenuated by knockdown of eNOS. In conclusion, the above findings provide convincing evidence for the protective effects of β-BA on blood stasis induced endothelial dysfunction by eNOS signaling pathway. PMID:26482008
Cumming, Graeme S; Allen, Craig R
2017-09-01
Conservation biology and applied ecology increasingly recognize that natural resource management is both an outcome and a driver of social, economic, and ecological dynamics. Protected areas offer a fundamental approach to conserving ecosystems, but they are also social-ecological systems whose ecological management and sustainability are heavily influenced by people. This editorial, and the papers in the invited feature that it introduces, discuss three emerging themes in social-ecological systems approaches to understanding protected areas: (1) the resilience and sustainability of protected areas, including analyses of their internal dynamics, their effectiveness, and the resilience of the landscapes within which they occur; (2) the relevance of spatial context and scale for protected areas, including such factors as geographic connectivity, context, exchanges between protected areas and their surrounding landscapes, and scale dependency in the provision of ecosystem services; and (3) efforts to reframe what protected areas are and how they both define and are defined by the relationships of people and nature. These emerging themes have the potential to transform management and policy approaches for protected areas and have important implications for conservation, in both theory and practice. © 2017 by the Ecological Society of America.
Cumming, Graeme S.; Allen, Craig R.
2017-01-01
Conservation biology and applied ecology increasingly recognize that natural resource management is both an outcome and a driver of social, economic, and ecological dynamics. Protected areas offer a fundamental approach to conserving ecosystems, but they are also social-ecological systems whose ecological management and sustainability are heavily influenced by people. This editorial, and the papers in the invited feature that it introduces, discuss three emerging themes in social-ecological systems approaches to understanding protected areas: (1) the resilience and sustainability of protected areas, including analyses of their internal dynamics, their effectiveness, and the resilience of the landscapes within which they occur; (2) the relevance of spatial context and scale for protected areas, including such factors as geographic connectivity, context, exchanges between protected areas and their surrounding landscapes, and scale dependency in the provision of ecosystem services; and (3) efforts to reframe what protected areas are and how they both define and are defined by the relationships of people and nature. These emerging themes have the potential to transform management and policy approaches for protected areas and have important implications for conservation, in both theory and practice.
Hou, Yi-Sheng; Guan, Jun-Jie; Xu, Hai-Dong; Wu, Feng; Sheng, Rui
2015-01-01
Dysfunction of the autophagy-lysosomal pathway (ALP) and the ubiquitin-proteasome system (UPS) was thought to be an important pathogenic mechanism in synuclein pathology and Parkinson's disease (PD). In the present study, we investigated the role of sestrin2 in autophagic degradation of α-synuclein and preservation of cell viability in a rotenone-induced cellular model of PD. We speculated that AMP-activated protein kinase (AMPK) was involved in regulation of autophagy and protection of dopaminergic cells against rotenone toxicity by sestrin2. The results showed that both the mRNA and protein levels of sestrin2 were increased in a TP53-dependent manner in Mes 23.5 cells after treatment with rotenone. Genetic knockdown of sestrin2 compromised the autophagy induction in response to rotenone, while overexpression of sestrin2 increased the basal autophagy activity. Sestrin2 presumably enhanced autophagy in an AMPK-dependent fashion, as sestrin2 overexpression activated AMPK, and genetic knockdown of AMPK abrogated autophagy induction by rotenone. Restoration of AMPK activity by metformin after sestrin2 knockdown recovered the autophagy activity. Sestrin2 overexpression ameliorated α-synuclein accumulation, inhibited caspase 3 activation, and reduced the cytotoxicity of rotenone. These results suggest that sestrin2 upregulation attempts to maintain autophagy activity and suppress rotenone cytotoxicity through activation of AMPK, and that sestrin2 exerts a protective effect on dopaminergic cells. PMID:26031332
Extravehicular Activity and Planetary Protection
NASA Technical Reports Server (NTRS)
Buffington, J. A.; Mary, N. A.
2015-01-01
The first human mission to Mars will be the farthest distance that humans have traveled from Earth and the first human boots on Martian soil in the Exploration EVA Suit. The primary functions of the Exploration EVA Suit are to provide a habitable, anthropometric, pressurized environment for up to eight hours that allows crewmembers to perform autonomous and robotically assisted extravehicular exploration, science/research, construction, servicing, and repair operations on the exterior of the vehicle, in hazardous external conditions of the Mars local environment. The Exploration EVA Suit has the capability to structurally interface with exploration vehicles via next generation ingress/egress systems. Operational concepts and requirements are dependent on the mission profile, surface assets, and the Mars environment. This paper will discuss the effects and dependencies of the EVA system design with the local Mars environment and Planetary Protection. Of the three study areas listed for the workshop, EVA identifies most strongly with technology and operations for contamination control.
Analysis of Vaginal Cell Populations during Experimental Vaginal Candidiasis
Fidel, Paul L.; Luo, Wei; Steele, Chad; Chabain, Joseph; Baker, Marc; Wormley, Floyd
1999-01-01
Studies with an estrogen-dependent murine model of vaginal candidiasis suggest that local cell-mediated immunity (CMI) is more important than systemic CMI for protection against vaginitis. The present study, however, showed that, compared to uninfected mice, little to no change in the percentage or types of vaginal T cells occurred during a primary vaginal infection or during a secondary vaginal infection where partial protection was observed. Furthermore, depletion of polymorphonuclear leukocytes (PMN) had no effect on infection in the presence or absence of pseudoestrus. These results indicate a lack of demonstrable effects by systemic CMI or PMN against vaginitis and suggest that if local T cells are important, they are functioning without showing significant increases in numbers within the vaginal mucosa during infection. PMID:10338532
Ploy and counterploy in predator-prey interactions: Orb-weaving spiders versus bombardier beetles*
Eisner, Thomas; Dean, Jeffrey
1976-01-01
Bombardier beetles (Brachinus spp.) offered to orb-weaving spiders are either captured or lost, depending on the attack strategy of the spider. Nephila clavipes grasps a beetle directly and attempts to bite it outright, but is repelled by the beetle's defensive spray. As the spider recovers from the spray, the beetle makes its escape from the web. Argiope first imprisons the beetle by wrapping it delicately in silk, without causing it to spray. When the spider then proceeds to bite, the wrapping protects it against the full effects of the spray. The wrapping strategy may be generally effective against chemically protected insects, and it is suggested that this may be one of its principal adaptive justifications. Images PMID:16592308
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Jae-Sook; Kim, Eun-Kyung; Choi, Yong-Won
Oxidative stress can contribute to the development and progression of liver diseases, such as drug-induced or alcoholic liver injury, nonalcoholic fatty liver disease, and nonalcoholic steatohepatitis. Nectandrin B is a bioactive lignan isolated from nutmeg extract. To date, little information is available about its pharmacological activities in the liver. This study investigated the hepatocyte-protective effect of nectandrin B against tert-butylhydroperoxide-induced oxidative injury and the underlying molecular mechanism. The cell viability assay revealed that nectandrin B prevents apoptosis stimulated by tert-butylhydroperoxide in both HepG2 cells and primary mouse hepatocytes. Nectandrin B also attenuated ROS production and restored the depleted glutathione level.more » Real-time PCR and immunoblot analyses showed that the expression of glutamate-cysteine ligase, an enzyme responsible for the glutathione biosynthesis, was induced by nectandrin B, indicating its indirect antioxidative effect. The NF-E2-related factor-2 (Nrf2) regulates gene expression of an array of antioxidant enzymes in hepatocytes. Nectandrin B stimulated Nrf2 activation as evidenced by its enhanced nuclear accumulation and increased antioxidant response element (ARE)-luciferase activity. Intriguingly, the hepatocyte-protective effect of nectandrin B against oxidative damage was completely abrogated by Nrf2 knockdown using Nrf2 specific siRNA. Nectandrin B promoted ERK activation, but inactivated GSK-3β through the AMPK-mediated inhibitory phosphorylation. The enforced overexpression of dominant-negative mutant of MEK1 or AMPKα, or wild-type GSK-3β inhibited the increase in the NQO1-ARE-luciferase activity stimulated by nectandrin B, suggesting that both ERK and AMPK-GSK-3β signalings are involved in the activation of Nrf2/ARE pathway by nectandrin B. Consistent with this, cytoprotection and restoration of glutathione level by nectandrin B was also blocked by the overexpression of dominant-negative MEK1 or wild-type GSK-3β. Finally, our data demonstrate that nectandrin B has the ability to protect hepatocytes against oxidative injury through the activation of Nrf2/ARE pathway mediated by ERK phosphorylation and AMPK-dependent inactivation of GSK-3β. - Highlight: • Nectandrin B, a nutmeg lignan protects hepatocytes against oxidative damage. • Nectandrin B exerts an indirect antioxidative effect via the activation of Nrf2. • Both ERK and GSK-3β pathways contribute to the activation of Nrf2 and hepatocyte-protection by nectandrin B. • Nectandrin B can inactivate GSK-3β through the activation of AMPK in HepG2 cells.« less
Morsali, Damineh; Bechtold, David; Lee, Woojin; Chauhdry, Summen; Palchaudhuri, Upayan; Hassoon, Paula; Snell, Daniel M; Malpass, Katy; Piers, Thomas; Pocock, Jennifer; Roach, Arthur; Smith, Kenneth J
2013-04-01
Axonal degeneration is a major cause of permanent disability in the inflammatory demyelinating disease multiple sclerosis, but no therapies are known to be effective in axonal protection. Sodium channel blocking agents can provide effective protection of axons in the white matter in experimental models of multiple sclerosis, but the mechanism of action (directly on axons or indirectly via immune modulation) remains uncertain. Here we have examined the efficacy of two sodium channel blocking agents to protect white matter axons in two forms of experimental autoimmune encephalomyelitis, a common model of multiple sclerosis. Safinamide is currently in phase III development for use in Parkinson's disease based on its inhibition of monoamine oxidase B, but the drug is also a potent state-dependent inhibitor of sodium channels. Safinamide provided significant protection against neurological deficit and axonal degeneration in experimental autoimmune encephalomyelitis, even when administration was delayed until after the onset of neurological deficit. Protection of axons was associated with a significant reduction in the activation of microglia/macrophages within the central nervous system. To clarify which property of safinamide was likely to be involved in the suppression of the innate immune cells, the action of safinamide on microglia/macrophages was compared with that of the classical sodium channel blocking agent, flecainide, which has no recognized monoamine oxidase B activity, and which has previously been shown to protect the white matter in experimental autoimmune encephalomyelitis. Flecainide was also potent in suppressing microglial activation in experimental autoimmune encephalomyelitis. To distinguish whether the suppression of microglia was an indirect consequence of the reduction in axonal damage, or possibly instrumental in the axonal protection, the action of safinamide was examined in separate experiments in vitro. In cultured primary rat microglial cells activated by lipopolysaccharide, safinamide potently suppressed microglial superoxide production and enhanced the production of the anti-oxidant glutathione. The findings show that safinamide is effective in protecting axons from degeneration in experimental autoimmune encephalomyelitis, and that this effect is likely to involve a direct effect on microglia that can result in a less activated phenotype. Together, this work highlights the potential of safinamide as an effective neuroprotective agent in multiple sclerosis, and implicates microglia in the protective mechanism.
Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C
2015-10-27
The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of exposure to infectious agents, while adaptive immunity takes several days to become effective. Here we show, by using a simple lipopeptide-based TLR2 agonist, that an influenza detergent-split vaccine can be made to simultaneously stimulate and amplify both systems to provide immediate antiviral protection while giving the adaptive immune system time to implement long-term immunity. Both types of immunity induced by this approach protect against vaccine-matched as well as unrelated virus strains and potentially even against strains yet to be encountered. Conferring dual functionality to influenza vaccines is beneficial for improving community protection, particularly during periods between the onset of an outbreak and the time when a vaccine becomes available or in scenarios in which mass vaccination with a strain to which the population is immunologically naive is imperative. Copyright © 2015 Chua et al.
Kitamura, Youji; Iida, Yasuhiko; Abe, Jun; Ueda, Masashi; Mifune, Masaki; Kasuya, Fumiyo; Ohta, Masayuki; Igarashi, Kazuo; Saito, Yutaka; Saji, Hideo
2006-02-01
In this study, we investigated the effect of vesicular zinc on ischemic neuronal injury. In cultured neurons, addition of a low concentration (under 100 microM) of zinc inhibited both glutamate-induced calcium influx and neuronal death. In contrast, a higher concentration (over 150 microM) of zinc decreased neuronal viability, although calcium influx was inhibited. These results indicate that zinc exhibits biphasic effects depending on its concentration. Furthermore, in cultured neurons, co-addition of glutamate and CaEDTA, which binds extra-cellular zinc, increased glutamate-induced calcium influx and aggravated the neurotoxicity of glutamate. In a rat transient middle cerebral artery occlusion (MCAO) model, the infarction volume, which is related to the neurotoxicity of glutamate, increased rapidly on the intracerebral ventricular injection of CaEDTA 30 min prior to occlusion. These results suggest that zinc released from synaptic vesicles may provide a protective effect against ischemic neuronal injury.
Morgan, Sophie B; Holzer, Barbara; Hemmink, Johanneke D; Salguero, Francisco J; Schwartz, John C; Agatic, Gloria; Cameroni, Elisabetta; Guarino, Barbara; Porter, Emily; Rijal, Pramila; Townsend, Alain; Charleston, Bryan; Corti, Davide; Tchilian, Elma
2018-01-01
Influenza virus infection is a significant global health threat. Because of the lack of cross-protective universal vaccines, short time window during which antivirals are effective and drug resistance, new therapeutic anti-influenza strategies are required. Broadly, cross-protective antibodies that target conserved sites in the hemagglutinin (HA) stem region have been proposed as therapeutic agents. FI6 is the first proven such monoclonal antibody to bind to H1-H16 and is protective in mice and ferrets. Multiple studies have shown that Fc-dependent mechanisms are essential for FI6 in vivo efficacy. Here, we show that therapeutic administration of FI6 either intravenously or by aerosol to pigs did not reduce viral load in nasal swabs or broncho-alveolar lavage, but aerosol delivery of FI6 reduced gross pathology significantly. We demonstrate that pig Fc receptors do not bind human IgG1 and that FI6 did not mediate antibody-dependent cytotoxicity (ADCC) with pig PBMC, confirming that ADCC is an important mechanism of protection by anti-stem antibodies in vivo . Enhanced respiratory disease, which has been associated with pigs with cross-reactive non-neutralizing anti-HA antibodies, did not occur after FI6 administration. Our results also show that in vitro neutralizing antibody responses are not a robust correlate of protection for the control of influenza infection and pathology in a natural host model.
Cardiovascular protection of magnolol: cell-type specificity and dose-related effects
2012-01-01
Magnolia officinalis has been widely used in traditional Chinese medicine. Magnolol, an active component isolated from Magnolia officinalis, is known to be a cardiovascular protector since 1994. The multiplex mechanisms of magnolol on cardiovascular protection depends on cell types and dosages, and will be reviewed and discussed in this article. Magnolol under low and moderate dosage possesses the ability to protect heart from ischemic/reperfusion injury, reduces atherosclerotic change, protects endothelial cell against apoptosis and inhibits neutrophil-endothelial adhesion. The moderate to high concentration of magnolol mainly acts on smooth muscle cells and platelets. Magnolol induces apoptosis in vascular smooth muscle cells at moderate concentration and inhibits proliferation at moderate and high concentration. High concentration of magnolol also abrogates platelet activation, aggregation and thrombus formation. Magnolol also serves as an smooth muscle relaxant only upon the high concentration. Oral intake of magnolol to reach the therapeutic level for cardiovascular protection is applicable, thus makes magnolol an agent of great potential for preventing cardiovascular diseases in high-risk patients. PMID:22849814
Cardiovascular protection of magnolol: cell-type specificity and dose-related effects.
Ho, Jennifer Hui-Chun; Hong, Chuang-Ye
2012-07-31
Magnolia officinalis has been widely used in traditional Chinese medicine. Magnolol, an active component isolated from Magnolia officinalis, is known to be a cardiovascular protector since 1994. The multiplex mechanisms of magnolol on cardiovascular protection depends on cell types and dosages, and will be reviewed and discussed in this article. Magnolol under low and moderate dosage possesses the ability to protect heart from ischemic/reperfusion injury, reduces atherosclerotic change, protects endothelial cell against apoptosis and inhibits neutrophil-endothelial adhesion. The moderate to high concentration of magnolol mainly acts on smooth muscle cells and platelets. Magnolol induces apoptosis in vascular smooth muscle cells at moderate concentration and inhibits proliferation at moderate and high concentration. High concentration of magnolol also abrogates platelet activation, aggregation and thrombus formation. Magnolol also serves as an smooth muscle relaxant only upon the high concentration. Oral intake of magnolol to reach the therapeutic level for cardiovascular protection is applicable, thus makes magnolol an agent of great potential for preventing cardiovascular diseases in high-risk patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pace, Brenda Ringe; Gilbert, Hollie Kae
2015-05-01
This plan addresses cultural resource protection procedures to be implemented during construction of the Remote Handled Low Level Waste project at the Idaho National Laboratory. The plan proposes pre-construction review of proposed ground disturbing activities to confirm avoidance of cultural resources. Depending on the final project footprint, cultural resource protection strategies might also include additional survey, protective fencing, cultural resource mapping and relocation of surface artifacts, collection of surface artifacts for permanent curation, confirmation of undisturbed historic canal segments outside the area of potential effects for construction, and/or archaeological test excavations to assess potential subsurface cultural deposits at known culturalmore » resource locations. Additionally, all initial ground disturbing activities will be monitored for subsurface cultural resource finds, cultural resource sensitivity training will be conducted for all construction field personnel, and a stop work procedure will be implemented to guide assessment and protection of any unanticipated discoveries after initial monitoring of ground disturbance.« less
2013-01-01
Assessing the detrimental health effects of chemicals requires the extrapolation of experimental data in animals to human populations. This is achieved by applying a default uncertainty factor of 100 to doses not found to be associated with observable effects in laboratory animals. It is commonly assumed that the toxicokinetic and toxicodynamic sub-components of this default uncertainty factor represent worst-case scenarios and that the multiplication of those components yields conservative estimates of safe levels for humans. It is sometimes claimed that this conservatism also offers adequate protection from mixture effects. By analysing the evolution of uncertainty factors from a historical perspective, we expose that the default factor and its sub-components are intended to represent adequate rather than worst-case scenarios. The intention of using assessment factors for mixture effects was abandoned thirty years ago. It is also often ignored that the conservatism (or otherwise) of uncertainty factors can only be considered in relation to a defined level of protection. A protection equivalent to an effect magnitude of 0.001-0.0001% over background incidence is generally considered acceptable. However, it is impossible to say whether this level of protection is in fact realised with the tolerable doses that are derived by employing uncertainty factors. Accordingly, it is difficult to assess whether uncertainty factors overestimate or underestimate the sensitivity differences in human populations. It is also often not appreciated that the outcome of probabilistic approaches to the multiplication of sub-factors is dependent on the choice of probability distributions. Therefore, the idea that default uncertainty factors are overly conservative worst-case scenarios which can account both for the lack of statistical power in animal experiments and protect against potential mixture effects is ill-founded. We contend that precautionary regulation should provide an incentive to generate better data and recommend adopting a pragmatic, but scientifically better founded approach to mixture risk assessment. PMID:23816180
Martin, Olwenn V; Martin, Scholze; Kortenkamp, Andreas
2013-07-01
Assessing the detrimental health effects of chemicals requires the extrapolation of experimental data in animals to human populations. This is achieved by applying a default uncertainty factor of 100 to doses not found to be associated with observable effects in laboratory animals. It is commonly assumed that the toxicokinetic and toxicodynamic sub-components of this default uncertainty factor represent worst-case scenarios and that the multiplication of those components yields conservative estimates of safe levels for humans. It is sometimes claimed that this conservatism also offers adequate protection from mixture effects. By analysing the evolution of uncertainty factors from a historical perspective, we expose that the default factor and its sub-components are intended to represent adequate rather than worst-case scenarios. The intention of using assessment factors for mixture effects was abandoned thirty years ago. It is also often ignored that the conservatism (or otherwise) of uncertainty factors can only be considered in relation to a defined level of protection. A protection equivalent to an effect magnitude of 0.001-0.0001% over background incidence is generally considered acceptable. However, it is impossible to say whether this level of protection is in fact realised with the tolerable doses that are derived by employing uncertainty factors. Accordingly, it is difficult to assess whether uncertainty factors overestimate or underestimate the sensitivity differences in human populations. It is also often not appreciated that the outcome of probabilistic approaches to the multiplication of sub-factors is dependent on the choice of probability distributions. Therefore, the idea that default uncertainty factors are overly conservative worst-case scenarios which can account both for the lack of statistical power in animal experiments and protect against potential mixture effects is ill-founded. We contend that precautionary regulation should provide an incentive to generate better data and recommend adopting a pragmatic, but scientifically better founded approach to mixture risk assessment.
Doubova, Svetlana V; Pérez-Cuevas, Ricardo; Canning, David; Reich, Michael R
2015-01-01
Objectives While the benefits of Seguro Popular health insurance in Mexico relative to no insurance have been widely documented, little has been reported on its effects relative to the pre-existing Social Security health insurance. We analyse the effects of Social Security and Seguro Popular health insurances in Mexico on access to healthcare of older adults, and on financial risk protection to their households, compared with older adults without health insurance. Setting Secondary data analysis was performed using the 2012 Mexican Survey of Health and Nutrition (ENSANUT). Participants The study population comprised 18 847 older adults and 13 180 households that have an elderly member. Outcome measures The dependent variables were access to healthcare given the reported need, the financial burden imposed by health expenditures measured through catastrophic health-related expenditures, and using savings for health-related expenditures. Separate propensity score matching analyses were conducted for each comparison. The analysis for access was performed at the individual level, and the analysis for financial burden at the household level. In each case, matching on a wide set of relevant characteristics was achieved. Results Seguro Popular showed a protective effect against lack of access to healthcare for older adults compared with those with no insurance. The average treatment effect on the treated (ATET) was ascertained through using the nearest-neighbour matching (−8.1%, t-stat −2.305) analysis. However, Seguro Popular did not show a protective effect against catastrophic expenditures in a household where an older adult lived. Social Security showed increased access to healthcare (ATET −11.3%, t-stat −3.138), and protective effect against catastrophic expenditures for households with an elderly member (ATET −1.9%, t-stat −2.178). Conclusions Seguro Popular increased access to healthcare for Mexican older adults. Social Security showed a significant protective effect against lack of access and catastrophic expenditures compared with those without health insurance. PMID:26198427
Hot steam transfer through heat protective clothing layers.
Rossi, René; Indelicato, Eric; Bolli, Walter
2004-01-01
The aim of this study was to analyse the transfer of steam through different types of textile layers as a function of sample parameters such as thickness and permeability. In order to simulate the human body, a cylinder releasing defined amounts of moisture was also used. The influence of sweating on heat and mass transfer was assessed. The results show that in general impermeable materials offer better protection against hot steam than semi-permeable ones. The transfer of steam depended on the water vapour permeability of the samples, but also on their thermal insulation and their thickness. Increasing the thickness of the samples with a spacer gave a larger increase in protection with the impermeable samples compared to semi-permeable materials. Measurements with pre-wetted samples showed a reduction in steam protection in any case. On the other hand, the measurements with a sweating cylinder showed a beneficial effect of sweating.
Bayer Andersen, Kirsten; Leander Johansen, Jens; Hentzer, Morten; Smith, Garrick Paul; Dietz, Gunnar P. H.
2016-01-01
The G-protein coupled receptor 139 (GPR139) is expressed specifically in the brain in areas of relevance for motor control. GPR139 function and signal transduction pathways are elusive, and results in the literature are even contradictory. Here, we examined the potential neuroprotective effect of GPR139 agonism in primary culture models of dopaminergic (DA) neuronal degeneration. We find that in vitro GPR139 agonists protected primary mesencephalic DA neurons against 1-methyl-4-phenylpyridinium (MPP+)-mediated degeneration. Protection was concentration-dependent and could be blocked by a GPR139 antagonist. However, the protection of DA neurons was not found against rotenone or 6-hydroxydopamine (6-OHDA) mediated degeneration. Our results support differential mechanisms of toxicity for those substances commonly used in Parkinson’s disease (PD) models and potential for GPR139 agonists in neuroprotection. PMID:27445691
Couvreur, Odile; Ferezou, Jacqueline; Gripois, Daniel; Serougne, Colette; Crépin, Delphine; Aubourg, Alain; Gertler, Arieh; Vacher, Claire-Marie; Taouis, Mohammed
2011-01-01
Background Metabolic and endocrine environment during early life is crucial for metabolic imprinting. When dams were fed a high fat diet (HF diet), rat offspring developed hypothalamic leptin resistance with lean phenotype when weaned on a normal diet. Interestingly, when grown on the HF diet, they appeared to be protected against the effects of HF diet as compared to offspring of normally fed dams. The mechanisms involved in the protective effect of maternal HF diet are unclear. Methodology/Principal Findings We thus investigated the impact of maternal high fat diet on offspring subjected to normal or high palatable diet (P diet) on metabolic and endocrine parameters. We compared offspring born to dams fed P or HF diet. Offspring born to dams fed control or P diet, when fed P diet exhibited a higher body weight, altered hypothalamic leptin sensitivity and metabolic parameters suggesting that maternal P diet has no protective effect on offspring. Whereas, maternal HF diet reduces body weight gain and circulating triglycerides, and ameliorates corpulence index of offspring, even when subjected to P diet. Interestingly, this protective effect is differently expressed in male and female offspring. Male offspring exhibited higher energy expenditure as mirrored by increased hypothalamic UCP-2 and liver AdipoR1/R2 expression, and a profound change in the arcuate nucleus astrocytic organization. In female offspring, the most striking impact of maternal HF diet is the reduced hypothalamic expression of NPY and POMC. Conclusions/Significance HF diet given during gestation and lactation protects, at least partially, offspring from excessive weight gain through several mechanisms depending upon gender including changes in arcuate nucleus astrocytic organization and increased hypothalamic UCP-2 and liver AdipoR1/2 expression in males and reduced hypothalamic expression of NPY and POMC in females. Taken together our results reveal new mechanisms involved in the protective effect of maternal HF diet. PMID:21464991
Bae, Jong-Sup; Yang, Likui; Rezaie, Alireza R
2010-11-05
We recently demonstrated that the Gla domain-dependent interaction of protein C with endothelial protein C receptor (EPCR) leads to dissociation of the receptor from caveolin-1 and recruitment of PAR-1 to a protective signaling pathway. Thus, the activation of PAR-1 by either thrombin or PAR-1 agonist peptide elicited a barrier-protective response if endothelial cells were preincubated with protein C. In this study, we examined whether other vitamin K-dependent coagulation protease zymogens can modulate PAR-dependent signaling responses in endothelial cells. We discovered that the activation of both PAR-1 and PAR-2 in endothelial cells pretreated with factor FX (FX)-S195A, but not other procoagulant protease zymogens, also results in initiation of protective intracellular responses. Interestingly, similar to protein C, FX interaction with endothelial cells leads to dissociation of EPCR from caveolin-1 and recruitment of PAR-1 to a protective pathway. Further studies revealed that, FX activated by factor VIIa on tissue factor bearing endothelial cells also initiates protective signaling responses through the activation of PAR-2 independent of EPCR mobilization. All results could be recapitulated by the receptor agonist peptides to both PAR-1 and PAR-2. These results suggest that a cross-talk between EPCR and an unknown FX/FXa receptor, which does not require interaction with the Gla domain of FX, recruits PAR-1 to protective signaling pathways in endothelial cells.
Hepatoprotective Effects of Corilagin Following Hemorrhagic Shock are Through Akt-Dependent Pathway
Liu, Fu-Chao; Chaudry, Irshad H.; Yu, Huang-Ping
2017-01-01
ABSTRACT Corilagin, a component of Phyllanthus urinaria extract, possesses antioxidant, thrombolytic, antiatherogenic, and hepatoprotective properties, but the mechanism underlying these effects remains unclear. Previous studies showed that the Akt (protein kinase B) signaling pathway exerts anti-inflammatory and organ protective effects. The aim of this study was to investigate the mechanism of action of corilagin and determine whether these effects are mediated through the Akt-dependent pathway in a trauma-hemorrhagic shock-induced liver injury rodent model. Hemorrhagic shock was induced in male Sprague–Dawley rats; mean blood pressure was maintained at 35 mm Hg to 40 mm Hg for 90 min, followed by fluid resuscitation. During resuscitation, three doses of corilagin alone (1 mg/kg, 5 mg/kg, or 10 mg/kg, intravenously) were administered. Furthermore, a single dose of corilagin (5 mg/kg) with and without Wortmannin (1 mg/kg, PI3K inhibitor), Wortmannin alone, or vehicle was administered. Twenty-four hours after resuscitation, plasma alanine aminotransferase and aspartate aminotransferase concentration and hepatic parameters were measured. One-way ANOVA was used for statistical analysis. Hepatic myeloperoxidase activity and the concentrations of plasma alanine aminotransferase and aspartate aminotransferase, interleukin-6, tumor necrosis factor-α, intercellular adhesion molecule-1, and cytokine-induced neutrophil chemoattractant-1 (CINC-1) and CINC-3 increased following hemorrhagic shock. These parameters were significantly attenuated in corilagin-treated rats following hemorrhagic shock. Hepatic phospho-Akt expression was also higher in corilagin-treated rats than in vehicle-treated rats. The elevation of phospho-Akt was abolished by combined treatment with Wortmannin and corilagin. Our results suggest that corilagin exerts its protective effects on hemorrhagic shock-induced liver injury, at least, via the Akt-dependent pathway. PMID:27559697
CD73-deficient mice have increased antitumor immunity and are resistant to experimental metastasis.
Stagg, John; Divisekera, Upulie; Duret, Helene; Sparwasser, Tim; Teng, Michele W L; Darcy, Phillip K; Smyth, Mark J
2011-04-15
CD73 is a cell-surface enzyme that suppresses immune responses by producing extracellular adenosine. In this study, we employed CD73 gene-targeted mice to investigate the role of host-derived CD73 on antitumor immunity and tumor cell metastasis. We found that CD73 ablation significantly suppressed the growth of ovalbumin-expressing MC38 colon cancer, EG7 lymphoma, AT-3 mammary tumors, and B16F10 melanoma. The protective effect of CD73 deficiency on primary tumors was dependent on CD8(+) T cells and associated with an increased frequency of antigen-specific CD8(+) T cells in peripheral blood and tumors and increased antigen-specific IFN-γ production. Replicate studies in bone marrow chimeras established that both hematopoietic and nonhematopoietic expression of CD73 was important to promote tumor immune escape. Using adoptive reconstitution of T regulatory cell (Treg)-depleted DEREG (depletion of regulatory T cells) mice, we demonstrated that part of the protumorigenic effect of Tregs was dependent on their expression of CD73. CD73-deficient mice were also protected against pulmonary metastasis of B16F10 melanoma cells after intravenous injection. Unexpectedly, we found that the prometastatic effect of host-derived CD73 was dependent on CD73 expression on nonhematopoietic cells. CD73 expression on nonhematopoietic cells, most likely endothelial cells, was critical for promoting lung metastasis in a manner independent from immunosuppressive effects. Notably, in vivo blockade of CD73 with a selective inhibitor or anti-CD73 monoclonal antibody significantly reduced tumor growth and metastasis of CD73-negative tumors. Taken together, our findings indicate that CD73 may be targeted at multiple levels to induce anticancer effects including at the level of tumor cells, Tregs, and nonhematopoietic cells. ©2011 AACR.
Zheng, Xiaochun; Chen, Feng; Zheng, Ting; Huang, Fengyi; Chen, Jianghu; Tu, Wenshao
2016-05-01
Tricyclic antidepressant amitriptyline (AM) has been shown to exert neurotrophic activity on neurons. We thus explored whether AM may aid the neuronal development and protect anesthesia-induced neuro-injury in young spinal cord dorsal root ganglion (DRG) neurons.The DRG explants were prepared from 1-day-old rats. The effect of AM on aiding DRG neural development was examined by immunohistochemistry at dose-dependent manner. AM-induced changes in gene and protein expressions, and also phosphorylation states of tyrosine kinases receptor A (TrkA) and B (TrkB) in DRG, were examined by quantitative real-time polymerase chain reaction and western blot. The effect of AM on attenuating lidocaine-induced DRG neurodegeneration was examined by immunohistochemistry, and small interfering RNA (siRNA)-mediated TrkA/B down-regulation.Amitriptyline stimulated DRG neuronal development in dose-dependent manner, but exerted toxic effect at concentrations higher than 10 M. AM activated TrkA in DRG through phosphorylation, whereas it had little effect on TrkB-signaling pathway. AM reduced lidocaine-induced DRG neurodegeneration by regenerating neurites and growth cones. Moreover, the neuroprotection of AM on lidocaine-injured neurodegeneration was blocked by siRNA-mediated TrkA down-regulation, but not by TrkB down-regulation.Amitriptyline facilitated neuronal development and had protective effect on lidocaine-induced neurodegeneration, very likely through the activation of TrkA-signaling pathway in DRG.
A Preliminary Investigation of the Predictors of Tanning Dependence
Heckman, Carolyn J.; Egleston, Brian L.; Wilson, Diane B.; Ingersoll, Karen S.
2014-01-01
Objectives To investigate possible predictors of tanning dependence including demographic variables, exposure and protective behaviors, and other health-related behaviors. Methods This study consisted of an online survey of 400 students and other volunteers from a university community. Results Twenty-seven percent of the sample was classified as tanning dependent. Tanning dependence was predicted by ethnicity and skin type, indoor and outdoor tanning and burning, and lower skin protective behaviors, as well as smoking and body mass index. Conclusions Young adults are at risk for tanning dependence, which can be predicted by specific demographic and behavioral variables. PMID:18241130
Pascua-Maestro, Raquel; Diez-Hermano, Sergio; Lillo, Concepción; Ganfornina, Maria D; Sanchez, Diego
2017-02-01
Environmental insults such as oxidative stress can damage cell membranes. Lysosomes are particularly sensitive to membrane permeabilization since their function depends on intraluminal acidic pH and requires stable membrane-dependent proton gradients. Among the catalog of oxidative stress-responsive genes is the Lipocalin Apolipoprotein D (ApoD), an extracellular lipid binding protein endowed with antioxidant capacity. Within the nervous system, cell types in the defense frontline, such as astrocytes, secrete ApoD to help neurons cope with the challenge. The protecting role of ApoD is known from cellular to organism level, and many of its downstream effects, including optimization of autophagy upon neurodegeneration, have been described. However, we still cannot assign a cellular mechanism to ApoD gene that explains how this protection is accomplished. Here we perform a comprehensive analysis of ApoD intracellular traffic and demonstrate its role in lysosomal pH homeostasis upon paraquat-induced oxidative stress. By combining single-lysosome in vivo pH measurements with immunodetection, we demonstrate that ApoD is endocytosed and targeted to a subset of vulnerable lysosomes in a stress-dependent manner. ApoD is functionally stable in this acidic environment, and its presence is sufficient and necessary for lysosomes to recover from oxidation-induced alkalinization, both in astrocytes and neurons. This function is accomplished by preventing lysosomal membrane permeabilization. Two lysosomal-dependent biological processes, myelin phagocytosis by astrocytes and optimization of neurodegeneration-triggered autophagy in a Drosophila in vivo model, require ApoD-related Lipocalins. Our results uncover a previously unknown biological function of ApoD, member of the finely regulated and evolutionary conserved gene family of extracellular Lipocalins. They set a lipoprotein-mediated regulation of lysosomal membrane integrity as a new mechanism at the hub of many cellular functions, critical for the outcome of a wide variety of neurodegenerative diseases. These results open therapeutic opportunities by providing a route of entry and a repair mechanism for lysosomes in pathological situations.
Salamander abundance along road edges and within abandoned logging roads in Appalachian forests.
Semlitsch, Raymond D; Ryan, Travis J; Hamed, Kevin; Chatfield, Matt; Drehman, Bethany; Pekarek, Nicole; Spath, Mike; Watland, Angie
2007-02-01
Roads may be one of the most common disturbances in otherwise continuous forested habitat in the southern Appalachian Mountains. Despite their obvious presence on the landscape, there is limited data on the ecological effects along a road edge or the size of the "road-effect zone." We sampled salamanders at current and abandoned road sites within the Nantahala National Forest, North Carolina (U.S.A.) to determine the road-effect zone for an assemblage of woodland salamanders. Salamander abundance near the road was reduced significantly, and salamanders along the edges were predominantly large individuals. These results indicate that the road-effect zone for these salamanders extended 35 m on either side of the relatively narrow, low-use forest roads along which we sampled. Furthermore, salamander abundance was significantly lower on old, abandoned logging roads compared with the adjacent upslope sites. These results indicate that forest roads and abandoned logging roads have negative effects on forest-dependent species such as plethodontid salamanders. Our results may apply to other protected forests in the southern Appalachians and may exemplify a problem created by current and past land use activities in all forested regions, especially those related to road building for natural-resource extraction. Our results show that the effect of roads reached well beyond their boundary and that abandonment or the decommissioning of roads did not reverse detrimental ecological effects; rather, our results indicate that management decisions have significant repercussions for generations to come. Furthermore, the quantity of suitable forested habitat in the protected areas we studied was significantly reduced: between 28.6% and 36.9% of the area was affected by roads. Management and policy decisions must use current and historical data on land use to understand cumulative impacts on forest-dependent species and to fully protect biodiversity on national lands.
Nilakantan, Vani; Liang, Huanling; Mortensen, Jordan; Taylor, Erin; Johnson, Christopher P
2010-02-01
The role of mitochondrial K(ATP) (mitoK(ATP)) channels in renal ischemia-reperfusion injury is controversial with studies showing both protective and deleterious effects. In this study, we compared the effects of the putative mitoK(ATP) opener, diazoxide, and the mitoK(ATP) blocker, 5-hydroxydecanoate (5-HD) on cytotoxicity and apoptosis in tubular epithelial cells derived from rat (NRK-52E) and pig (LLC-PK1) following in vitro ischemic injury. Following ATP depletion-recovery, there was a significant increase in cytotoxicity in both NRK cells and LLC-PK1 cells although NRK cells were more sensitive to the injury. Diazoxide treatment attenuated cytotoxicity in both cell types and 5-HD treatment-increased cytotoxicity in the sensitive NRK cells in a superoxide-dependant manner. The protective effect of diazoxide was also reversed in the presence of 5-HD in ATP-depleted NRK cells. The ATP depletion-mediated increase in superoxide was enhanced by both diazoxide and 5-HD with the effect being more pronounced in the cells undergoing 5-HD treatment. Further, ATP depletion-induced activation of caspase-3 was decreased by diazoxide in NRK cells. In order to determine the signaling pathways involved in apoptosis, we examined the activation of Erk and JNK in ATP-depleted NRK cells. Diazoxide-activated Erk in ATP-depleted cells, but did not have any effect on JNK activation. In contrast, 5-HD did not impact Erk levels but increased JNK activation even under controlled conditions. Further, the use of a JNK inhibitor with 5-HD reversed the deleterious effects of 5-HD. This study demonstrates that in cells that are sensitive to ATP depletion-recovery, mitoK(ATP) channels protect against ATP depletion-mediated cytotoxicity and apoptosis through Erk- and JNK-dependant mechanisms.
Fuller, R W; Hemrick-Luecke, S K; Ornstein, P L
1992-10-01
LY274614, 3SR,4aRS,6SR,8aRS-6-[phosphonomethyl]decahydr oisoquinoline-3- carboxylic acid, has been described as a potent antagonist of the N-methyl-D-aspartate (NMDA) subtype of glutamate receptor. Here its ability to antagonize the prolonged depletion of dopamine in the striatum by amphetamine in iprindole-treated rats is reported. A single 18.4 mg/kg (i.p.) dose of (+/-)-amphetamine hemisulfate, given to rats pretreated with iprindole, resulted in persistent depletion of dopamine in the striatum 1 week later. This prolonged depletion of dopamine in the striatum was antagonized by dizocilpine (MK-801, a non-competitive antagonist of NMDA receptors) or by LY274614 (a competitive antagonist of NMDA receptors). The protective effect of LY274614 was dose-dependent, being maximum at 10-40 mgkg (i.p.). A 10 mg/kg dose of LY274614 was effective in antagonizing the depletion of dopamine in the striatum, when given as long as 8 hr prior to amphetamine but not when given 24 hr prior to amphetamine. Depletion of dopamine in the striatum was also antagonized when LY274614 was given after the injection of amphetamine; LY274614 protected when given up to 4 hr after but not when given 8 or 24 hr after amphetamine. The prolonged depletion of dopamine in the striatum in mice, given multiple injections of methamphetamine, was also antagonized dose-dependently and completely by LY274614. The data strengthen the evidence that the neurotoxic effect of amphetamine and related compounds toward nigrostriatal dopamine neurons involves NMDA receptors and that LY274614 is an NMDA receptor antagonist with long-lasting in vivo effects in rats.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shibuya, Akiko; Onda, Kenji, E-mail: knjond@toyaku.ac.jp; Kawahara, Hirofumi
2010-07-30
Research highlights: {yields} Sofalcone increases HO-1 in gastric epithelial cells. {yields} The induction of HO-1 by sofalcone treatment follows the activation of Nrf2. {yields} The production of VEGF by sofalcone treatment is mediated by HO-1 induction. -- Abstract: Sofalcone, 2'-carboxymethoxy-4,4-bis(3-methyl-2-butenyloxy)chalcone, is an anti-ulcer agent that is classified as a gastric mucosa protective agent. Recent studies indicate heat shock proteins such as HSP32, also known as heme-oxygenase-1(HO-1), play important roles in protecting gastrointestinal tissues from several stresses. We have previously reported that sofalcone increases the expression of HO-1 in adipocytes and pre-adipocytes, although the effect of sofalcone on HO-1 induction inmore » gastrointestinal tissues is not clear. In the current study, we investigated the effects of sofalcone on the expression of HO-1 and its functional role in rat gastric epithelial (RGM-1) cells. We found that sofalcone increased HO-1 expression in RGM-1 cells in both time- and concentration-dependent manners. The HO-1 induction was associated with the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in RGM-1 cells. We also observed that sofalcone increased vascular endothelial growth factor (VEGF) production in the culture medium. Treatment of RGM-1 cells with an HO-1 inhibitor (tin-protoporphyrin), or HO-1 siRNA inhibited sofalcone-induced VEGF production, suggesting that the effect of sofalcone on VEGF expression is mediated by the HO-1 pathway. These results suggest that the gastroprotective effects of sofalcone are partly exerted via Nrf2-HO-1 activation followed by VEGF production.« less
Moringa oleifera Leaf Extract: Beneficial Effects on Cadmium Induced Toxicities - A Review
Mallya, Roopashree; Vinodini, NA; Chatterjee, Poulomi; Mithra, Prasanna
2017-01-01
Environment has been contaminated by heavy metals ever since the original magma of earth has solidified. One such toxin is cadmium. Cadmium that has been around since the industrial age, is considered hazardous both to us and to the environment. From time immemorial man is dependent on plants available in nature for several health benefits. Moringa oleifera, has nutritional, pharmacological and antioxidant properties, thus having several medicinal applications. In the present article, we discuss the dose and time dependent damage due to exposure to cadmium on kidneys, liver, testis, lipid profile and haematological parameters in adult Wistar rats and the protective effects of Moringa oleifera (pre-treatment) on cadmium induced damage. PMID:28571135
Cheminay, Cédric; Körner, Jana; Bernig, Constanze; Brückel, Michael; Feigl, Markus; Schletz, Martin; Suter, Mark; Chaplin, Paul; Volkmann, Ariane
2018-04-25
Newborns are considered difficult to protect against infections shortly after birth, due to their ineffective immune system that shows quantitative and qualitative differences compared to adults. However, here we show that a single vaccination of mice at birth with a replication-deficient live vaccine Modified Vaccinia Ankara [MVA] efficiently induces antigen-specific B- and T-cells that fully protect against a lethal Ectromelia virus challenge. Protection was induced within 2 weeks and using genetically modified mice we show that this protection was mainly T-cell dependent. Persisting immunological T-cell memory and neutralizing antibodies were obtained with the single vaccination. Thus, MVA administered as early as at birth induced immediate and long-term protection against an otherwise fatal disease and appears attractive as a new generation smallpox vaccine that is effective also in children. Moreover, it may have the potential to serve as platform for childhood vaccines as indicated by measles specific T- and B-cell responses induced in newborn mice vaccinated with recombinant MVA expressing measles antigens. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zhao, Jingling; Chen, Lei; Shu, Bin; Tang, Jinming; Zhang, Lijun; Xie, Julin; Liu, Xusheng; Xu, Yingbin; Qi, Shaohai
2015-08-01
Endothelial dysfunction is a major characteristic of diabetic vasculopathy. Protection of the vascular endothelium is an essential aspect of preventing and treating diabetic vascular complications. Although Angiopoietin-1 (Ang-1) is an important endothelial-specific protective factor, whether Ang-1 protects vascular cells undergoing advanced glycation end product (AGE) injury has not been investigated. The aim of the present study was to determine the potential effects of Ang-1 on endothelial cells after exposure to AGE. We show here that Ang-1 prevented AGE-induced vascular leakage by enhancing the adherens junctions between endothelial cells, and this process was mediated by the phosphorylation and membrane localization of VE-cadherin. Furthermore, Ang-1 also protected endothelial cells from AGE-induced death by regulating phosphatidylinositol 3-kinase (PI3K)/Akt-dependent Bad phosphorylation. Our findings suggest that the novel protective mechanisms of Ang-1 on endothelium are achieved by strengthening endothelial cell junctions and reducing endothelial cell death after AGE injury. © 2014 Wiley Periodicals, Inc.
Huo, Yazhen; Win, Sanda; Than, Tin Aung; Yin, Shutao; Ye, Min
2017-01-01
Abstract Aim: Antrodia Camphorate (AC) is a mushroom that is widely used in Asian countries to prevent and treat various diseases, including liver diseases. However, the active ingredients that contribute to the biological functions remain elusive. The purpose of the present study is to test the hepatoprotective effect of Antcin H, a major triterpenoid chemical isolated from AC, in murine models of acute liver injury. Results: We found that Antcin H pretreatment protected against liver injury in both acetaminophen (APAP) and galactosamine/tumor necrosis factor (TNF)α models. More importantly, Antcin H also offered a significant protection against acetaminophen-induced liver injury when it was given 1 h after acetaminophen. The protection was verified in primary mouse hepatocytes. Antcin H prevented sustained c-Jun-N-terminal kinase (JNK) activation in both models. We excluded an effect of Antcin H on acetaminophen metabolism and TNF receptor signaling and excluded a direct effect as a free radical scavenger or JNK inhibitor. Since the sustained JNK activation through its interaction with mitochondrial Sab, leading to increased mitochondrial reactive oxygen species (ROS), is pivotal in both models, we examined the effect of Antcin H on p-JNK binding to mitochondria and impairment of mitochondrial respiration. Antcin H inhibited the direct effect of p-JNK on isolated mitochondrial function and binding to isolated mitochondria. Innovation and Conclusion: Our study has identified Antcin H as a novel active ingredient that contributes to the hepatoprotective effect of AC, and Antcin H protects against liver injury through disruption of the binding of p-JNK to Sab, which interferes with the ROS-dependent self-sustaining activation of MAPK cascade. Antioxid. Redox Signal. 26, 207–220. PMID:27596680
Cadet, J L; Ordonez, S V; Ordonez, J V
1997-02-01
Methamphetamine (METH) is an amphetamine analog that produces degeneration of the dopaminergic system in mammals. The neurotoxic effects of the drug are thought to be mediated by oxygen-based free radicals. In the present report, we have used immortalized neural cells obtained from rat mesencephalon in order to further assess the role of oxidative stress in METH-induced neurotoxicity. We thus tested if the anti-death proto-oncogene, bcl-2 could protect against METH-induced cytotoxicity. METH caused dose-dependent loss of cellular viability in control cells while bcl-2-expressing cells were protected against these deleterious effects. Using flow cytometry, immunofluorescent staining, and DNA electrophoresis, we also show that METH exposure can cause DNA strand breaks, chromatin condensation, nuclear fragmentation, and DNA laddering. All these changes were prevented by bcl-2 expression. These observations provide further support for the involvement of oxidative stress in the toxic effects of amphetamine analogs. They also document that METH-induced cytotoxicity is secondary to apoptosis. These findings may be of relevance to the cause(s) of Parkinson's disease which involves degeneration of the nigrostriatal dopaminergic pathway.
Zheng, Jing; Inoguchi, Toyoshi; Sasaki, Shuji; Maeda, Yasutaka; McCarty, Mark F; Fujii, Masakazu; Ikeda, Noriko; Kobayashi, Kunihisa; Sonoda, Noriyuki; Takayanagi, Ryoichi
2013-01-15
We and other investigators have reported that bilirubin and its precursor biliverdin may have beneficial effects on diabetic vascular complications, including nephropathy, via its antioxidant effects. Here, we investigated whether phycocyanin derived from Spirulina platensis, a blue-green algae, and its chromophore phycocyanobilin, which has a chemical structure similar to that of biliverdin, protect against oxidative stress and renal dysfunction in db/db mice, a rodent model for Type 2 diabetes. Oral administration of phycocyanin (300 mg/kg) for 10 wk protected against albuminuria and renal mesangial expansion in db/db mice, and normalized tumor growth factor-β and fibronectin expression. Phycocyanin also normalized urinary and renal oxidative stress markers and the expression of NAD(P)H oxidase components. Similar antioxidant effects were observed following oral administration of phycocyanobilin (15 mg/kg) for 2 wk. Phycocyanobilin, bilirubin, and biliverdin also inhibited NADPH dependent superoxide production in cultured renal mesangial cells. In conclusion, oral administration of phycocyanin and phycocyanobilin may offer a novel and feasible therapeutic approach for preventing diabetic nephropathy.
2015-07-01
excess deficit, likely related to a flow dependent reduction in systemic oxygen consumption (VO2), but this effect was transient attain- ing values... oxygen delivery index; VO2, systemic oxygen consumption index; Hct, hematocrit, PaCO2, arterial PCO2; PETCO2, end-tidal PCO2. Table S1: Effect of...response that enabled maintaining oxygen consumption close to baseline resulting in minimal lactate increases and high resuscitability and survival without
Buprenorphine is protective against the depressive effects of norbuprenorphine on ventilation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Megarbane, Bruno; Marie, Nicolas; Pirnay, Stephane
2006-05-01
High dose buprenorphine is used as substitution treatment in heroin addiction. However, deaths have been reported in addicts using buprenorphine. The role of norbuprenorphine, an N-dealkyl metabolite of buprenorphine, was hypothesized to explain these fatal cases. We determined the median intravenous lethal dose (LD{sub 5}) of norbuprenorphine in male Sprague-Dawley rats. The effects of a single intravenous dose of 3 or 9 mg/kg norbuprenorphine alone on arterial blood gases were studied. Finally, the effect of pre- and post-administrations of buprenorphine on norbuprenorphine-induced changes on arterial blood gases were analyzed. Norbuprenorphine's LD{sub 5} was 10 mg kg{sup -1}. Norbuprenorphine 3 mgmore » kg{sup -1} produces the rapid onset of sustained respiratory depression, as demonstrated at 20 min by a maximal significant increase in PaCO{sub 2} (8.4 {+-} 0.9 versus 5.7 {+-} 0.1 kPa), decrease in arterial pH (7.25 {+-} 0.06 versus 7.44 {+-} 0.01), and hypoxia (8.3 {+-} 0.6 versus 11.1 {+-} 0.2 kPa). Buprenorphine not only protected against the effects of 3 mg kg{sup -1} norbuprenorphine in a dose-dependent manner but also reversed the effects when given afterward. Binding experiments suggest a role for mu- and to a lesser extent for delta-opioid receptors in buprenorphine protective effect against norbuprenorphine-induced respiratory depression. In conclusion, our data clearly show that norbuprenorphine alone causes important deleterious effects on ventilation in rats. However, buprenorphine protective effect calls into question the role for norbuprenorphine in respiratory toxicity associated with buprenorphine use.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seo-Young; Lee, Hae-June; Nam, Joo-Won
Purpose: We previously screened natural compounds and found that coniferyl aldehyde (CA) was identified as an inducer of HSF1. In this study, we further examined the protective effects of CA against ionizing radiation (IR) in normal cell system. Methods and Materials: Western blotting and reverse transcription-polymerase chain reaction tests were performed to evaluate expression of HSF1, HSP27, and HSP70 in response to CA. Cell death and cleavage of PARP and caspase-3 were analyzed to determine the protective effects of CA in the presence of IR or taxol. The protective effects of CA were also evaluated using animal models. Results: CAmore » increased stability of the HSF1 protein by phosphorylation at Ser326, which was accompanied by increased expression of HSP27 and HSP70. HSF1 phosphorylation at Ser326 by CA was mediated by EKR1/2 activation. Cotreatment of CA with IR or taxol in normal cells induced protective effects with phosphorylation- dependent patterns at Ser326 of HSF1. The decrease in bone marrow (BM) cellularity and increase of terminal deoxynucleotidyl transferase dUTP nick end labeling–positive BM cells by IR were also significantly inhibited by CA in mice (30.6% and 56.0%, respectively). A549 lung orthotopic lung tumor model indicated that CA did not affect the IR-mediated reduction of lung tumor nodules, whereas CA protected normal lung tissues from the therapeutic irradiation. Conclusions: These results suggest that CA may be useful for inducing HSF1 to protect against normal cell damage after IR or chemotherapeutic agents.« less
Who owns the Brazilian carbon?
Freitas, Flavio L M; Englund, Oskar; Sparovek, Gerd; Berndes, Göran; Guidotti, Vinicius; Pinto, Luís F G; Mörtberg, Ulla
2018-05-01
Brazil is one of the major contributors to land-use change emissions, mostly driven by agricultural expansion for food, feed, and bioenergy feedstock. Policies to avoid deforestation related to private commitments, economic incentives, and other support schemes are expected to improve the effectiveness of current command and control mechanisms increasingly. However, until recently, land tenure was unknown for much of the Brazilian territory, which has undermined the governance of native vegetation and challenged support and incentive mechanisms for avoiding deforestation. We assess the total extent of public governance mechanisms protecting aboveground carbon (AGC) stocks. We constructed a land tenure dataset for the entire nation and modeled the effects and uncertainties of major land-use acts on protecting AGC stocks. Roughly 70% of the AGC stock in Brazil is estimated to be under legal protection, and an additional 20% is expected to be protected after areas in the Amazon with currently undesignated land undergo a tenure regularization. About 30% of the AGC stock is on private land, of which roughly two-thirds are protected. The Cerrado, Amazon, and Caatinga biomes hold about 40%, 30%, and 20% of the unprotected AGC, respectively. Effective conservation of protected and unprotected carbon will depend on successful implementation of the Forest Act, and regularization of land tenure in the Amazon. Policy development that prioritizes unprotected AGC stocks is warranted to promote conservation of native vegetation beyond the legal requirements. However, different biomes and land tenure structures may require different policy settings considering local and regional specifics. Finally, the fate of current AGC stocks relies upon effective implementation of command and control mechanisms, considering that unprotected AGC in native vegetation on private land only accounts for 6.5% of the total AGC stock. © 2017 John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Sulman, B. N.; Phillips, R.; Shevliakova, E.; Oishi, A. C.; Pacala, S. W.
2014-12-01
The sensitivity of soil organic carbon (SOC) to changing environmental conditions represents a critical uncertainty in coupled carbon cycle-climate models. Much of this uncertainty arises from our limited understanding of the extent to which plants induce SOC losses (through accelerated decomposition or "priming") or promote SOC gains (via stabilization through physico-chemical protection). We developed a new SOC model, "Carbon, Organisms, Rhizosphere and Protection in the Soil Environment" (CORPSE), to examine the net effect of priming and protection in response to rising atmospheric CO2, and conducted simulations of rhizosphere priming effects at both ecosystem and global scales. At the ecosystem scale, the model successfully captured and explained disparate SOC responses at the Duke and Oak Ridge free-air CO2 enrichment (FACE) experiments. We show that stabilization of "new" carbon in protected SOC pools may equal or exceed microbial priming of "old" SOC in ecosystems with readily decomposable litter (e.g. Oak Ridge). In contrast, carbon losses owing to priming dominate the net SOC response in ecosystems with more resistant litters (e.g. Duke). For global simulations, the model was fully integrated into the Geophysical Fluid Dynamics Laboratory (GFDL) land model LM3. Globally, priming effects driven by enhanced root exudation and expansion of the rhizosphere reduced SOC storage in the majority of terrestrial areas, partially counterbalancing SOC gains from the enhanced ecosystem productivity driven by CO2 fertilization. Collectively, our results suggest that SOC stocks globally depend not only on temperature and moisture, but also on vegetation responses to environmental changes, and that protected C may provide an important constraint on priming effects.
Khanna, S; Sen, C K; Roy, S; Christen, M O; Packer, L
1998-07-01
The protective effects of anethole dithiolethione (ADT) against H2O2- or 4-hydroxynonenal (HNE)-induced cytotoxicity in human Jurkat T cells were investigated. Jurkat T cells were pretreated with ADT (10-50 microM) for 18 hr and then challenged with H202 or HNE for up to 4 hr. Cytotoxicity was assessed by measuring: 1) leakage of lactate dehydrogenase from cells to medium; and 2) exclusion of the DNA intercalating fluorescent probe propidium iodide by viable cells. Pretreatment of cells with ADT (10 or 25 microM) for 18 hr significantly protected cells against H202- or HNE-induced cytotoxicity. Treatment of cells with ADT (10-50 microM) for 72 hr significantly increased the activities of catalase and glutathione reductase. The maximum effect of ADT treatment on the activity of these enzymes was observed when cells were treated with 25 microM of ADT for 72 hr. A significant increase in cellular GSH was observed in cells that were treated with ADT for 72 hr. Using monobromobimane as a thiol probe, we consistently observed that cells pretreated for 18 hr with ADT (25 or 50 microM) had also increased total thiol content. Exposure of Jurkat T cells to H202 or HNE resulted in a time-dependent decrease in cellular GSH. ADT (10-50 microM, 18 hr) pretreatment circumvented H202-dependent lowering of cellular GSH. In conclusion, ADT proved to be a potent cytoprotective thiol antioxidant with multifaceted mechanisms of action, suggesting that the drug has a remarkable therapeutic potential.
Lai, Yi-Syuan; Chen, Wei-Cheng; Ho, Chi-Tang; Lu, Kuan-Hung; Lin, Shih-Hang; Tseng, Hui-Chun; Lin, Shuw-Yuan; Sheen, Lee-Yan
2014-06-25
This study investigated the protective properties of garlic essential oil (GEO) and its major organosulfur component (diallyl disulfide, DADS) against the development of nonalcoholic fatty liver disease (NAFLD). C57BL/6J mice were fed a normal or high-fat diet (HFD) with/without GEO (25, 50, and 100 mg/kg) or DADS (10 and 20 mg/kg) for 12 weeks. GEO and DADS dose-dependently exerted antiobesity and antihyperlipidemic effects by reducing HFD-induced body weight gain, adipose tissue weight, and serum biochemical parameters. Administration of 50 and 100 mg/kg GEO and 20 mg/kg DADS significantly decreased the release of pro-inflammatory cytokines in liver, accompanied by elevated antioxidant capacity via inhibition of cytochrome P450 2E1 expression during NAFLD development. The anti-NAFLD effects of GEO and DADS were mediated through down-regulation of sterol regulatory element binding protein-1c, acetyl-CoA carboxylase, fatty acid synthase, and 3-hydroxy-3-methylglutaryl-coenzyme A reductase, as well as stimulation of peroxisome proliferator-activated receptor α and carnitine palmitoyltransferase-1. These results demonstrate that GEO and DADS dose-dependently protected obese mice with long-term HFD-induced NAFLD from lipid accumulation, inflammation, and oxidative damage by ameliorating lipid metabolic disorders and oxidative stress. The dose of 20 mg/kg DADS was equally as effective in preventing NAFLD as 50 mg/kg GEO containing the same amount of DADS, which demonstrates that DADS may be the main bioactive component in GEO.
Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei
2014-04-01
There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells
Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.
2014-01-01
Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917
Reduced cytotoxicity in PCB-exposed Chinese Hamster Ovary (CHO) cells pretreated with vitamin E.
Murati, Teuta; Šimić, Branimir; Pleadin, Jelka; Vukmirović, Maja; Miletić, Marina; Durgo, Ksenija; Kniewald, Jasna; Kmetič, Ivana
2017-01-01
The aim of this study was to evaluate protective effects of vitamin E (50 -150 μM) in ovary cells upon cytotoxic effects induced by two structurally distinct PCB congeners - planar "dioxin-like" PCB 77 and non-planar di-ortho-substituted PCB 153 with an emphasis on identifying differences in the mechanism of vitamin E action depending on the structure of congeners. Application of three bioassays confirmed that PCBs decrease ovarian cell proliferation with slightly profound effects of PCB 77. PCB - induced ROS production and lipid peroxidation were significant for both congeners with also more noticeable effect for PCB 77. Vitamin E pre-incubation has improved viability of cells, reduced ROS formation and lipid peroxidation induced by PCBs' treatment. Preincubation with vitamin E was more effective when cells where treated with non-planar PCB 153. Altogether, vitamin E action was protective, congener specific and more effective when ovary cells were exposed to ortho-substituted PCB congener. Copyright © 2016 Elsevier Ltd. All rights reserved.
Du, Kuo; McGill, Mitchell R.; Xie, Yuchao; Jaeschke, Hartmut
2015-01-01
Acetaminophen (APAP) hepatotoxicity is a serious public health problem in western countries. Current treatment options for APAP poisoning are limited and novel therapeutic intervention strategies are needed. A recent publication suggested that benzyl alcohol (BA) protects against APAP hepatotoxicity and could serve as a promising antidote for APAP poisoning. To assess the protective mechanisms of BA, C56Bl/6J mice were treated with 400mg/kg APAP and/or 270mg/kg BA. APAP alone caused extensive liver injury at 6h and 24h post-APAP. This injury was attenuated by BA co-treatment. Assessment of protein adduct formation demonstrated that BA inhibits APAP metabolic activation. In support of this, in vitro experiments also showed that BA dose-dependently inhibits cytochrome P450 activities. Correlating with the hepatoprotection of BA, APAP-induced oxidant stress and mitochondrial dysfunction were reduced. Similar results were obtained in primary mouse hepatocytes. Interestingly, BA alone caused mitochondrial membrane potential loss and cell toxicity at high doses, and its protective effect could not be reproduced in primary human hepatocytes (PHH). We conclude that BA protects against APAP hepatotoxicity mainly by inhibiting cytochrome P450 enzymes in mice. Considering its toxic effect and the loss of protection in PHH, BA is not a clinically useful treatment option for APAP overdose patient. PMID:26522885
Neurotensin protects pancreatic beta cells from apoptosis.
Coppola, Thierry; Béraud-Dufour, Sophie; Antoine, Aurélie; Vincent, Jean-Pierre; Mazella, Jean
2008-01-01
The survival of pancreatic beta cells depends on the balance between external cytotoxic and protective molecular systems. The neuropeptide neurotensin (NT) has been shown to regulate certain functions of the endocrine pancreas including insulin and glucagon release. However, the mechanism of action of NT as well as the identification of receptors involved in the pancreatic functions of the peptide remained to be studied. We demonstrate here that NT is an efficient protective agent of pancreatic beta cells against cytotoxic agents. Both beta-TC3 and INS-1E cell lines and the mouse pancreatic islet cells express the three known NT receptors. The incubation of beta cells with NT protects cells from apoptosis induced either by staurosporine or by IL-1beta. In beta-TC3 cells, NT activates both MAP and PI-3 kinases pathways and strongly reduces the staurosporine or the Il-1beta-induced caspase-3 activity by a mechanism involving Akt activation. The NTSR2 agonist levocabastine displays the same protective effect than NT whereas the NTSR1 antagonist is unable to block the effect of NT suggesting the predominant involvement of the NTSR2 in the action of NT on beta cells. These results clearly indicate for the first time that NT is able to protect endocrine beta cells from external cytotoxic agents, a role well correlated with its release in the circulation after a meal.
Protective effects of apomorphine against zinc-induced neurotoxicity in cultured cortical neurons.
Hara, Hirokazu; Maeda, Asuka; Kamiya, Tetsuro; Adachi, Tetsuo
2013-01-01
There is evidence that excessive zinc (Zn(2+)) release from presynaptic terminals following brain injuries such as ischemia and severe epileptic seizures induces neuronal cell death. Apomorphine (Apo), a dopamine receptor agonist, has been shown to have pleiotropic biological functions. In this study, we investigated whether Apo protects cultured cortical neurons from neurotoxicity provoked by excessive Zn(2+) exposure. Pretreatment with Apo dose- and time-dependently ameliorated Zn(2+) neurotoxicity. In addition, pretreatment with Apo prevented intracellular nicotinamide adenine dinucleotide (NAD(+)) and ATP depletion caused by Zn(2+) exposure. Dopamine receptor antagonists did not influence Apo protection against Zn(2+) neurotoxicity. Apo is shown to be autoxidized to produce oxidized products such as reactive oxygen species and quinones. N-Acetylcysteine, a thiol compound, partially reduced Apo protection. Entry of Zn(2+) into neurons is thought to be a critical step of Zn(2+) neurotoxicity. Interestingly, we found that pretreatment with Apo decreased elevation of intracellular Zn(2+) levels after Zn(2+) exposure and induced mRNA expression of the zinc transporter ZnT1, which transports intracellular Zn(2+) out of cells, and metallothionein. Taken together, these results suggest that the protective effects of Apo are regulated, at least in part, by its oxidized products, and preventing intracellular accumulation of Zn(2+) contributes to Apo protection against Zn(2+) neurotoxicity.
Takeuchi, Koji; Nagahama, Kenji
2014-01-01
Esophagitis was induced in rats within 3 h by ligating both the pylorus and transitional region between the forestomach and glandular portion under ether anesthesia. This esophageal injury was prevented by the administration of acid suppressants and antipepsin drug and aggravated by exogenous pepsin. Damage was also aggravated by pretreatment with indomethacin and the selective COX-1 but not COX-2 inhibitor, whereas PGE2 showed a biphasic effect depending on the dose; a protection at low doses, and an aggravation at high doses, with both being mediated by EP1 receptors. Various amino acids also affected this esophagitis in different ways; L-alanine and L-glutamine had a deleterious effect, while L-arginine and glycine were highly protective, both due to yet unidentified mechanisms. It is assumed that acid/pepsin plays a major pathogenic role in this model of esophagitis; PGs derived from COX-1 are involved in mucosal defense of the esophagus; and some amino acids are protective against esophagitis. These findings also suggest a novel therapeutic approach in the treatment of esophagitis, in addition to acid suppressant therapy. The model introduced may be useful to test the protective effects of drugs on esophagitis and investigate the mucosal defense mechanism in the esophagus.
Curculigo orchioides protects cisplatin-induced cell damage.
Kang, Tong Ho; Hong, Bin Na; Jung, Su-Young; Lee, Jeong-Han; So, Hong-Seob; Park, Raekil; You, Yong-Ouk
2013-01-01
Cisplatin is commonly used as a chemotherapeutic agent against many human cancers. However, it generates reactive oxygen species (ROS) and has serious dose-limiting side effects, including ototoxicity. The roots of Curculigo orchioides (C. orchioides) have been used to treat auditory diseases such as tinnitus and hearing loss in Chinese traditional medicine. In the present study, we investigated the protective effects of an ethanol extract obtained from C. orchioides rhizome (COR) on cisplatin-induced cell damage in auditory cells (HEI-OC1). COR (2.5-25 μg/ml) inhibited cisplatin-induced HEI-OC1 cell damage in a dose-dependent manner. To investigate the protective mechanism of COR on cisplatin cytotoxicity in HEI-OC1 cells, we measured the effects of COR on ROS generation and lipid peroxidation in cisplatin-treated cells as well as its scavenging activities against superoxide radicals, hydroxyl radicals, hydrogen peroxide, and DPPH radicals. COR (1-25 μg/ml) had scavenging activities against superoxide radicals, hydroxyl radicals, hydrogen peroxide, and DPPH radicals, as well as reduced lipid peroxidation. In in vivo experiments, COR was shown to reduce cochlear and peripheral auditory function impairments through cisplatin-induced auditory damage in mice. These results indicate that COR protects from cisplatin-induced auditory damage by inhibiting lipid peroxidation and scavenging activities against free radicals.
Coenzyme Q{sub 10} and alpha-tocopherol protect against amitriptyline toxicity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cordero, Mario D.; Dpto. Citologia e Histologia Normal y Patologica, Facultad de Medicina. Universidad de Sevilla. 41009 Sevilla; Moreno-Fernandez, Ana Maria
Since amitriptyline is a very frequently prescribed antidepressant drug, it is not surprising that amitriptyline toxicity is relatively common. Amitriptyline toxic systemic effects include cardiovascular, autonomous nervous, and central nervous systems. To understand the mechanisms of amitriptyline toxicity we studied the cytotoxic effects of amitriptyline treatment on cultured primary human fibroblasts and zebrafish embryos, and the protective role of coenzyme Q{sub 10} and alpha-tocopherol, two membrane antioxidants. We found that amitriptyline treatment induced oxidative stress and mitochondrial dysfunction in primary human fibroblasts. Mitochondrial dysfunction in amitriptyline treatment was characterized by reduced expression levels of mitochondrial proteins and coenzyme Q{sub 10},more » decreased NADH:cytochrome c reductase activity, and a drop in mitochondrial membrane potential. Moreover, and as a consequence of these toxic effects, amitriptyline treatment induced a significant increase in apoptotic cell death activating mitochondrial permeability transition. Coenzyme Q{sub 10} and alpha-tocopherol supplementation attenuated ROS production, lipid peroxidation, mitochondrial dysfunction, and cell death, suggesting that oxidative stress affecting cell membrane components is involved in amitriptyline cytotoxicity. Furthermore, amitriptyline-dependent toxicity and antioxidant protection were also evaluated in zebrafish embryos, a well established vertebrate model to study developmental toxicity. Amitriptyline significantly increased embryonic cell death and apoptosis rate, and both antioxidants provided a significant protection against amitriptyline embryotoxicity.« less
Park, Sang-Il; Lee, Eun Hye; Kim, So Ra; Jang, Young Pyo
2017-03-01
The purpose of the study was to investigate the protective effect of the Curcuma longa L. extract (CLE) and its curcuminoids against blue light-induced cytotoxicity in human retinal pigment epithelial (RPE) cells laded with A2E. A2E has been concerned in age-related macular degeneration (AMD). To perform this study, A2E-accumulated ARPE-19 cells were exposed to blue light to induce cytotoxicity. The cytotoxicity and apoptotic gene expression levels were evaluated using a lactate dehydrogenase (LDH) assay and real-time PCR analysis, respectively. Curcuma longa L. extract was found to exert a protective effect in a dose-dependent manner. At a concentration of 15 μm, curcumin, demethoxycurcumin and bisdemethoxycurcumin exerted significant protective effects against blue light-induced cytotoxicity. Treatment with CLE and curcuminoids meaningfully reduced the mRNA levels of c-Abl and p53, which was known to be augmented in apoptotic RPE cells. Demethoxycurcumin and bisdemethoxycurcumin were found to inhibit p38 expression, which is increased in blue light-irradiated A2E-accumulated RPE cells. Curcuma longa L. extract and its curcuminoids provided significant protection against photooxidative damage and apoptosis in the RPE cells. Our results suggest that curcuminoids may show potential in the treatment of AMD. © 2017 Royal Pharmaceutical Society.
Lee, J-H; Jeong, J-K; Park, S-Y
2014-10-10
Prion diseases are neurodegenerative and infectious disorders that involve accumulation of misfolded scrapie prion protein, and which are characterized by spongiform degeneration. Autophagy, a major homeostatic process responsible for the degradation of cytoplasmic components, has garnered attention as the potential target for neurodegenerative diseases such as prion disease. We focused on protective effects of sulforaphane found in cruciferous vegetables on prion-mediated neurotoxicity and the mechanism of sulforaphane related to autophagy. In human neuroblastoma cells, sulforaphane protected prion protein (PrP) (106-126)-mediated neurotoxicity and increased autophagy flux marker microtubule-associated protein 1 light chain 3-II protein levels, following a decrease of p62 protein level. Pharmacological and genetical inhibition of autophagy by 3MA, wortmannin and knockdown of autophagy-related 5 (ATG5) led to block the effect of sulforaphane against PrP (106-126)-induced neurotoxicity. Furthermore we demonstrated that both sulforaphane-induced autophagy and protective effect of sulforaphane against PrP (106-126)-induced neurotoxicity are dependent on the AMP-activated protein kinase (AMPK) signaling. The present results indicated that sulforaphane of cruciferous vegetables enhanced autophagy flux led to the protection effects against prion-mediated neurotoxicity, which was regulated by AMPK signaling pathways in human neuron cells. Our data also suggest that sulforaphane has a potential value as a therapeutic tool in neurodegenerative disease including prion diseases. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.
Protective and therapeutic effects of fucoxanthin against sunburn caused by UV irradiation.
Matsui, Mio; Tanaka, Kosuke; Higashiguchi, Naoki; Okawa, Hisato; Yamada, Yoichi; Tanaka, Ken; Taira, Soichiro; Aoyama, Tomoko; Takanishi, Misaki; Natsume, Chika; Takakura, Yuuki; Fujita, Norihisa; Hashimoto, Takeshi; Fujita, Takashi
2016-09-01
Mild exposure to ultraviolet (UV) radiation is also harmful and hazardous to the skin and often causes a photosensitivity disorder accompanied by sunburn. To understand the action of UV on the skin we performed a microarray analysis to isolate UV-sensitive genes. We show here that UV irradiation promoted sunburn and downregulated filaggrin (Flg); fucoxanthin (FX) exerted a protective effect. In vitro analysis showed that UV irradiation of human dermal fibroblasts caused production of intracellular reactive oxygen species (ROS) without cellular toxicity. ROS production was diminished by N-acetylcysteine (NAC) or FX, but not by retinoic acid (RA). In vivo analysis showed that UV irradiation caused sunburn and Flg downregulation, and that FX, but not NAC, RA or clobetasol, exerted a protective effect. FX stimulated Flg promoter activity in a concentration-dependent manner. Flg promoter deletion and chromatin immunoprecipitation analysis showed that caudal type homeo box transcription factor 1 (Cdx1) was a key factor for Flg induction. Cdx1 was also downregulated in UV-exposed skin. Therefore, our data suggested that the protective effects of FX against UV-induced sunburn might be exerted by promotion of skin barrier formation through induction of Flg, unrelated to quenching of ROS or an RA-like action. Copyright © 2016 The Authors. Production and hosting by Elsevier B.V. All rights reserved.
Peters, Adam; Lofts, Stephen; Merrington, Graham; Brown, Bruce; Stubblefield, William; Harlow, Keven
2011-11-01
Ecotoxicity tests were performed with fish, invertebrates, and algae to investigate the effect of water quality parameters on Mn toxicity. Models were developed to describe the effects of Mn as a function of water quality. Calcium (Ca) has a protective effect on Mn toxicity for both fish and invertebrates, and magnesium (Mg) also provides a protective effect for invertebrates. Protons have a protective effect on Mn toxicity to algae. The models derived are consistent with models of the toxicity of other metals to aquatic organisms in that divalent cations can act as competitors to Mn toxicity in fish and invertebrates, and protons act as competitors to Mn toxicity in algae. The selected models are able to predict Mn toxicity to the test organisms to within a factor of 2 in most cases. Under low-pH conditions invertebrates are the most sensitive taxa, and under high-pH conditions algae are most sensitive. The point at which algae become more sensitive than invertebrates depends on the Ca concentration and occurs at higher pH when Ca concentrations are low, because of the sensitivity of invertebrates under these conditions. Dissolved organic carbon concentrations have very little effect on the toxicity of Mn to aquatic organisms. Copyright © 2011 SETAC.
ERIC Educational Resources Information Center
Dimopoulos, Dimitrios; Paraskevopoulos, Stefanos; Pantis, John D.
2008-01-01
The ability of the National Marine Park of Zakynthos (NMPZ) in Greece to protect an important sea turtle rookery will ultimately depend on the level of local support and involvement that it receives. Therefore, it is essential for environmental educators to generate among local inhabitants, starting at early ages, positive attitudes concerning the…
Quantifying the consequences of fire suppression in two California national parks
Carol Miller; Brett Davis
2009-01-01
Excluding fire can have untold ecological effects. Decades of fire suppression in national parks and other protected areas have altered natural fire regimes, vegetation, and wildlife habitat (Chang 1996; Keane et al. 2002). Management actions to suppress lightning-ignited wildfires removes one of the most important natural processes from fire-dependent ecosystems, and...
Optimum Timing for Ground-applied Forestry Herbcides in the South
James H. Miller
1989-01-01
Your success in applying a forestry herbicide depends on serveral critical factors. First, you must accurately identify the weed species to be controlled. Then you must select a herbicide that effectively controls theses species. Moreover, the crop tree must be resistant to, or protected from, the herbicide. Weather conditions must be favorable, both before and after...
Teacher Quality and School Improvement: What Is the Role of Research?
ERIC Educational Resources Information Center
Mincu, Monica Elena
2015-01-01
In a rapidly changing world, students' success depends upon the schools' capacity to deal with their specific instructional needs. Thus, effective teaching plays the role of a unique protective factor that may reduce and even close the achievement gap. Two broad questions structure this study: What is the research contribution to teacher quality…
Chapter 6: Ecology and Biodiversity
Patricia N. Manley; Dennis D. Murphy; Seth Bigelow; Sudeep Chandra
2010-01-01
The integrity of animal and plant communities serves as a critical measure of the effectiveness of policies designed to protect and restore ecosystem processes in the Lake Tahoe basin. The conservation of plants and animals in the Tahoe basin is utterly dependent on the conservation of its terrestrial and aquatic ecosystems; so, in many ways, the research agenda that...
ERIC Educational Resources Information Center
Buth, Jeffrey M.
2016-01-01
Ocean acidification refers to the process by which seawater absorbs carbon dioxide from the atmosphere, producing aqueous carbonic acid. Acidic conditions increase the solubility of calcium carbonate, threatening corals and other calcareous organisms that depend on it for protective structures. The global nature of ocean acidification and the…
Kaynak, Övgü; Meyers, Kathleen; Caldeira, Kimberly M.; Vincent, Kathryn B.; Winters, Ken C.; Arria, Amelia M.
2012-01-01
Substance use disorder is a serious health problem that tends to manifest in late adolescence. Attempting to influence targetable risk and protective factors holds promise for prevention and treatment. Survey data from 1,253 college students (48.5% male, 26.9% non-White) were used to investigate the independent and combined effects of two prominent factors, sensation seeking and parental monitoring, on the probability of alcohol and/or cannabis dependence during the first year of college. In multivariate analyses that controlled for high school use, gender, race, mother’s education, and importance of religion, retrospective reports by the student of parental behavior during the last year of high school indicated that higher levels of parental monitoring had a direct effect on reducing risk for alcohol dependence during the first year of college, but not on cannabis dependence. High levels of sensation seeking were associated with increased risk for both alcohol and cannabis dependence. No interaction effects were found. The results extend prior findings by highlighting influences of pre-college parental monitoring and sensation seeking on the probability of alcohol and/or cannabis dependence during the first year of college. The findings also suggest that these two factors are useful in identifying college students at high risk for alcohol and/or cannabis dependence. PMID:23017733
Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection
Duan, Susu; Thomas, Paul G.
2016-01-01
Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022
T cells play an essential role in anti-F1 mediated rapid protection against bubonic plague.
Levy, Yinon; Flashner, Yehuda; Tidhar, Avital; Zauberman, Ayelet; Aftalion, Moshe; Lazar, Shirley; Gur, David; Shafferman, Avigdor; Mamroud, Emanuelle
2011-09-16
Plague, which is initiated by Yersinia pestis infection, is a fatal disease that progresses rapidly and leads to high mortality rates if not treated. Antibiotics are an effective plague therapy, but antibiotic-resistant Y. pestis strains have been reported and therefore alternative countermeasures are needed. In the present study, we assessed the potential of an F1 plus LcrV-based vaccine to provide protection shortly pre- or post-exposure to a lethal Y. pestis infection. Mice vaccinated up to one day before or even several hours after subcutaneous challenge were effectively protected. Mice immunized one or three days pre-challenge were protected even though their anti-F1 and anti-LcrV titers were below detection levels at the day of challenge. Moreover, using B-cell deficient μMT mice, we found that rapidly induced protective immunity requires the integrity of the humoral immune system. Analysis of the individual contributions of vaccine components to protection revealed that rF1 is responsible for the observed rapid antibody-mediated immunity. Applying anti-F1 passive therapy in the mouse model of bubonic plague demonstrated that anti-F1 F(ab')(2) can delay mortality, but it cannot provide long-lasting protection, as do intact anti-F1 molecules. Fc-dependent immune components, such as the complement system and (to a lesser extent) neutrophils, were found to contribute to mouse survival. Interestingly, T cells but not B cells were found to be essential for the recovery of infected animals following passive anti-F1 mediated therapy. These data extend our understanding of the immune mechanisms required for the development of a rapid and effective post-exposure therapy against plague. Copyright © 2011 Elsevier Ltd. All rights reserved.
Pride, Christelle Kamga; Mo, Li; Quesnelle, Kelly; Dagda, Ruben K.; Murillo, Daniel; Geary, Lisa; Corey, Catherine; Portella, Rafael; Zharikov, Sergey; St Croix, Claudette; Maniar, Salony; Chu, Charleen T.; K. H. Khoo, Nicholas; Shiva, Sruti
2014-01-01
Aims Nitrite (NO2–), a dietary constituent and nitric oxide (NO) oxidation product, mediates cardioprotection after ischaemia/reperfusion (I/R) in a number of animal models when administered during ischaemia or as a pre-conditioning agent hours to days prior to the ischaemic episode. When present during ischaemia, the reduction of nitrite to bioactive NO by deoxygenated haem proteins accounts for its protective effects. However, the mechanism of nitrite-induced pre-conditioning, a normoxic response which does not appear to require reduction of nitrite to NO, remains unexplored. Methods and results Using a model of hypoxia/reoxygenation (H/R) in cultured rat H9c2 cardiomyocytes, we demonstrate that a transient (30 min) normoxic nitrite treatment significantly attenuates cell death after a hypoxic episode initiated 1 h later. Mechanistically, this protection depends on the activation of protein kinase A, which phosphorylates and inhibits dynamin-related protein 1, the predominant regulator of mitochondrial fission. This results morphologically, in the promotion of mitochondrial fusion and functionally in the augmentation of mitochondrial membrane potential and superoxide production. We identify AMP kinase (AMPK) as a downstream target of the mitochondrial reactive oxygen species (ROS) generated and show that its oxidation and subsequent phosphorylation are essential for cytoprotection, as scavenging of ROS prevents AMPK activation and inhibits nitrite-mediated protection after H/R. The protein kinase A-dependent protection mediated by nitrite is reproduced in an intact isolated rat heart model of I/R. Conclusions These data are the first to demonstrate nitrite-dependent normoxic modulation of both mitochondrial morphology and function and reveal a novel signalling pathway responsible for nitrite-mediated cardioprotection. PMID:24081164
Transduced human copper chaperone for Cu,Zn-SOD (PEP-1-CCS) protects against neuronal cell death.
Choi, Soo Hyun; Kim, Dae Won; Kim, So Young; An, Jae Jin; Lee, Sun Hwa; Choi, Hee Soon; Sohn, Eun Jung; Hwang, Seok-Il; Won, Moo Ho; Kang, Tae-Cheon; Kwon, Hyung Joo; Kang, Jung Hoon; Cho, Sung-Woo; Park, Jinseu; Eum, Won Sik; Choi, Soo Young
2005-12-31
Reactive oxygen species (ROS) contribute to the development of various human diseases. Cu,Zn-superoxide dismutase (SOD) is one of the major means by which cells counteract the deleterious effects of ROS. SOD activity is dependent upon bound copper ions supplied by its partner metallochaperone protein, copper chaperone for SOD (CCS). In the present study, we investigated the protective effects of PEP-1-CCS against neuronal cell death and ischemic insults. When PEP-1-CCS was added to the culture medium of neuronal cells, it rapidly entered the cells and protected them against paraquat-induced cell death. Moreover, transduced PEP-1-CCS markedly increased endogenous SOD activity in the cells. Immunohistochemical analysis revealed that it prevented neuronal cell death in the hippocampus in response to transient forebrain ischemia. These results suggest that CCS is essential to activate SOD, and that transduction of PEP-1-CCS provides a potential strategy for therapeutic delivery in various human diseases including stroke related to SOD or ROS.
Amri, Manel; Touil-Boukoffa, Chafia
2015-09-01
The role of nitric oxide (NO) in host defense against Echinococcus granulosus larvae was previously reported. However, NO production by NOS2 (inducible NO synthase) is counteracted by the expression of Arginase. In the present study, our aim is to evaluate the involvement of the laminated layer (external layer of parasitic cyst) in Arginase induction and the protoscoleces (living and infective part of the cyst) survival. Our in vitro results indicate that this cystic compound increases the Arginase activity in macrophages. Moreover, C-type lectin receptors (CLRs) with specificity for mannan and the TGF-β are implicated in this effect as shown after adding Mannan and Anti-TGFβ. Interestingly, the laminated layer increases protoscoleces survival in macrophages-parasite co-cultures. Our results indicate that the laminated layer protects E. granulosus against the NOS2 protective response through Arginase pathway, a hallmark of M2 macrophages. Copyright © 2015 Elsevier B.V. All rights reserved.
Gurvich, V B; Kuz'min, S V; Dikonskaia, O V; Gileva, M A; Boiarskiĭ, A P
2015-01-01
Control and supervision measures--one of the main technologies of Federal Service for Supervision of Consumer Rights protection and Human Welfare in the overall system of risk management for public health and damage to property consumers, aimed at the solution of the prior tasks in the field of assurance of the sanitary and epidemiological welfare of the population and consumer rights protection. The effectiveness of this technology depends on the correct choice of priority objects of supervision, which form the main problems in the sanitary and epidemiological situation and in the consumer market. The application of is approach has led to more effective oversight activity and the improvement of a number of indices characterizing the achievement of the objectives in the common system of risk management for public health and property of consumers.
Emulsions Made of Oils from Seeds of GM Flax Protect V79 Cells against Oxidative Stress
Skorkowska-Telichowska, Katarzyna; Hasiewicz-Derkacz, Karolina; Gębarowski, Tomasz; Kulma, Anna; Kostyn, Kamil; Gębczak, Katarzyna; Szyjka, Anna; Wojtasik, Wioleta; Gąsiorowski, Kazimierz
2016-01-01
Polyunsaturated fatty acids, sterols, and hydrophilic phenolic compounds are components of flax oil that act as antioxidants. We investigated the impact of flax oil from transgenic flax in the form of emulsions on stressed Chinese hamster pulmonary fibroblasts. We found that the emulsions protect V79 cells against the H2O2 and the effect is dose dependent. They reduced the level of intracellular reactive oxygen species and protected genomic DNA against damage. The rate of cell proliferation increased upon treatment with the emulsions at a low concentration, while at a high concentration it decreased significantly, accompanied by increased frequency of apoptotic cell death. Expression analysis of selected genes revealed the upregulatory impact of the emulsions on the histones, acetylases, and deacetylases. Expression of apoptotic, proinflammatory, and anti-inflammatory genes was also altered. It is thus suggested that flax oil emulsions might be useful as a basis for biomedical products that actively protect cells against inflammation and degeneration. The beneficial effect on fibroblast resistance to oxidative damage was superior in the emulsion made of oil from transgenic plants which was correlated with the quantity of antioxidants and squalene. The emulsions from transgenic flax are promising candidates for skin protection against oxidative damage. PMID:26779302
Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L
2018-01-01
No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.
Gao, Chenguang; Chen, Hong; Niu, Cong; Hu, Jie; Cao, Bo
2017-01-02
Schizandrin B is extracted from Schisandra chinensis (Turcz.) Baill. This study evaluated the photoprotective effect of Schizandrin B on oxidative stress injury of the skin caused by UVB-irradiation and the molecular mechanism of the photoprotective effect of Schizandrin B, and we firstly found that Schizandrin B could block Cox-2, IL-6 and IL-18 signal pathway to protect damage of skin cells given by UVB-irradiation. In the research, we found that Schizandrin B can attenuate the UVB-induced toxicity on keratinocytes and dermal fibroblasts in human body, and can outstandingly eliminated intracellular ROS produced by UVB-irradiation. These results demonstrate that Schizandrin B can regulate the function of decreasing intracellular SOD's activity and increasing the expression level of MDA in HaCaT cells result from the guidance of UVB, and it markedly reduced the production of inflammatory factors such as Cox-2, IL-6 or IL-18, decreased the expression level of MMP-1, and interdicted degradation process of collagens in UVB-radiated cells. Therefore, skin keratinocytes can be effectively protected from UVB-radiated damage by Schizandrin B, and UVB-irradiation caused inflammatory responses can be inhibited by attenuating process of ROS generating.
Ketones prevent synaptic dysfunction induced by mitochondrial respiratory complex inhibitors
Kim, Do Young; Vallejo, Johana; Rho, Jong M
2010-01-01
Abstract Ketones have previously shown beneficial effects in models of neurodegenerative disorders, particularly against associated mitochondrial dysfunction and cognitive impairment. However, evidence of a synaptic protective effect of ketones remains lacking. We tested the effects of ketones on synaptic impairment induced by mitochondrial respiratory complex (MRC) inhibitors using electrophysiological, reactive oxygen species (ROS) imaging and biochemical techniques. MRC inhibitors dose-dependently suppressed both population spike (PS) and field potential amplitudes in the CA1 hippocampus. Pre-treatment with ketones strongly prevented changes in the PS, whereas partial protection was seen in the field potential. Rotenone (Rot; 100 nmol/L), a MRC I inhibitor, suppressed synaptic function without altering ROS levels and PS depression by Rot was unaffected by antioxidants. In contrast, antioxidant-induced PS recovery against the MRC II inhibitor 3-nitropropionic acid (3-NP; 1 mmol/L) was similar to the synaptic protective effects of ketones. Ketones also suppressed ROS generation induced by 3-NP. Finally, ketones reversed the decreases in ATP levels caused by Rot and 3-NP. In summary, our data demonstrate that ketones can preserve synaptic function in CA1 hippocampus induced by MRC dysfunction, likely through an antioxidant action and enhanced ATP generation. PMID:20374433
Mo, Fei; Hu, Jing-Ying; Gan, Yu; Zhao, Yang-Xing; Zhao, Xin-Tai
2008-09-01
To confirm the anti-cancer effect and mechanism of Wuxing soup. Inhibition of cellular growth under Wuxing soup treatment was observed by MTT; Apoptosis was detected by gel electrophoresis, transmission electron microscopy and FACS; The concentration of calcium was measured by fluorescence probe. After SGC-7901 cell being treated by Wuxing soup, it showed that: 1) Wuxing soup could specifically inhibit cancer cells proliferation in a time and dose dependent manner; 2) Typical apoptotic morphological changes and DNA ladder of SGC-7901 cells were observed; 3) calcium inhibitor Bapta AM could reduce the apoptotic rate and protect SGC-7901 cells in a dose dependent manner. Wuxing soup has an effective inhibition on cancer cells, and can induce SGC-7901 cells to apoptosis by calcium.
Specht, Charles A; Lee, Chrono K; Huang, Haibin; Hester, Maureen M; Liu, Jianhua; Luckie, Bridget A; Torres Santana, Melanie A; Mirza, Zeynep; Khoshkenar, Payam; Abraham, Ambily; Shen, Zu T; Lodge, Jennifer K; Akalin, Ali; Homan, Jane; Ostroff, Gary R; Levitz, Stuart M
2017-11-28
Development of a vaccine to protect against cryptococcosis is a priority given the enormous global burden of disease in at-risk individuals. Using glucan particles (GPs) as a delivery system, we previously demonstrated that mice vaccinated with crude Cryptococcus -derived alkaline extracts were protected against lethal challenge with Cryptococcus neoformans and Cryptococcus gattii The goal of the present study was to identify protective protein antigens that could be used in a subunit vaccine. Using biased and unbiased approaches, six candidate antigens (Cda1, Cda2, Cda3, Fpd1, MP88, and Sod1) were selected, recombinantly expressed in Escherichia coli , purified, and loaded into GPs. Three mouse strains (C57BL/6, BALB/c, and DR4) were then vaccinated with the antigen-laden GPs, following which they received a pulmonary challenge with virulent C. neoformans and C. gattii strains. Four candidate vaccines (GP-Cda1, GP-Cda2, GP-Cda3, and GP-Sod1) afforded a significant survival advantage in at least one mouse model; some vaccine combinations provided added protection over that seen with either antigen alone. Vaccine-mediated protection against C. neoformans did not necessarily predict protection against C. gattii Vaccinated mice developed pulmonary inflammatory responses that effectively contained the infection; many surviving mice developed sterilizing immunity. Predicted T helper cell epitopes differed between mouse strains and in the degree to which they matched epitopes predicted in humans. Thus, we have discovered cryptococcal proteins that make promising candidate vaccine antigens. Protection varied depending on the mouse strain and cryptococcal species, suggesting that a successful human subunit vaccine will need to contain multiple antigens, including ones that are species specific. IMPORTANCE The encapsulated fungi Cryptococcus neoformans and Cryptococcus gattii are responsible for nearly 200,000 deaths annually, mostly in immunocompromised individuals. An effective vaccine could substantially reduce the burden of cryptococcosis. However, a major gap in cryptococcal vaccine development has been the discovery of protective antigens to use in vaccines. Here, six cryptococcal proteins with potential as vaccine antigens were expressed recombinantly and purified. Mice were then vaccinated with glucan particle preparations containing each antigen. Of the six candidate vaccines, four protected mice from a lethal cryptococcal challenge. However, the degree of protection varied as a function of mouse strain and cryptococcal species. These preclinical studies identify cryptococcal proteins that could serve as candidate vaccine antigens and provide a proof of principle regarding the feasibility of protein antigen-based vaccines to protect against cryptococcosis. Copyright © 2017 Specht et al.
Liu, Qingpeng; Zhao, Gang; Zhou, Changwei; Farlow, Martin R; Du, Yansheng; Xu, Guangxu; Gu, Huiying
2017-01-01
Adipose stromal cells conditioned media (ASC-CM) protect neurons in a variety of neuronal death models including potassium/serum deprivation-induced neuronal apoptosis. In this study, we found that ASC-CM contained glutamate oxaloacetate transaminase and its substrate, oxaloacetate (OAA) directly protected cerebellar granule neurons (CGN) from apoptosis induced by serum and potassium deprivation. Additionally, OAA inhibited serum and potassium deprivation-induced caspase 3 activation. ASC-CM and OAA in combination had a synergistic neuroprotective effect. Clearly, different from ASC-CM-induced neuroprotection, OAA-induced neuroprotection was Akt- independent but JNK-dependent. These data establish a mechanistic basis supporting that the application of ASC-CM for neuroprotective treatments could be significantly enhanced by addition of OAA. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Kelkboom, Emile J. C.; Breebaart, Jeroen; Buhan, Ileana; Veldhuis, Raymond N. J.
2010-04-01
Template protection techniques are used within biometric systems in order to protect the stored biometric template against privacy and security threats. A great portion of template protection techniques are based on extracting a key from or binding a key to a biometric sample. The achieved protection depends on the size of the key and its closeness to being random. In the literature it can be observed that there is a large variation on the reported key lengths at similar classification performance of the same template protection system, even when based on the same biometric modality and database. In this work we determine the analytical relationship between the system performance and the theoretical maximum key size given a biometric source modeled by parallel Gaussian channels. We consider the case where the source capacity is evenly distributed across all channels and the channels are independent. We also determine the effect of the parameters such as the source capacity, the number of enrolment and verification samples, and the operating point selection on the maximum key size. We show that a trade-off exists between the privacy protection of the biometric system and its convenience for its users.
Martin, Megan M.; Winter, Shawn S.; Cheatwood, Joseph L.; Carter, Lynniece A.; Jones, Jeana L.; Weathered, Scott L.; Wagner, Steven J.; Wallace, Douglas G.
2008-01-01
Converging lines of evidence have supported a role for the nucleus basalis magnocellularis (NB) in attentional mechanisms; however, debate continues regarding the role of the medial septum in behavior (MS). Recent studies have supported a role for the septohippocampal system in the online processing of internally generated cues. The current study was designed to investigate a possible double dissociation in rat food protection behavior, a natural behavior that has been shown to depend on external and internal sources of information. The study examined the effects of intraparenchymal injections of 192 IgG-saporin into either the MS or NB on the organization of food protection behavior. NB cholinergic lesions reduced the number of successful food protection behaviors while sparing the temporal organization of food protection behavior. In contrast, MS cholinergic lesions disrupted the temporal organization of food protection behavior while sparing the ability to successfully protect food items. These observations are consistent with a double dissociation of NB and MS cholinergic systems' contributions to processing external and internal sources of information and provide further evidence for the septohippocampal system's involvement in processing internally generated cues. PMID:18823954
Calculation of Radiation Protection Quantities and Analysis of Astronaut Orientation Dependence
NASA Technical Reports Server (NTRS)
Clowdsley, Martha S.; Nealy, John E.; Atwell, William; Anderson, Brooke M.; Luetke, Nathan J.; Wilson, John W.
2006-01-01
Health risk to astronauts due to exposure to ionizing radiation is a primary concern for exploration missions and may become the limiting factor for long duration missions. Methodologies for evaluating this risk in terms of radiation protection quantities such as dose, dose equivalent, gray equivalent, and effective dose are described. Environment models (galactic cosmic ray and solar particle event), vehicle/habitat geometry models, human geometry models, and transport codes are discussed and sample calculations for possible lunar and Mars missions are used as demonstrations. The dependence of astronaut health risk, in terms of dosimetric quantities, on astronaut orientation within a habitat is also examined. Previous work using a space station type module exposed to a proton spectrum modeling the October 1989 solar particle event showed that reorienting the astronaut within the module could change the calculated dose equivalent by a factor of two or more. Here the dose equivalent to various body tissues and the whole body effective dose due to both galactic cosmic rays and a solar particle event are calculated for a male astronaut in two different orientations, vertical and horizontal, in a representative lunar habitat. These calculations also show that the dose equivalent at some body locations resulting from a solar particle event can vary by a factor of two or more, but that the dose equivalent due to galactic cosmic rays has a much smaller (<15%) dependence on astronaut orientation.
Consumer depletion alters seagrass resistance to an invasive macroalga.
Caronni, Sarah; Calabretti, Chiara; Delaria, Maria Anna; Bernardi, Giuseppe; Navone, Augusto; Occhipinti-Ambrogi, Anna; Panzalis, Pieraugusto; Ceccherelli, Giulia
2015-01-01
Few field studies have investigated how changes at one trophic level can affect the invasibility of other trophic levels. We examined the hypothesis that the spread of an introduced alga in disturbed seagrass beds with degraded canopies depends on the depletion of large consumers. We mimicked the degradation of seagrass canopies by clipping shoot density and reducing leaf length, simulating natural and anthropogenic stressors such as fish overgrazing and water quality. Caulerpa racemosa was transplanted into each plot and large consumers were excluded from half of them using cages. Potential cage artifacts were assessed by measuring irradiance, scouring by leaf movement, water flow, and sedimentation. Algal invasion of the seagrass bed differed based on the size of consumers. The alga had higher cover and size under the cages, where the seagrass was characterized by reduced shoot density and canopy height. Furthermore, canopy height had a significant effect depending on canopy density. The alteration of seagrass canopies increased the spread of C. racemosa only when large consumers were absent. Our results suggest that protecting declining habitats and/or restoring fish populations will limit the expansion of C. racemosa. Because MPAs also enhance the abundance and size of fish consuming seagrass they can indirectly promote algal invasion. The effects of MPAs on invasive species are context dependent and require balancing opposing forces, such as the conservation of seagrass canopy structure and the protection of fish grazing the seagrass.
Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei
2015-03-15
Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.
Dietary Phytochemicals Promote Health by Enhancing Antioxidant Defence in a Pig Model
Selby-Pham, Sophie N. B.; Cottrell, Jeremy J.; Ng, Ken
2017-01-01
Phytochemical-rich diets are protective against chronic diseases and mediate their protective effect by regulation of oxidative stress (OS). However, it is proposed that under some circumstances, phytochemicals can promote production of reactive oxygen species (ROS) in vitro, which might drive OS-mediated signalling. Here, we investigated the effects of administering single doses of extracts of red cabbage and grape skin to pigs. Blood samples taken at baseline and 30 min intervals for 4 hours following intake were analyzed by measures of antioxidant status in plasma, including Trolox equivalent antioxidant capacity (TEAC) and glutathione peroxidase (GPx) activity. In addition, dose-dependent production of hydrogen peroxide (H2O2) by the same extracts was measured in untreated commercial pig plasma in vitro. Plasma from treated pigs showed extract dose-dependent increases in non-enzymatic (plasma TEAC) and enzymatic (GPx) antioxidant capacities. Similarly, extract dose-dependent increases in H2O2 were observed in commercial pig plasma in vitro. The antioxidant responses to extracts by treated pigs were highly correlated with their respective yields of H2O2 production in vitro. These results support that dietary phytochemicals regulate OS via direct and indirect antioxidant mechanisms. The latter may be attributed to the ability to produce H2O2 and to thereby stimulate cellular antioxidant defence systems. PMID:28708113
Effects of cost metric on cost-effectiveness of protected-area network design in urban landscapes.
Burkhalter, J C; Lockwood, J L; Maslo, B; Fenn, K H; Leu, K
2016-04-01
A common goal in conservation planning is to acquire areas that are critical to realizing biodiversity goals in the most cost-effective manner. The way monetary acquisition costs are represented in such planning is an understudied but vital component to realizing cost efficiencies. We sought to design a protected-area network within a forested urban region that would protect 17 birds of conservation concern. We compared the total costs and spatial structure of the optimal protected-area networks produced using three acquisition-cost surrogates (area, agricultural land value, and tax-assessed land value). Using the tax-assessed land values there was a 73% and 78% cost savings relative to networks derived using area or agricultural land value, respectively. This cost reduction was due to the considerable heterogeneity in acquisition costs revealed in tax-assessed land values, especially for small land parcels, and the corresponding ability of the optimization algorithm to identify lower-cost parcels for inclusion that had equal value to our target species. Tax-assessed land values also reflected the strong spatial differences in acquisition costs (US$0.33/m(2)-$55/m(2)) and thus allowed the algorithm to avoid inclusion of high-cost parcels when possible. Our results add to a nascent but growing literature that suggests conservation planners must consider the cost surrogate they use when designing protected-area networks. We suggest that choosing cost surrogates that capture spatial- and size-dependent heterogeneity in acquisition costs may be relevant to establishing protected areas in urbanizing ecosystems. © 2015 Society for Conservation Biology.
Thei, Laura; Rocha-Ferreira, Eridan; Peebles, Donald; Raivich, Gennadij; Hristova, Mariya
2018-06-06
Hypoxia-ischemia (HI) is a major cause of neonatal brain injury resulting in cerebral palsy, epilepsy, cognitive impairment and other neurological disabilities. The role of Extracellular signal-Regulated Kinase (ERK) isoforms and their MEK-dependent phosphorylation in HI has previously been explored but remains unresolved at cellular level. This is pertinent given the growing awareness of the role of non-neuronal cells in neuroprotection. Using a modified Rice-Vannuccci model of HI in the neonatal mouse we observed time and cell-dependent ERK phosphorylation (pERK), with strongly up-regulated pERK immunoreactivity first in periventricular white matter axons within 15-45 min of HI, followed by forebrain astrocytes and neurons (1-4 h post HI), and return to baseline by 16 h. We explored the effects of pharmacological ERK-blockade through the MEK inhibitor SL327 on neonatal HI-brain damage following HI alone (30 or 60 min) or LPS-sensitized HI insult (30 min). Global inhibition of ERK phosphorylation with systemically applied SL327 abolished forebrain pERK immunoreactivity, significantly reduced cell death and associated microglial activation at 48h post HI. We then explored the effects of cell specific ERK2 deletion alone or in combination with global ERK1 knockout under the same conditions of HI insult. Neuronal ERK2 deletion strongly decreased infarct size, neuronal cell death and microglial activation in grey matter following both HI alone or LPS-sensitised HI. ERK1 deletion attenuated the protective effect of neuronal ERK2 deletion. Removal of astroglial ERK2 produced a reverse response, with 3-4 fold increase in microglial activation and cell death. Our data suggests cell-specific and time-dependent role of ERK in neonatal HI, with a predominant, neurotoxic effect of neuronal ERK2, which is counteracted by neuroprotection by ERK1 and astrocytic ERK2. Overall, global pharmacological inhibition of ERK phosphorylation is strongly neuroprotective. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.