URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.
Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel
2014-06-03
Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka
2007-01-01
Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Bielaszewska, Martina; Karch, Helge; Toth, Ian K.
2012-01-01
Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
Gell, I; Cubero, J; Melgarejo, P
2007-12-01
To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.
Murata, C; Ogura, G; Kuroiwa, A
2011-03-01
To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
USDA-ARS?s Scientific Manuscript database
Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...
Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize
USDA-ARS?s Scientific Manuscript database
Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G
2015-07-01
Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki
2014-01-01
Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti
Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig
2016-01-01
Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J
2017-08-01
Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.
Lee, Chang Soo; Lee, Jiyoung
2010-09-01
A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
NASA Astrophysics Data System (ADS)
Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.
2015-12-01
Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Novel ITS1 Fungal Primers for Characterization of the Mycobiome
Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.
2017-01-01
ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834
Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.
Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D
2000-11-01
(a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X
2012-01-01
Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.
Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael
2016-01-01
Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698
Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan
2013-01-01
Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Evaluation of the PCR method for identification of Bifidobacterium species.
Youn, S Y; Seo, J M; Ji, G E
2008-01-01
Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.
Wang, Deguo; Liu, Yanhong
2015-05-26
Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Molecular Tools for the Detection of Nitrogen Cycling Archaea
Rusch, Antje
2013-01-01
Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509
Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu
2017-08-01
Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.
Nomoto, R; Kagawa, H; Yoshida, T
2008-01-01
To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.
Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.
Doh, Eui Jeong; Oh, Seung-Eun
2012-01-01
Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan
2014-07-01
In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna
ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo
2015-01-01
The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
Cowan, Ashley F; Elkins, Kelly M
2017-12-01
Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi
2005-01-01
Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428
Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.
2007-01-01
Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita
2018-01-01
In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou
2018-08-15
Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi
2013-03-01
Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Cabrerizo, María; Calvo, Cristina; Rabella, Nuria; Muñoz-Almagro, Carmen; del Amo, Eva; Pérez-Ruiz, Mercedes; Sanbonmatsu-Gámez, Sara; Moreno-Docón, Antonio; Otero, Almudena; Trallero, Gloria
2014-11-01
Human enteroviruses (EVs) and parechoviruses (HPeVs) are important etiological agents causing infections such as meningitis, encephalitis and sepsis-like disease in neonates and young children. We have developed a real-time RT-PCR for simultaneous detection of EV and HPeV in clinical samples. Primers and probe sets were designed from the conserved 5'-noncoding region of the genomes. The sensitivity, specificity and reproducibility of the technique were measured using a set of 25 EV and 6 HPeV types. All EVs but no HPeVs were detected with the EV primers-probe set. The HPeV primers-probe set detected only the 6 HPeV types. The lower detection limit was found to be 4 and 40CCID50/ml for HPeV and EV respectively, demonstrating high sensitivity of the technique for both viruses. The threshold cycle values were highly reproducible on repeat testing of positive controls among assay runs. The assay was evaluated in 53 clinical samples of suspected meningitis, sepsis or febrile syndromes from children under 3 years. In 11 of these (21%) EVs were detected, while 4, i.e. 7.5%, were HPeV positive. Molecular typing was carried out for 73% of the viruses. In summary, the RT-PCR method developed demonstrated effectively both EV and HPeV detection, which can cause similar clinical symptoms in infants. Copyright © 2014 Elsevier B.V. All rights reserved.
Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.
Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su
2012-02-01
New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A
2018-03-09
Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
Molecular diagnosis of group B coltiviruses infections.
Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X
1999-08-01
The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko
2009-11-01
To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.
Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333
Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao
2014-09-01
Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.
Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.
Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo
2016-08-30
Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan
2013-11-01
The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.
Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25
Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan
2013-01-01
The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades
2007-01-01
Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334
Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements
Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.
2010-01-01
Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612
Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M
2015-08-14
In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.
Evans, J D; Leigh, S A
2008-09-01
Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses within the poultry industry. In an effort to develop tools to aid in MG research and diagnostics, we have compared sequences of the attenuated MG vaccine strain ts-11 to those of commonly used pathogenic challenge strains in search of a simple means of differentiation. Via gapA sequence alignments and comparisons, we have identified and designed primers facilitating strain differentiation. When applied to conventional polymerase chain reaction (PCR) assay at low annealing temperature, the primer sets allow for the differentiation of MG attenuated vaccine strains ts-11 as well as the attenuated MG vaccine strain 6/85 from the commonly utilized MG challenge strains R(low), R, and S6. Conventional PCR differentiation is based on the visualization of sole products with the attenuated MG strains ts-11 and 6/85 and the lack of the corresponding products from MG strains R(low), R, and S6. When applied to MG strain F, product visualization varies with the applied primer set. The differentiation of MG strains ts-11 and 6/85 from the pathogenic challenge strains was also accomplished via real-time analyses, however, the primer sets were not able to differentiate MG strains ts-11 and 6/85 from selected MG field isolates.
2013-01-01
Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Csank, Tomáš; Bhide, Katarína; Bencúrová, Elena; Dolinská, Saskia; Drzewnioková, Petra; Major, Peter; Korytár, Ľuboš; Bocková, Eva; Bhide, Mangesh; Pistl, Juraj
2016-06-01
West Nile virus (WNV) is a mosquito-borne neurotropic pathogen that presents a major public health concern. Information on WNV prevalence and circulation in Slovakia is insufficient. Oral and cloacal swabs and bird brain samples were tested for flavivirus RNA by RT-PCR using newly designed generic primers. The species designation was confirmed by sequencing. WNV was detected in swab and brain samples, whereas one brain sample was positive for tick-borne encephalitis virus (TBEV). The WNV sequences clustered with lineages 1 and 2. These results confirm the circulation of WNV in birds in Slovakia and emphasize the risk of infection of humans and horses.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
2014-01-01
Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511
2014-01-01
Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K
2015-09-08
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.
Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.
2015-01-01
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000
Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun
2015-07-01
Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.
Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M
2018-02-01
Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.
Tao, Chenyu; Zhang, Qingde; Zhai, Shanli; Liu, Bang
2013-11-01
In this study, sensitive and rapid detection systems were designed using a loop-mediated isothermal amplification (LAMP) method to detect the genetically modified goats. A set of 4 primers were designed for each exogenous nucleic acids HBsAg and hATIII. The DNA samples were first amplified with the outer and inner primers and released a single-stranded DNA,of which both ends were stem-loop structure. Then one inner primer hybridized with the loop, and initiated displacement synthesis in less than 1 h. The result could be visualized by both agarose gel electrophoresis and unaided eyes directly after adding SYBR GREEN 1. The detection limit of LAMP was ten copies of target molecules, indicating that LAMP was tenfold more sensitive than the classical PCR. Furthermore, all the samples of genetically modified goats were tested positively by LAMP, and the results demonstrated that the LAMP was a rapid and sensitive method for detecting the genetically modified organism.
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
Chen, Huaihai; Yu, Fangbo; Shi, Wei
2016-12-01
Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].
Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei
2006-09-01
To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David
2006-01-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David
2006-07-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A
Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole
2013-01-01
Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505
Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A
2016-10-01
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.
Asvapathanagul, P; Olson, B H
2017-01-01
To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.
Implementation of Novel Design Features for qPCR-Based eDNA Assessment
Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.
2016-01-01
Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293
Detection and Heterogeneity of Herpesviruses Causing Pacheco's Disease in Parrots
Tomaszewski, Elizabeth; Wilson, Van G.; Wigle, William L.; Phalen, David N.
2001-01-01
Pacheco's disease (PD) is a common, often fatal, disease of parrots. We cloned a virus isolate from a parrot that had characteristic lesions of PD. Three viral clones were partially sequenced, demonstrating that this virus was an alphaherpesvirus most closely related to the gallid herpesvirus 1. Five primer sets were developed from these sequences. The primer sets were used with PCR to screen tissues or tissue culture media suspected to contain viruses from 54 outbreaks of PD. The primer sets amplified DNA from all but one sample. Ten amplification patterns were detected, indicating that PD is caused by a genetically heterogeneous population of viruses. A single genetic variant (psittacid herpesvirus variant 1) amplified with all primer sets and was the most common virus variant (62.7%). A single primer set (23F) amplified DNA from all of the positive samples, suggesting that PCR could be used as a rapid postmortem assay for these viruses. PCR was found to be significantly more sensitive than tissue culture for the detection of psittacid herpesviruses. PMID:11158102
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.
Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L
2012-07-01
Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.
2014-01-01
A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...
2016-07-15
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
Kokosková, B; Mráz, I; Fousek, J
2010-05-01
Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less
Jeon, Sun-Ok; Ahn, Tae-Seok; Hong, Sun-Hee
2008-02-01
Archaea have been found in many more diverse habitats than previously believed due in part to modern molecular approaches to discovering microbial diversity. We report here an unexpected expansion of the habitat diversity of the Archaea in the Cariaco Basin we found using a primer set designed for 18S eukaryotic rDNA sequence analysis. The results presented here expand the originally identified 9 archaeal clones reported in this environment using bacterial/archaeal primers to 152 archaeal clones: 67 (18 OTU) of these clones were found at a depth of 900 m of station A while 71 (9 OTU) of them were at a depth of between 300 approximately 335 m of station B&C depending upon which location the samples were taken. We used three phylogenetic analysis methods and detected 20 phylotypes belonging to a single previously unreported group distantly related to the Crenarchaeota. Also, we determined that the original nine sequences did not fall into any of the known phyla of the Archaea suggesting that they may represent a novel group within the Kingdom Archaea. Thus, from these two studies, we suggest that Archaea in the Cariaco Basin could be unique; however, further studies using archaeal-specific primers and the design of new primers as well as the systematic use of several different primer combinations may improve the chances of understanding the archeal diversity in the Cariaco Basin.
Characterization of a Methanogenic Community within an Algal Fed Anaerobic Digester
Ellis, Joshua T.; Tramp, Cody; Sims, Ronald C.; Miller, Charles D.
2012-01-01
The microbial diversity and metabolic potential of a methanogenic consortium residing in a 3785-liter anaerobic digester, fed with wastewater algae, was analyzed using 454 pyrosequencing technology. DNA was extracted from anaerobic sludge material and used in metagenomic analysis through PCR amplification of the methyl-coenzyme M reductase α subunit (mcrA) gene using primer sets ML, MCR, and ME. The majority of annotated mcrA sequences were assigned taxonomically to the genera Methanosaeta in the order Methanosarcinales. Methanogens from the genus Methanosaeta are obligate acetotrophs, suggesting this genus plays a dominant role in methane production from the analyzed fermentation sample. Numerous analyzed sequences within the algae fed anaerobic digester were unclassified and could not be assigned taxonomically. Relative amplicon frequencies were determined for each primer set to determine the utility of each in pyrosequencing. Primer sets ML and MCR performed better quantitatively (representing the large majority of analyzed sequences) than primer set ME. However, each of these primer sets was shown to provide a quantitatively unique community structure, and thus they are of equal importance in mcrA metagenomic analysis. PMID:23724331
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.
Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
Assessment and Evaluation Methods for Access Services
ERIC Educational Resources Information Center
Long, Dallas
2014-01-01
This article serves as a primer for assessment and evaluation design by describing the range of methods commonly employed in library settings. Quantitative methods, such as counting and benchmarking measures, are useful for investigating the internal operations of an access services department in order to identify workflow inefficiencies or…
Designing specific chloroplast markers for black walnut from a set of universal primers
Erin Victory; Rodney L. Robichaud; Keith Woeste
2003-01-01
Chloroplasts are a valuable source of genetic information because their sequence is highly conserved, they undergo little or no recombination, and they are uniparentally inherited. Chloroplast polymorphisms are powerful genetic tools for identifying matrilineal family groups, studying gene flow from seed versus pollen movement, reconstructing phylogeographic...
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A
2005-12-01
Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.
Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.
2016-01-01
We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445
Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean
2014-07-01
Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.
Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia
2015-01-01
This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Grapevine fleck virus-like viruses in Vitis.
Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P
2000-01-01
Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Detection of Bovine and Porcine Adenoviruses for Tracing the Source of Fecal Contamination
Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina
2004-01-01
In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies. PMID:15006765
Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination.
Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina
2004-03-01
In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies.
Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L
2017-02-01
Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Nodavirus infections in Israeli mariculture.
Ucko, M; Colorni, A; Diamant, A
2004-08-01
Viral encephalopathy and retinopathy (VER) infections were diagnosed in five fish species: Epinephelus aeneus, Dicentrarchus labrax, Sciaenops ocellatus, Lates calcarifer and Mugil cephalus cultured on both the Red Sea and Mediterranean coasts of Israel during 1998-2002. Spongiform vacuolation of nervous tissue was observed in histological sections of all examined species. With transmission electron microscopy, paracrystalline arrays and pieces of membrane-associated non-enveloped virions measuring approximately 30 nm in diameter were observed in the brain and retina of all species. At the molecular level, the nodavirus was detected by using a primer set that amplified the T4 region of the coat protein gene. When the same set of primers was used to search for VER in an additional fish species, Sparus aurata, it was found to produce non-specific amplicons, giving rise to false-positive results. This problem was overcome by using a different primer set (F1/VR3), designed on a highly conserved region of the virus gene, which amplified a fragment of 254 bp, and confirmed that S. aurata was nodavirus-free. This set was validated on all five species of infected fish, as well as clinically healthy fish. Comparison of the coat protein genes from the Israeli isolated sequences indicated that more than one viral strain was involved. No strict host-specificity was evident. Red Sea and Mediterranean isolated sequences grouped in distinct clusters, together with several foreign isolates from the Mediterranean area and the Far East, as phylogenetically close to the Epinephelus akaara RGNNV type.
Molecular method for determining sex of walruses
Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.
2008-01-01
We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.
Wang, Y.; Boyd, E.; Crane, S.; Lu-Irving, P.; Krabbenhoft, D.; King, S.; Dighton, J.; Geesey, G.; Barkay, T.
2011-01-01
The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient. ?? 2011 Springer Science+Business Media, LLC.
Wang, Yanping; Boyd, Eric; Crane, Sharron; Lu-Irving, Patricia; Krabbenhoft, David; King, Susan; Dighton, John; Geesey, Gill; Barkay, Tamar
2011-11-01
The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient.
Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian
2017-07-01
In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.
NASA Astrophysics Data System (ADS)
Park, S.; Kim, H.; Kim, M.; Lee, Y.; Han, J.
2011-12-01
The 2010 outbreak of foot and mouth disease (FMD) in South Korea caused about 4,054 carcass burial sites to dispose the carcasses. Potential environmental impacts by leachate of carcass on groundwater have been issued and it still needs to be studied. Therefore, we tried to develop robust and sensitive tool to immediately determine a groundwater contamination by the leachate from carcass burial. For tracking both an agricultural fecal contamination source and the leachate in groundwater, competitive real-time PCR and PCR method were developed using various PCR primer sets designed to detect E. Coli uidA gene and mtDNA(cytochrome B, cytB) of the animal species such as ovine, porcine, caprine, and bovine. The designed methods were applied to tract the animal species in livestock wastewater and leachate of carcass under appropriate PCR or real-time PCR condition. In the result, mtDNA primer sets for individual (Cow or Pig) and multiple (Cow and Pig) amplification, and E. Coli uidA primers for fecal source amplification were specific and sensitive to target genes. To determine contamination source, concentration of amplified mtDNA and uidA was competitively quantified in Livestock wastewater, leachate of carcass, and groundwater. The highest concentration of mtDNA and uidA showed in leachate of carcass and livestock wastewater, respectively. Groundwater samples possibly contaminated by leachate of carcass were analyzed by this assay and it was able to prove contamination source.
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk
2015-11-01
Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
1986-08-29
Abrasives Work Planning for Shipyard SP&C Training Overcoating of Zinc Primers Citric Acid Cleaning - Phase II - Waterborne Coatings Economics of...members workout organizational problems with minimum government involvement a set of strong, committed, and sometimes fiercely independent panels and...01 Manual of Welding Planning and Design Guidelines - Phase III PANEL SP-3 Ship Design Considerations: Adaptation of Japanese Pre - 7 9 79 81 82 83 83
Designing for transportation management and operations : a primer.
DOT National Transportation Integrated Search
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Detection of different South American hantaviruses.
Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio
2015-12-02
Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.
Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W
2000-12-01
Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
An innovative SNP genotyping method adapting to multiple platforms and throughputs.
Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L
2017-03-01
An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.
PCR detection of uncultured rumen bacteria.
Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan
2012-07-01
16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.
Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.
Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R
2017-01-03
This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.
USDA-ARS?s Scientific Manuscript database
A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Apple chlorotic leaf spot virus (ACLSV) was developed. In this method, a set of four primers was designed based on the conserved regions in the coat protein gene of ACLSV, and was synthesized for the ...
Detection of a Novel Porcine Parvovirus in Chinese Swine Herds
USDA-ARS?s Scientific Manuscript database
To determine whether the recently reported novel porcine parvovirus type 4 (PPV4) is prevalent in China, a set of PPV4 specific primers were designed and used for the molecular survey of PPV4 among clinical samples. The results indicated a positive detection for PPV4 in Chinese swine herds of 1.84% ...
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and principal component analysis. The statistical analysis results based on the band intensities of fungal DGGE profile showed that Saccharomyces cerevisiae, Saccharomycopsis fibuligera, Rhizopus oryzae, Monascus purpureus and Aspergillus niger were the dominant fungal species. In conclusion, the comparison of several primer sets for fungal PCR-DGGE would be useful to enrich our knowledge of the fungal community structures associated with traditional fermentation starters, which may facilitate the development of better starter cultures for manufacturing Chinese Hong Qu glutinous rice wine. Copyright © 2017 Elsevier B.V. All rights reserved.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.
2009-01-01
The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332
Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P
2008-01-01
Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660
Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R
2007-01-01
We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.
Maki, Masayuki
2009-03-01
Two sex-linked fragments were identified by RAPD analyses in the dioecious diploid shrub Aucuba japonica var. ovoidea and were converted into markers of male-specific sequence characterized amplified region (SCAR) markers. PCRs using the primers designed in this study correctly discriminated 24 flowering males and 24 flowering females at higher annealing temperatures (SCAR markers OPA10-424 at 55 degrees C and OPN11-1095 at 65 degrees C), although at relatively low annealing temperatures, the fragments were amplified in both males and females. These SCAR primers were also tested to see whether they were applicable to sex identification in the conspecific tetraploid Aucuba japonica var. japonica. One set pf SCAR primers could be used for sex identification even in this tetraploid variety, although the other failed. The SCAR markers developed in this study will provide a powerful tool in identifying the sex of immature plants of dioecious A. japonica, which is a commercially valuable shrub due to its conspicuous fruits.
Pentaplex PCR as screening assay for jellyfish species identification in food products.
Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra
2014-12-17
Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
2015-12-09
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
USDA-ARS?s Scientific Manuscript database
A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for detecting Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV) in sugarcane. Six sets of four primers corresponding to the conserved coat protein gene were designed for each virus and their succ...
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Mills, D; Russell, B W; Hanus, J W
1997-08-01
ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.
Matthew Parks; Aaron Liston; Rich Cronn
2011-01-01
Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...
Linear elastic fracture mechanics primer
NASA Technical Reports Server (NTRS)
Wilson, Christopher D.
1992-01-01
This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.
Novy, Ari; Flory, S Luke; Honig, Joshua A; Bonos, Stacy; Hartman, Jean Marie
2012-02-01
Microsatellite markers were developed for the invasive plant Microstegium vimineum (Poaceae) to assess its population structure and to facilitate tracking of invasion expansion. Using 454 sequencing, 11 polymorphic and six monomorphic microsatellite primer sets were developed for M. vimineum. The primer sets were tested on individuals sampled from six populations in the United States and China. The polymorphic primers amplified di-, tri-, and tetranucleotide repeats with three to 10 alleles per locus. These markers will be useful for a variety of applications including tracking of invasion dynamics and population genetics studies.
Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora
2010-01-01
A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank
2015-01-01
Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976
Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes
USDA-ARS?s Scientific Manuscript database
TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
DNA-based identification of Brassica vegetable species for the juice industry.
Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi
2003-10-01
Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.
Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk
2014-01-01
Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.
A Hamiltonian approach to the planar optimization of mid-course corrections
NASA Astrophysics Data System (ADS)
Iorfida, E.; Palmer, P. L.; Roberts, M.
2016-04-01
Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.
USDA-ARS?s Scientific Manuscript database
Botrytis cinerea, B. fabae and B. fabiopsis are known to cause chocolate spot on broad bean. This study was conducted to develop PCR-based assays to detect and differentiate this three species. Two sets of primers, Bc-f/Bc-r for B. cinerea and Bfab-f/Bfab-r for B. fabiopsis, were designed based on t...
Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.
2015-01-01
We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265
Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W
2015-07-01
We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.
Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.
Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan
2014-11-01
Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico <75% of insect species with complete mitochondrial genomes available, whereas new primers targeting 16S provided >90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.
Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.
2009-01-01
Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.
Improving molecular tools for global surveillance of measles virus⋆
Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.
2017-01-01
Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666
Lee, Mi Young; Doh, Eui Jeong; Kim, Eung Soo; Kim, Young Wha; Ko, Byong Seob; Oh, Seung-Eun
2008-04-01
Some plants classified in the genus Artemisia are used for medicinal purposes. In particular, A. iwayomogi, which is referred to as 'Haninjin,' is used as an important medicinal material in traditional Korean medicine. However, A. capillaris, and both A. argyi and A. princeps, referred to as 'Injinho' and 'Aeyup,' respectively, are used for purposes other than those for which 'Haninjin' is utilized. However, it is occasionally difficult to differentiate 'Haninjin' from 'Injinho' and/or 'Aeyup' on the basis of their morphological features, particularly when in the dried and/or sliced form. Therefore, the development of a reliable method by which to discriminate 'Haninjin' from other Artemisia herbs, especially 'Injinho' and 'Aeyup,' is clearly necessary. We recently determined that the RAPD (random amplified polymorphic DNA) technique can be used to discriminate efficiently between some Artemisia herbs. In particular, when applied to RAPD, the non-specific UBC primer 391 (5'-GCG AAC CTC G-3') was demonstrated to amplify PCR products specific to A. iwayomogi. Based on the nucleotide sequences of the PCR product, we designed a 2F1 (5'-ACC TCG GAC CTA AAT ACA-3')/ 2F3 (5'-TTA TGA TTC ATG TTC AAT TC-3') primer set to amplify a SCAR (sequence-characterized amplified region) marker of A. iwayomogi. Employing this primer set, along with two other primer sets amplifying SCAR markers of 'Aeyup' (A. argyi and A. princeps) and both 'Injinho' (A. capillaris) and A. japonica, which are classified into the same subgroup in a phenogram constructed from RAPD analysis, we developed a multiplex PCR method by which A. iwayomogi could be discriminated with certainty from other Artemisia herbs. Via this method, we determined not only whether the tested Artemisia herb was A. iwayomogi, but also which Artemisia herbs were tested concurrently with A. iwayomogi.
NASA Astrophysics Data System (ADS)
Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.
2004-12-01
The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.
Ostberg, C.O.; Rodriguez, R.J.
2004-01-01
Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.
Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen
2012-01-01
The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be detected in about an hour. Therefore, we have developed a platform to simultaneously detect foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could enable rapid detection or confirmation of contamination by these agents. PMID:22488053
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun
2015-07-08
We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.
Wang, Wei; Li, Zhuo; Li, Yong
2014-03-24
Cotinus coggygria Scop. (Anacardiaceae) is a deciduous shrub or small tree that is native to a large area covering from southern Europe, east across central Asia, and the Himalayas in northern China. Shotgun 454 pyrosequencing was used to develop microsatellite markers from the genome of C. coggygria. In this study, 349 microsatellite loci were identified from 40,074 individual sequence reads produced by one-sixteenth run, and primer pairs were designed for these loci. To test the primer amplification efficiency, 50 microsatellite primer pairs were tested across 12 individuals from two C. coggygria populations (Wuzhi Mountain: 36°30'N, 113°39'E; Tianlong Mountain: 37°42'N, 112°26'E). Among the 50 tested primer pairs, eight were found to be polymorphic. The average allele number of the microsatellites was 3.5 per locus, with a range from two to five. The inbreeding coefficient ranged from -0.478 to 0.222. The observed and expected heterozygosities varied from 0.167 to 0.750 and from 0.163 to 0.743, respectively. This set of markers is potentially useful for assessing the genetic diversity, as well as for understanding the population structure and phylogeographical and landscape genetic patterns, of C. coggygria.
Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA
Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus
2018-01-01
One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Woubit, Abdela; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen
2012-04-01
The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia, and Francisella include important food safety and biothreat agents. By extensive mining of the whole genome and protein databases of diverse, closely and distantly related bacterial species and strains, we have identified novel genome regions, which we utilized to develop a rapid detection platform for these pathogens. The specific genomic targets we have identified to design the primers in Francisella tularensis subsp. tularensis, F. tularensis subsp. novicida, Shigella dysenteriae, Salmonella enterica serovar Typhimurium, Vibrio cholerae, Yersinia pestis, and Yersinia pseudotuberculosis contained either known genes or putative proteins. Primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in silico PCR against whole-genome sequences of different species, subspecies, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (Escherichia coli O157:H7 strain EDL 933, Shigella dysenteriae, S. enterica serovar Typhi, F. tularensis subsp. tularensis, V. cholerae, and Y. pestis) and six foodborne pathogens (Salmonella Typhimurium, Salmonella Saintpaul, Shigella sonnei, F. tularensis subsp. novicida, Vibrio parahaemolyticus, and Y. pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed with purified DNA showed the lowest detection limit of 128 fg of DNA/μl for F. tularensis subsp. tularensis. A preliminary test to detect Shigella organisms in a milk matrix also enabled the detection of 6 to 60 CFU/ml. These new tools could ultimately be used to develop platforms to simultaneously detect these pathogens.
Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.
2006-01-01
Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263
Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong
2011-04-15
A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.
Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi
2015-09-01
Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.
KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud
2017-01-01
Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324
Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee
2017-10-01
Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.
Multiprimer PCR system for differential identification of mycobacteria in clinical samples.
Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M
1996-01-01
A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008
Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu
2013-01-01
In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Kim, Hyun-Joong; Ryu, Ji-Oh; Song, Ji-Yeon; Kim, Hae-Yeong
2017-07-01
In the detection of Shigella species using molecular biological methods, previously known genetic markers for Shigella species were not sufficient to discriminate between Shigella species and diarrheagenic Escherichia coli. The purposes of this study were to screen for genetic markers of the Shigella genus and four Shigella species through comparative genomics and develop a multiplex polymerase chain reaction (PCR) for the detection of shigellae and Shigella species. A total of seven genomic DNA sequences from Shigella species were subjected to comparative genomics for the screening of genetic markers of shigellae and each Shigella species. The primer sets were designed from the screened genetic markers and evaluated using PCR with genomic DNAs from Shigella and other bacterial strains in Enterobacteriaceae. A novel Shigella quintuplex PCR, designed for the detection of Shigella genus, S. dysenteriae, S. boydii, S. flexneri, and S. sonnei, was developed from the evaluated primer sets, and its performance was demonstrated with specifically amplified results from each Shigella species. This Shigella multiplex PCR is the first to be reported with novel genetic markers developed through comparative genomics and may be a useful tool for the accurate detection of the Shigella genus and species from closely related bacteria in clinical microbiology and food safety.
Isolation of a sex-linked DNA sequence in cranes.
Duan, W; Fuerst, P A
2001-01-01
A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.
Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin
2018-01-01
A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde
2014-11-01
To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.
Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang
2018-01-01
Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang
2018-01-01
Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture
2015-08-01
preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally
Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T
2016-09-01
Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.
Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.
Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn
2015-03-20
USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Ecological Risk Assessment of Explosive Residues in Rodents, Reptiles, Amphibians, and Fish
2004-03-01
oligonucleotide primers were designed according to the sequence for pendrin in Mus musculus . PCR was carried out using a Failsafe kit (Epicentre, WI). PCR...Project No. T9700 PERCHLORATE ANALYTICAL Phase V As a calibration curve is run each time a set of samples is analyzed, we routinely include an... Reset FINAL REPORT FY2002 SERDP Project: ER-1235 TABLE OF CONTENTS Topic Page IDENTIFICATION OF PERCHLORATE-CONTAMINATED AND REFERENCE SITES
Multiplex detection of agricultural pathogens
Siezak, Thomas R.; Gardner, Shea; Torres, Clinton; Vitalis, Elizabeth; Lenhoff, Raymond J.
2013-01-15
Described are kits and methods useful for detection of agricultural pathogens in a sample. Genomic sequence information from agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay and/or an array assay to successfully identify the presence or absence of pathogens in a sample.
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
2018-01-01
Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H
2006-04-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.
Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.
2006-01-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra
2015-01-01
Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743
Mohon, Abu Naser; Elahi, Rubayet; Khan, Wasif A; Haque, Rashidul; Sullivan, David J; Alam, Mohammad Shafiul
2014-06-01
Molecular diagnosis of malaria by nucleotide amplification requires sophisticated and expensive instruments, typically found only in well-established laboratories. Loop-mediated isothermal amplification (LAMP) has provided a new platform for an easily adaptable molecular technique for molecular diagnosis of malaria without the use of expensive instruments. A new primer set has been designed targeting the 18S rRNA gene for the detection of Plasmodium falciparum in whole blood samples. The efficacy of LAMP using the new primer set was assessed in this study in comparison to that of a previously described set of LAMP primers as well as with microscopy and real-time PCR as reference methods for detecting P. falciparum. Pre-addition of hydroxy napthol blue (HNB) in the LAMP reaction caused a distinct color change, thereby improving the visual detection system. The new LAMP assay was found to be 99.1% sensitive compared to microscopy and 98.1% when compared to real-time PCR. Meanwhile, its specificity was 99% and 100% in contrast to microscopy and real-time PCR, respectively. Moreover, the LAMP method was in very good agreement with microscopy and real-time PCR (0.94 and 0.98, respectively). This new LAMP method can detect at least 5parasites/μL of infected blood within 35min, while the other LAMP method tested in this study, could detect a minimum of 100parasites/μL of human blood after 60min of amplification. Thus, the new method is sensitive and specific, can be carried out in a very short time, and can substitute PCR in healthcare clinics and standard laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
TipMT: Identification of PCR-based taxon-specific markers.
Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C
2017-02-11
Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .
Nakayama, Motokazu; Hosoya, Kouichi; Tomiyama, Daisuke; Tsugukuni, Takashi; Matsuzawa, Tetsuhiro; Imanishi, Yumi; Yaguchi, Takashi
2013-06-01
In the beverage industry, peracetic acid has been increasingly used as a disinfectant for the filling machinery and environment due to merits of leaving no residue, it is safe for humans, and its antiseptic effect against fungi and endospores of bacteria. Recently, Chaetomium globosum and Chaetomium funicola were reported resistant to peracetic acid; however, little is known concerning the detail of peracetic acid resistance. Therefore, we assessed the peracetic acid resistance of the species of Chaetomium and related genera under identical conditions and made a thorough observation of the microstructure of their ascospores by transmission electron microscopy. The results of analyses revealed that C. globosum and C. funicola showed the high resistance to peracetic acid (a 1-D antiseptic effect after 900 s and 3-D antiseptic effect after 900 s) and had thick cell walls of ascospores that can impede the action mechanism of peracetic acid. We also developed specific primers to detect the C. globosum clade and identify C. funicola by using PCR to amplify the β-tubulin gene. PCR with the primer sets designed for C. globosum (Chae 4F/4R) and C. funicola (Cfu 2F/2R) amplified PCR products specific for the C. globosum clade and C. funicola, respectively. PCR with these two primer sets did not detect other fungi involved in food spoilage and environmental contamination. This detection and identification method is rapid and simple, with extremely high specificity.
Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk
2012-06-01
The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.
2013-07-10
of the virus in Spain was detected during an outbreak investigation of influenza -like illness (ILI) in soldiers from an engineering military academy...SwInfA primer and probe set) and specific A(H1N1) pdm09 influenza A viruses using SwH1 primer and probe set developed by CDC, Atlanta (WHO...CY062374, CY062375 and CY062376. Viral culture Influenza viruses were isolated from clinical samples by infecting Madin Darby Canine Kidney (MDCK
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
Messier, S P; Callahan, L F; Golightly, Y M; Keefe, F J
2015-05-01
The objective was to develop a set of "best practices" for use as a primer for those interested in entering the clinical trials field for lifestyle diet and/or exercise interventions in osteoarthritis (OA), and as a set of recommendations for experienced clinical trials investigators. A subcommittee of the non-pharmacologic therapies committee of the OARSI Clinical Trials Working Group was selected by the Steering Committee to develop a set of recommended principles for non-pharmacologic diet/exercise OA randomized clinical trials. Topics were identified for inclusion by co-authors and reviewed by the subcommittee. Resources included authors' expert opinions, traditional search methods including MEDLINE (via PubMed), and previously published guidelines. Suggested steps and considerations for study methods (e.g., recruitment and enrollment of participants, study design, intervention and assessment methods) were recommended. The recommendations set forth in this paper provide a guide from which a research group can design a lifestyle diet/exercise randomized clinical trial in patients with OA. Copyright © 2015 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R
2016-09-01
Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].
2012-01-01
Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984
Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed
2012-08-10
Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
A new cultivation independent approach to detect and monitor common Trichoderma species in soils.
Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael
2007-04-01
A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-09-29
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.
Multiplex detection of agricultural pathogens
McBride, Mary Teresa; Slezak, Thomas Richard; Messenger, Sharon Lee
2010-09-14
Described are kits and methods useful for detection of seven agricultural pathogens (BPSV; BHV; BVD; FMDV; BTV; SVD; and VESV) in a sample. Genomic sequence information from 7 agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.
Ballinas-Verdugo, Martha; Reyes, Pedro Antonio; Mejia-Dominguez, Ana; López, Ruth; Matta, Vivian; Monteón, Victor M
2011-12-01
Thirteen Trypanosoma cruzi isolates from different geographic regions of Mexico and Guatemala belonging to discrete typing unit (DTU) I and a reference CL-Brener (DTU VI) strain were used to perform enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). A panel of 57 Mexican serum samples of patients with chronic chagasic cardiopathy and asymptomatic infected subjects (blood bank donors) were used in this study. DNA from the above 14 T. cruzi strains were extracted and analyzed by PCR using different sets of primers designed from minicircle and satellite T. cruzi DNA. The chronic chagasic cardiopathy serum samples were easily recognized with ELISA regardless of the source of antigenic extract used, even with the CL-Brener TcVI, but positive serum samples from blood bank donors in some cases were not recognized by some Mexican antigenic extracts. On the other hand, PCR showed an excellent performance despite the set of primers used, since all Mexican and Guatemalan T. cruzi strains were correctly amplified. In general terms, Mexican, Guatemalan, and CL-Brener T. cruzi strains are equally good sources of antigen when using the ELISA test to detect Mexican serum samples. However, there are some strains with poor performance. The DTU I strains are easily detected using either kinetoplast or satellite DNA target designed from DTU VI strains.
Piwat, S; Teanpaisan, R
2013-01-01
This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.
Piwat, S.; Teanpaisan, R.
2013-01-01
This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230
Real-time PCR for rapidly detecting aniline-degrading bacteria in activated sludge.
Kayashima, Takakazu; Suzuki, Hisako; Maeda, Toshinari; Ogawa, Hiroaki I
2013-05-01
We developed a detection method that uses quantitative real-time PCR (qPCR) and the TaqMan system to easily and rapidly assess the population of aniline-degrading bacteria in activated sludge prior to conducting a biodegradability test on a chemical compound. A primer and probe set for qPCR was designed by a multiple alignment of conserved amino acid sequences encoding the large (α) subunit of aniline dioxygenase. PCR amplification tests showed that the designed primer and probe set targeted aniline-degrading strains such as Acidovorax sp., Gordonia sp., Rhodococcus sp., and Pseudomonas putida, thereby suggesting that the developed method can detect a wide variety of aniline-degrading bacteria. There was a strong correlation between the relative copy number of the α-aniline dioxygenase gene in activated sludge obtained with the developed qPCR method and the number of aniline-degrading bacteria measured by the Most Probable Number method, which is the conventional method, and a good correlation with the lag time of the BOD curve for aniline degradation produced by the biodegradability test in activated sludge samples collected from eight different wastewater treatment plants in Japan. The developed method will be valuable for the rapid and accurate evaluation of the activity of inocula prior to conducting a ready biodegradability test. Copyright © 2013 Elsevier Ltd. All rights reserved.
Wang, Ruixue; Soll, Lindsey; Dugan, Vivien; Runstadler, Jonathan; Happ, George; Slemons, Richard D; Taubenberger, Jeffery K
2008-05-25
This study presents an interconnected approach for circumventing two inherent limitations associated with studies defining the natural history of influenza A viruses in wild birds. The first limiting factor is the ability to maintain a cold chain from specimen collection to the laboratory when study sites are in more remote locations. The second limiting factor is the ability to identify all influenza A virus HA subtypes present in an original sample. We report a novel method for molecular subtyping of avian influenza A virus hemagglutinin genes using degenerate primers designed to amplify all known hemagglutinin subtypes. It was shown previously that templates larger than 200 bp were not consistently amplifiable from ethanol-fixed cloacal swabs. For this study, new primer sets were designed within these constraints. This method was used to perform subtyping RT-PCR on 191 influenza RNA-positive ethanol-fixed cloacal swabs obtained from 880 wild ducks in central Alaska in 2005. Seven different co-circulating hemagglutinin subtypes were identified in this study set, including H1, H3, H4, H5, H6, H8, and H12. In addition, 16% of original cloacal samples showed evidence of mixed infection, with samples yielding from two-to-five different hemagglutinin subtypes. This study further demonstrates the complex ecobiology of avian influenza A viruses in wild birds.
Wang, Ruixue; Soll, Lindsey; Dugan, Vivien; Runstadler, Jonathan; Happ, George; Slemons, Richard D.; Taubenberger, Jeffery K.
2008-01-01
This study presents an interconnected approach for circumventing two inherent limitations associated with studies defining the natural history of influenza A viruses in wild birds. The first limiting factor is the ability to maintain a cold chain from specimen collection to the laboratory when study sites are in more remote locations. The second limiting factor is the ability to identify all influenza A virus HA subtypes present in an original sample. We report a novel method for molecular subtyping of avian influenza A virus hemagglutinin genes using degenerate primers designed to amplify all known hemagglutinin subtypes. It was shown previously that templates larger than 200 bp were not consistently amplifiable from ethanol-fixed cloacal swabs. For this study, new primer sets were designed within these constraints. This method was used to perform subtyping RT-PCR on 191 influenza RNA-positive ethanol-fixed cloacal swabs obtained from 880 wild ducks in central Alaska in 2005. Seven different co-circulating hemagglutinin subtypes were identified in this study set, including H1, H3, H4, H5, H6, H8, and H12. In addition, 16% of original cloacal samples showed evidence of mixed infection, with samples yielding from two-to-five different hemagglutinin subtypes. This study further demonstrates the complex ecobiology of avian influenza A viruses in wild birds. PMID:18308356
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
Murrinh Nganki (Our Language), 1.
ERIC Educational Resources Information Center
Street, Chester; And Others
This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
GSP: a web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...
Huang, Yili; Feng, Hao; Lu, Hang; Zeng, Yanhua
2017-07-01
It is believed that sphingomonads are ubiquitously distributed in environments. However detailed information about their community structure and their co-relationship with environmental parameters remain unclear. In this study, novel sphingomonads-specific primers based on the 16S rRNA gene were designed to investigate the distribution of sphingomonads in 10 different niches. Both in silico and in-practice tests on pure cultures and environmental samples showed that Sph384f/Sph701r was an efficient primer set. Illumina MiSeq sequencing revealed that community structures of sphingomonads were significantly different among the 10 samples, although 12 sphingomonad genera were present in all samples. Based on RDA analysis and Monte Carlo permutation test, sphingomonad community structure was significantly correlated with limnetic and marine habitat types. Among these niches, the genus Sphingomicrobium showed strong positive correlation with marine habitats, whereas genera Sphingobium, Novosphingobium, Sphingopyxis, and Sphingorhabdus showed strong positive correlation with limnetic habitats. Our study provided direct evidence that sphingomonads are ubiquitously distributed in environments, and revealed for the first time that their community structure can be correlated with habitats.
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H
2015-01-01
DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.
Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua
2016-07-01
This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.
ABACAS: algorithm-based automatic contiguation of assembled sequences
Assefa, Samuel; Keane, Thomas M.; Otto, Thomas D.; Newbold, Chris; Berriman, Matthew
2009-01-01
Summary: Due to the availability of new sequencing technologies, we are now increasingly interested in sequencing closely related strains of existing finished genomes. Recently a number of de novo and mapping-based assemblers have been developed to produce high quality draft genomes from new sequencing technology reads. New tools are necessary to take contigs from a draft assembly through to a fully contiguated genome sequence. ABACAS is intended as a tool to rapidly contiguate (align, order, orientate), visualize and design primers to close gaps on shotgun assembled contigs based on a reference sequence. The input to ABACAS is a set of contigs which will be aligned to the reference genome, ordered and orientated, visualized in the ACT comparative browser, and optimal primer sequences are automatically generated. Availability and Implementation: ABACAS is implemented in Perl and is freely available for download from http://abacas.sourceforge.net Contact: sa4@sanger.ac.uk PMID:19497936
Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F
2016-07-01
Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.
Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu
2015-03-01
Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.
Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho
2015-04-01
Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
ERIC Educational Resources Information Center
Schubert, Sandra; Zelinsky, Benjamin
Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia
Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah
2011-01-01
Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311
Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang
2014-01-17
Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.
Competitor internal standards for quantitative detection of mycoplasma DNA.
Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J
1995-05-01
Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.
Filipiak, Anna; Hasiów-Jaroszewska, Beata
2016-04-01
The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"
ERIC Educational Resources Information Center
Belfield, Clive
2008-01-01
Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…
Primers As Socializing Agents in American and Finnish Schools.
ERIC Educational Resources Information Center
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt
2017-03-22
Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
USDA-ARS?s Scientific Manuscript database
Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander
2012-01-01
The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135
Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.
Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R
2001-04-01
A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.
Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel
2016-01-21
A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. Copyright © 2015 Elsevier B.V. All rights reserved.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
ERIC Educational Resources Information Center
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Guo, Xu-Guang; Zhou, Shan
2014-01-01
Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360
2013-01-01
Background Microsatellites are widely used for many genetic studies. In contrast to single nucleotide polymorphism (SNP) and genotyping-by-sequencing methods, they are readily typed in samples of low DNA quality/concentration (e.g. museum/non-invasive samples), and enable the quick, cheap identification of species, hybrids, clones and ploidy. Microsatellites also have the highest cross-species utility of all types of markers used for genotyping, but, despite this, when isolated from a single species, only a relatively small proportion will be of utility. Marker development of any type requires skill and time. The availability of sufficient “off-the-shelf” markers that are suitable for genotyping a wide range of species would not only save resources but also uniquely enable new comparisons of diversity among taxa at the same set of loci. No other marker types are capable of enabling this. We therefore developed a set of avian microsatellite markers with enhanced cross-species utility. Results We selected highly-conserved sequences with a high number of repeat units in both of two genetically distant species. Twenty-four primer sets were designed from homologous sequences that possessed at least eight repeat units in both the zebra finch (Taeniopygia guttata) and chicken (Gallus gallus). Each primer sequence was a complete match to zebra finch and, after accounting for degenerate bases, at least 86% similar to chicken. We assessed primer-set utility by genotyping individuals belonging to eight passerine and four non-passerine species. The majority of the new Conserved Avian Microsatellite (CAM) markers amplified in all 12 species tested (on average, 94% in passerines and 95% in non-passerines). This new marker set is of especially high utility in passerines, with a mean 68% of loci polymorphic per species, compared with 42% in non-passerine species. Conclusions When combined with previously described conserved loci, this new set of conserved markers will not only reduce the necessity and expense of microsatellite isolation for a wide range of genetic studies, including avian parentage and population analyses, but will also now enable comparisons of genetic diversity among different species (and populations) at the same set of loci, with no or reduced bias. Finally, the approach used here can be applied to other taxa in which appropriate genome sequences are available. PMID:23497230
Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia
2017-04-01
This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Initialization of Formation Flying Using Primer Vector Theory
NASA Technical Reports Server (NTRS)
Mailhe, Laurie; Schiff, Conrad; Folta, David
2002-01-01
In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.
Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido
2018-02-08
Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2013-01-01
Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.
Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H
2015-09-28
Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.
Ludeña, Bertha; Chabrillange, Nathalie; Aberlenc-Bertossi, Frédérique; Adam, Hélène; Tregear, James W.; Pintaud, Jean-Christophe
2011-01-01
Background and Aims Molecular phylogenetic studies of palms (Arecaceae) have not yet provided a fully resolved phylogeny of the family. There is a need to increase the current set of markers to resolve difficult groups such as the Neotropical subtribe Bactridinae (Arecoideae: Cocoseae). We propose the use of two single-copy nuclear genes as valuable tools for palm phylogenetics. Methods New primers were developed for the amplification of the AGAMOUS 1 (AG1) and PHYTOCHROME B (PHYB) genes. For the AGAMOUS gene, the paralogue 1 of Elaeis guineensis (EgAG1) was targeted. The region amplified contained coding sequences between the MIKC K and C MADS-box domains. For the PHYB gene, exon 1 (partial sequence) was first amplified in palm species using published degenerate primers for Poaceae, and then specific palm primers were designed. The two gene portions were sequenced in 22 species of palms representing all genera of Bactridinae, with emphasis on Astrocaryum and Hexopetion, the status of the latter genus still being debated. Key Results The new primers designed allow consistent amplification and high-quality sequencing within the palm family. The two loci studied produced more variability than chloroplast loci and equally or less variability than PRK, RPBII and ITS nuclear markers. The phylogenetic structure obtained with AG1 and PHYB genes provides new insights into intergeneric relationships within the Bactridinae and the intrageneric structure of Astrocaryum. The Hexopetion clade was recovered as monophyletic with both markers and was weakly supported as sister to Astrocaryum sensu stricto in the combined analysis. The rare Astrocaryum minus formed a species complex with Astrocaryum gynacanthum. Moreover, both AG1 and PHYB contain a microsatellite that could have further uses in species delimitation and population genetics. Conclusions AG1 and PHYB provide additional phylogenetic information within the palm family, and should prove useful in combination with other genes to improve the resolution of palm phylogenies. PMID:21828068
Bekaert, Michaël; Bakheit, Mohammed; Frischmann, Sieghard; Patel, Pranav; Simon-Loriere, Etienne; Lambrechts, Louis; Duong, Veasna; Dussart, Philippe; Harold, Graham; Fall, Cheikh; Faye, Oumar; Sall, Amadou Alpha; Weidmann, Manfred
2018-01-01
Background 4 one-step, real-time, reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays were developed for the detection of dengue virus (DENV) serotypes by considering 2,056 full genome DENV sequences. DENV1 and DENV2 RT-LAMP assays were validated with 31 blood and 11 serum samples from Tanzania, Senegal, Sudan and Mauritania. DENV3 and DENV4 RT-LAMP assays were validated with 25 serum samples from Cambodia Methodology/Principal findings 4 final reaction primer mixes were obtained by using a combination of Principal Component Analysis of the full DENV genome sequences, and LAMP primer design based on sequence alignments using the LAVA software. These mixes contained 14 (DENV1), 12 (DENV2), 8 (DENV3) and 3 (DENV4) LAMP primer sets. The assays were evaluated with an External Quality Assessment panel from Quality Control for Molecular Diagnostics. The assays were serotype-specific and did not cross-detect with other flaviviruses. The limits of detection, with 95% probability, were 22 (DENV1), 542 (DENV2), 197 (DENV3) and 641 (DENV4) RNA molecules, and 100% reproducibility in the assays was obtained with up to 102 (DENV1) and 103 RNA molecules (DENV2, DENV3 and DENV4). Validation of the DENV2 assay with blood samples from Tanzania resulted in 23 samples detected by RT-LAMP, demonstrating that the assay is 100% specific and 95.8% sensitive (positive predictive value of 100% and a negative predictive value of 85.7%). All serum samples from Senegal, Sudan and Mauritania were detected and 3 untyped as DENV1. The sensitivity of RT-LAMP for DENV4 samples from Cambodia did not quite match qRT-PCR. Conclusions/Significance We have shown a novel approach to design LAMP primers that makes use of fast growing sequence databases. The DENV1 and DENV2 assays were validated with viral RNA extracted clinical samples, showing very good performance parameters. PMID:29813062
Primer vector theory and applications
NASA Technical Reports Server (NTRS)
Jezewski, D. J.
1975-01-01
A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Fondevila, M; Børsting, C; Phillips, C; de la Puente, M; Consortium, Euroforen-NoE; Carracedo, A; Morling, N; Lareu, M V
2017-01-01
This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides an advantage. In order to provide the basis for developing such expertise, we cover in this paper the most challenging aspects of the SNaPshot technology, focusing on the steps taken to design primer sets, optimize the PCR and single-base extension chemistries, and the important features of the peak patterns observed in typical forensic SNP profiles using SNaPshot. With that purpose in mind, we provide guidelines and troubleshooting for multiplex-SNaPshot-oriented primer design and the resulting capillary electrophoresis (CE) profile interpretation (covering the most commonly observed artifacts and expected departures from the ideal conditions). Copyright © 2017 Central Police University.
Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli
2014-04-03
Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad
2017-09-15
At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.
AMPLISAS: a web server for multilocus genotyping using next-generation amplicon sequencing data.
Sebastian, Alvaro; Herdegen, Magdalena; Migalska, Magdalena; Radwan, Jacek
2016-03-01
Next-generation sequencing (NGS) technologies are revolutionizing the fields of biology and medicine as powerful tools for amplicon sequencing (AS). Using combinations of primers and barcodes, it is possible to sequence targeted genomic regions with deep coverage for hundreds, even thousands, of individuals in a single experiment. This is extremely valuable for the genotyping of gene families in which locus-specific primers are often difficult to design, such as the major histocompatibility complex (MHC). The utility of AS is, however, limited by the high intrinsic sequencing error rates of NGS technologies and other sources of error such as polymerase amplification or chimera formation. Correcting these errors requires extensive bioinformatic post-processing of NGS data. Amplicon Sequence Assignment (AMPLISAS) is a tool that performs analysis of AS results in a simple and efficient way, while offering customization options for advanced users. AMPLISAS is designed as a three-step pipeline consisting of (i) read demultiplexing, (ii) unique sequence clustering and (iii) erroneous sequence filtering. Allele sequences and frequencies are retrieved in excel spreadsheet format, making them easy to interpret. AMPLISAS performance has been successfully benchmarked against previously published genotyped MHC data sets obtained with various NGS technologies. © 2015 John Wiley & Sons Ltd.
Tao, Chenyu; Yang, Yalan; Li, Xunbi; Zheng, Xinmin; Ren, Hongyan; Li, Kui; Zhou, Rong
2016-07-01
Genetically modified (GM) livestock have the potential to contribute to improving the environment and human health, with consumption of fewer resources and reduced waste production. However, the transgene process also poses risks. The safety assessment and control of transgenic animal products have drawn wide attention, and the relevant regulations and technology are being developed. Quick testing technology plays a significant role in on-site and customs sampling. Nowadays, loop-mediated isothermal amplification (LAMP) was widely applied in nucleic acid analysis because of its simplicity, rapidity, high efficiency and specificity. In this study, a specific, sensitive detection system for detecting sFAT-1 transgenic pigs was designed. A set of six primers including two loop primers was designed for the target sequence. The DNA samples were amplified in less than 1 h at the optimized temperature and detecting by both Nephelometer LA-320c and unaided eyes directly adding calcein. The detection limit of sFAT-1 LAMP was as low as 1.26 ng/μL. Furthermore, blind tests of transgenic and non-transgenic DNA samples were all correctly detected. Hence, the results in this study demonstrated that LAMP is a very useful tool for transgenic detection.
Blick, Robert J.; Revel, Andrew T.; Hansen, Eric J.
2008-01-01
Summary FindGDPs is a program that uses a greedy algorithm to quickly identify a set of genome-directed primers that specifically anneal to all of the open reading frames in a genome and that do not exhibit full-length complementarity to the members of another user-supplied set of nucleotide sequences. Availability The program code is distributed under the GNU General Public License at http://www8.utsouthwestern.edu/utsw/cda/dept131456/files/159331.html Contact eric.hansen@utsouthwestern.edu PMID:15593406
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
S-genotype identification based on allele-specific PCR in Japanese pear
Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya
2015-01-01
Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617
Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A
2009-01-01
We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351
Li, Yong; Zhang, Weirui
2015-10-01
Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.
Christophersen, Edward; Butt, Zeeshan
2012-12-01
Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.
Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin
2016-07-01
The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.
Priming cases disturb visual search patterns in screening mammography
NASA Astrophysics Data System (ADS)
Lewis, Sarah J.; Reed, Warren M.; Tan, Alvin N. K.; Brennan, Patrick C.; Lee, Warwick; Mello-Thoms, Claudia
2015-03-01
Rationale and Objectives: To investigate the effect of inserting obvious cancers into a screening set of mammograms on the visual search of radiologists. Previous research presents conflicting evidence as to the impact of priming in scenarios where prevalence is naturally low, such as in screening mammography. Materials and Methods: An observer performance and eye position analysis study was performed. Four expert breast radiologists were asked to interpret two sets of 40 screening mammograms. The Control Set contained 36 normal and 4 malignant cases (located at case # 9, 14, 25 and 37). The Primed Set contained the same 34 normal and 4 malignant cases (in the same location) plus 2 "primer" malignant cases replacing 2 normal cases (located at positions #20 and 34). Primer cases were defined as lower difficulty cases containing salient malignant features inserted before cases of greater difficulty. Results: Wilcoxon Signed Rank Test indicated no significant differences in sensitivity or specificity between the two sets (P > 0.05). The fixation count in the malignant cases (#25, 37) in the Primed Set after viewing the primer cases (#20, 34) decreased significantly (Z = -2.330, P = 0.020). False-Negatives errors were mostly due to sampling in the Primed Set (75%) in contrast to in the Control Set (25%). Conclusion: The overall performance of radiologists is not affected by the inclusion of obvious cancer cases. However, changes in visual search behavior, as measured by eye-position recording, suggests visual disturbance by the inclusion of priming cases in screening mammography.
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C
2015-03-01
A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.
Improving molecular tools for global surveillance of measles virus.
Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A
2013-09-01
The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.
Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko
2005-01-01
PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.
Koester, Meike; Gergs, René
2017-10-05
Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.
40 CFR 63.821 - Designation of affected sources.
Code of Federal Regulations, 2013 CFR
2013-07-01
... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...
40 CFR 63.821 - Designation of affected sources.
Code of Federal Regulations, 2012 CFR
2012-07-01
... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...
40 CFR 63.821 - Designation of affected sources.
Code of Federal Regulations, 2014 CFR
2014-07-01
... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
2010-01-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642
Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B
1997-11-01
Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou
2015-01-09
Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control.
Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou
2015-01-01
Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control. PMID:25584616
ERIC Educational Resources Information Center
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Constructing STR multiplex assays.
Butler, John M
2005-01-01
Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.
Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E
2013-10-01
Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.
BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"
This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...
Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Wiesner, G.; Laken, S.
The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less
Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray
2018-06-01
Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.
Li, Yong; Zhang, Weirui
2015-01-01
Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
Kishimoto, Mai; Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Hasebe, Ayako; Otsu, Keiko; Sugimura, Satoshi; Kobayashi, Suguru; Komatsu, Natsumi; Nagai, Makoto; Omatsu, Tsutomu; Naoi, Yuki; Sano, Kaori; Okazaki-Terashima, Sachiko; Oba, Mami; Katayama, Yukie; Sato, Reiichiro; Asai, Tetsuo; Mizutani, Tetsuya
2017-03-18
Bovine respiratory disease complex (BRDC) is frequently found in cattle worldwide. The etiology of BRDC is complicated by infections with multiple pathogens, making identification of the causal pathogen difficult. Here, we developed a detection system by applying TaqMan real-time PCR (Dembo respiratory-PCR) to screen a broad range of microbes associated with BRDC in a single run. We selected 16 bovine respiratory pathogens (bovine viral diarrhea virus, bovine coronavirus, bovine parainfluenza virus 3, bovine respiratory syncytial virus, influenza D virus, bovine rhinitis A virus, bovine rhinitis B virus, bovine herpesvirus 1, bovine adenovirus 3, bovine adenovirus 7, Mannheimia haemolytica, Pasteurella multocida, Histophilus somni, Trueperella pyogenes, Mycoplasma bovis and Ureaplasma diversum) as detection targets and designed novel specific primer-probe sets for nine of them. The assay performance was assessed using standard curves from synthesized DNA. In addition, the sensitivity of the assay was evaluated by spiking solutions extracted from nasal swabs that were negative by Dembo respiratory-PCR for nucleic acids of pathogens or synthesized DNA. All primer-probe sets showed high sensitivity. In this study, a total of 40 nasal swab samples from cattle on six farms were tested by Dembo respiratory-PCR. Dembo respiratory-PCR can be applied as a screening system with wide detection targets.
Wong, Y-P; Othman, S; Lau, Y-L; Radu, S; Chee, H-Y
2018-03-01
Loop-mediated isothermal amplification (LAMP) amplifies DNA with high specificity, efficiency and rapidity under isothermal conditions by using a DNA polymerase with high displacement strand activity and a set of specifically designed primers to amplify targeted DNA strands. Following its first discovery by Notomi et al. ( Nucleic Acids Res 28: E63), LAMP was further developed over the years which involved the combination of this technique with other molecular approaches, such as reverse transcription and multiplex amplification for the detection of infectious diseases caused by micro-organisms in humans, livestock and plants. In this review, available types of LAMP techniques will be discussed together with their applications in detection of various micro-organisms. Up to date, there are varieties of LAMP detection methods available including colorimetric and fluorescent detection, real-time monitoring using turbidity metre and detection using lateral flow device which will also be highlighted in this review. Apart from that, commercialization of LAMP technique had also been reported such as lyophilized form of LAMP reagents kit and LAMP primer sets for detection of pathogenic micro-organisms. On top of that, advantages and limitations of this molecular detection method are also described together with its future potential as a diagnostic method for infectious disease. © 2017 The Society for Applied Microbiology.
Aguirre, C; Olivares, N; Luppichini, P; Hinrichsen, P
2015-02-01
A PCR-based method was developed to identify Naupactus cervinus (Boheman) and Naupactus xanthographus (Germar), two curculionids affecting the citrus industry in Chile. The quarantine status of these two species depends on the country to which fruits are exported. This identification method was developed because it is not possible to discriminate between these two species at the egg stage. The method is based on the species-specific amplification of sequences of internal transcribed spacers, for which we cloned and sequenced these genome fragments from each species. We designed an identification system based on two duplex-PCR reactions. Each one contains the species-specific primer set and a second generic primer set that amplify a short 18S region common to coleopterans, to avoid false negatives. The marker system is able to differentiate each Naupactus species at any life stage, and with a diagnostic sensitivity to 0.045 ng of genomic DNA. This PCR kit was validated by samples collected from different citrus production areas throughout Chile and showed 100% accuracy in differentiating the two Naupactus species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji
2012-12-01
Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
ERIC Educational Resources Information Center
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
Neupauerová, Jana; Grečmalová, Dagmar; Seeman, Pavel; Laššuthová, Petra
2016-05-01
We describe a patient with early onset severe axonal Charcot-Marie-Tooth disease (CMT2) with dominant inheritance, in whom Sanger sequencing failed to detect a mutation in the mitofusin 2 (MFN2) gene because of a single nucleotide polymorphism (rs2236057) under the PCR primer sequence. The severe early onset phenotype and the family history with severely affected mother (died after delivery) was very suggestive of CMT2A and this suspicion was finally confirmed by a MFN2 mutation. The mutation p.His361Tyr was later detected in the patient by massively parallel sequencing with a gene panel for hereditary neuropathies. According to this information, new primers for amplification and sequencing were designed which bind away from the polymorphic sites of the patient's DNA. Sanger sequencing with these new primers then confirmed the heterozygous mutation in the MFN2 gene in this patient. This case report shows that massively parallel sequencing may in some rare cases be more sensitive than Sanger sequencing and highlights the importance of accurate primer design which requires special attention. © 2016 John Wiley & Sons Ltd/University College London.
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-01-01
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711
2010-01-01
Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041
Crystallographic observation of nonenzymatic RNA primer extension.
Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W
2018-05-31
The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.
Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using
Weier, H.U.G.; Gray, J.W.
1995-06-27
A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.
Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis
2017-12-02
DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.
Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using
Weier, Heinz-Ulrich G.; Gray, Joe W.
1995-01-01
A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.
DNA authentication of animal-derived concentrated Chinese medicine granules.
Jiang, Li-Li; Lo, Yat-Tung; Chen, Wei-Ting; Shaw, Pang-Chui
2016-09-10
Concentrated Chinese medicine granules (CCMG) offer patients a convenient option for traditional therapy. However with morphological and microscopic characteristics lost, it is difficult to authenticate and control the quality of these medicinal products. This study is the first to examine the feasibility of using DNA techniques to authenticate animal-derived CCMG, which has so far lacking of effective means for authentication. Primers targeting amplicons of different sizes were designed to determine the presence of PCR-amplifiable DNA fragments in two types of CCMG, namely Zaocys and Scorpio. Species-specific primers were designed to differentiate the genuine drugs from their adulterants. The specificity of the designed primers was evaluated in crude drugs (including genuine and adulterant) and CCMG. Results showed that by using species-specific primers, DNA fragments of less than 200bp could be isolated from the CCMG and the concerned source materials. This study demonstrated the presence of small size DNA in animal-derived CCMG and the DNA is effective in species identification. The work has extended the application of DNA techniques in herbal medicine and this approach may be further developed for quality control and regulatory compliance in the CCMG industry. Copyright © 2016 Elsevier B.V. All rights reserved.
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
Identification of duck plague virus by polymerase chain reaction.
Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
Shivappa, R.B.; Savan, R.; Kono, T.; Sakai, M.; Emmenegger, E.; Kurath, G.; Levine, Jay F.
2008-01-01
Spring viraemia of carp virus (SVCV) is a rhabdovirus associated with systemic illness and mortality in cyprinids. Several diagnostic tests are available for detection of SVCV. However, most of these tests are time consuming and are not well adapted for field-based diagnostics. In this study, a diagnostic tool for SVCV detection based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) has been developed. Based on the nucleotide sequence of the glycoprotein (G) gene of SVCV North Carolina (NC) isolate, four sets (each set containing two outer and two inner) of primers were designed. Temperature and time conditions were optimized to 65 ??C and 60 min, respectively, for LAMP and RT-LAMP using one primer set. In vitro specificity was evaluated using four different strains of fish rhabdoviruses and RT-LAMP was found to be specific to SVCV. Serial dilutions of SVCV NC isolate was used to evaluate the in vitro sensitivity of RT-LAMP. Sensitivity of the assays was similar to RT-PCR and detected SVCV even at the lowest dilution of 10 1 TCID50 mL-1. The ability of RT-LAMP to detect SVCV from infected carp was also tested and the assay detected SVCV from all infected fish. The isothermal temperature requirements, high specificity and sensitivity, and short incubation time of the RT-LAMP assay make it an excellent choice as a field diagnostic test for SVCV. ?? 2008 The Authors.
Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K
2018-06-06
Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
Molecular tools for the identification of Tuber melanosporum in agroindustry.
Séjalon-Delmas, N; Roux, C; Martins, M; Kulifaj, M; Bécard, G; Dargent, R
2000-06-01
Tuber melanosporum Vitt., Tuber magnatum Pico, and Tuber uncinatum Chat. can be differentiated by their morphological characters. Fraud problems have arisen recently with the importation to Europe of truffles from China. T. melanosporum is morphologically very close, but distinct from the Chinese species [Tuber indicum (Cooke and Massee) and T. himalayense BC (Zhang and Winter)]. We have optimized molecular tools to unequivocally identify T. melanosporum. DNA extraction from ascocarps of black truffles is not straightforward. Problems to obtain pure DNA are due to high contents of phenolic compounds, melanine, and various polymers (proteins, polysaccharides, etc). These compounds coprecipitate with the DNA during extraction and strongly inhibit the PCR reaction. We have developed an efficient and reliable protocol for DNA extraction from truffle ascocarps. It was used successfully for DNA extraction from mycorrhizal root tips as well as from canned preparations of T. melanosporum. Several approaches to identify T. melanosporum by PCR were developed. Two specific primers for T. melanosporum were designed after comparison of the ITS region of this species with those of three Chinese fungi. They proved to be efficient to specifically detect the presence of T. melanosporum by PCR. The mycorrhizal status of trees inoculated with T. melanosporum but unable to produce truffles was confirmed in a single-step PCR reaction. A multiplex PCR approach was also developed with three sets of primers (including a specific one for Chinese truffles) to detect, in one PCR reaction, the presence of any other Tuber species mixed with T. melanosporum ascocarps. This optimized protocol, in association with the specific primers we designed, is applicable to quality control in the truffle industry from the production stages to final commercial products.
Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro
2016-01-01
Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929
Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro
2016-02-01
Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.
Raue, R; Hess, M
1998-08-01
Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.
Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A
2008-05-01
Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this group. Phylogenetic analysis of amplicons from virus assemblages from Norwegian coastal waters as well as from isolated algal viruses revealed a cluster of viruses infecting members of the prymnesiophyte and prasinophyte alga divisions. Other distinct clusters were also identified, containing amplicons from this study as well as sequences retrieved from the Sargasso Sea metagenome. This shows that closely related sequences of this family are present at geographically distant locations within the marine environment.
Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco
Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
Ogaya, Yuko; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko
2015-01-01
The oral cavity has been implicated as a source of Helicobacter pylori infection in childhood. Various PCR methods have been used to detect H. pylori DNA in oral specimens with various detection rates reported. Such disparity in detection rates complicates the estimation of the true infection rate of H. pylori in the oral cavity. In the present study, we constructed a novel PCR system for H. pylori detection and used it to analyse oral specimens. Firstly, the nucleotide alignments of genes commonly used for H. pylori detection were compared using the complete genome information for 48 strains registered in the GenBank database. Candidate primer sets with an estimated amplification size of approximately 300-400 bp were selected, and the specificity and sensitivity of the detection system using each primer set were evaluated. Five sets of primers targeting ureA were considered appropriate, of which a single primer set was chosen for inclusion in the PCR system. The sensitivity of the system was considered appropriate and its detection limit established as one to ten cells per reaction. The novel PCR system was used to examine H. pylori distribution in oral specimens (40 inflamed pulp tissues, 40 saliva samples) collected from Japanese children, adolescents and young adults. PCR analysis revealed that the detection rate of H. pylori in inflamed pulp was 15 %, whereas no positive reaction was found in any of the saliva specimens. Taken together, our novel PCR system was found to be reliable for detecting H. pylori. The results obtained showed that H. pylori was detected in inflamed pulp but not saliva specimens, indicating that an infected root canal may be a reservoir for H. pylori. © 2015 The Authors.
Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel
2011-04-28
The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.
One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.
Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung
2016-06-01
Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.
Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun
2015-12-03
Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.
Development of Cross-Assembly Phage PCR-Based Methods ...
Technologies that can characterize human fecal pollution in environmental waters offer many advantages over traditional general indicator approaches. However, many human-associated methods cross-react with non-human animal sources and lack suitable sensitivity for fecal source identification applications. The genome of a newly discovered bacteriophage (~97 kbp), the Cross-Assembly phage or “crAssphage”, assembled from a human gut metagenome DNA sequence library is predicted to be both highly abundant and predominately occur in human feces suggesting that this double stranded DNA virus may be an ideal human fecal pollution indicator. We report the development of two human-associated crAssphage endpoint PCR methods (crAss056 and crAss064). A shotgun strategy was employed where 384 candidate primers were designed to cover ~41 kbp of the crAssphage genome deemed favorable for method development based on a series of bioinformatics analyses. Candidate primers were subjected to three rounds of testing to evaluate assay optimization, specificity, limit of detection (LOD95), geographic variability, and performance in environmental water samples. The top two performing candidate primer sets exhibited 100% specificity (n = 70 individual samples from 8 different animal species), >90% sensitivity (n = 10 raw sewage samples from different geographic locations), LOD95 of 0.01 ng/µL of total DNA per reaction, and successfully detected human fecal pollution in impaired envi
Lee, Mi Young; Doh, Eui Jeong; Park, Chae Haeng; Kim, Young Hwa; Kim, Eung Soo; Ko, Byong Seob; Oh, Seung-Eun
2006-04-01
Some Artemisia herbs are used for medicinal purposes. In particular, A. princeps and A. argyi are classified as 'Aeyup' and are used as important medicinal material in traditional Korean medicine. On the other hand, A. capillaris and A. iwayomogi, which are classified as 'Injinho' and 'Haninjin', respectively, are used for other purposes distinct from those of 'Aeyup'. However, sometimes 'Aeyup' is not clearly discriminated from 'Injinho' and/or 'Haninjin'. Furthermore, Artemisia capillaris and/or A. iwayomogi have been used in place of A. princeps and A. argyi. In this study, we developed an efficient method to discriminate A. argyi and A. princeps from other Artemisia plants. The RAPD (random amplified polymorphic DNA) method efficiently discriminated various Artemisia herbs. In particular, non-specific primer 329 (5'-GCG AAC CTC C-3'), which shows polymorphism among Artemisia herbs, amplified 838 bp products, which are specific to A. princeps and A. argyi only. Based on nucleotide sequence of the primer 329 product, we designed a Fb (5'-CAT CAA CCA TGG CTT ATC CT-3') and R7 (5'-GCG AAC CTC CCC ATT CCA-3') primer-set to amplify a 254 bp sized SCAR (sequence characterized amplified regions) marker, through which A. princeps and A. argyi can be efficiently discriminated from other Artemisia herbs, particularly, A. capillaris and A. iwayomogi.
Li, Qiong; Yue, Zhiqin; Liu, Hong; Liang, Chengzhu; Zheng, Xiaolong; Zhao, Yuran; Chen, Xiao; Xiao, Xizhi; Chen, Changfu
2010-02-01
A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of lymphocystis disease virus (LCDV). A set of five specific primers, two inner and two outer primers and a loop primer, were designed on the basis of the major capsid protein gene of LCDV. The reaction time and temperatures were optimized for 60 min at 63 degrees C, respectively. LAMP amplification products were detected by a ladder-like appearance on agarose gel electrophoresis or a naked-eye inspection of a color change in the reaction tube by addition of SYBR Green I. The assay was specific for LCDV, and there was no cross-reactivity with white spot syndrome virus (WSSV) or six other Iridoviridae viruses (epizootic hematopoietic necrosis virus, EHNV; tiger frog virus, TFV; Bohle iridovirus, BIV; soft-shelled turtle iridovirus, STIV; infectious spleen and kidney necrosis virus, ISKNV; red sea bream iridovirus, RSIV). The detection limit of the LAMP assay was 15 fg, which was similar to that of real-time quantitative polymerase chain reaction (PCR) and 10-fold higher than the conventional PCR. The LAMP assay was evaluated using 109 clinical samples, and the results indicated the suitability and simplicity of the test as a rapid, field diagnostic tool for detection of LCDV. The LCDV LAMP assay has potential for early diagnosis of LCDV infection. 2009 Elsevier B.V. All rights reserved.
Zhou, Dinggang; Guo, Jinlong; Xu, Liping; Gao, Shiwu; Lin, Qingliang; Wu, Qibin; Wu, Luguang; Que, Youxiong
2014-01-01
To meet the demand for detection of foreign genes in genetically modified (GM) sugarcane necessary for regulation of gene technology, an efficient method with high specificity and rapidity was developed for the cry1Ac gene, based on loop-mediated isothermal amplification (LAMP). A set of four primers was designed using the sequence of cry1Ac along with optimized reaction conditions: 5.25 mM of Mg2+, 4:1 ratio of inner primer to outer primer, 2.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. Three post-LAMP detection methods (precipitation, calcein (0.60 mM) with Mn2+ (0.05 mM) complex and SYBR Green I visualization), were shown to be effective. The sensitivity of the LAMP method was tenfold higher than that of conventional PCR when using templates of the recombinant cry1Ac plasmid or genomic DNA from cry1Ac transgenic sugarcane plants. More importantly, this system allowed detection of the foreign gene on-site when screening GM sugarcane without complex and expensive instruments, using the naked eye. This method can not only provide technological support for detection of cry1Ac, but can also further facilitate the use of this detection technique for other transgenes in GM sugarcane. PMID:24810230
Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander
2015-01-01
High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zhou, Jindan; Rudd, Kenneth E.
2013-01-01
EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection. PMID:23197660
Zhou, Jindan; Rudd, Kenneth E
2013-01-01
EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection.
ERIC Educational Resources Information Center
Whetstone, B. D.; Yates, Benny
This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…
ERIC Educational Resources Information Center
Anderson, Daniel K.
1996-01-01
Discusses theoretical backgrounds for training teachers to use the Internet, including: a history of the Internet, education reform, technology and education, teacher training, affective domains, learning styles, and evaluation. Instructional design considerations are described for developing the HyperCard Internet Primer, software introducing…
Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism
USDA-ARS?s Scientific Manuscript database
Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...
Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X
2003-01-01
The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.
Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann
2014-01-01
• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625
Multiplex detection of respiratory pathogens
McBride, Mary [Brentwood, CA; Slezak, Thomas [Livermore, CA; Birch, James M [Albany, CA
2012-07-31
Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.
Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James
2017-03-01
Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Narihiro, Takashi; Sekiguchi, Yuji
2011-01-01
Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721
Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira
2010-08-01
Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.
Studier, F. William
1995-04-18
Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.
Studier, F.W.
1995-04-18
Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.
Characterization of (CA)n microsatellite repeats from large-insert clones.
Litt, M; Browne, D
2001-05-01
The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Miller, D M; Dudley, E G; Roberts, R F
2012-09-01
Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem
2018-05-12
Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Smith, J K; Parry, J D; Day, J G; Smith, R J
1998-10-01
The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.
2012-01-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223
Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.
Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng
2005-08-01
Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.
Presti, Flavia T.; Oliveira-Marques, Adriana R.; Caparroz, Renato; Biondo, Cibele; Miyaki, Cristina Y.
2011-01-01
Cross-amplification was tested and variability in microsatellite primers (designed for Neotropical parrots) compared, in five macaw species, viz., three endangered blue macaws (Cyanopsitta spixii [extinct in the wild], Anodorhynchus leari [endangered] and Anodorhynchus hyacinthinus [vulnerable]), and two unthreatened red macaws (Ara chloropterus and Ara macao). Among the primers tested, 84.6% successfully amplified products in C. spixii, 83.3% in A. leari, 76.4% in A. hyacinthinus, 78.6% in A. chloropterus and 71.4% in A. macao. The mean expected heterozygosity estimated for each species, and based on loci analyzed in all the five, ranged from 0.33 (A. hyacinthinus) to 0.85 (A. macao). As expected, the results revealed lower levels of genetic variability in threatened macaw species than in unthreatened. The low combined probability of genetic identity and the moderate to high potential for paternity exclusion, indicate the utility of the microsatellite loci set selected for each macaw species in kinship and population studies, thus constituting an aid in planning in-situ and ex-situ conservation. PMID:21734841
Guo, Xu-Guang; Zhou, Yong-Zhuo; Li, Qin; Wang, Wei; Wen, Jin-Zhou; Zheng, Lei; Wang, Qian
2018-04-18
To detect Zika virus more rapidly and accurately, we developed a novel method that utilized a real-time fluorescence reverse transcription loop-mediated isothermal amplification (LAMP) technique. The NS5 gene was amplified by a set of six specific primers that recognized six distinct sequences. The amplification process, including 60 min of thermostatic reaction with Bst DNA polymerase following real-time fluorescence reverse transcriptase using genomic Zika virus standard strain (MR766), was conducted through fluorescent signaling. Among the six pairs of primers that we designate here, NS5 was the most efficient with a high sensitivity of up to 3.3 ng/μl and reproducible specificity on eight pathogen samples that were used as negative controls. The real-time fluorescence reverse transcription LAMP detection process can be completed within 35 min. Our study demonstrated that real-time fluorescence reverse transcription LAMP could be highly beneficial and convenient clinical application to detect Zika virus due to its high specificity and stability.
Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi
2009-01-14
We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .
Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz
2017-01-01
Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-01
The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.
Zubko, Elena I; Shackleton, Jennifer L; Zubko, Mikhajlo K
2016-12-01
Measuring telomere length is essential in telomere biology. Southern blot hybridization is the predominant method for measuring telomere length in the genetic model Saccharomyces cerevisiae. We have further developed and refined a telomere PCR approach, which was rarely used previously (mainly in specific telomeric projects), into a robust method allowing direct visualisation of telomere length differences in routine experiments with S. cerevisiae, and showing a strong correlation of results with data obtained by Southern blot hybridization. In this expanded method denoted as ATLAS (A-dvanced T-elomere L-ength A-nalysis in S. cerevisiae), we have introduced: 1) set of new primers annealing with high specificity to telomeric regions on five different chromosomes; 2) new approach for designing reverse telomere primers that is based on the ligation of an adaptor of a fixed size to telomeric ends. ATLAS can be used at the scale of individual assays and high-throughput approaches. This simple, time/cost-effective and reproducible methodology will complement Southern blot hybridization and facilitate further progress in telomere research. Copyright © 2016 Elsevier B.V. All rights reserved.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Kumar, P V; Sharma, S K; Rishi, N; Ghosh, D K; Baranwal, V K
Management of viral diseases relies on definite and sensitive detection methods. Citrus yellow mosaic virus (CYMV), a double stranded DNA virus of the genus Badnavirus, causes yellow mosaic disease in citrus plants. CYMV is transmitted through budwood and requires a robust and simplified indexing protocol for budwood certification programme. The present study reports development and standardization of an isothermal based recombinase polymerase amplification (RPA) assay for a sensitive, rapid, easy, and cost-effective method for detection and diagnosis of CYMV. Two different oligonucleotide primer sets were designed from ORF III (coding for polyprotein) and ORF II (coding for virion associated protein) regions of CYMV to perform amplification assays. Comparative evaluation of RPA, PCR and immuno-capture recombinase polymerase amplification (IC-RPA) based assays were done using purified DNA and plant crude sap. CYMV infection was efficiently detected from the crude sap in RPA and IC-RPA assays. The primer set used in RPA was specific and did not show any cross-amplification with banana streak MY virus (BSMYV), another Badnavirus species. The results from the present study indicated that RPA assay can be used easily in routine indexing of citrus planting material. To the best of our knowledge, this is the first report on development of a rapid and simplified isothermal detection assay for CYMV and can be utilized as an effective technique in quarantine and budwood certification process.
Gene Polymorphism Studies in a Teaching Laboratory
NASA Astrophysics Data System (ADS)
Shultz, Jeffry
2009-02-01
I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.
Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R
2003-08-01
Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.
NASA Astrophysics Data System (ADS)
Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin
2010-08-01
In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.
Kevill, Jessica L; Highfield, Andrea; Mordecai, Gideon J; Martin, Stephen J; Schroeder, Declan C
2017-10-27
Deformed wing virus (DWV) is one of the most prevalent honey bee viral pathogens in the world. Typical of many RNA viruses, DWV is a quasi-species, which is comprised of a large number of different variants, currently consisting of three master variants: Type A, B, and C. Little is known about the impact of each variant or combinations of variants upon the biology of individual hosts. Therefore, we have developed a new set of master variant-specific DWV primers and a set of standards that allow for the quantification of each of the master variants. Competitive reverse transcriptase polymerase chain reaction (RT-PCR) experimental design confirms that each new DWV primer set is specific to the retrospective master variant. The sensitivity of the ABC assay is dependent on whether DNA or RNA is used as the template and whether other master variants are present in the sample. Comparison of the overall proportions of each master variant within a sample of known diversity, as confirmed by next-generation sequence (NGS) data, validates the efficiency of the ABC assay. The ABC assay was used on archived material from a Devon overwintering colony loss (OCL) 2006-2007 study; further implicating DWV type A and, for the first time, possibly C in the untimely collapse of honey bee colonies. Moreover, in this study DWV type B was not associated with OCL. The use of the ABC assay will allow researchers to quickly and cost effectively pre-screen for the presence of DWV master variants in honey bees.
Meena, Ram Prasnna; Baranwal, V K
2016-09-01
Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.
[SSR loci information analysis in transcriptome of Andrographis paniculata].
Li, Jun-Ren; Chen, Xiu-Zhen; Tang, Xiao-Ting; He, Rui; Zhan, Ruo-Ting
2018-06-01
To study the SSR loci information and develop molecular markers, a total of 43 683 Unigenes in transcriptome of Andrographis paniculata were used to explore SSR. The distribution frequency of SSR and the basic characteristics of repeat motifs were analyzed using MicroSAtellite software, SSR primers were designed by Primer 3.0 software and then validated by PCR. Moreover, the gene function analysis of SSR Unigene was obtained by Blast. The results showed that 14 135 SSR loci were found in the transcriptome of A. paniculata, which distributed in 9 973 Unigenes with a distribution frequency of 32.36%. Di-nucleotide and Tri-nucleotide repeat were the main types, accounted for 75.54% of all SSRs. The repeat motifs of AT/AT and CCG/CGG were the predominant repeat types of Di-nucleotide and Tri-nucleotide, respectively. A total of 4 740 pairs of SSR primers with the potential to produce polymorphism were designed for maker development. Ten pairs of primers in 20 pairs of randomly picked primers produced fragments with expected molecular size. The gene function of Unigenes containing SSR were mostly related to the basic metabolism function of A. paniculata. The SSR markers in transcriptome of A. paniculata show rich type, strong specificity and high potential of polymorphism, which will benefit the candidate gene mining and marker-assisted breeding. Copyright© by the Chinese Pharmaceutical Association.
NASA Astrophysics Data System (ADS)
Tanumihardja, J.; Bela, B.
2017-08-01
Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.
Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio
2008-10-15
Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.
Sight Word Recognition among Young Children At-Risk: Picture-Supported vs. Word-Only
ERIC Educational Resources Information Center
Meadan, Hedda; Stoner, Julia B.; Parette, Howard P.
2008-01-01
A quasi-experimental design was used to investigate the impact of Picture Communication Symbols (PCS) on sight word recognition by young children identified as "at risk" for academic and social-behavior difficulties. Ten pre-primer and 10 primer Dolch words were presented to 23 students in the intervention group and 8 students in the…
Assessing the Nation's Literacy: A State Policy Primer.
ERIC Educational Resources Information Center
National Governors' Association, Washington, DC.
This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…
A Primer on Fresh Water: The Environmental Citizenship Series.
ERIC Educational Resources Information Center
Environment Canada, Ottawa (Ontario).
Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…
Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression
2005-04-26
reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al
Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich
2007-04-25
The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.
Methods, compounds and systems for detecting a microorganism in a sample
Colston, Jr, Bill W.; Fitch, J. Patrick; Gardner, Shea N.; Williams, Peter L.; Wagner, Mark C.
2016-09-06
Methods to identify a set of probe polynucleotides suitable for detecting a set of targets and in particular methods for identification of primers suitable for detection of target microorganisms related polynucleotides, set of polynucleotides and compositions, and related methods and systems for detection and/or identification of microorganisms in a sample.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Designer proton-channel transgenic algae for photobiological hydrogen production
Lee, James Weifu [Knoxville, TN
2011-04-26
A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.
Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk
2015-06-01
Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×10(2) copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10(-6) dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension.
Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D
2018-06-01
We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk
2015-01-01
Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×102 copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10−6 dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension. PMID:26060431
Newsham, Kevin K; Bridge, Paul D
2010-06-01
The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.
Nuclear Matrix Proteins in Disparity of Prostate Cancer
2011-07-01
using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included
Regulation of Mammary Stem Cell Quiescence via Post-Translational Modification of DeltaNp63alpha
2014-02-01
mRNA expression in atopic dermatitis following narrow- band ultraviolet B phototherapy: results of a pilot study. J Dermatol Sci 44: 56– 58. 39. Lee...Change II site-directed mutagenesis kit ( Cat # 200523-5) with the following set of primers; sense primer 59-CGATGCTCTCGCTCCAGCACCCGC- CATCCCCTCC-39, and...Invitrogen, Cat #11668) according to manufacturers protocol. Kinome Screen The Silencer Select Human Kinase siRNA Library ( Cat - alog#4397918) from Ambion
3'-terminal sequence of a small round structured virus (SRSV) in Japan.
Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S
1994-01-01
We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.
Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.
2015-01-01
Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728
Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie
2014-01-01
Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.
A New Single-Step PCR Assay for the Detection of the Zoonotic Malaria Parasite Plasmodium knowlesi
Lucchi, Naomi W.; Poorak, Mitra; Oberstaller, Jenna; DeBarry, Jeremy; Srinivasamoorthy, Ganesh; Goldman, Ira; Xayavong, Maniphet; da Silva, Alexandre J.; Peterson, David S.; Barnwell, John W.; Kissinger, Jessica; Udhayakumar, Venkatachalam
2012-01-01
Background Recent studies in Southeast Asia have demonstrated substantial zoonotic transmission of Plasmodium knowlesi to humans. Microscopically, P. knowlesi exhibits several stage-dependent morphological similarities to P. malariae and P. falciparum. These similarities often lead to misdiagnosis of P. knowlesi as either P. malariae or P. falciparum and PCR-based molecular diagnostic tests are required to accurately detect P. knowlesi in humans. The most commonly used PCR test has been found to give false positive results, especially with a proportion of P. vivax isolates. To address the need for more sensitive and specific diagnostic tests for the accurate diagnosis of P. knowlesi, we report development of a new single-step PCR assay that uses novel genomic targets to accurately detect this infection. Methodology and Significant Findings We have developed a bioinformatics approach to search the available malaria parasite genome database for the identification of suitable DNA sequences relevant for molecular diagnostic tests. Using this approach, we have identified multi-copy DNA sequences distributed in the P. knowlesi genome. We designed and tested several novel primers specific to new target sequences in a single-tube, non-nested PCR assay and identified one set of primers that accurately detects P. knowlesi. We show that this primer set has 100% specificity for the detection of P. knowlesi using three different strains (Nuri, H, and Hackeri), and one human case of malaria caused by P. knowlesi. This test did not show cross reactivity with any of the four human malaria parasite species including 11 different strains of P. vivax as well as 5 additional species of simian malaria parasites. Conclusions The new PCR assay based on novel P. knowlesi genomic sequence targets was able to accurately detect P. knowlesi. Additional laboratory and field-based testing of this assay will be necessary to further validate its utility for clinical diagnosis of P. knowlesi. PMID:22363751
Tank, David C.
2016-01-01
Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Detection and Diversity of Fungal Nitric Oxide Reductase Genes (p450nor) in Agricultural Soils
Welsh, Allana; Orellana, Luis H.; Konstantinidis, Konstantinos T.; Chee-Sanford, Joanne C.; Sanford, Robert A.; Schadt, Christopher W.
2016-01-01
ABSTRACT Members of the Fungi convert nitrate (NO3−) and nitrite (NO2−) to gaseous nitrous oxide (N2O) (denitrification), but the fungal contributions to N loss from soil remain uncertain. Cultivation-based methodologies that include antibiotics to selectively assess fungal activities have limitations, and complementary molecular approaches to assign denitrification potential to fungi are desirable. Microcosms established with soils from two representative U.S. Midwest agricultural regions produced N2O from added NO3− or NO2− in the presence of antibiotics to inhibit bacteria. Cultivation efforts yielded 214 fungal isolates belonging to at least 15 distinct morphological groups, 151 of which produced N2O from NO2−. Novel PCR primers targeting the p450nor gene, which encodes the nitric oxide (NO) reductase responsible for N2O production in fungi, yielded 26 novel p450nor amplicons from DNA of 37 isolates and 23 amplicons from environmental DNA obtained from two agricultural soils. The sequences shared 54 to 98% amino acid identity with reference P450nor sequences within the phylum Ascomycota and expand the known fungal P450nor sequence diversity. p450nor was detected in all fungal isolates that produced N2O from NO2−, whereas nirK (encoding the NO-forming NO2− reductase) was amplified in only 13 to 74% of the N2O-forming isolates using two separate nirK primer sets. Collectively, our findings demonstrate the value of p450nor-targeted PCR to complement existing approaches to assess the fungal contributions to denitrification and N2O formation. IMPORTANCE A comprehensive understanding of the microbiota controlling soil N loss and greenhouse gas (N2O) emissions is crucial for sustainable agricultural practices and addressing climate change concerns. We report the design and application of a novel PCR primer set targeting fungal p450nor, a biomarker for fungal N2O production, and demonstrate the utility of the new approach to assess fungal denitrification potential in fungal isolates and agricultural soils. These new PCR primers may find application in a variety of biomes to assess the fungal contributions to N loss and N2O emissions. PMID:26969694
2013-01-01
Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286
NASA Technical Reports Server (NTRS)
Bill, R. C.; Sovey, J.; Allen, G. P.
1981-01-01
The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.
Mitchell, Andrew
2015-09-01
Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.
Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte
2012-01-01
Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.
Gorrell, Jamieson C; Boutin, Stan; Raveh, Shirley; Neuhaus, Peter; Côté, Steeve D; Coltman, David W
2012-09-01
We determined the sequence of the male-specific minor histocompatibility complex antigen (Smcy) from the Y chromosome of seven squirrel species (Sciuridae, Rodentia). Based on conserved regions inside the Smcy intron sequence, we designed PCR primers for sex determination in these species that can be co-amplified with nuclear loci as controls. PCR co-amplification yields two products for males and one for females that are easily visualized as bands by agarose gel electrophoresis. Our method provides simple and reliable sex determination across a wide range of squirrel species. © 2012 Blackwell Publishing Ltd.
Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2014-01-01
Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363