Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.
Wood-Bouwens, Christina M; Ji, Hanlee P
2018-01-01
Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.
Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li
2009-03-01
The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen
2017-04-01
In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.
Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.
Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru
2017-04-18
Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.
Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki
2013-09-23
Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?
USDA-ARS?s Scientific Manuscript database
Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven
2006-01-01
Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952
Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun
2018-05-22
Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.
Detecting Single-Nucleotide Substitutions Induced by Genome Editing.
Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R
2016-08-01
The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.
Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
Kwok, Pui-Yan; Chen, Xiangning
1999-01-01
A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.
Single nucleotide polymorphism analysis using different colored dye dimer probes
NASA Astrophysics Data System (ADS)
Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter
2006-09-01
Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
NASA Astrophysics Data System (ADS)
Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan
2017-02-01
Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L
2006-01-15
Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Nelson, Chase W; Moncla, Louise H; Hughes, Austin L
2015-11-15
New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel
2013-10-01
Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.
Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi
2008-04-15
The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.
DNAzyme based gap-LCR detection of single-nucleotide polymorphism.
Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo
2013-07-15
Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.
An exonuclease III and graphene oxide-aided assay for DNA detection.
Peng, Lu; Zhu, Zhi; Chen, Yan; Han, Da; Tan, Weihong
2012-05-15
We have developed a novel DNA assay based on exonuclease III (ExoIII)-induced target recycling and the fluorescence quenching ability of graphene oxide (GO). This assay consists of a linear DNA probe labeled with a fluorophore in the middle. Introduction of target sequence induces the exonuclease III catalyzed probe digestion and generation of single nucleotides. After each cycle of digestion, the target is recycled to realize the amplification. Finally, graphene oxide is added to quench the remaining probes and the signal from the resulting fluorophore labeled single nucleotides is detected. With this approach, a sub-picomolar detection limit can be achieved within 40 min at 37°C. The method was successfully applied to multicolor DNA detection and the analysis of telomerase activity in extracts from cancer cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c
Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne
2001-01-01
A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336
NASA Astrophysics Data System (ADS)
Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.
2018-04-01
Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.
Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.
Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E
2016-11-18
Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.
3'-End labeling of nucleic acids by a polymerase ribozyme.
Samanta, Biswajit; Horning, David P; Joyce, Gerald F
2018-06-13
A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.
Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A
2017-04-01
Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.
Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F
2009-07-14
In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.
Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor
Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.
2015-01-01
Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148
Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun
2007-01-01
Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Novel applications of array comparative genomic hybridization in molecular diagnostics.
Cheung, Sau W; Bi, Weimin
2018-05-31
In 2004, the implementation of array comparative genomic hybridization (array comparative genome hybridization [CGH]) into clinical practice marked a new milestone for genetic diagnosis. Array CGH and single-nucleotide polymorphism (SNP) arrays enable genome-wide detection of copy number changes in a high resolution, and therefore microarray has been recognized as the first-tier test for patients with intellectual disability or multiple congenital anomalies, and has also been applied prenatally for detection of clinically relevant copy number variations in the fetus. Area covered: In this review, the authors summarize the evolution of array CGH technology from their diagnostic laboratory, highlighting exonic SNP arrays developed in the past decade which detect small intragenic copy number changes as well as large DNA segments for the region of heterozygosity. The applications of array CGH to human diseases with different modes of inheritance with the emphasis on autosomal recessive disorders are discussed. Expert commentary: An exonic array is a powerful and most efficient clinical tool in detecting genome wide small copy number variants in both dominant and recessive disorders. However, whole-genome sequencing may become the single integrated platform for detection of copy number changes, single-nucleotide changes as well as balanced chromosomal rearrangements in the near future.
Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G
2014-09-05
The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Large scale variation in DNA copy number in chicken breeds
USDA-ARS?s Scientific Manuscript database
Background Detecting genetic variation is a critical step in elucidating the molecular mechanisms underlying phenotypic diversity. Until recently, such detection has mostly focused on single nucleotide polymorphisms (SNPs) because of the ease in screening complete genomes. Another type of variant, c...
El-Sabrout, Karim; Aggag, Sarah A.
2017-01-01
Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458
Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto
2017-05-01
Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Using of methods of speckle optics for Chlamydia trachomatis typing
NASA Astrophysics Data System (ADS)
Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.
2017-03-01
Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.
Consolandi, Clarissa
2009-01-01
One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.
NASA Astrophysics Data System (ADS)
Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo
2016-04-01
We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Lou, Jing; Wang, Zhaoyin; Wang, Xiao; Bao, Jianchun; Tu, Wenwen; Dai, Zhihui
2015-10-07
A "signal-on" electrochemiluminescent DNA biosensing platform was proposed based on the dual quenching and strand displacement reaction. This novel "signal-on" detection strategy revealed its sensitivity in achieving a detection limit of 2.4 aM and its selectivity in distinguishing single nucleotide polymorphism of target DNA.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E
2015-01-01
The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.
Comparison of three PCR-based assays for SNP genotyping in sugar beet
USDA-ARS?s Scientific Manuscript database
Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...
Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei
2017-08-01
Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease
Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.
2016-01-01
Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047
Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua
2005-02-01
A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.
Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge
2006-12-01
The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.
1991-02-15
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less
Detecting and Analyzing Genetic Recombination Using RDP4.
Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev
2017-01-01
Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.
Nanopores and nucleic acids: prospects for ultrarapid sequencing
NASA Technical Reports Server (NTRS)
Deamer, D. W.; Akeson, M.
2000-01-01
DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.
Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang
2016-03-15
In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.
Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin
2017-05-23
A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi
2004-09-20
Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.
Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K
2018-06-07
Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.
Identification of pathogen genomic variants through an integrated pipeline
2014-01-01
Background Whole-genome sequencing represents a powerful experimental tool for pathogen research. We present methods for the analysis of small eukaryotic genomes, including a streamlined system (called Platypus) for finding single nucleotide and copy number variants as well as recombination events. Results We have validated our pipeline using four sets of Plasmodium falciparum drug resistant data containing 26 clones from 3D7 and Dd2 background strains, identifying an average of 11 single nucleotide variants per clone. We also identify 8 copy number variants with contributions to resistance, and report for the first time that all analyzed amplification events are in tandem. Conclusions The Platypus pipeline provides malaria researchers with a powerful tool to analyze short read sequencing data. It provides an accurate way to detect SNVs using known software packages, and a novel methodology for detection of CNVs, though it does not currently support detection of small indels. We have validated that the pipeline detects known SNVs in a variety of samples while filtering out spurious data. We bundle the methods into a freely available package. PMID:24589256
Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu
2018-01-01
Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-01-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
NASA Technical Reports Server (NTRS)
Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.
2003-01-01
We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.
Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin
2014-10-01
Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.
Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng
2012-08-21
Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.
Detection limit of intragenic deletions with targeted array comparative genomic hybridization
2013-01-01
Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607
A Bioluminometric Method of DNA Sequencing
NASA Technical Reports Server (NTRS)
Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)
2001-01-01
Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.
Wang, Junxiu; Xiong, Guoliang; Ma, Liang; Wang, Shihui; Zhou, Xu; Wang, Lei; Xiao, Lehui; Su, Xin; Yu, Changyuan
2017-08-15
Single-nucleotide mutation (SNM) has proven to be associated with a variety of human diseases. Development of reliable methods for the detection of SNM is crucial for molecular diagnosis and personalized medicine. The sandwich assays are widely used tools for detecting nucleic acid biomarkers due to their low cost and rapid signaling. However, the poor hybridization specificity of signal probe at room temperature hampers the discrimination of mutant and wild type. Here, we demonstrate a dynamic sandwich assay on magnetic beads for SNM detection based on the transient binding between signal probe and target. By taking the advantage of mismatch sensitive thermodynamics of transient DNA binding, the dynamic sandwich assay exhibits high discrimination factor for mutant with a broad range of salt concentration at room temperature. The beads used in this assay serve as a tool for separation, and might be helpful to enhance SNM selectivity. Flexible design of signal probe and facile magnetic separation allow multiple-mode downstream analysis including colorimetric detection and isothermal amplification. With this method, BRAF mutations in the genomic DNA extracted from cancer cell lines were tested, allowing sensitive detection of SNM at very low abundances (0.1-0.5% mutant/wild type). Copyright © 2017 Elsevier B.V. All rights reserved.
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.
Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie
2011-06-15
A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J
2003-10-01
The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.
Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection
KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.
2016-01-01
CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703
Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome
Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark
2016-01-01
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779
Identification of differentially methylated sites with weak methylation effect
USDA-ARS?s Scientific Manuscript database
DNA methylation is an epigenetic alteration crucial for regulating stress responses. Identifying large-scale DNA methylation at single nucleotide resolution is made possible by whole genome bisulfite sequencing. An essential task following the generation of bisulfite sequencing data is to detect dif...
Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu
2012-10-01
To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.
Fixed-Gap Tunnel Junction for Reading DNA Nucleotides
2015-01-01
Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for comparative analyses with other Salmonella serotypes.
Martin, Lauren; Damaso, Natalie; Mills, DeEtta
2016-10-01
Molecular methods for the detection of mammalian coat color phenotypes have expanded greatly within the past decade. Many phenotypes are associated with a single nucleotide polymorphism mutation in the genetic sequence. Traditionally, these mutations are detected through sequencing, hybridization assays or mini-sequencing. However, these techniques can be expensive and tedious. Previously, CE-SSCP using the F-108 polymer was able to distinguish SNPs for the melanocortin-1 receptor (mc1r) coat color gene in horses (Equus caballus) that differed by one nucleotide substitution. The objective of this study was to expand the detection of coat color SNPs in horses. The genes for the solute carrier family member 2 (slc45a2/matp), type III receptor protein-tyrosine kinase (kit) and mc1r genes using CE-SSCP and F-108 polymer were compared to mini-sequencing with the SNaPshot TM kit. The F-108 polymer reproducibly resolved homozygous and heterozygous individuals for the mc1r and kit markers, but was unable to resolve heterozygous individuals for slc45a2 at 38ºC. The need for temperatures <15ºC, the SNP position being close to the 5'-end, and conformational structures/free energy with similar values resulted in the inability to resolve the secondary structures. Despite this limitation, the CE-SSCP method could be used to provide a rapid phenotypic description for equine forensic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel
Eriksson, Anders; Manica, Andrea
2011-01-01
Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358
Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M
2016-07-01
It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.
Protein-nucleotide contacts in motor proteins detected by DNP-enhanced solid-state NMR.
Wiegand, Thomas; Liao, Wei-Chih; Ong, Ta Chung; Däpp, Alexander; Cadalbert, Riccardo; Copéret, Christophe; Böckmann, Anja; Meier, Beat H
2017-11-01
DNP (dynamic nuclear polarization)-enhanced solid-state NMR is employed to directly detect protein-DNA and protein-ATP interactions and identify the residue type establishing the intermolecular contacts. While conventional solid-state NMR can detect protein-DNA interactions in large oligomeric protein assemblies in favorable cases, it typically suffers from low signal-to-noise ratios. We show here, for the oligomeric DnaB helicase from Helicobacter pylori complexed with ADP and single-stranded DNA, that this limitation can be overcome by using DNP-enhanced spectroscopy. Interactions are established by DNP-enhanced 31 P- 13 C polarization-transfer experiments followed by the recording of a 2D 13 C- 13 C correlation experiment. The NMR spectra were obtained in less than 2 days and allowed the identification of residues of the motor protein involved in nucleotide binding.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
NASA Astrophysics Data System (ADS)
Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue
2008-11-01
Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.
Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast
Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora
2006-01-01
Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318
Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).
Studer, Jacqueline; Bartsch, Christine; Haas, Cordula
2014-07-01
Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.
Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji
2012-12-01
Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Tang, Shaohua; Lv, Jiaojiao; Chen, Xiangnan; Bai, Lili; Li, Huanzheng; Chen, Chong; Wang, Ping; Xu, Xueqin; Lu, Jianxin
2016-01-01
To evaluate the usefulness of single-nucleotide polymorphism (SNP) array for prenatal genetic diagnosis of congenital heart defect (CHD), we used this approach to detect clinically significant copy number variants (CNVs) in fetuses with CHDs. A HumanCytoSNP-12 array was used to detect genomic samples obtained from 39 fetuses that exhibited cardiovascular abnormalities on ultrasound and had a normal karyotype. The relationship between CNVs and CHDs was identified by using genotype-phenotype comparisons and searching of chromosomal databases. All clinically significant CNVs were confirmed by real-time PCR. CNVs were detected in 38/39 (97.4%) fetuses: variants of unknown significance were detected in 2/39 (5.1%), and clinically significant CNVs were identified in 7/39 (17.9%). In 3 of the 7 fetuses with clinically significant CNVs, 3 rare and previously undescribed CNVs were detected, and these CNVs encompassed the CHD candidate genes FLNA (Xq28 dup), BCOR (Xp11.4 dup), and RBL2 (16q12.2 del). Compared with conventional cytogenetic genomics, SNP array analysis provides significantly improved detection of submicroscopic genomic aberrations in pregnancies with CHDs. Based on these results, we propose that genomic SNP array is an effective method which could be used in the prenatal diagnostic test to assist genetic counseling for pregnancies with CHDs. © 2015 S. Karger AG, Basel.
Chen, Fangzhou; Knutson, Todd P; Porter, Robert E; Ciarlet, Max; Mor, Sunil Kumar; Marthaler, Douglas G
2017-12-01
Rotavirus G (RVG) strains have been detected in a variety of avian species, but RVG genomes have been published from only a single pigeon and two chicken strains. Two turkey RVG strains were identified and characterized, one in a hatchery with no reported health issues and the other in a hatchery with high embryo/poult mortality. The two turkey RVG strains shared only an 85.3 % nucleotide sequence identity in the VP7 gene while the other genes possessed high nucleotide identity among them (96.3-99.9 %). Low nucleotide percentage identities (31.6-87.3 %) occurred among the pigeon and chicken RVG strains. Interestingly, potential recombination events were detected between our RVG strains and a human RVB strain, in the VP6 and NSP3 segments. The epidemiology of RVG in avian flocks and the pathogenicity of the two different RVG strains should be further investigated to understand the ecology and impact of RVG in commercial poultry flocks.
A survey of copy number variation in the porcine genome detected from whole-genome sequence
USDA-ARS?s Scientific Manuscript database
An important challenge to post-genomic biology is relating observed phenotypic variation to the underlying genotypic variation. Genome-wide association studies (GWAS) have made thousands of connections between single nucleotide polymorphisms (SNPs) and phenotypes, implicating regions of the genome t...
76 FR 4921 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-27
... chemical imaging (IRCI) to detect nanostructure-based DNA microarrays, which can be utilized in the life science research arena to examine gene expression and single nucleotide polymorphisms (SNPs), as well as... can be applied to the areas of environmental sciences, agriculture research, bio-defense, diagnostics...
Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.
2015-01-01
We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787
Alcaide, Miguel; Yu, Stephen; Bushell, Kevin; Fornika, Daniel; Nielsen, Julie S; Nelson, Brad H; Mann, Koren K; Assouline, Sarit; Johnson, Nathalie A; Morin, Ryan D
2016-09-01
A plethora of options to detect mutations in tumor-derived DNA currently exist but each suffers limitations in analytical sensitivity, cost, or scalability. Droplet digital PCR (ddPCR) is an appealing technology for detecting the presence of specific mutations based on a priori knowledge and can be applied to tumor biopsies, including formalin-fixed paraffin embedded (FFPE) tissues. More recently, ddPCR has gained popularity in its utility in quantifying circulating tumor DNA. We have developed a suite of novel ddPCR assays for detecting recurrent mutations that are prevalent in common B-cell non-Hodgkin lymphomas (NHLs), including diffuse large B-cell lymphoma, follicular lymphoma, and lymphoplasmacytic lymphoma. These assays allowed the differentiation and counting of mutant and wild-type molecules using one single hydrolysis probe. We also implemented multiplexing that allowed the simultaneous detection of distinct mutations and an "inverted" ddPCR assay design, based on employing probes matching wild-type alleles, capable of detecting the presence of multiple single nucleotide polymorphisms. The assays successfully detected and quantified somatic mutations commonly affecting enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) (Y641) and signal transducer and activator of transcription 6 (STAT6) (D419) hotspots in fresh tumor, FFPE, and liquid biopsies. The "inverted" ddPCR approach effectively reported any single nucleotide variant affecting either of these 2 hotspots as well. Finally, we could effectively multiplex hydrolysis probes targeting 2 additional lymphoma-related hotspots: myeloid differentiation primary response 88 (MYD88; L265P) and cyclin D3 (CCND3; I290R). Our suite of ddPCR assays provides sufficient analytical sensitivity and specificity for either the invasive or noninvasive detection of multiple recurrent somatic mutations in B-cell NHLs. © 2016 American Association for Clinical Chemistry.
van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick
2012-03-27
In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society
Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing
2014-03-04
Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.
Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.
Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio
2014-02-15
A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-02-01
This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-01-01
OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237
Feng, Hao; Conneely, Karen N.; Wu, Hao
2014-01-01
DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809
Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko
2017-04-04
Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.
Survey of diagnostic tools for detection of viroids and impacts of test results on the seed industry
USDA-ARS?s Scientific Manuscript database
Viroids are unencapsidated, single-stranded, covalently closed circular, highly structured noncoding RNAs of 239 – 401 nucleotides that are replicated by host enzymes and cause disease in several economically important crop plants. Although viroids are primarily and easily transmitted mechanically t...
USDA-ARS?s Scientific Manuscript database
Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. Conventionally, these mutations are identified by techniques that can detect single-nucleotide mismatches in heteroduplexes of individual PCR amplicons. We applied whole-genome sequencing to 256-phenotyped mutant l...
Identification of single-nucleotide variants in RNA-seq data. Current version focuses on detection of RNA editing sites without requiring genome sequence data. New version is under development to separately identify RNA editing sites and genetic variants using RNA-seq data alone.
Digynic triploidy: utility and challenges of noninvasive prenatal testing
Fleischer, Julie; Shenoy, Archana; Goetzinger, Katherine; Cottrell, Catherine E; Baldridge, Dustin; White, Frances V; Shinawi, Marwan
2015-01-01
Key Clinical Message Low fraction fetal DNA in noninvasive prenatal testing in the context of fetal growth restriction and multiple congenital anomalies should alert medical professionals to the possibility of digynic triploidy. Single-nucleotide polymorphism microarray can detect the parental origin of triploidy and explain its mechanism. PMID:26185638
Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System
NASA Astrophysics Data System (ADS)
Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro
2012-04-01
A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.
Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V
2015-09-15
In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.
Generalization of Associations of Kidney-Related Genetic Loci to American Indians
Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.
2014-01-01
Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711
FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.
Wang, Meng; Lin, Shili
2014-09-15
In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan
2014-09-02
A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-22
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
Liljeqvist, Jan-Åke; Svennerholm, Bo; Bergström, Tomas
1999-01-01
Herpes simplex virus (HSV) codes for several envelope glycoproteins, including glycoprotein G-2 (gG-2) of HSV type 2 (HSV-2), which are dispensable for replication in cell culture. However, clinical isolates which are deficient in such proteins occur rarely. We describe here five clinical HSV-2 isolates which were found to be unreactive to a panel of anti-gG-2 monoclonal antibodies and therefore considered phenotypically gG-2 negative. These isolates were further examined for expression of the secreted amino-terminal and cell-associated carboxy-terminal portions of gG-2 by immunoblotting and radioimmunoprecipitation. The gG-2 gene was completely inactivated in four isolates, with no expression of the two protein products. For one isolate a normally produced secreted portion and a truncated carboxy-terminal portion of gG-2 were detected in virus-infected cell medium. Sequencing of the complete gG-2 gene identified a single insertion or deletion of guanine or cytosine nucleotides in all five strains, resulting in a premature termination codon. The frameshift mutations were localized within runs of five or more guanine or cytosine nucleotides and were dispersed throughout the gene. For the isolate for which a partially inactivated gG-2 gene was detected, the frameshift mutation was localized upstream of but adjacent to the nucleotides coding for the transmembranous region. Thus, this study demonstrates the existence of clinical HSV-2 isolates which do not express an envelope glycoprotein and identifies the underlying molecular mechanism to be a single frameshift mutation. PMID:10559290
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
Zhang, Xi; Zhang, Jing; Wu, Dongzhi; Liu, Zhijing; Cai, Shuxian; Chen, Mei; Zhao, Yanping; Li, Chunyan; Yang, Huanghao; Chen, Jinghua
2014-12-07
Locked nucleic acid (LNA) is applied in toehold-mediated strand displacement reaction (TMSDR) to develop a junction-probe electrochemiluminescence (ECL) biosensor for single-nucleotide polymorphism (SNP) detection in the BRCA1 gene related to breast cancer. More than 65-fold signal difference can be observed with perfectly matched target sequence to single-base mismatched sequence under the same conditions, indicating good selectivity of the ECL biosensor.
Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing
2016-04-19
2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.
Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat
2016-11-01
Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Lapitan Jr., Lorico D. S.; Guo, Yuan
2015-01-01
Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914
Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.
Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A
2018-06-01
Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo
Malm, Sven; Linguissi, Laure S. Ghoma; Tekwu, Emmanuel M.; Vouvoungui, Jeannhey C.; Kohl, Thomas A.; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K.; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine
2017-01-01
Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC. PMID:28221129
New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo.
Malm, Sven; Linguissi, Laure S Ghoma; Tekwu, Emmanuel M; Vouvoungui, Jeannhey C; Kohl, Thomas A; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine; Niemann, Stefan
2017-03-01
Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC.
Gentilini, Fabio; Turba, Maria E
2014-01-01
A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...
2016-09-07
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
Adaptation of the TdT assay for semi-quantitative flow cytometric detection of DNA strand breaks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bromidge, T.J.; Howe, D.J.; Johnson, S.A.
The enzyme Terminal Deoxynucleotidyl Transferase (TdT) is a DNA polymerase which can be used to label DNA strand breaks by the incorporation of a labelled nucleotide followed by a fluorescent detection step. The amount of label incorporated can then be assessed by flow cytometry. The mechanism of action of TdT, however, will allow the addition of varying numbers of nucleotides to the free 3{prime} termini produced by DNA strand breaks. The substitution of Digoxigenin (DIG){trademark} labelled dideoxynucleotides for labelled deoxy-nucleotides in the TdT assay will limit the addition of label to a DNA break to a single nucleotide, thus ensuringmore » a direct relationship between an increase in DNA strand breaks and an increase in fluorescence. We have used this adaptation of the TdT assay to evaluate DNA damage incurred in lymphocytes, from patients with Chronic Lymphocytic Leukemia (CLL), on exposure to UV irradiation and apoptosis-inducing drugs, fludarabine and 2-Chloro-2{prime}-deoxyadenosine (2-CdA). This technique may give a good indication of the susceptibility of CLL patients to apoptosis inducing drugs, and hence an indication of the likely response to these therapies. 7 refs., 2 figs., 2 tabs.« less
Bison PRNP genotyping and potential association with Brucella spp. seroprevalence
Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.
2005-01-01
The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.
Sun, Yueying; Lu, Xiaohui; Su, Fengxia; Wang, Limei; Liu, Chenghui; Duan, Xinrui; Li, Zhengping
2015-12-15
Most of practical methods for detection of single nucleotide polymorphism (SNP) need at least two steps: amplification (usually by PCR) and detection of SNP by using the amplification products. Ligase chain reaction (LCR) can integrate the amplification and allele discrimination in one step. However, the detection of LCR products still remains a great challenge for highly sensitive and quantitative SNP detection. Herein, a simple but robust strategy for real-time fluorescence LCR has been developed for highly sensitive and quantitative SNP detection. A pair of LCR probes are firstly labeled with a fluorophore and a quencher, respectively. When the pair of LCR probes are ligated in LCR, the fluorophore will be brought close to the quencher, and thus, the fluorescence will be specifically quenched by fluorescence resonance energy transfer (FRET). The decrease of fluorescence intensity resulted from FRET can be real-time monitored in the LCR process. With the proposed real-time fluorescence LCR assay, 10 aM DNA targets or 100 pg genomic DNA can be accurately determined and as low as 0.1% mutant DNA can be detected in the presence of a large excess of wild-type DNA, indicating the high sensitivity and specificity. The real-time measuring does not require the detection step after LCR and gives a wide dynamic range for detection of DNA targets (from 10 aM to 1 pM). As LCR has been widely used for detection of SNP, DNA methylation, mRNA and microRNA, the real-time fluorescence LCR assay shows great potential for various genetic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne
2012-01-01
Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761
Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne
2012-11-01
Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.
He, Fei; Zhou, Wanjun; Cai, Ren; Yan, Tizhen; Xu, Xiangmin
2018-04-01
In this study, we aimed to assess the performance of two whole-genome amplification methods, multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycle (MALBAC), for β-thalassemia genotyping and single-nucleotide polymorphism (SNP)/copy-number variant (CNV) detection using two DNA sequencing assays. We collected peripheral blood, cell lines, and discarded embryos, and carried out MALBAC and MDA on single-cell and five-cell samples. We detected and statistically analyzed differences in the amplification efficiency, positive predictive value, sensitivity, allele dropout (ADO) rate, SNPs, and CV values between the two methods. Through Sanger sequencing at the single-cell and five-cell levels, we showed that both the amplification rate and ADO rate of MDA were better than those using MALBAC, and the sensitivity and positive predictive value obtained from MDA were higher than those from MALBAC for β-thalassemia genotyping. Using next-generation sequencing (NGS) at the single-cell level, we confirmed that MDA has better properties than MALBAC for SNP detection. However, MALBAC was more stable and homogeneous than MDA using low-depth NGS at the single-cell level for CNV detection. We conclude that MALBAC is the better option for CNV detection, while MDA is better suited for SNV detection.
Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel
2009-06-15
DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.
Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na
2013-03-15
We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.
Kerman, Kagan; Saito, Masato; Tamiya, Eiichi
2008-08-01
Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.
Le, D P; Smith, M K; Aitken, E A B
2017-10-01
Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
Hardy, M Y; Ontiveros, N; Varney, M D; Tye-Din, J A
2018-04-01
A hallmark of coeliac disease (CD) is the exceptionally strong genetic association with HLA-DQ2.5, DQ8, and DQ2.2. HLA typing provides information on CD risk important to both clinicians and researchers. A method that enables simple and fast detection of all CD risk genotypes is particularly desirable for the study of large populations. Single nucleotide polymorphism (SNP)-based HLA typing can detect the CD risk genotypes by detecting a combination of six SNPs but this approach can struggle to resolve HLA-DQ2.2, seen in 4% of European CD patients, because of the low resolution of one negatively predicting SNP. We sought to optimise SNP-based HLA typing by harnessing the additional resolution of digital droplet PCR to resolve HLA-DQ2.2. Here we test this two-step approach in an unselected sample of Mexican DNA and compare its accuracy to DNA typed using traditional exon detection. The addition of digital droplet PCR for samples requiring negative prediction of HLA-DQ2.2 enabled HLA-DQ2.2 to be accurately typed. This technique is a simple addition to a SNP-based typing strategy and enables comprehensive definition of all at-risk HLA genotypes in CD in a timely and cost-effective manner. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Destouni, A; Poulou, M; Kakourou, G; Vrettou, C; Tzetis, M; Traeger-Synodinos, J; Kitsiou-Tzeli, S
2016-03-01
Institutions offering CF-PGD face the challenge of developing and optimizing single cell genotyping protocols that should cover for the extremely heterogeneous CF mutation spectrum. Here we report the development and successful clinical application of a generic CF-PGD protocol to facilitate direct detection of any CFTR nucleotide variation(s) by HRMA and simultaneous confirmation of diagnosis through haplotype analysis. A multiplex PCR was optimized supporting co-amplification of any CFTR exon-region, along with 6 closely linked STRs. Single cell genotypes were established through HRM analysis following melting of the 2nd round PCR products and were confirmed by STR haplotype analysis of the 1st PCR products. The protocol was validated pre-clinically, by testing 208 single lymphocytes, isolated from whole blood samples from 4 validation family trios. Fifteen PGD cycles were performed and 103 embryos were biopsied. In 15 clinical PGD cycles, genotypes were achieved in 88/93 (94.6%) embryo biopsy samples, of which 57/88 (64.8%) were deemed genetically suitable for embryo transfer. Amplification failed at all loci for 10/103 blastomeres biopsied from poor quality embryos. Six clinical pregnancies were achieved (2 twin, 4 singletons). PGD genotypes were confirmed following conventional amniocentesis or chorionic villus sampling in all achieved pregnancies. The single cell HRMA CF-PGD protocol described herein is a flexible, generic, low cost and robust genotyping method, which facilitates the analysis of any CFTR genotype combination. Single-cell HRMA can be beneficial to other clinical settings, for example the detection of single nucleotide variants in single cells derived from clinical tumor samples. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
[Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].
Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu
2016-07-01
Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Veale, Andrew J.
2017-01-01
Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601
Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo
2018-01-01
We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. PMID:29367403
Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K
2016-10-01
Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.
Identification of single nucleotide polymorphism in ginger using expressed sequence tags
Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J
2009-01-01
Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184
Genovar: a detection and visualization tool for genomic variants.
Jung, Kwang Su; Moon, Sanghoon; Kim, Young Jin; Kim, Bong-Jo; Park, Kiejung
2012-05-08
Along with single nucleotide polymorphisms (SNPs), copy number variation (CNV) is considered an important source of genetic variation associated with disease susceptibility. Despite the importance of CNV, the tools currently available for its analysis often produce false positive results due to limitations such as low resolution of array platforms, platform specificity, and the type of CNV. To resolve this problem, spurious signals must be separated from true signals by visual inspection. None of the previously reported CNV analysis tools support this function and the simultaneous visualization of comparative genomic hybridization arrays (aCGH) and sequence alignment. The purpose of the present study was to develop a useful program for the efficient detection and visualization of CNV regions that enables the manual exclusion of erroneous signals. A JAVA-based stand-alone program called Genovar was developed. To ascertain whether a detected CNV region is a novel variant, Genovar compares the detected CNV regions with previously reported CNV regions using the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation) and the Single Nucleotide Polymorphism Database (dbSNP). The current version of Genovar is capable of visualizing genomic data from sources such as the aCGH data file and sequence alignment format files. Genovar is freely accessible and provides a user-friendly graphic user interface (GUI) to facilitate the detection of CNV regions. The program also provides comprehensive information to help in the elimination of spurious signals by visual inspection, making Genovar a valuable tool for reducing false positive CNV results. http://genovar.sourceforge.net/.
Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.
2016-01-01
The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325
Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu
2018-05-09
The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.
USDA-ARS?s Scientific Manuscript database
Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a mor...
Using single nucleotide polymorphism to detect selection signature in Hereford beef cattle
USDA-ARS?s Scientific Manuscript database
The objective of this study was to investigate selection signature in 2 sources of purebred Hereford beef cattle. Data were available from 240 Line 1 Herefords (L1) born between 1953 to 2008, and 311 Industry Herefords (IH) born between 1970 and 2008. Line 1 Herefords were sampled from a closed line...
Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls.
Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2013-01-01
Uncovering manipulation of athletic performance via small interfering (si)RNA is an emerging field in sports drug testing. Due to the potential to principally knock down every target gene in the organism by means of the RNA interference pathway, this facet of gene doping has become a realistic scenario. In the present study, two distinct model siRNAs comprising 21 nucleotides were designed as double strands which were perfect counterparts to a sequence of the respective messenger RNA coding the muscle regulator myostatin of Rattus norvegicus. Several modified nucleotides were introduced in both the sense and the antisense strand comprising phosphothioates, 2'-O-methylation, 2'-fluoro-nucleotides, locked nucleic acids and a cholesterol tag at the 3'-end. The model siRNAs were applied to rats at 1 mg/kg (i.v.) and blood as well as urine samples were collected. After isolation of the RNA by means of a RNA purification kit, the target analytes were detected by liquid chromatography - high resolution/high accuracy mass spectrometry (LC-HRMS). Analytes were detected as modified nucleotides after alkaline hydrolysis, as intact oligonucleotide strands (top-down) and by means of denaturing SDS-PAGE analysis. The gel-separated siRNA was further subjected to in-gel hydrolysis with different RNases and subsequent identification of the fragments by untargeted LC-HRMS analysis (bottom-up, 'experimental RNomics'). Combining the results of all approaches, the identification of several 3'-truncated urinary metabolites was accomplished and target analytes were detected up to 24 h after a single administration. Simultaneously collected blood samples yielded no promising results. The methods were validated and found fit-for-purpose for doping controls. Copyright © 2013 John Wiley & Sons, Ltd.
Zhang, Yuqin; Lin, Fanbo; Zhang, Youyu; Li, Haitao; Zeng, Yue; Tang, Hao; Yao, Shouzhuo
2011-01-01
A new method for the detection of point mutation in DNA based on the monobase-coded cadmium tellurium nanoprobes and the quartz crystal microbalance (QCM) technique was reported. A point mutation (single-base, adenine, thymine, cytosine, and guanine, namely, A, T, C and G, mutation in DNA strand, respectively) DNA QCM sensor was fabricated by immobilizing single-base mutation DNA modified magnetic beads onto the electrode surface with an external magnetic field near the electrode. The DNA-modified magnetic beads were obtained from the biotin-avidin affinity reaction of biotinylated DNA and streptavidin-functionalized core/shell Fe(3)O(4)/Au magnetic nanoparticles, followed by a DNA hybridization reaction. Single-base coded CdTe nanoprobes (A-CdTe, T-CdTe, C-CdTe and G-CdTe, respectively) were used as the detection probes. The mutation site in DNA was distinguished by detecting the decreases of the resonance frequency of the piezoelectric quartz crystal when the coded nanoprobe was added to the test system. This proposed detection strategy for point mutation in DNA is proved to be sensitive, simple, repeatable and low-cost, consequently, it has a great potential for single nucleotide polymorphism (SNP) detection. 2011 © The Japan Society for Analytical Chemistry
Shi, Chao; Ge, Yujie; Gu, Hongxi; Ma, Cuiping
2011-08-15
Single nucleotide polymorphism (SNP) genotyping is attracting extensive attentions owing to its direct connections with human diseases including cancers. Here, we have developed a highly sensitive chemiluminescence biosensor based on circular strand-displacement amplification and the separation by magnetic beads reducing the background signal for point mutation detection at room temperature. This method took advantage of both the T4 DNA ligase recognizing single-base mismatch with high selectivity and the strand-displacement reaction of polymerase to perform signal amplification. The detection limit of this method was 1.3 × 10(-16)M, which showed better sensitivity than that of most of those reported detection methods of SNP. Additionally, the magnetic beads as carrier of immobility was not only to reduce the background signal, but also may have potential apply in high through-put screening of SNP detection in human genome. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen
2018-03-01
MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.
Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen
2013-12-04
Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.
Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel
2011-08-01
Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.
VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism.
Kim, HyoYoung; Sung, Samsun; Cho, Seoae; Kim, Tae-Hun; Seo, Kangseok; Kim, Heebal
2014-12-01
Copy number variation (CNV) or single nucleotide phlyorphism (SNP) is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP) to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i) the enrichment of genome contents in CNV; ii) the physical distribution of CNV or SNP on chromosomes; iii) the distribution of log2 ratio of CNVs with criteria of interested; iv) the number of CNV or SNP per binning unit; v) the distribution of homozygosity of SNP genotype; and vi) cytomap of genes within CNV or SNP region.
Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.
2015-01-01
Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258
Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui
2016-01-01
The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Kimura, Hiroki; Tsuboi, Daisuke; Wang, Chenyao; Kushima, Itaru; Koide, Takayoshi; Ikeda, Masashi; Iwayama, Yoshimi; Toyota, Tomoko; Yamamoto, Noriko; Kunimoto, Shohko; Nakamura, Yukako; Yoshimi, Akira; Banno, Masahiro; Xing, Jingrui; Takasaki, Yuto; Yoshida, Mami; Aleksic, Branko; Uno, Yota; Okada, Takashi; Iidaka, Tetsuya; Inada, Toshiya; Suzuki, Michio; Ujike, Hiroshi; Kunugi, Hiroshi; Kato, Tadafumi; Yoshikawa, Takeo; Iwata, Nakao; Kaibuchi, Kozo; Ozaki, Norio
2015-01-01
Background: Nuclear distribution E homolog 1 (NDE1), located within chromosome 16p13.11, plays an essential role in microtubule organization, mitosis, and neuronal migration and has been suggested by several studies of rare copy number variants to be a promising schizophrenia (SCZ) candidate gene. Recently, increasing attention has been paid to rare single-nucleotide variants (SNVs) discovered by deep sequencing of candidate genes, because such SNVs may have large effect sizes and their functional analysis may clarify etiopathology. Methods and Results: We conducted mutation screening of NDE1 coding exons using 433 SCZ and 145 pervasive developmental disorders samples in order to identify rare single nucleotide variants with a minor allele frequency ≤5%. We then performed genetic association analysis using a large number of unrelated individuals (3554 SCZ, 1041 bipolar disorder [BD], and 4746 controls). Among the discovered novel rare variants, we detected significant associations between SCZ and S214F (P = .039), and between BD and R234C (P = .032). Furthermore, functional assays showed that S214F affected axonal outgrowth and the interaction between NDE1 and YWHAE (14-3-3 epsilon; a neurodevelopmental regulator). Conclusions: This study strengthens the evidence for association between rare variants within NDE1 and SCZ, and may shed light into the molecular mechanisms underlying this severe psychiatric disorder. PMID:25332407
Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua
2015-03-15
A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The genome-wide association study (GWAS) is a useful tool for detecting and characterizing traits of interest including those associated with disease resistance in soybean. The availability of 50,000 single nucleotide polymorphism (SNP) markers (SoySNP50K iSelect BeadChip; www.soybase.org) on 19,652...
Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine
2015-10-01
Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile.
Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin
2015-07-01
To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.
USDA-ARS?s Scientific Manuscript database
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L
2015-05-01
Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors
NASA Astrophysics Data System (ADS)
Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian
2006-01-01
We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor
Aihara, Masamune; Yamamoto, Shigeru; Nishioka, Hiroko; Inoue, Yutaro; Hamano, Kimikazu; Oka, Masaaki; Mizukami, Yoichi
2012-06-15
G protein-coupled receptor 30/G protein estrogen receptor-1 (GPR30/GPER-1) is a novel membrane receptor for estrogen whose mRNA is expressed at high levels in estrogen-dependent cells such as breast cancer cell lines. However, mutations in GRP30 related to diseases remain unreported. To detect unknown mutations in the GPR30 open reading frame (ORF) quickly, the experimental conditions for high-resolution melting (HRM) analysis were examined for PCR primers, Taq polymerases, saturation DNA binding dyes, Mg(2+) concentration, and normalized temperatures. Nine known SNPs and 13 artificial point mutations within the GPR30 ORF, as well as single nucleotide variants in DNA extracted from subjects with breast cancers were tested under the optimal experimental conditions. The combination of Expand High Fidelity(PLUS) and SYTO9 in the presence of 2.0 mM MgCl(2) produced the best separation in melting curves of mutations in all regions of the GPR30 ORF. Under these experimental conditions, the mutations were clearly detected in both heterozygotes and homozygotes. HRM analysis of GPR30 using genomic DNA from subjects with breast cancers showed a novel single nucleotide variant, 111C>T in GPR30 and 4 known SNPs. The experimental conditions determined in this study for HRM analysis are useful for high throughput assays to detect unknown mutations within the GPR30 ORF. Copyright © 2012 Elsevier B.V. All rights reserved.
Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F
2007-08-01
Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.
Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen
2014-01-01
A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186
Smidansky, Eric D.; Arnold, Jamie J.; Reynolds, Shelley L.; Cameron, Craig E.
2013-01-01
The human mitochondrial RNA polymerase (h-mtRNAP) serves as both the transcriptase for expression and the primase for replication of mitochondrial DNA. As such, the enzyme is of fundamental importance to cellular energy metabolism, and defects in its function may be related to human disease states. Here we describe in vitro analysis of the h-mtRNAP kinetic mechanism for single, correct nucleotide incorporation. This was made possible by the development of efficient methods for expression and purification of h-mtRNAP using a bacterial system and by utilization of assays that rely on simple, synthetic RNA/DNA scaffolds without the need for mitochondrial transcription accessory proteins. We find that h-mtRNAP accomplishes single-nucleotide incorporation by using the same core steps, including conformational change steps before and after chemistry, that are prototypical for most types of nucleic acid polymerases. The polymerase binds to scaffolds via a two-step mechanism consisting of a fast initial-encounter step followed by a much slower isomerization that leads to catalytic competence. A substantial solvent deuterium kinetic isotope effect was observed for the forward reaction, but none was detectable for the reverse reaction, suggesting that chemistry is at least partially rate-limiting in the forward direction but not in the reverse. h-mtRNAP appears to exercise much more stringent surveillance over base than over sugar in determining the correctness of a nucleotide. The utility of developing the robust in vitro assays described here and of establishing a baseline of kinetic performance for the wild-type enzyme is that biological questions concerning h-mtRNAP may now begin to be addressed. PMID:21548588
Gerstner, Arpad; DeFord, James H; Papaconstantinou, John
2003-07-25
Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.
HomSI: a homozygous stretch identifier from next-generation sequencing data.
Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil
2014-02-01
In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.
Taylor, Angela J; Lappi, Victoria; Wolfgang, William J; Lapierre, Pascal; Palumbo, Michael J; Medus, Carlota; Boxrud, David
2015-10-01
Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Veale, Andrew J; Russello, Michael A
2017-10-01
Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo
2018-04-01
We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. Copyright © 2018 by the Genetics Society of America.
Prenatal detection of fetal triploidy from cell-free DNA testing in maternal blood.
Nicolaides, Kypros H; Syngelaki, Argyro; del Mar Gil, Maria; Quezada, Maria Soledad; Zinevich, Yana
2014-01-01
To investigate potential performance of cell-free DNA (cfDNA) testing in maternal blood in detecting fetal triploidy. Plasma and buffy coat samples obtained at 11-13 weeks' gestation from singleton pregnancies with diandric triploidy (n=4), digynic triploidy (n=4), euploid fetuses (n=48) were sent to Natera, Inc. (San Carlos, Calif., USA) for cfDNA testing. Multiplex polymerase chain reaction amplification of cfDNA followed by sequencing of single nucleotide polymorphic loci covering chromosomes 13, 18, 21, X, and Y was performed. Sequencing data were analyzed using the NATUS algorithm which identifies copy number for each of the five chromosomes. cfDNA testing provided a result in 44 (91.7%) of the 48 euploid cases and correctly predicted the fetal sex and the presence of two copies each of chromosome 21, 18 and 13. In diandric triploidy, cfDNA testing identified multiple paternal haplotypes (indicating fetal trisomy 21, trisomy 18 and trisomy 13) suggesting the presence of either triploidy or dizygotic twins. In digynic triploidy the fetal fraction corrected for maternal weight and gestational age was below the 0.5th percentile. cfDNA testing by targeted sequencing and allelic ratio analysis of single nucleotide polymorphisms covering chromosomes 21, 18, 13, X, and Y can detect diandric triploidy and raise the suspicion of digynic triploidy. © 2013 S. Karger AG, Basel.
Hu, Bo; Guo, Jing; Xu, Ying; Wei, Hua; Zhao, Guojie; Guan, Yifu
2017-08-01
Rapid and accurate detection of microRNAs in biological systems is of great importance. Here, we report the development of a visual colorimetric assay which possesses the high amplification capabilities and high selectivity of the rolling circle amplification (RCA) method and the simplicity and convenience of gold nanoparticles used as a signal indicator. The designed padlock probe recognizes the target miRNA and is circularized, and then acts as the template to extend the target miRNA into a long single-stranded nucleotide chain of many tandem repeats of nucleotide sequences. Next, the RCA product is hybridized with oligonucleotides tagged onto gold nanoparticles. This interaction leads to the aggregation of gold nanoparticles, and the color of the system changes from wine red to dark blue according to the abundance of miRNA. A linear correlation between fluorescence and target oligonucleotide content was obtained in the range 0.3-300 pM, along with a detection limit of 0.13 pM (n = 7) and a RSD of 3.9% (30 pM, n = 9). The present approach provides a simple, rapid, and accurate visual colorimetric assay that allows sensitive biodetection and bioanalysis of DNA and RNA nucleotides of interest in biologically important samples. Graphical abstract The colorimetric assay system for analyzing target oligonucleotides.
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-01-01
Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-05-05
Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.
Sheynkman, Gloria M.; Shortreed, Michael R.; Frey, Brian L.; Scalf, Mark; Smith, Lloyd M.
2013-01-01
Each individual carries thousands of non-synonymous single nucleotide variants (nsSNVs) in their genome, each corresponding to a single amino acid polymorphism (SAP) in the encoded proteins. It is important to be able to directly detect and quantify these variations at the protein level in order to study post-transcriptional regulation, differential allelic expression, and other important biological processes. However, such variant peptides are not generally detected in standard proteomic analyses, due to their absence from the generic databases that are employed for mass spectrometry searching. Here, we extend previous work that demonstrated the use of customized SAP databases constructed from sample-matched RNA-Seq data. We collected deep coverage RNA-Seq data from the Jurkat cell line, compiled the set of nsSNVs that are expressed, used this information to construct a customized SAP database, and searched it against deep coverage shotgun MS data obtained from the same sample. This approach enabled detection of 421 SAP peptides mapping to 395 nsSNVs. We compared these peptides to peptides identified from a large generic search database containing all known nsSNVs (dbSNP) and found that more than 70% of the SAP peptides from this dbSNP-derived search were not supported by the RNA-Seq data, and thus are likely false positives. Next, we increased the SAP coverage from the RNA-Seq derived database by utilizing multiple protease digestions, thereby increasing variant detection to 695 SAP peptides mapping to 504 nsSNV sites. These detected SAP peptides corresponded to moderate to high abundance transcripts (30+ transcripts per million, TPM). The SAP peptides included 192 allelic pairs; the relative expression levels of the two alleles were evaluated for 51 of those pairs, and found to be comparable in all cases. PMID:24175627
Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C
2015-07-01
To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal cytogenetic results. Recommended recurrent pregnancy loss screening was unnecessary in almost half the patients in our study. II.
Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.
Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A
2010-08-01
Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine
2015-01-01
Key Clinical Message Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile. PMID:26509013
Bendezu Eguis, Jorge; Montesinos, Ricardo; Fernández-Díaz, Manolo
2018-01-01
ABSTRACT We report here the first genome sequence of infectious laryngotracheitis virus isolated in Peru from tracheal tissues of layer chickens. The genome showed 99.98% identity to the J2 strain genome sequence. Single nucleotide polymorphisms were detected in five gene-coding sequences related to vaccine development, virus attachment, and viral immune evasion. PMID:29519822
Wu, Y.; Tan, E. L.; Yeo, A.; Chan, K. P.; Nishimura, H.; Cardosa, M. J.; Poh, C. L.; Quak, S. H.; Chow, Vincent T.
2011-01-01
A high-throughput multiplex bead suspension array was developed for the rapid subgenogrouping of EV71 strains, based on single nucleotide polymorphisms observed within the VP1 region with a high sensitivity as low as 1 PFU. Of 33 viral isolates and 55 clinical samples, all EV71 strains were successfully detected and correctly subgenogrouped. PMID:21084510
Highly multiplexed subcellular RNA sequencing in situ
Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Yang, Joyce L.; Terry, Richard; Jeanty, Sauveur S. F.; Li, Chao; Amamoto, Ryoji; Peters, Derek T.; Turczyk, Brian M.; Marblestone, Adam H.; Inverso, Samuel A.; Bernard, Amy; Mali, Prashant; Rios, Xavier; Aach, John; Church, George M.
2014-01-01
Understanding the spatial organization of gene expression with single nucleotide resolution requires localizing the sequences of expressed RNA transcripts within a cell in situ. Here we describe fluorescent in situ RNA sequencing (FISSEQ), in which stably cross-linked cDNA amplicons are sequenced within a biological sample. Using 30-base reads from 8,742 genes in situ, we examined RNA expression and localization in human primary fibroblasts using a simulated wound healing assay. FISSEQ is compatible with tissue sections and whole mount embryos, and reduces the limitations of optical resolution and noisy signals on single molecule detection. Our platform enables massively parallel detection of genetic elements, including gene transcripts and molecular barcodes, and can be used to investigate cellular phenotype, gene regulation, and environment in situ. PMID:24578530
Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.
Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru
2015-11-01
Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...
DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†
Comer, Jeffrey
2016-01-01
Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233
Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K
2017-09-01
Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.
Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi
2001-01-01
We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945
CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer
Carter, Hannah; Diekhans, Mark; Ryan, Michael C.; Karchin, Rachel
2011-01-01
Summary: Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. Availability and Implementation: MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM. Contact: karchin@jhu.edu Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:21685053
Carter, Tamar E; Boulter, Alexis; Existe, Alexandre; Romain, Jean R; St Victor, Jean Yves; Mulligan, Connie J; Okech, Bernard A
2015-03-01
Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. © The American Society of Tropical Medicine and Hygiene.
Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer
NASA Astrophysics Data System (ADS)
Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming
2017-09-01
Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.
Val66Met Polymorphism of BDNF Alters Prodomain Structure to Induce Neuronal Growth Cone Retraction
Anastasia, Agustin; Deinhardt, Katrin; Chao, Moses V.; Will, Nathan E.; Irmady, Krithi; Lee, Francis S.; Hempstead, Barbara L.; Bracken, Clay
2013-01-01
A common single-nucleotide polymorphism in the human brain-derived neurotrophic factor (BDNF) gene results in a Val66Met substitution in the BDNF prodomain region. This single-nucleotide polymorphism is associated with alterations in memory and with enhanced risk to develop depression and anxiety disorders in humans. Here we show that the isolated BDNF prodomain is detected in the hippocampus and that it can be secreted from neurons in an activity-dependent manner. Using nuclear magnetic resonance spectroscopy and circular dichroism we find that the prodomain is intrinsically disordered, and the Val66Met substitution induces structural changes. Surprisingly, application of Met66 (but not Val66) BDNF prodomain induces acute growth cone retraction and a decrease in Rac activity in hippocampal neurons. Expression of p75NTR and differential engagement of the Met66 prodomain to the SorCS2 receptor are required for this effect. These results identify the Met66 prodomain as a new active ligand which modulates neuronal morphology. PMID:24048383
Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.
2015-01-01
Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965
Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo
2017-08-01
In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.
Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua
2013-03-28
Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.
Gymoese, Pernille; Sørensen, Gitte; Litrup, Eva; Olsen, John Elmerdal; Nielsen, Eva Møller
2017-01-01
Whole-genome sequencing is rapidly replacing current molecular typing methods for surveillance purposes. Our study evaluates core-genome single-nucleotide polymorphism analysis for outbreak detection and linking of sources of Salmonella enterica serovar Typhimurium and its monophasic variants during a 7-month surveillance period in Denmark. We reanalyzed and defined 8 previously characterized outbreaks from the phylogenetic relatedness of the isolates, epidemiologic data, and food traceback investigations. All outbreaks were identified, and we were able to exclude unrelated and include additional related human cases. We were furthermore able to link possible food and veterinary sources to the outbreaks. Isolates clustered according to sequence types (STs) 19, 34, and 36. Our study shows that core-genome single-nucleotide polymorphism analysis is suitable for surveillance and outbreak investigation for Salmonella Typhimurium (ST19 and ST36), but whole genome–wide analysis may be required for the tight genetic clone of monophasic variants (ST34). PMID:28930002
Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S.; Johnson, Marc T.J.; Wright, Stephen I.; Pellizzer, Tommaso; Sobanski, Johanna; Greiner, Stephan
2016-01-01
Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. PMID:27053421
2011-01-01
Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311
Although exome sequencing data are generated primarily to detect single-nucleotide variants and indels, they can also be used to identify a subset of genomic rearrangements whose breakpoints are located in or near exons. Using >4,600 tumor and normal pairs across 15 cancer types, we identified over 9,000 high confidence somatic rearrangements, including a large number of gene fusions.
Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek
2005-02-01
Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.
Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F
2018-03-22
Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.
Huang, Shih-Ying; Chang, Jia-Ru; Liao, Yu-Chieh; Dou, Horng-Yunn; Chuang, Min-Chieh
2018-05-12
Tuberculosis (TB) remains one of the major infectious diseases worldwide. The pathogenic bacterium, Mycobacterium tuberculosis (M.tb), continuously evolves strains carrying drug-resistance genes, thus posing a growing challenge to TB prevention and treatment. We report a diagnostic system that uses a molecular beacon probe and an assistant strand as the core to simultaneously interact with an M.tb-specific fragment (in IS6110) and a single nucleotide substitution (SNS)-encoded segment (in rpoB) associated with drug resistance. A single fluorescent output in three-tiered levels was produced for combinatorial interpretations based on formation of a four-way DNA junction (4WJ). The SNS caused the 4WJ to partially dissociate, thus resulting in medium-level fluorescence. By contrast, high- and low-level fluorescence, represented the complete complementary complex and absence of either targeted fragments, respectively. Manipulating the length of the analyte-binding arm realized the medium output. The thermodynamics and kinetics of 4WJ construction were investigated to maximize the tiered-output performance. Biocatalytic amplification driven by the Klenow Fragment and Nt.AlwI was incorporated into the method to enhance the signal 64-fold and ensure long-term stability of the three-tiered output. The detection accuracy of the sensing system was verified using unpurified amplicons with templates of extracted DNA and boiled bacterial solutions. The tiered-output mechanism was usable at bacterial loads ranging from 4 × 10 0 to 4 × 10 3 CFU per reaction. The interference caused by nontuberculous mycobacteria was minimal. The results demonstrated the integrity of the sensing method as an alternative strategy for rapid screening of M.tb and detecting rifampin-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Hartmann, Luise; Stephenson, Christine F; Verkamp, Stephanie R; Johnson, Krystal R; Burnworth, Bettina; Hammock, Kelle; Brodersen, Lisa Eidenschink; de Baca, Monica E; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K
2014-12-01
Array comparative genomic hybridization (aCGH) has become a powerful tool for analyzing hematopoietic neoplasms and identifying genome-wide copy number changes in a single assay. aCGH also has superior resolution compared with fluorescence in situ hybridization (FISH) or conventional cytogenetics. Integration of single nucleotide polymorphism (SNP) probes with microarray analysis allows additional identification of acquired uniparental disomy, a copy neutral aberration with known potential to contribute to tumor pathogenesis. However, a limitation of microarray analysis has been the inability to detect clonal heterogeneity in a sample. This study comprised 16 samples (acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, plasma cell neoplasm) with complex cytogenetic features and evidence of clonal evolution. We used an integrated manual peak reassignment approach combining analysis of aCGH and SNP microarray data for characterization of subclonal abnormalities. We compared array findings with results obtained from conventional cytogenetic and FISH studies. Clonal heterogeneity was detected in 13 of 16 samples by microarray on the basis of log2 values. Use of the manual peak reassignment analysis approach improved resolution of the sample's clonal composition and genetic heterogeneity in 10 of 13 (77%) patients. Moreover, in 3 patients, clonal disease progression was revealed by array analysis that was not evident by cytogenetic or FISH studies. Genetic abnormalities originating from separate clonal subpopulations can be identified and further characterized by combining aCGH and SNP hybridization results from 1 integrated microarray chip by use of the manual peak reassignment technique. Its clinical utility in comparison to conventional cytogenetic or FISH studies is demonstrated. © 2014 American Association for Clinical Chemistry.
Germline contamination and leakage in whole genome somatic single nucleotide variant detection.
Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C
2018-01-31
The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.
Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H
2006-04-01
We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Shihai; Lo, Chien-Chi; Li, Po-E
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
Feng, Shihai; Lo, Chien-Chi; Li, Po-E; ...
2016-02-29
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun
2015-11-10
Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure. Published by Elsevier B.V.
Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q
2014-04-01
Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.
Development of solution-gated graphene transistor model for biosensors
NASA Astrophysics Data System (ADS)
Karimi, Hediyeh; Yusof, Rubiyah; Rahmani, Rasoul; Hosseinpour, Hoda; Ahmadi, Mohammad T.
2014-02-01
The distinctive properties of graphene, characterized by its high carrier mobility and biocompatibility, have stimulated extreme scientific interest as a promising nanomaterial for future nanoelectronic applications. In particular, graphene-based transistors have been developed rapidly and are considered as an option for DNA sensing applications. Recent findings in the field of DNA biosensors have led to a renewed interest in the identification of genetic risk factors associated with complex human diseases for diagnosis of cancers or hereditary diseases. In this paper, an analytical model of graphene-based solution gated field effect transistors (SGFET) is proposed to constitute an important step towards development of DNA biosensors with high sensitivity and selectivity. Inspired by this fact, a novel strategy for a DNA sensor model with capability of single-nucleotide polymorphism detection is proposed and extensively explained. First of all, graphene-based DNA sensor model is optimized using particle swarm optimization algorithm. Based on the sensing mechanism of DNA sensors, detective parameters ( I ds and V gmin) are suggested to facilitate the decision making process. Finally, the behaviour of graphene-based SGFET is predicted in the presence of single-nucleotide polymorphism with an accuracy of more than 98% which guarantees the reliability of the optimized model for any application of the graphene-based DNA sensor. It is expected to achieve the rapid, quick and economical detection of DNA hybridization which could speed up the realization of the next generation of the homecare sensor system.
Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M
2015-09-01
Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
Development of solution-gated graphene transistor model for biosensors
2014-01-01
The distinctive properties of graphene, characterized by its high carrier mobility and biocompatibility, have stimulated extreme scientific interest as a promising nanomaterial for future nanoelectronic applications. In particular, graphene-based transistors have been developed rapidly and are considered as an option for DNA sensing applications. Recent findings in the field of DNA biosensors have led to a renewed interest in the identification of genetic risk factors associated with complex human diseases for diagnosis of cancers or hereditary diseases. In this paper, an analytical model of graphene-based solution gated field effect transistors (SGFET) is proposed to constitute an important step towards development of DNA biosensors with high sensitivity and selectivity. Inspired by this fact, a novel strategy for a DNA sensor model with capability of single-nucleotide polymorphism detection is proposed and extensively explained. First of all, graphene-based DNA sensor model is optimized using particle swarm optimization algorithm. Based on the sensing mechanism of DNA sensors, detective parameters (Ids and Vgmin) are suggested to facilitate the decision making process. Finally, the behaviour of graphene-based SGFET is predicted in the presence of single-nucleotide polymorphism with an accuracy of more than 98% which guarantees the reliability of the optimized model for any application of the graphene-based DNA sensor. It is expected to achieve the rapid, quick and economical detection of DNA hybridization which could speed up the realization of the next generation of the homecare sensor system. PMID:24517158
Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo
2017-03-27
Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.
Mismatch cleavage by single-strand specific nucleases
Till, Bradley J.; Burtner, Chris; Comai, Luca; Henikoff, Steven
2004-01-01
We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S1) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S1 family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery. PMID:15141034
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697
Walter, Christiane; Pozzorini, Christian; Reinhardt, Katarina; Geffers, Robert; Xu, Zhenyu; Reinhardt, Dirk; von Neuhoff, Nils; Hanenberg, Helmut
2018-02-01
The small portion of leukemic stem cells (LSCs) in acute myeloid leukemia (AML) present in children and adolescents is often masked by the high background of AML blasts and normal hematopoietic cells. The aim of the current study was to establish a simple workflow for reliable genetic analysis of single LSC-enriched blasts from pediatric patients. For three AMLs with mutations in nucleophosmin 1 and/or fms-like tyrosine kinase 3, we performed whole genome amplification on sorted single-cell DNA followed by whole exome sequencing (WES). The corresponding bulk bone marrow DNAs were also analyzed by WES and by targeted sequencing (TS) that included 54 genes associated with myeloid malignancies. Analysis revealed that read coverage statistics were comparable between single-cell and bulk WES data, indicating high-quality whole genome amplification. From 102 single-cell variants, 72 single nucleotide variants and insertions or deletions (70%) were consistently found in the two bulk DNA analyses. Variants reliably detected in single cells were also present in TS. However, initial screening by WES with read counts between 50-72× failed to detect rare AML subclones in the bulk DNAs. In summary, our study demonstrated that single-cell WES combined with bulk DNA TS is a promising tool set for detecting AML subclones and possibly LSCs. © 2017 Wiley Periodicals, Inc.
2010-01-01
We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458
Photoinitiator Nucleotide for Quantifying Nucleic Acid Hybridization
Johnson, Leah M.; Hansen, Ryan R.; Urban, Milan; Kuchta, Robert D.; Bowman, Christopher N.
2010-01-01
This first report of a photoinitiator-nucleotide conjugate demonstrates a novel approach for sensitive, rapid and visual detection of DNA hybridization events. This approach holds potential for various DNA labeling schemes and for applications benefiting from selective DNA-based polymerization initiators. Here, we demonstrate covalent, enzymatic incorporation of an eosin-photoinitiator 2′-deoxyuridine-5′-triphosphate (EITC-dUTP) conjugate into surface-immobilized DNA hybrids. Subsequent radical chain photoinitiation from these sites using an acrylamide/bis-acrylamide formulation yields a dynamic detection range between 500pM and 50nM of DNA target. Increasing EITC-nucleotide surface densities leads to an increase in surface-based polymer film heights until achieving a film height plateau of 280nm ±20nm at 610 ±70 EITC-nucleotides/μm2. Film heights of 10–20 nm were obtained from eosin surface densities of approximately 20 EITC-nucleotides/μm2 while below the detection limit of ~10 EITC-nucleotides/μm2, no detectable films were formed. This unique threshold behavior is utilized for instrument-free, visual quantification of target DNA concentration ranges. PMID:20337438
López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás
2012-06-01
The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K
2015-11-10
Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs can inform control programs. This manuscript describes modifications to high resolution melting technology that further increase its sensitivity to identify polygenomic infections in patient samples.
Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz
2008-01-01
The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.
Denaturing high-performance liquid chromatography for mutation detection and genotyping.
Fackenthal, Donna Lee; Chen, Pei Xian; Howe, Ted; Das, Soma
2013-01-01
Denaturing high-performance liquid chromatography (DHPLC) is an accurate and efficient screening technique used for detecting DNA sequence changes by heteroduplex analysis. It can also be used for genotyping of single nucleotide polymorphisms (SNPs). The high sensitivity of DHPLC has made this technique one of the most reliable approaches to mutation analysis and, therefore, used in various areas of genetics, both in the research and clinical arena. This chapter describes the methods used for mutation detection analysis and the genotyping of SNPs by DHPLC on the WAVE™ system from Transgenomic Inc. ("WAVE" and "DNASep" are registered trademarks, and "Navigator" is a trademark, of Transgenomic, used with permission. All other trademarks are property of the respective owners).
Kovaliov, Marina; Weitman, Michal; Major, Dan Thomas; Fischer, Bilha
2014-08-01
To expand the arsenal of fluorescent cytidine analogues for the detection of genetic material, we synthesized para-substituted phenyl-imidazolo-cytidine ((Ph)ImC) analogues 5a-g and established a relationship between their structure and fluorescence properties. These analogues were more emissive than cytidine (λem 398-420 nm, Φ 0.009-0.687), and excellent correlation was found between Φ of 5a-g and σp(-) of the substituent on the phenyl-imidazolo moiety (R(2) = 0.94). Calculations suggested that the dominant tautomer of (Ph)ImC in methanol solution is identical to that of cytidine. DFT calculations of the stable tautomer of selected (Ph)ImC analogues suggested a relationship between the HOMO-LUMO gap and Φ and explained the loss of fluorescence in the nitro analogue. Incorporation of the CF3-(Ph)ImdC analogue into a DNA probe resulted in 6-fold fluorescence quenching of the former. A 17-fold reduction of fluorescence was observed for the G-matched duplex vs ODN(CF3-(Ph)ImdC), while for A-mismatched duplex, only a 2-fold decrease was observed. Furthermore, since the quantum yield of ODN(CF3-(Ph)ImdC):ODN(G) was reduced 17-fold vs that of a single strand, whereas that of ODN(CF3-(Ph)ImdC):ORN(G) was reduced only 3.8-fold, ODN(CF3-(Ph)ImdC) appears to be a DNA-selective probe. We conclude that the ODN(CF3-(Ph)ImdC) probe, exhibiting emission sensitivity upon single nucleotide replacement, may be potentially useful for DNA single nucleotide polymorphism (SNP) typing.
Murray, James L.; Hu, Peixu; Shafer, David A.
2015-01-01
We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. PMID:25307756
Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H
2006-04-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.
Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.
2006-01-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031
Conformational transitions in DNA polymerase I revealed by single-molecule FRET
Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.
2010-01-01
The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740
2014-01-01
The Bactrian camel (Camelus bactrianus) and the dromedary (Camelus dromedarius) are among the last species that have been domesticated around 3000–6000 years ago. During domestication, strong artificial (anthropogenic) selection has shaped the livestock, creating a huge amount of phenotypes and breeds. Hence, domestic animals represent a unique resource to understand the genetic basis of phenotypic variation and adaptation. Similar to its late domestication history, the Bactrian camel is also among the last livestock animals to have its genome sequenced and deciphered. As no genomic data have been available until recently, we generated a de novo assembly by shotgun sequencing of a single male Bactrian camel. We obtained 1.6 Gb genomic sequences, which correspond to more than half of the Bactrian camel’s genome. The aim of this study was to identify heterozygous single-nucleotide polymorphisms (SNPs) and to estimate population parameters and nucleotide diversity based on an individual camel. With an average 6.6-fold coverage, we detected over 116 000 heterozygous SNPs and recorded a genome-wide nucleotide diversity similar to that of other domesticated ungulates. More than 20 000 (85%) dromedary expressed sequence tags successfully aligned to our genomic draft. Our results provide a template for future association studies targeting economically relevant traits and to identify changes underlying the process of camel domestication and environmental adaptation. PMID:23454912
Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S; Zupok, Arkadiusz; Johnson, Marc T J; Wright, Stephen I; Pellizzer, Tommaso; Sobanski, Johanna; Bock, Ralph; Greiner, Stephan
2016-04-01
Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. © 2016 American Society of Plant Biologists. All rights reserved.
Ge, H; Noble, J; Colgan, J; Manley, J L
1990-01-01
We have studied splicing of the polyoma virus early region pre-mRNA in vitro. This RNA is alternatively spliced in vivo to produce mRNA encoding the large, middle-sized (MTAg), and small (StAg) tumor antigens. Our primary interest was to learn how the 48-nucleotide StAg intron is excised, because the length of this intron is significantly less than the apparent minimum established for mammalian introns. Although the products of all three splices are detected in vitro, characterization of the pathway and sequence requirements of StAg splicing suggests that splicing factors interact with the precursor RNA in an unexpected way to catalyze removal of this intron. Specifically, StAg splicing uses either of two lariat branch points, one of which is located only 4 nucleotides from the 3' splice site. Furthermore, the StAg splice absolutely requires that the alternative MTAg 3' splice site, located 14 nucleotides downstream of the StAg 3' splice site, be intact. Insertion mutations that increase or decrease the quality of the MTAg pyrimidine stretch enhance or repress StAg as well as MTAg splicing, and a single-base change in the MTAg AG splice acceptor totally blocks both splices. These results demonstrate the ability of two 3' splice sites to cooperate with each other to bring about removal of a single intron. Images PMID:2159146
Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria
2011-01-01
Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.
Evaluation of somatic copy number estimation tools for whole-exome sequencing data.
Nam, Jae-Yong; Kim, Nayoung K D; Kim, Sang Cheol; Joung, Je-Gun; Xi, Ruibin; Lee, Semin; Park, Peter J; Park, Woong-Yang
2016-03-01
Whole-exome sequencing (WES) has become a standard method for detecting genetic variants in human diseases. Although the primary use of WES data has been the identification of single nucleotide variations and indels, these data also offer a possibility of detecting copy number variations (CNVs) at high resolution. However, WES data have uneven read coverage along the genome owing to the target capture step, and the development of a robust WES-based CNV tool is challenging. Here, we evaluate six WES somatic CNV detection tools: ADTEx, CONTRA, Control-FREEC, EXCAVATOR, ExomeCNV and Varscan2. Using WES data from 50 kidney chromophobe, 50 bladder urothelial carcinoma, and 50 stomach adenocarcinoma patients from The Cancer Genome Atlas, we compared the CNV calls from the six tools with a reference CNV set that was identified by both single nucleotide polymorphism array 6.0 and whole-genome sequencing data. We found that these algorithms gave highly variable results: visual inspection reveals significant differences between the WES-based segmentation profiles and the reference profile, as well as among the WES-based profiles. Using a 50% overlap criterion, 13-77% of WES CNV calls were covered by CNVs from the reference set, up to 21% of the copy gains were called as losses or vice versa, and dramatic differences in CNV sizes and CNV numbers were observed. Overall, ADTEx and EXCAVATOR had the best performance with relatively high precision and sensitivity. We suggest that the current algorithms for somatic CNV detection from WES data are limited in their performance and that more robust algorithms are needed. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
2013-01-01
Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
QQ-SNV: single nucleotide variant detection at low frequency by comparing the quality quantiles.
Van der Borght, Koen; Thys, Kim; Wetzels, Yves; Clement, Lieven; Verbist, Bie; Reumers, Joke; van Vlijmen, Herman; Aerssens, Jeroen
2015-11-10
Next generation sequencing enables studying heterogeneous populations of viral infections. When the sequencing is done at high coverage depth ("deep sequencing"), low frequency variants can be detected. Here we present QQ-SNV (http://sourceforge.net/projects/qqsnv), a logistic regression classifier model developed for the Illumina sequencing platforms that uses the quantiles of the quality scores, to distinguish true single nucleotide variants from sequencing errors based on the estimated SNV probability. To train the model, we created a dataset of an in silico mixture of five HIV-1 plasmids. Testing of our method in comparison to the existing methods LoFreq, ShoRAH, and V-Phaser 2 was performed on two HIV and four HCV plasmid mixture datasets and one influenza H1N1 clinical dataset. For default application of QQ-SNV, variants were called using a SNV probability cutoff of 0.5 (QQ-SNV(D)). To improve the sensitivity we used a SNV probability cutoff of 0.0001 (QQ-SNV(HS)). To also increase specificity, SNVs called were overruled when their frequency was below the 80(th) percentile calculated on the distribution of error frequencies (QQ-SNV(HS-P80)). When comparing QQ-SNV versus the other methods on the plasmid mixture test sets, QQ-SNV(D) performed similarly to the existing approaches. QQ-SNV(HS) was more sensitive on all test sets but with more false positives. QQ-SNV(HS-P80) was found to be the most accurate method over all test sets by balancing sensitivity and specificity. When applied to a paired-end HCV sequencing study, with lowest spiked-in true frequency of 0.5%, QQ-SNV(HS-P80) revealed a sensitivity of 100% (vs. 40-60% for the existing methods) and a specificity of 100% (vs. 98.0-99.7% for the existing methods). In addition, QQ-SNV required the least overall computation time to process the test sets. Finally, when testing on a clinical sample, four putative true variants with frequency below 0.5% were consistently detected by QQ-SNV(HS-P80) from different generations of Illumina sequencers. We developed and successfully evaluated a novel method, called QQ-SNV, for highly efficient single nucleotide variant calling on Illumina deep sequencing virology data.
Solid-State and Biological Nanopore for Real-Time Sensing of Single Chemical and Sequencing of DNA.
Haque, Farzin; Li, Jinghong; Wu, Hai-Chen; Liang, Xing-Jie; Guo, Peixuan
2013-02-01
Sensitivity and specificity are two most important factors to take into account for molecule sensing, chemical detection and disease diagnosis. A perfect sensitivity is to reach the level where a single molecule can be detected. An ideal specificity is to reach the level where the substance can be detected in the presence of many contaminants. The rapidly progressing nanopore technology is approaching this threshold. A wide assortment of biomotors and cellular pores in living organisms perform diverse biological functions. The elegant design of these transportation machineries has inspired the development of single molecule detection based on modulations of the individual current blockage events. The dynamic growth of nanotechnology and nanobiotechnology has stimulated rapid advances in the study of nanopore based instrumentation over the last decade, and inspired great interest in sensing of single molecules including ions, nucleotides, enantiomers, drugs, and polymers such as PEG, RNA, DNA, and polypeptides. This sensing technology has been extended to medical diagnostics and third generation high throughput DNA sequencing. This review covers current nanopore detection platforms including both biological pores and solid state counterparts. Several biological nanopores have been studied over the years, but this review will focus on the three best characterized systems including α-hemolysin and MspA, both containing a smaller channel for the detection of single-strand DNA, as well as bacteriophage phi29 DNA packaging motor connector that contains a larger channel for the passing of double stranded DNA. The advantage and disadvantage of each system are compared; their current and potential applications in nanomedicine, biotechnology, and nanotechnology are discussed.
Solid-State and Biological Nanopore for Real-Time Sensing of Single Chemical and Sequencing of DNA
Haque, Farzin; Li, Jinghong; Wu, Hai-Chen; Liang, Xing-Jie; Guo, Peixuan
2013-01-01
Sensitivity and specificity are two most important factors to take into account for molecule sensing, chemical detection and disease diagnosis. A perfect sensitivity is to reach the level where a single molecule can be detected. An ideal specificity is to reach the level where the substance can be detected in the presence of many contaminants. The rapidly progressing nanopore technology is approaching this threshold. A wide assortment of biomotors and cellular pores in living organisms perform diverse biological functions. The elegant design of these transportation machineries has inspired the development of single molecule detection based on modulations of the individual current blockage events. The dynamic growth of nanotechnology and nanobiotechnology has stimulated rapid advances in the study of nanopore based instrumentation over the last decade, and inspired great interest in sensing of single molecules including ions, nucleotides, enantiomers, drugs, and polymers such as PEG, RNA, DNA, and polypeptides. This sensing technology has been extended to medical diagnostics and third generation high throughput DNA sequencing. This review covers current nanopore detection platforms including both biological pores and solid state counterparts. Several biological nanopores have been studied over the years, but this review will focus on the three best characterized systems including α-hemolysin and MspA, both containing a smaller channel for the detection of single-strand DNA, as well as bacteriophage phi29 DNA packaging motor connector that contains a larger channel for the passing of double stranded DNA. The advantage and disadvantage of each system are compared; their current and potential applications in nanomedicine, biotechnology, and nanotechnology are discussed. PMID:23504223
Liu, Meiying; Yuan, Min; Lou, Xinhui; Mao, Hongju; Zheng, Dongmei; Zou, Ruxing; Zou, Nengli; Tang, Xiangrong; Zhao, Jianlong
2011-07-15
We report here an optical approach that enables highly selective and colorimetric single-base mismatch detection without the need of target modification, precise temperature control or stringent washes. The method is based on the finding that nucleoside monophosphates (dNMPs), which are digested elements of DNA, can better stabilize unmodified gold nanoparticles (AuNPs) than single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with the same base-composition and concentration. The method combines the exceptional mismatch discrimination capability of the structure-selective nucleases with the attractive optical property of AuNPs. Taking S1 nuclease as one example, the perfectly matched 16-base synthetic DNA target was distinctively differentiated from those with single-base mutation located at any position of the 16-base synthetic target. Single-base mutations present in targets with varied length up to 80-base, located either in the middle or near to the end of the targets, were all effectively detected. In order to prove that the method can be potentially used for real clinic samples, the single-base mismatch detections with two HBV genomic DNA samples were conducted. To further prove the generality of this method and potentially overcome the limitation on the detectable lengths of the targets of the S1 nuclease-based method, we also demonstrated the use of a duplex-specific nuclease (DSN) for color reversed single-base mismatch detection. The main limitation of the demonstrated methods is that it is limited to detect mutations in purified ssDNA targets. However, the method coupled with various convenient ssDNA generation and purification techniques, has the potential to be used for the future development of detector-free testing kits in single nucleotide polymorphism screenings for disease diagnostics and treatments. Copyright © 2011 Elsevier B.V. All rights reserved.
Moore, Jason H; Gilbert, Joshua C; Tsai, Chia-Ti; Chiang, Fu-Tien; Holden, Todd; Barney, Nate; White, Bill C
2006-07-21
Detecting, characterizing, and interpreting gene-gene interactions or epistasis in studies of human disease susceptibility is both a mathematical and a computational challenge. To address this problem, we have previously developed a multifactor dimensionality reduction (MDR) method for collapsing high-dimensional genetic data into a single dimension (i.e. constructive induction) thus permitting interactions to be detected in relatively small sample sizes. In this paper, we describe a comprehensive and flexible framework for detecting and interpreting gene-gene interactions that utilizes advances in information theory for selecting interesting single-nucleotide polymorphisms (SNPs), MDR for constructive induction, machine learning methods for classification, and finally graphical models for interpretation. We illustrate the usefulness of this strategy using artificial datasets simulated from several different two-locus and three-locus epistasis models. We show that the accuracy, sensitivity, specificity, and precision of a naïve Bayes classifier are significantly improved when SNPs are selected based on their information gain (i.e. class entropy removed) and reduced to a single attribute using MDR. We then apply this strategy to detecting, characterizing, and interpreting epistatic models in a genetic study (n = 500) of atrial fibrillation and show that both classification and model interpretation are significantly improved.
Single Endemic Genotype of Measles Virus Continuously Circulating in China for at Least 16 Years
Wang, Huiling; Zhu, Zhen; Ji, Yixin; Liu, Chunyu; Zhang, Xiaojie; Sun, Liwei; Zhou, Jianhui; Lu, Peishan; Hu, Ying; Feng, Daxing; Zhang, Zhenying; Wang, Changyin; Fang, Xueqiang; Zheng, Huanying; Liu, Leng; Sun, Xiaodong; Tang, Wei; Wang, Yan; Liu, Yan; Gao, Hui; Tian, Hong; Ma, Jiangtao; Gu, Suyi; Wang, Shuang; Feng, Yan; Bo, Fang; Liu, Jianfeng; Si, Yuan; Zhou, Shujie; Ma, Yuyan; Wu, Shengwei; Zhou, Shunde; Li, Fangcai; Ding, Zhengrong; Yang, Zhaohui; Rota, Paul A.; Featherstone, David; Jee, Youngmee; Bellini, William J.; Xu, Wenbo
2012-01-01
The incidence of measles in China from 1991 to 2008 was reviewed, and the nucleotide sequences from 1507 measles viruses (MeV) isolated during 1993 to 2008 were phylogenetically analyzed. The results showed that measles epidemics peaked approximately every 3 to 5 years with the range of measles cases detected between 56,850 and 140,048 per year. The Chinese MeV strains represented three genotypes; 1501 H1, 1 H2 and 5 A. Genotype H1 was the predominant genotype throughout China continuously circulating for at least 16 years. Genotype H1 sequences could be divided into two distinct clusters, H1a and H1b. A 4.2% average nucleotide divergence was found between the H1a and H1b clusters, and the nucleotide sequence and predicted amino acid homologies of H1a viruses were 92.3%–100% and 84.7%–100%, H1b were 97.1%–100% and 95.3%–100%, respectively. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Cluster H1a and H1b viruses were co-circulating during 1993 to 2005, while no H1b viruses were detected after 2005 and the transmission of that cluster has presumably been interrupted. Analysis of the nucleotide and predicted amino acid changes in the N proteins of H1a and H1b viruses showed no evidence of selective pressure. This study investigated the genotype and cluster distribution of MeV in China over a 16-year period to establish a genetic baseline before MeV elimination in Western Pacific Region (WPR). Continuous and extensive MeV surveillance and the ability to quickly identify imported cases of measles will become more critical as measles elimination goals are achieved in China in the near future. This is the first report that a single endemic genotype of measles virus has been found to be continuously circulating in one country for at least 16 years. PMID:22532829
Single endemic genotype of measles virus continuously circulating in China for at least 16 years.
Zhang, Yan; Xu, Songtao; Wang, Huiling; Zhu, Zhen; Ji, Yixin; Liu, Chunyu; Zhang, Xiaojie; Sun, Liwei; Zhou, Jianhui; Lu, Peishan; Hu, Ying; Feng, Daxing; Zhang, Zhenying; Wang, Changyin; Fang, Xueqiang; Zheng, Huanying; Liu, Leng; Sun, Xiaodong; Tang, Wei; Wang, Yan; Liu, Yan; Gao, Hui; Tian, Hong; Ma, Jiangtao; Gu, Suyi; Wang, Shuang; Feng, Yan; Bo, Fang; Liu, Jianfeng; Si, Yuan; Zhou, Shujie; Ma, Yuyan; Wu, Shengwei; Zhou, Shunde; Li, Fangcai; Ding, Zhengrong; Yang, Zhaohui; Rota, Paul A; Featherstone, David; Jee, Youngmee; Bellini, William J; Xu, Wenbo
2012-01-01
The incidence of measles in China from 1991 to 2008 was reviewed, and the nucleotide sequences from 1507 measles viruses (MeV) isolated during 1993 to 2008 were phylogenetically analyzed. The results showed that measles epidemics peaked approximately every 3 to 5 years with the range of measles cases detected between 56,850 and 140,048 per year. The Chinese MeV strains represented three genotypes; 1501 H1, 1 H2 and 5 A. Genotype H1 was the predominant genotype throughout China continuously circulating for at least 16 years. Genotype H1 sequences could be divided into two distinct clusters, H1a and H1b. A 4.2% average nucleotide divergence was found between the H1a and H1b clusters, and the nucleotide sequence and predicted amino acid homologies of H1a viruses were 92.3%-100% and 84.7%-100%, H1b were 97.1%-100% and 95.3%-100%, respectively. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Cluster H1a and H1b viruses were co-circulating during 1993 to 2005, while no H1b viruses were detected after 2005 and the transmission of that cluster has presumably been interrupted. Analysis of the nucleotide and predicted amino acid changes in the N proteins of H1a and H1b viruses showed no evidence of selective pressure. This study investigated the genotype and cluster distribution of MeV in China over a 16-year period to establish a genetic baseline before MeV elimination in Western Pacific Region (WPR). Continuous and extensive MeV surveillance and the ability to quickly identify imported cases of measles will become more critical as measles elimination goals are achieved in China in the near future. This is the first report that a single endemic genotype of measles virus has been found to be continuously circulating in one country for at least 16 years.
Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan
2018-01-01
To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.
Analysis of mutational changes at the HLA locus in single human sperm.
Huang, M M; Erlich, H A; Goodman, M F; Arnheim, N
1995-01-01
Using a simple and efficient single sperm PCR and direct sequencing method, we screened for HLA-DPB1 gene mutations that may give rise to new alleles at this highly polymorphic locus. More than 800 single sperm were studied from a heterozygous individual whose two alleles carried 16 nucleotide sequence differences clustered in six polymorphic regions. A potential microgene conversion event was detected. Unrepaired heteroduplex DNA similar to that which gives rise to postmeiotic segregation events in yeast was observed in three cases. Control experiments also revealed unusual sperm from DPB1 homozygous individuals. The data may help explain allelic diversity in the MHC and suggest that a possible source of human mosaicism may be incomplete DNA mismatch repair during gametogenesis.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-07-08
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.
Larsen, Jesper; Soldanova, Katerina; Aziz, Maliha; Contente-Cuomo, Tania; Petersen, Andreas; Vandendriessche, Stien; Jiménez, Judy N.; Mammina, Caterina; van Belkum, Alex; Salmenlinna, Saara; Laurent, Frederic; Skov, Robert L.; Larsen, Anders R.; Andersen, Paal S.; Price, Lance B.
2013-01-01
Staphylococcus aureus clonal complex 398 (CC398) isolates cluster into two distinct phylogenetic clades based on single-nucleotide polymorphisms (SNPs) revealing a basal human clade and a more derived livestock clade. The scn and tet(M) genes are strongly associated with the human and the livestock clade, respectively, due to loss and acquisition of mobile genetic elements. We present canonical single-nucleotide polymorphism (canSNP) assays that differentiate the two major host-associated S. aureus CC398 clades and a duplex PCR assay for detection of scn and tet(M). The canSNP assays correctly placed 88 S. aureus CC398 isolates from a reference collection into the human and livestock clades and the duplex PCR assay correctly identified scn and tet(M). The assays were successfully applied to a geographically diverse collection of 272 human S. aureus CC398 isolates. The simple assays described here generate signals comparable to a whole-genome phylogeny for major clade assignment and are easily integrated into S. aureus CC398 surveillance programs and epidemiological studies. PMID:24244535
Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc
2013-12-01
Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.
Li, Su-Xia
2004-12-01
Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
USDA-ARS?s Scientific Manuscript database
High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...
Kullback-Leibler divergence for detection of rare haplotype common disease association.
Lin, Shili
2015-11-01
Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.
Wang, Geng-Fu; Ye, Sheng; Gao, Lei; Han, Yu; Guo, Xuan; Dong, Xiao-Peng; Su, Yuan-Yuan; Zhang, Xin
2018-05-10
Increasing evidence has revealed that genetic variants in Reelin (RELN) gene, especially single-nucleotide polymorphisms (SNPs), correlate with autistic spectrum disorders (ASD) risk; however, no consensus have been reached. This study aimed to provide additional evidence for the association between two SNPs of RELN (i.e., rs736707, rs2229864) and ASD risk, as well as the relationship between RELN gene and symptom-based and developmental deficits of ASD patients in Chinese Han children and adolescents. 157 ASD subjects and 256 typical development (TD) controls were genotyped by TaqMan® genotyping assay. ASD patients were assessed by Childhood Autism Rating Scale (CARS), Autism Behavior Checklist (ABC), and Early Childhood Development Questionnaire (ECDQ). We found that SNP rs2229864 was associated with the genetic predisposition of ASD, whereas a negative association between SNP rs2229864 and symptom-based and developmental features was detected. In contrast, RELN rs736707 correlated with the sensory subscale of the ABC, the relating subscale of the ABC and the total score of ABC, although we did not detect a significant association between SNP rs736707 and ASD risk. Furthermore, a significant rs736707-rs2229864 haplotype was detected. Individuals with a CC haplotype were more likely to have ASD, but individuals with a CT haplotype had more chance be TD controls. Further studies using more samples and including more gene variants in RELN are warranted to confirm our results. Copyright © 2018 Elsevier B.V. All rights reserved.
Kogelman, Lisette J A; Zhernakova, Daria V; Westra, Harm-Jan; Cirera, Susanna; Fredholm, Merete; Franke, Lude; Kadarmideen, Haja N
2015-10-20
Obesity is a multi-factorial health problem in which genetic factors play an important role. Limited results have been obtained in single-gene studies using either genomic or transcriptomic data. RNA sequencing technology has shown its potential in gaining accurate knowledge about the transcriptome, and may reveal novel genes affecting complex diseases. Integration of genomic and transcriptomic variation (expression quantitative trait loci [eQTL] mapping) has identified causal variants that affect complex diseases. We integrated transcriptomic data from adipose tissue and genomic data from a porcine model to investigate the mechanisms involved in obesity using a systems genetics approach. Using a selective gene expression profiling approach, we selected 36 animals based on a previously created genomic Obesity Index for RNA sequencing of subcutaneous adipose tissue. Differential expression analysis was performed using the Obesity Index as a continuous variable in a linear model. eQTL mapping was then performed to integrate 60 K porcine SNP chip data with the RNA sequencing data. Results were restricted based on genome-wide significant single nucleotide polymorphisms, detected differentially expressed genes, and previously detected co-expressed gene modules. Further data integration was performed by detecting co-expression patterns among eQTLs and integration with protein data. Differential expression analysis of RNA sequencing data revealed 458 differentially expressed genes. The eQTL mapping resulted in 987 cis-eQTLs and 73 trans-eQTLs (false discovery rate < 0.05), of which the cis-eQTLs were associated with metabolic pathways. We reduced the eQTL search space by focusing on differentially expressed and co-expressed genes and disease-associated single nucleotide polymorphisms to detect obesity-related genes and pathways. Building a co-expression network using eQTLs resulted in the detection of a module strongly associated with lipid pathways. Furthermore, we detected several obesity candidate genes, for example, ENPP1, CTSL, and ABHD12B. To our knowledge, this is the first study to perform an integrated genomics and transcriptomics (eQTL) study using, and modeling, genomic and subcutaneous adipose tissue RNA sequencing data on obesity in a porcine model. We detected several pathways and potential causal genes for obesity. Further validation and investigation may reveal their exact function and association with obesity.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N
1995-01-01
Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.
CNG site-specific and methyl-sensitive endonuclease WEN1 from wheat seedlings.
Fedoreyeva, L I; Vanyushin, B F
2011-06-01
Endonuclease WEN1 with apparent molecular mass about 27 kDa isolated from cytoplasmic vesicular fraction of aging coleoptiles of wheat seedlings has expressed site specificity action. This is a first detection and isolation of a site-specific endonuclease from higher eukaryotes, in general, and higher plants, in particular. The enzyme hydrolyzes deoxyribooligonucleotides of different composition on CNG (N is G, A, C, or T) sites by splitting the phosphodiester bond between C and N nucleotide residues in CNG sequence independent from neighbor nucleotide context except for CCCG. WEN1 prefers to hydrolyze methylated λ phage DNA and double-stranded deoxyribooligonucleotides containing 5-methylcytosine sites (m(5)CAG, m(5)CTG) compared with unmethylated substrates. The enzyme is also able to hydrolyze single-stranded substrates, but in this case it splits unmethylated substrates predominantly. Detection in wheat seedlings of WEN1 endonuclease that is site specific, sensitive to the substrate methylation status, and modulated with S-adenosyl-L-methionine indicates that in higher plants restriction--modification systems or some of their elements, at least, may exist.
USDA-ARS?s Scientific Manuscript database
Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...
Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms
USDA-ARS?s Scientific Manuscript database
We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...
USDA-ARS?s Scientific Manuscript database
Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...
USDA-ARS?s Scientific Manuscript database
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...
USDA-ARS?s Scientific Manuscript database
Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Qiu, T; Lu, R H; Zhang, J; Zhu, Z Y
2001-07-01
The complete nucleotide sequence of M6 gene of grass carp hemorrhage virus (GCHV) was determined. It is 2039 nucleotides in length and contains a single large open reading frame that could encode a protein of 648 amino acids with predicted molecular mass of 68.7 kDa. Amino acid sequence comparison revealed that the protein encoded by GCHV M6 is closely related to the protein mu1 of mammalian reovirus. The M6 gene, encoding the major outer-capsid protein, was expressed using the pET fusion protein vector in Escherichia coli and detected by Western blotting using chicken anti-GCHV immunoglobulin (IgY). The result indicates that the protein encoded by M6 may share a putative Asn-42-Pro-43 proteolytic cleavage site with mu1.
Zhang, Genxi; Ding, Fuxiang; Wang, Jinyu; Dai, Guojun; Xie, Kaizhou; Zhang, Lijun; Wang, Wei; Zhou, Shenghua
2011-02-01
In our research, single nucleotide polymorphisms (SNPs) of exon regions of the myostatin gene were detected by PCR-SSCP in the Bian chicken and three reference chicken populations (Jinghai, Youxi, and Arbor Acre). Four novel SNPs (G2283A, C7552T, C7638T, and T7661A) were detected. The findings from the least square means showed that Bian chickens with EE and DE genotypes had significantly higher body weight, at 6-18 weeks of age, than those of the DD genotype (P < 0.05). The results suggest that the mutation G2283A, detected in exon 1, has potential as a genetic marker for body weight traits in the Bian chicken.
Randles, Lucy G; Dawes, Gwen J S; Wensley, Beth G; Steward, Annette; Nickson, Adrian A; Clarke, Jane
2013-01-01
Studying the effects of pathogenic mutations is more complex in multidomain proteins when compared with single domains: mutations occurring at domain boundaries may have a large effect on a neighbouring domain that will not be detected in a single-domain system. To demonstrate this, we present a study that utilizes well-characterized model protein domains from human spectrin to investigate the effect of disease-and non-disease-causing single point mutations occurring at the boundaries of human spectrin repeats. Our results show that mutations in the single domains have no clear correlation with stability and disease; however, when studied in a tandem model system, the disease-causing mutations are shown to disrupt stabilizing interactions that exist between domains. This results in a much larger decrease in stability than would otherwise have been predicted, and demonstrates the importance of studying such mutations in the correct protein context. PMID:23241237
Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco
2014-01-01
The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537
Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C
2002-11-01
We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.
Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.
Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L
2017-10-06
Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
Atrial Fibrillation Genetic Risk and Ischemic Stroke Mechanisms.
Lubitz, Steven A; Parsons, Owen E; Anderson, Christopher D; Benjamin, Emelia J; Malik, Rainer; Weng, Lu-Chen; Dichgans, Martin; Sudlow, Cathie L; Rothwell, Peter M; Rosand, Jonathan; Ellinor, Patrick T; Markus, Hugh S; Traylor, Matthew
2017-06-01
Atrial fibrillation (AF) is a leading cause of cardioembolic stroke, but the relationship between AF and noncardioembolic stroke subtypes are unclear. Because AF may be unrecognized, and because AF has a substantial genetic basis, we assessed for predisposition to AF across ischemic stroke subtypes. We examined associations between AF genetic risk and Trial of Org 10172 in Acute Stroke Treatment stroke subtypes in 2374 ambulatory individuals with ischemic stroke and 5175 without from the Wellcome Trust Case-Control Consortium 2 using logistic regression. We calculated AF genetic risk scores using single-nucleotide polymorphisms associated with AF in a previous independent analysis across a range of preselected significance thresholds. There were 460 (19.4%) individuals with cardioembolic stroke, 498 (21.0%) with large vessel, 474 (20.0%) with small vessel, and 814 (32.3%) individuals with strokes of undetermined cause. Most AF genetic risk scores were associated with stroke, with the strongest association ( P =6×10 - 4 ) attributed to scores of 944 single-nucleotide polymorphisms (each associated with AF at P <1×10 - 3 in a previous analysis). Associations between AF genetic risk and stroke were enriched in the cardioembolic stroke subset (strongest P =1.2×10 - 9 , 944 single-nucleotide polymorphism score). In contrast, AF genetic risk was not significantly associated with noncardioembolic stroke subtypes. Comprehensive AF genetic risk scores were specific for cardioembolic stroke. Incomplete workups and subtype misclassification may have limited the power to detect associations with strokes of undetermined pathogenesis. Future studies are warranted to determine whether AF genetic risk is a useful biomarker to enhance clinical discrimination of stroke pathogeneses. © 2017 American Heart Association, Inc.
Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P
2016-06-01
We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.
2012-01-01
Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373
Base pair mismatch recognition using plasmon resonant particle labels.
Oldenburg, Steven J; Genick, Christine C; Clark, Keith A; Schultz, David A
2002-10-01
We demonstrate the use of silver plasmon resonant particles (PRPs), as reporter labels, in a microarray-based DNA hybridization assay in which we screen for a known polymorphic site in the breast cancer gene BRCA1. PRPs (40-100 nm in diameter) image as diffraction-limited points of colored light in a standard microscope equipped with dark-field illumination, and can be individually identified and discriminated against background scatter. Rather than overall intensity, the number of PRPs counted in a CCD image by a software algorithm serves as the signal in these assays. In a typical PRP hybridization assay, we achieve a detection sensitivity that is approximately 60 x greater than that achieved by using fluorescent labels. We conclude that single particle counting is robust, generally applicable to a wide variety of assay platforms, and can be integrated into low-cost and quantitative detection systems for single nucleotide polymorphism analysis.
USDA-ARS?s Scientific Manuscript database
The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...
USDA-ARS?s Scientific Manuscript database
Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...
USDA-ARS?s Scientific Manuscript database
Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...
Prospects for inferring pairwise relationships with single nucleotide polymorphisms
Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody
2003-01-01
An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...
USDA-ARS?s Scientific Manuscript database
Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...
USDA-ARS?s Scientific Manuscript database
Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...
Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu
2016-04-01
Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
Prince, Silvas J; Valliyodan, Babu; Ye, Heng; Yang, Ming; Tai, Shuaishuai; Hu, Wushu; Murphy, Mackensie; Durnell, Lorellin A; Song, Li; Joshi, Trupti; Liu, Yang; Van de Velde, Jan; Vandepoele, Klaas; Grover Shannon, J; Nguyen, Henry T
2018-05-10
Developing crops with better root systems is a promising strategy to ensure productivity in both optimum and stress environments. Root system architectural (RSA) traits in 397 soybean accessions were characterized and a high-density single nucleotide polymorphisms (SNP) based genome-wide association study was performed to identify the underlying genes associated with root structure. SNPs associated with root architectural traits specific to landraces and elite germplasm pools were detected. Four loci were detected in landraces for lateral root number (LRN) and distribution of root thickness in diameter class I with a major locus on chromosome 16. This major loci was detected in the coding region of unknown protein, and subsequent analyses demonstrated that root traits are affected with mutated haplotypes of the gene. In elite germplasm pool, three significant SNPs in alanine-glyoxalate aminotransferase, Leucine-Rich Repeat receptor/No apical meristem and unknown functional genes were found to govern multiple traits including root surface area and volume. However, no major loci were detected for LRN in elite germplasm. Nucleotide diversity analysis found evidence of selective sweeps around the landraces LRN gene. Soybean accessions with minor and mutated allelic variants of LRN gene were found to perform better in both water-limited and optimal field conditions. This article is protected by copyright. All rights reserved.
Murray, James L; Hu, Peixu; Shafer, David A
2014-11-01
We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-11-01
Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.
Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-01-01
Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242
Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição
2013-01-01
The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785
Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu
2014-01-01
Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287
Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang
2014-01-01
A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528
Becságh, Péter; Szakács, Orsolya
2014-10-01
During diagnostic workflow when detecting sequence alterations, sometimes it is important to design an algorithm that includes screening and direct tests in combination. Normally the use of direct test, which is mainly sequencing, is limited. There is an increased need for effective screening tests, with "closed tube" during the whole process and therefore decreasing the risk of PCR product contamination. The aim of this study was to design such a closed tube, detection probe based screening assay to detect different kind of sequence alterations in the exon 11 of the human c-kit gene region. Inside this region there are variable possible deletions and single nucleotide changes. During assay setup, more probe chemistry formats were screened and tested. After some optimization steps the taqman probe format was selected.
Noninvasive Prenatal Diagnosis of Single-Gene Disorders by Use of Droplet Digital PCR.
Camunas-Soler, Joan; Lee, Hojae; Hudgins, Louanne; Hintz, Susan R; Blumenfeld, Yair J; El-Sayed, Yasser Y; Quake, Stephen R
2018-02-01
Prenatal diagnosis in pregnancies at risk of single-gene disorders is currently performed using invasive methods such as chorionic villus sampling and amniocentesis. This is in contrast with screening for common aneuploidies, for which noninvasive methods with a single maternal blood sample have become standard clinical practice. We developed a protocol for noninvasive prenatal diagnosis of inherited single-gene disorders using droplet digital PCR from circulating cell-free DNA (cfDNA) in maternal plasma. First, the amount of cfDNA and fetal fraction is determined using a panel of TaqMan assays targeting high-variability single-nucleotide polymorphisms. Second, the ratio of healthy and diseased alleles in maternal plasma is quantified using TaqMan assays targeting the mutations carried by the parents. Two validation approaches of the mutation assay are presented. We collected blood samples from 9 pregnancies at risk for different single-gene disorders, including common conditions and rare metabolic disorders. We measured cases at risk of hemophilia, ornithine transcarbamylase deficiency, cystic fibrosis, β-thalassemia, mevalonate kinase deficiency, acetylcholine receptor deficiency, and DFNB1 nonsyndromic hearing loss. We correctly differentiated affected and unaffected pregnancies (2 affected, 7 unaffected), confirmed by neonatal testing. We successfully measured an affected pregnancy as early as week 11 and with a fetal fraction as low as 3.7% (0.3). Our method detects single-nucleotide mutations of autosomal recessive diseases as early as the first trimester of pregnancy. This is of importance for metabolic disorders in which early diagnosis can affect management of the disease and reduce complications and anxiety related to invasive testing. © 2017 American Association for Clinical Chemistry.
Avci, Oguzhan; Lortlar Ünlü, Nese; Yalçın Özkumur, Ayça; Ünlü, M. Selim
2015-01-01
Over the last decade, the growing need in disease diagnostics has stimulated rapid development of new technologies with unprecedented capabilities. Recent emerging infectious diseases and epidemics have revealed the shortcomings of existing diagnostics tools, and the necessity for further improvements. Optical biosensors can lay the foundations for future generation diagnostics by providing means to detect biomarkers in a highly sensitive, specific, quantitative and multiplexed fashion. Here, we review an optical sensing technology, Interferometric Reflectance Imaging Sensor (IRIS), and the relevant features of this multifunctional platform for quantitative, label-free and dynamic detection. We discuss two distinct modalities for IRIS: (i) low-magnification (ensemble biomolecular mass measurements) and (ii) high-magnification (digital detection of individual nanoparticles) along with their applications, including label-free detection of multiplexed protein chips, measurement of single nucleotide polymorphism, quantification of transcription factor DNA binding, and high sensitivity digital sensing and characterization of nanoparticles and viruses. PMID:26205273
NASA Astrophysics Data System (ADS)
Herron, James N.; Tolley, Samuel E.; Smith, Richard; Christensen, Douglas A.
2006-02-01
Personalized medicine is an emerging field in which clinical diagnostics information about a patient's genotype or phenotype is used to optimize his/her pharmacotherapy. This article evaluates whether planar waveguide fluorescent sensors are suitable for determining such information from patient testing in point-of-care (POC) settings. The model system was Long QT Syndrome, a congenital disease associated with single nucleotide polymorphisms (SNPs) in genes encoding for cardiac ion channels. Three different SNP assay formats were examined: DNA/DNA hybridization, DNA/PNA hybridization (PNA: "peptide nucleic acid"), and single base extension (SBEX). Although DNA/DNA hybridization produced a strong intensity-time response for both wildtype and SNP analytes in a 5-min assay at 32°C, their hybridization rates differed by only 32.7%, which was insufficient for clinical decision-making. Much better differentiation of the two rates was observed at 53°C, where the wildtype's hybridization rate was two-thirds of its maximum value, while that of the SNP was essentially zero. Such all-or-nothing resolution would be adequate for clinical decision-making; however, the elevated temperature and precise temperature control would be hard to achieve in a POC setting. Results from DNA/PNA hybridization studies were more promising. Nearly 20-fold discrimination between wildtype and SNP hybridization rates was observed in a 5-min assay at 30°C, although the low ionic strength conditions required necessitated a de-salting step between sample preparation and SNP detection. SBEX was the most promising of the three, determining the absolute identity of the suspected polymorphism in a 5-min assay at 40°C.
Song, Yajun; Roumagnac, Philippe; Weill, François-Xavier; Wain, John; Dolecek, Christiane; Mazzoni, Camila J.; Holt, Kathryn E.; Achtman, Mark
2010-01-01
Objectives Decreased susceptibility to fluoroquinolones has become a major problem for the successful therapy of human infections caused by Salmonella enterica, especially the life-threatening typhoid and paratyphoid fevers. Methods By using Luminex xTAG beads, we developed a rapid, reliable and cost-effective multiplexed genotyping assay for simultaneously detecting 11 mutations in gyrA, gyrB and parE of S. enterica serovars Typhi and Paratyphi A that result in nalidixic acid resistance (NalR) and/or decreased susceptibility to fluoroquinolones. Results This assay yielded unambiguous single nucleotide polymorphism calls on extracted DNA from 292 isolates of Salmonella Typhi (NalR = 223 and NalS = 69) and 106 isolates of Salmonella Paratyphi A (NalR = 24 and NalS = 82). All of the 247 NalR Salmonella Typhi and Salmonella Paratyphi A isolates were found to harbour at least one of the target mutations, with GyrA Phe-83 as the most common one (143/223 for Salmonella Typhi and 18/24 for Salmonella Paratyphi A). We also identified three GyrB mutations in eight NalS Salmonella Typhi isolates (six for GyrB Phe-464, one for GyrB Leu-465 and one for GyrB Asp-466), and mutations GyrB Phe-464 and GyrB Asp-466 seem to be related to the decreased ciprofloxacin susceptibility phenotype in Salmonella Typhi. This assay can also be used directly on boiled single colonies. Conclusions The assay presented here would be useful for clinical and reference laboratories to rapidly screen quinolone-resistant isolates of Salmonella Typhi and Salmonella Paratyphi A, and decipher the underlying genetic changes for epidemiological purposes. PMID:20511368
Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.
2007-01-01
Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309
2012-01-01
Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801
Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen
2012-05-14
High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.
Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder
ERIC Educational Resources Information Center
Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.
2012-01-01
Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…
USDA-ARS?s Scientific Manuscript database
Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...
USDA-ARS?s Scientific Manuscript database
Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent
2012-05-01
Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.
Kim, So Young; Kim, Ah Reum; Kim, Nayoung K. D.; Lee, Chung; Kim, Min Young; Jeon, Eun-Hee; Park, Woong-Yang; Choi, Byung Yoon
2016-01-01
Abstract The molecular etiology of nonsyndromic sensorineural hearing loss (SNHL) in subjects with only one detectable autosomal recessive GJB2 mutation is unclear. Here, we report GJB2 single heterozygotes with various final genetic diagnoses and suggest appropriate diagnostic strategies. A total of 160 subjects with SNHL without phenotypic markers were screened for GJB2 mutations. Single-nucleotide variants or structural variations within the DFNB1 locus or in other deafness genes were examined by Sanger sequencing, breakpoint PCR, and targeted exome sequencing (TES) of 129 deafness genes. We identified 27 subjects with two mutations and 10 subjects with only one detectable mutation in GJB2. The detection rate of the single GJB2 mutation among the 160 SNHL subjects in the present study (6.25%) was higher than 2.58% in normal hearing controls in Korean. The DFNB1 was clearly excluded as a molecular etiology in four (40%) subjects: other recessive deafness genes (N = 3) accounted for SNHL and the causative gene for the other non-DFNB1 subject (N = 1) was not identified. The etiology of additional two subjects was potentially explained by digenic etiology (N = 2) of GJB2 with MITF and GJB3, respectively. The contribution of the single GJB2 mutation in the four remaining subjects is unclear. Comprehensive diagnostic testing including TES is prerequisite for understanding GJB2 single heterozygotes. PMID:27057829
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Bernacka-Wojcik, Iwona; Águas, Hugo; Carlos, Fabio Ferreira; Lopes, Paulo; Wojcik, Pawel Jerzy; Costa, Mafalda Nascimento; Veigas, Bruno; Igreja, Rui; Fortunato, Elvira; Baptista, Pedro Viana; Martins, Rodrigo
2015-06-01
The use of microfluidics platforms combined with the optimal optical properties of gold nanoparticles has found plenty of application in molecular biosensing. This paper describes a bio-microfluidic platform coupled to a non-cross-linking colorimetric gold nanoprobe assay to detect a single nucleotide polymorphism associated with increased risk of obesity fat-mass and obesity-associated (FTO) rs9939609 (Carlos et al., 2014). The system enabled significant discrimination between positive and negative assays using a target DNA concentration of 5 ng/µL below the limit of detection of the conventionally used microplate reader (i.e., 15 ng/µL) with 10 times lower solution volume (i.e., 3 µL). A set of optimization of our previously reported bio-microfluidic platform (Bernacka-Wojcik et al., 2013) resulted in a 160% improvement of colorimetric analysis results. Incorporation of planar microlenses increased 6 times signal-to-loss ratio reaching the output optical fiber improving by 34% the colorimetric analysis of gold nanoparticles, while the implementation of an optoelectronic acquisition system yielded increased accuracy and reduced noise. The microfluidic chip was also integrated with a miniature fiber spectrometer to analyze the assays' colorimetric changes and also the LEDs transmission spectra when illuminating through various solutions. Furthermore, by coupling an optical microscope to a digital camera with a long exposure time (30 s), we could visualise the different scatter intensities of gold nanoparticles within channels following salt addition. These intensities correlate well to the expected difference in aggregation between FTO positive (none to small aggregates) and negative samples (large aggregates). © 2015 Wiley Periodicals, Inc.
Walther, Dirk; Bartha, Gábor; Morris, Macdonald
2001-01-01
A pivotal step in electrophoresis sequencing is the conversion of the raw, continuous chromatogram data into the actual sequence of discrete nucleotides, a process referred to as basecalling. We describe a novel algorithm for basecalling implemented in the program LifeTrace. Like Phred, currently the most widely used basecalling software program, LifeTrace takes processed trace data as input. It was designed to be tolerant to variable peak spacing by means of an improved peak-detection algorithm that emphasizes local chromatogram information over global properties. LifeTrace is shown to generate high-quality basecalls and reliable quality scores. It proved particularly effective when applied to MegaBACE capillary sequencing machines. In a benchmark test of 8372 dye-primer MegaBACE chromatograms, LifeTrace generated 17% fewer substitution errors, 16% fewer insertion/deletion errors, and 2.4% more aligned bases to the finished sequence than did Phred. For two sets totaling 6624 dye-terminator chromatograms, the performance improvement was 15% fewer substitution errors, 10% fewer insertion/deletion errors, and 2.1% more aligned bases. The processing time required by LifeTrace is comparable to that of Phred. The predicted quality scores were in line with observed quality scores, permitting direct use for quality clipping and in silico single nucleotide polymorphism (SNP) detection. Furthermore, we introduce a new type of quality score associated with every basecall: the gap-quality. It estimates the probability of a deletion error between the current and the following basecall. This additional quality score improves detection of single basepair deletions when used for locating potential basecalling errors during the alignment. We also describe a new protocol for benchmarking that we believe better discerns basecaller performance differences than methods previously published. PMID:11337481
Zhao, Linlu; Bracken, Michael B.; DeWan, Andrew T.
2013-01-01
Summary A genome-wide association study was undertaken to identify maternal single nucleotide polymorphisms (SNPs) and copy-number variants (CNVs) associated with preeclampsia. Case-control analysis was performed on 1070 Afro-Caribbean (n=21 cases and 1049 controls) and 723 Hispanic (n=62 cases and 661 controls) mothers and 1257 mothers of European ancestry (n=50 cases and 1207 controls) from the Hyperglycemia and Adverse Pregnancy Outcome (HAPO) study. European ancestry subjects were genotyped on Illumina Human610-Quad and Afro-Caribbean and Hispanic subjects were genotyped on Illumina Human1M-Duo BeadChip microarrays. Genome-wide SNP data were analyzed using PLINK. CNVs were called using three detection algorithms (GNOSIS, PennCNV, and QuantiSNP), merged using CNVision, and then screened using stringent criteria. SNP and CNV findings were compared to those of the Study of Pregnancy Hypertension in Iowa (SOPHIA), an independent preeclampsia case-control dataset of Caucasian mothers (n=177 cases and 116 controls). A list of top SNPs were identified for each of the HAPO ethnic groups, but none reached Bonferroni-corrected significance. Novel candidate CNVs showing enrichment among preeclampsia cases were also identified in each of the three ethnic groups. Several variants were suggestively replicated in SOPHIA. The discovered SNPs and copy-number variable regions present interesting candidate genetic variants for preeclampsia that warrant further replication and investigation. PMID:23551011
Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis
Pucholt, Pascal; Wright, Alison E.; Conze, Lei Liu; Mank, Judith E.; Berlin, Sofia
2017-01-01
Abstract Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. PMID:28453634
Schmidt, Liesbeth M; Mouton, Laurence; Nong, Guang; Ebert, Dieter; Preston, James F
2008-01-01
Pasteuria penetrans, an obligate endospore-forming parasite of Meloidogyne spp. (root knot nematodes), has been identified as a promising agent for biocontrol of these destructive agricultural crop pests. Pasteuria ramosa, an obligate parasite of water fleas (Daphnia spp.), has been shown to modulate cladoceran populations in natural ecosystems. Selected sporulation genes and an epitope associated with the spore envelope of these related species were compared. The sigE and spoIIAA/spoIIAB genes differentiate the two species to a greater extent than 16S rRNA and may serve as probes to differentiate the species. Single-nucleotide variations were observed in several conserved genes of five distinct populations of P. ramosa, and while most of these variations are silent single-nucleotide polymorphisms, a few result in conservative amino acid substitutions. A monoclonal antibody directed against an adhesin epitope present on P. penetrans P20 endospores, previously determined to be specific for Pasteuria spp. associated with several phytopathogenic nematodes, also detects an epitope associated with P. ramosa endospores. Immunoblotting provided patterns that differentiate P. ramosa from other Pasteuria spp. This monoclonal antibody thus provides a probe with which to detect and discriminate endospores of different Pasteuria spp. The presence of a shared adhesin epitope in two species with such ecologically distant hosts suggests that there is an ancient and ecologically significant recognition process in these endospore-forming bacilli that contributes to the virulence of both species in their respective hosts.
Schmidt, Liesbeth M.; Mouton, Laurence; Nong, Guang; Ebert, Dieter; Preston, James F.
2008-01-01
Pasteuria penetrans, an obligate endospore-forming parasite of Meloidogyne spp. (root knot nematodes), has been identified as a promising agent for biocontrol of these destructive agricultural crop pests. Pasteuria ramosa, an obligate parasite of water fleas (Daphnia spp.), has been shown to modulate cladoceran populations in natural ecosystems. Selected sporulation genes and an epitope associated with the spore envelope of these related species were compared. The sigE and spoIIAA/spoIIAB genes differentiate the two species to a greater extent than 16S rRNA and may serve as probes to differentiate the species. Single-nucleotide variations were observed in several conserved genes of five distinct populations of P. ramosa, and while most of these variations are silent single-nucleotide polymorphisms, a few result in conservative amino acid substitutions. A monoclonal antibody directed against an adhesin epitope present on P. penetrans P20 endospores, previously determined to be specific for Pasteuria spp. associated with several phytopathogenic nematodes, also detects an epitope associated with P. ramosa endospores. Immunoblotting provided patterns that differentiate P. ramosa from other Pasteuria spp. This monoclonal antibody thus provides a probe with which to detect and discriminate endospores of different Pasteuria spp. The presence of a shared adhesin epitope in two species with such ecologically distant hosts suggests that there is an ancient and ecologically significant recognition process in these endospore-forming bacilli that contributes to the virulence of both species in their respective hosts. PMID:17933927
Holland, Heidrun; Ahnert, Peter; Koschny, Ronald; Kirsten, Holger; Bauer, Manfred; Schober, Ralf; Meixensberger, Jürgen; Fritzsch, Dominik; Krupp, Wolfgang
2012-06-15
Astrocytomas represent the largest and most common subgroup of brain tumors. Anaplastic astrocytoma (WHO grade III) may arise from low-grade diffuse astrocytoma (WHO grade II) or as primary tumors without any precursor lesion. Comprehensive analyses of anaplastic astrocytomas combining both cytogenetic and molecular cytogenetic techniques are rare. Therefore, we analyzed genomic alterations of five anaplastic astrocytomas using high-density single nucleotide polymorphism arrays combined with GTG-banding and FISH-techniques. By cytogenetics, we found 169 structural chromosomal aberrations most frequently involving chromosomes 1, 2, 3, 4, 10, and 12, including two not previously described alterations, a nonreciprocal translocation t(3;11)(p12;q13), and one interstitial chromosomal deletion del(2)(q21q31). Additionally, we detected previously not documented loss of heterozygosity (LOH) without copy number changes in 4/5 anaplastic astrocytomas on chromosome regions 5q11.2, 5q22.1, 6q21, 7q21.11, 7q31.33, 8q11.22, 14q21.1, 17q21.31, and 17q22, suggesting segmental uniparental disomy (UPD), applying high-density single nucleotide polymorphism arrays. UPDs are currently considered to play an important role in the initiation and progression of different malignancies. The significance of previously not described genetic alterations in anaplastic astrocytomas presented here needs to be confirmed in a larger series. Copyright © 2012 Elsevier GmbH. All rights reserved.
Volkán-Kacsó, Sándor; Marcus, Rudolph A
2016-10-25
A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.
Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo
2012-01-01
Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.
[Identification of single nucleotide polymorphisms related to frailty].
Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José
2018-04-07
The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.
Børsting, Claus; Morling, Niels
2012-02-01
In some relationship cases, the initial investigations of autosomal short tandem repeats (STRs) lead to an ambiguous conclusion and supplementary investigations become necessary. Six unusual paternity cases were previously investigated by other researchers and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. Three cases were solved by the SNP investigation without the need for any additional testing. In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. The case work examples underline the importance of performing supplementary investigations, and they advocate for the implementation of several panels that may be used in the highly unusual cases. Panels with SNPs or other markers with low mutation probabilities are preferable as supplementary markers, because the risk of detecting (additional) mutations is very low. © 2012 American Association of Blood Banks.
Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G
2015-02-07
The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.
The Single Nucleotide Polymorphism Consortium
NASA Technical Reports Server (NTRS)
Morgan, Michael
2003-01-01
I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
USDA-ARS?s Scientific Manuscript database
The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...
Winterhagen, Patrick; Wünsche, Jens-Norbert
2016-05-01
Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.
Differential detection of pathogenic Yersinia spp. by fluorescence in situ hybridization.
Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha
2017-04-01
Yersinia enterocolitica, Y. pseudotuberculosis and Y. pestis are pathogens of major medical importance, which are responsible for a considerable number of infections every year. The detection of these species still relies on cultural methods, which are slow, labour intensive and often hampered by the presence of high amounts of accompanying flora. In this study, fluorescence in situ hybridization (FISH) was used to develop a fast, sensitive and reliable alternative to detect viable bacteria in food. For this purpose, highly specific probes targeting the 16S and 23S ribosomal RNA were employed to differentially detect each of the three species. In order to enable the differentiation of single nucleotide polymorphisms (SNPs), suitable competitor oligonucleotides and locked nucleic acids (LNAs) were used. Starved cells still showed a strong signal and a direct viable count (DVC) approach combined with FISH optimized live/dead discrimination. Sensitivity of the FISH test was high and even a single cell per gram of spiked minced pork meat could be detected within a day, demonstrating the applicability to identify foodborne hazards at an early stage. In conclusion, the established FISH tests proved to be promising tools to compensate existing drawbacks of the conventional cultural detection of these important zoonotic agents. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923
Purine metabolism in Toxoplasma gondii
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krug, E.C.; Marr, J.J.; Berens, R.L.
1989-06-25
We have studied the incorporation and interconversion of purines into nucleotides by freshly isolated Toxoplasma gondii. They did not synthesize nucleotides from formate, glycine, or serine. The purine bases hypoxanthine, xanthine, guanine, and adenine were incorporated at 9.2, 6.2, 5.1, and 4.3 pmol/10(7) cells/h, respectively. The purine nucleosides adenosine, inosine, guanosine, and xanthosine were incorporated at 110, 9.0, 2.7, and 0.3 pmol/10(7) cells/h, respectively. Guanine, xanthine, and their respective nucleosides labeled only guanine nucleotides. Inosine, hypoxanthine, and adenine labeled both adenine and guanine nucleotide pools at nearly equal ratios. Adenosine kinase was greater than 10-fold more active than the nextmore » most active enzyme in vitro. This is consistent with the metabolic data in vivo. No other nucleoside kinase or phosphotransferase activities were found. Phosphorylase activities were detected for guanosine and inosine; no other cleavage activities were detected. Deaminases were found for adenine and guanine. Phosphoribosyltransferase activities were detected for all four purine nucleobases. Interconversion occurs only in the direction of adenine to guanine nucleotides.« less
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Dong, Chongmei; Vincent, Kate; Sharp, Peter
2009-12-04
TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here is a useful alternative to locus-specific based methods for screening mutations in conserved functional domains of homoeologous genes. This method can also be used for SNP (single nucleotide polymorphism) marker development and eco-TILLING in polyploid species.
DNA biosensors implemented on PNA-functionalized microstructured optical fibers Bragg gratings
NASA Astrophysics Data System (ADS)
Candiani, A.; Giannetti, S.; Cucinotta, A.; Bertucci, A.; Manicardi, A.; Konstantaki, M.; Margulis, W.; Pissadakis, S.; Corradini, R.; Selleri, S.
2013-05-01
A novel DNA sensing platform based on a Peptide Nucleic Acid - functionalized Microstructured Optical Fibers gratings has been demonstrated. The inner surface of different MOFs has been functionalized using PNA probes, OligoNucleotides mimic that are well suited for specific DNA target sequences detection. The hybrid sensing systems were tested for optical DNA detection of targets of relevance in biomedical application, using the cystic fibrosis gene mutation, and food-analysis, using the genomic DNA from genetic modified organism soy flour. After the solutions of DNA molecules has been infiltrated inside the fibers capillaries and hybridization has occurred, oligonucleotidefunctionalized gold nanoparticles were infiltrated and used to form a sandwich-like system to achieve signal amplification. Spectral measurements of the reflected signal reveal a clear wavelength shift of the reflected modes when the infiltrated complementary DNA matches with the PNA probes placed on the inner fiber surface. Measurements have also been made using the mismatched DNA solution for the c, containing a single nucleotide polymorphism, showing no significant changes in the reflected spectrum. Several experiments have been carried out demonstrating the reproducibility of the results and the high selectivity of the sensors, showing the simplicity and the potential of this approach.
High density DNA microarrays: algorithms and biomedical applications.
Liu, Wei-Min
2004-08-01
DNA microarrays are devices capable of detecting the identity and abundance of numerous DNA or RNA segments in samples. They are used for analyzing gene expressions, identifying genetic markers and detecting mutations on a genomic scale. The fundamental chemical mechanism of DNA microarrays is the hybridization between probes and targets due to the hydrogen bonds of nucleotide base pairing. Since the cross hybridization is inevitable, and probes or targets may form undesirable secondary or tertiary structures, the microarray data contain noise and depend on experimental conditions. It is crucial to apply proper statistical algorithms to obtain useful signals from noisy data. After we obtained the signals of a large amount of probes, we need to derive the biomedical information such as the existence of a transcript in a cell, the difference of expression levels of a gene in multiple samples, and the type of a genetic marker. Furthermore, after the expression levels of thousands of genes or the genotypes of thousands of single nucleotide polymorphisms are determined, it is usually important to find a small number of genes or markers that are related to a disease, individual reactions to drugs, or other phenotypes. All these applications need careful data analyses and reliable algorithms.
Li, Feng; Kitashiba, Hiroyasu; Inaba, Kiyofumi; Nishio, Takeshi
2009-01-01
For identification of genes responsible for varietal differences in flowering time and leaf morphological traits, we constructed a linkage map of Brassica rapa DNA markers including 170 EST-based markers, 12 SSR markers, and 59 BAC sequence-based markers, of which 151 are single nucleotide polymorphism (SNP) markers. By BLASTN, 223 markers were shown to have homologous regions in Arabidopsis thaliana, and these homologous loci covered nearly the whole genome of A. thaliana. Synteny analysis between B. rapa and A. thaliana revealed 33 large syntenic regions. Three quantitative trait loci (QTLs) for flowering time were detected. BrFLC1 and BrFLC2 were linked to the QTLs for bolting time, budding time, and flowering time. Three SNPs in the promoter, which may be the cause of low expression of BrFLC2 in the early-flowering parental line, were identified. For leaf lobe depth and leaf hairiness, one major QTL corresponding to a syntenic region containing GIBBERELLIN 20 OXIDASE 3 and one major QTL containing BrGL1, respectively, were detected. Analysis of nucleotide sequences and expression of these genes suggested possible involvement of these genes in leaf morphological traits. PMID:19884167
Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann
2004-11-01
Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.
Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo
2017-01-01
A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.
Chuang, Li-Yeh; Moi, Sin-Hua; Lin, Yu-Da; Yang, Cheng-Hong
2016-10-01
Evolutionary algorithms could overcome the computational limitations for the statistical evaluation of large datasets for high-order single nucleotide polymorphism (SNP) barcodes. Previous studies have proposed several chaotic particle swarm optimization (CPSO) methods to detect SNP barcodes for disease analysis (e.g., for breast cancer and chronic diseases). This work evaluated additional chaotic maps combined with the particle swarm optimization (PSO) method to detect SNP barcodes using a high-dimensional dataset. Nine chaotic maps were used to improve PSO method results and compared the searching ability amongst all CPSO methods. The XOR and ZZ disease models were used to compare all chaotic maps combined with PSO method. Efficacy evaluations of CPSO methods were based on statistical values from the chi-square test (χ 2 ). The results showed that chaotic maps could improve the searching ability of PSO method when population are trapped in the local optimum. The minor allele frequency (MAF) indicated that, amongst all CPSO methods, the numbers of SNPs, sample size, and the highest χ 2 value in all datasets were found in the Sinai chaotic map combined with PSO method. We used the simple linear regression results of the gbest values in all generations to compare the all methods. Sinai chaotic map combined with PSO method provided the highest β values (β≥0.32 in XOR disease model and β≥0.04 in ZZ disease model) and the significant p-value (p-value<0.001 in both the XOR and ZZ disease models). The Sinai chaotic map was found to effectively enhance the fitness values (χ 2 ) of PSO method, indicating that the Sinai chaotic map combined with PSO method is more effective at detecting potential SNP barcodes in both the XOR and ZZ disease models. Copyright © 2016 Elsevier B.V. All rights reserved.
Chatzidimopoulos, Michael; Ganopoulos, Ioannis; Vellios, Evangelos; Madesis, Panagiotis; Tsaftaris, Athanasios; Pappas, Athanassios C
2014-11-01
A rapid, high-resolution melting (HRM) analysis protocol was developed to detect sequence variations associated with resistance to the QoIs, benzimidazoles and dicarboximides in Botrytis cinerea airborne inoculum. HRM analysis was applied directly in fungal DNA collected from air samplers with selective medium. Three and five different genotypes were detected and classified according to their melting profiles in BenA and bos1 genes associated with resistance to benzimidazoles and dicarboximides, respectively. The sensitivity of the methodology was evident in the case of the QoIs, where genotypes varying either by a single nucleotide polymorphism or an additional 1205-bp intron were separated accurately with a single pair of primers. The developed two-step protocol was completed in 82 min and showed reduced variation in the melting curves' formation. HRM analysis rapidly detected the major mutations found in greenhouse strains providing accurate data for successfully controlling grey mould. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Wen, Bo; Xu, Shaohang; Sheynkman, Gloria M; Feng, Qiang; Lin, Liang; Wang, Quanhui; Xu, Xun; Wang, Jun; Liu, Siqi
2014-11-01
Single nucleotide variations (SNVs) located within a reading frame can result in single amino acid polymorphisms (SAPs), leading to alteration of the corresponding amino acid sequence as well as function of a protein. Accurate detection of SAPs is an important issue in proteomic analysis at the experimental and bioinformatic level. Herein, we present sapFinder, an R software package, for detection of the variant peptides based on tandem mass spectrometry (MS/MS)-based proteomics data. This package automates the construction of variation-associated databases from public SNV repositories or sample-specific next-generation sequencing (NGS) data and the identification of SAPs through database searching, post-processing and generation of HTML-based report with visualized interface. sapFinder is implemented as a Bioconductor package in R. The package and the vignette can be downloaded at http://bioconductor.org/packages/devel/bioc/html/sapFinder.html and are provided under a GPL-2 license. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Molecular spectrum of somaclonal variation in regenerated rice revealed by whole-genome sequencing.
Miyao, Akio; Nakagome, Mariko; Ohnuma, Takako; Yamagata, Harumi; Kanamori, Hiroyuki; Katayose, Yuichi; Takahashi, Akira; Matsumoto, Takashi; Hirochika, Hirohiko
2012-01-01
Somaclonal variation is a phenomenon that results in the phenotypic variation of plants regenerated from cell culture. One of the causes of somaclonal variation in rice is the transposition of retrotransposons. However, many aspects of the mechanisms that result in somaclonal variation remain undefined. To detect genome-wide changes in regenerated rice, we analyzed the whole-genome sequences of three plants independently regenerated from cultured cells originating from a single seed stock. Many single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) were detected in the genomes of the regenerated plants. The transposition of only Tos17 among 43 transposons examined was detected in the regenerated plants. Therefore, the SNPs and indels contribute to the somaclonal variation in regenerated rice in addition to the transposition of Tos17. The observed molecular spectrum was similar to that of the spontaneous mutations in Arabidopsis thaliana. However, the base change ratio was estimated to be 1.74 × 10(-6) base substitutions per site per regeneration, which is 248-fold greater than the spontaneous mutation rate of A. thaliana.
Ge, Liya; Yong, Jean Wan Hong; Tan, Swee Ngin; Yang, Xin Hao; Ong, Eng Shi
2006-11-10
A method based on solid-phase extraction (SPE) and capillary zone electrophoresis-tandem mass spectrometry (CZE-MS/MS) is described for the separation and determination of six cytokinin nucleotides in coconut water. The best CZE separation for the six cytokinin nucleotide standards was achieved using a 25 mM ammonium formate/formic acid buffer (pH 3.8) and 2% (v/v) methanol with an applied gradient separation voltage (25 kV for 32 min, and then a linear gradient to 30 kV in 5 min, finally 30 kV to the end of separation) in less than 60 min. MS/MS with multiple reaction monitoring (MRM) detection was carried out to obtain sufficient selectivity and sensitivity for the cytokinin nucleotides. The combined use of on-line sample stacking and CZE-MS/MS achieved limits of detection (LODs) in the range of 0.06-0.19 microM for the six cytokinin nucleotides at a signal-to-noise ratio of 3. Furthermore, a novel dual-step SPE procedure was developed for the pre-concentration and purification of cytokinin nucleotides using Oasis HLB and Oasis MAX cartridges. The recoveries of the cytokinin nucleotides after the dual-step SPE were in the range of 44-71%. The combination of off-line SPE, on-line sample stacking and CZE-MS/MS approach was successfully applied to screen for endogenous cytokinin nucleotides present in coconut water sample. trans-Zeatin riboside-5'-monophosphate (ZMP) was detected and quantified in coconut water by CZE-MS/MS after SPE and on-line sample stacking.
Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W
2013-07-08
Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valles, Steven M., E-mail: steven.valles@ars.usda.gov; Oi, David H.; Becnel, James J.
We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strandmore » of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.« less
USDA-ARS?s Scientific Manuscript database
Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...
ERIC Educational Resources Information Center
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2010-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…
USDA-ARS?s Scientific Manuscript database
The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...
Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins
2016-01-01
Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...
ERIC Educational Resources Information Center
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-01-01
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…
Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.
2007-01-01
A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140
Profiling of Sugar Nucleotides.
Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A
2017-01-01
Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
Champagne, Devin P.; Shockett, Penny E.
2014-01-01
Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is similar for both genes and consistent with results at the TCRβ locus. Non-templated (N) nucleotide insertions appear to increase between fetal and postnatal stages for Notch1, consistent with normal terminal deoxynucleotidyl transferase (TdT) activity; however, neonatal Bcl11b junctions contain elevated levels of N insertions. Finally, contrasting with results at the HPRT1 locus, we find no obvious age or gender bias in junctional processing, and inverted repeats at recessed coding ends (Pr nucleotides) correspond mostly to single-base additions consistent with normal TdT activity. PMID:24530429
Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi
2017-06-13
We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.
Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang
2018-02-23
The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.
OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities
NASA Astrophysics Data System (ADS)
Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.
2016-09-01
The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.
NASA Astrophysics Data System (ADS)
Nardo, Luca; Tosi, Giovanna; Bondani, Maria; Accolla, Roberto; Andreoni, Alessandra
2012-06-01
By tens-of-picosecond resolved fluorescence detection we study Förster resonance energy transfer between a donor and a black-hole-quencher bound at the 5'- and 3'-positions of an oligonucleotide probe matching the highly polymorphic region between codons 51 and 58 of the human leukocyte antigen DQB1 0201 allele, conferring susceptibility to type-1 diabetes. The probe is annealed with non-amplified genomic DNAs carrying either the 0201 sequence or other DQB1 allelic variants. We detect the longest-lived donor fluorescence in the case of hybridization with the 0201 allele and definitely faster and distinct decays for the other allelic variants, some of which are single-nucleotide polymorphic.
Hsin, Wei-Chen; Chang, Chan-Hua; Chang, Chi-You; Peng, Wei-Hao; Chien, Chung-Liang; Chang, Ming-Fu; Chang, Shin C
2018-05-24
Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome. A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969) ME ), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969) ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome. A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969) ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.
USDA-ARS?s Scientific Manuscript database
In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...
Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan
2015-12-01
We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.
Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.
2010-01-01
Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771
Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M
2010-01-12
Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.
Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.
Cui, Chenghua; Shu, Wei; Li, Peining
2016-01-01
Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.
NASA Astrophysics Data System (ADS)
Spinney, Patrick; Collins, Scott D.; Howitt, David G.; Smith, Rosemary L.
2012-06-01
Rapid and cost-effective DNA sequencing is a pivotal prerequisite for the genomics era. Many of the recent advances in forensics, medicine, agriculture, taxonomy, and drug discovery have paralleled critical advances in DNA sequencing technology. Nanopore modalities for DNA sequencing have recently surfaced including the electrical interrogation of protein ion channels and/or solid-state nanopores during translocation of DNA. However to date, most of this work has met with mixed success. In this work, we present a unique nanofabrication strategy that realizes an artificial nanopore articulated with carbon electrodes to sense the current modulations during the transport of DNA through the nanopore. This embodiment overcomes most of the technical difficulties inherent in other artificial nanopore embodiments and present a versatile platform for the testing of DNA single nucleotide detection. Characterization of the device using gold nanoparticles, silica nanoparticles, lambda dsDNA and 16-mer ssDNA are presented. Although single molecule DNA sequencing is still not demonstrated, the device shows a path towards this goal.
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis.
Pucholt, Pascal; Wright, Alison E; Conze, Lei Liu; Mank, Judith E; Berlin, Sofia
2017-08-01
Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Langefeld, Carl D; Comeau, Mary E; Ng, Maggie C Y; Guan, Meijian; Dimitrov, Latchezar; Mudgal, Poorva; Spainhour, Mitzie H; Julian, Bruce A; Edberg, Jeffrey C; Croker, Jennifer A; Divers, Jasmin; Hicks, Pamela J; Bowden, Donald W; Chan, Gary C; Ma, Lijun; Palmer, Nicholette D; Kimberly, Robert P; Freedman, Barry I
2018-06-06
African Americans carrying two apolipoprotein L1 gene (APOL1) renal risk variants have a high risk for nephropathy. However, only a minority develops end-stage renal disease (ESRD). Hence, modifying factors likely contribute to initiation of kidney disease such as endogenous (HIV infection) or exogenous (interferon treatment) environmental modifiers. In this report, genome-wide association studies and a meta-analysis were performed to identify novel loci for nondiabetic ESRD in African Americans and to detect genetic modifiers in APOL1-associated nephropathy. Two African American cohorts were analyzed, 1749 nondiabetic ESRD cases and 1136 controls from Wake Forest and 901 lupus nephritis (LN)-ESRD cases and 520 controls with systemic lupus erythematosus but lacking nephropathy from the LN-ESRD Consortium. Association analyses adjusting for APOL1 G1/G2 renal-risk variants were completed and stratified by APOL1 risk genotype status. Individual genome-wide association studies and meta-analysis results of all 2650 ESRD cases and 1656 controls did not detect significant genome-wide associations with ESRD beyond APOL1. Similarly, no single nucleotide polymorphism showed significant genome-wide evidence of an interaction with APOL1 risk variants. Thus, although variants with small individual effects cannot be ruled out and are likely to exist, our results suggest that APOL1-environment interactions may be of greater clinical importance in triggering nephropathy in African Americans than APOL1 interactions with other single nucleotide polymorphisms. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
Rueda, Oscar M; Diaz-Uriarte, Ramon
2007-10-16
Yu et al. (BMC Bioinformatics 2007,8: 145+) have recently compared the performance of several methods for the detection of genomic amplification and deletion breakpoints using data from high-density single nucleotide polymorphism arrays. One of the methods compared is our non-homogenous Hidden Markov Model approach. Our approach uses Markov Chain Monte Carlo for inference, but Yu et al. ran the sampler for a severely insufficient number of iterations for a Markov Chain Monte Carlo-based method. Moreover, they did not use the appropriate reference level for the non-altered state. We rerun the analysis in Yu et al. using appropriate settings for both the Markov Chain Monte Carlo iterations and the reference level. Additionally, to show how easy it is to obtain answers to additional specific questions, we have added a new analysis targeted specifically to the detection of breakpoints. The reanalysis shows that the performance of our method is comparable to that of the other methods analyzed. In addition, we can provide probabilities of a given spot being a breakpoint, something unique among the methods examined. Markov Chain Monte Carlo methods require using a sufficient number of iterations before they can be assumed to yield samples from the distribution of interest. Running our method with too small a number of iterations cannot be representative of its performance. Moreover, our analysis shows how our original approach can be easily adapted to answer specific additional questions (e.g., identify edges).
Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons.
Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M
2012-06-01
The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02). We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.
On safari to Random Jungle: a fast implementation of Random Forests for high-dimensional data
Schwarz, Daniel F.; König, Inke R.; Ziegler, Andreas
2010-01-01
Motivation: Genome-wide association (GWA) studies have proven to be a successful approach for helping unravel the genetic basis of complex genetic diseases. However, the identified associations are not well suited for disease prediction, and only a modest portion of the heritability can be explained for most diseases, such as Type 2 diabetes or Crohn's disease. This may partly be due to the low power of standard statistical approaches to detect gene–gene and gene–environment interactions when small marginal effects are present. A promising alternative is Random Forests, which have already been successfully applied in candidate gene analyses. Important single nucleotide polymorphisms are detected by permutation importance measures. To this day, the application to GWA data was highly cumbersome with existing implementations because of the high computational burden. Results: Here, we present the new freely available software package Random Jungle (RJ), which facilitates the rapid analysis of GWA data. The program yields valid results and computes up to 159 times faster than the fastest alternative implementation, while still maintaining all options of other programs. Specifically, it offers the different permutation importance measures available. It includes new options such as the backward elimination method. We illustrate the application of RJ to a GWA of Crohn's disease. The most important single nucleotide polymorphisms (SNPs) validate recent findings in the literature and reveal potential interactions. Availability: The RJ software package is freely available at http://www.randomjungle.org Contact: inke.koenig@imbs.uni-luebeck.de; ziegler@imbs.uni-luebeck.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20505004
Combined array CGH plus SNP genome analyses in a single assay for optimized clinical testing
Wiszniewska, Joanna; Bi, Weimin; Shaw, Chad; Stankiewicz, Pawel; Kang, Sung-Hae L; Pursley, Amber N; Lalani, Seema; Hixson, Patricia; Gambin, Tomasz; Tsai, Chun-hui; Bock, Hans-Georg; Descartes, Maria; Probst, Frank J; Scaglia, Fernando; Beaudet, Arthur L; Lupski, James R; Eng, Christine; Wai Cheung, Sau; Bacino, Carlos; Patel, Ankita
2014-01-01
In clinical diagnostics, both array comparative genomic hybridization (array CGH) and single nucleotide polymorphism (SNP) genotyping have proven to be powerful genomic technologies utilized for the evaluation of developmental delay, multiple congenital anomalies, and neuropsychiatric disorders. Differences in the ability to resolve genomic changes between these arrays may constitute an implementation challenge for clinicians: which platform (SNP vs array CGH) might best detect the underlying genetic cause for the disease in the patient? While only SNP arrays enable the detection of copy number neutral regions of absence of heterozygosity (AOH), they have limited ability to detect single-exon copy number variants (CNVs) due to the distribution of SNPs across the genome. To provide comprehensive clinical testing for both CNVs and copy-neutral AOH, we enhanced our custom-designed high-resolution oligonucleotide array that has exon-targeted coverage of 1860 genes with 60 000 SNP probes, referred to as Chromosomal Microarray Analysis – Comprehensive (CMA-COMP). Of the 3240 cases evaluated by this array, clinically significant CNVs were detected in 445 cases including 21 cases with exonic events. In addition, 162 cases (5.0%) showed at least one AOH region >10 Mb. We demonstrate that even though this array has a lower density of SNP probes than other commercially available SNP arrays, it reliably detected AOH events >10 Mb as well as exonic CNVs beyond the detection limitations of SNP genotyping. Thus, combining SNP probes and exon-targeted array CGH into one platform provides clinically useful genetic screening in an efficient manner. PMID:23695279
Shen, Wei; Paxton, Christian N; Szankasi, Philippe; Longhurst, Maria; Schumacher, Jonathan A; Frizzell, Kimberly A; Sorrells, Shelly M; Clayton, Adam L; Jattani, Rakhi P; Patel, Jay L; Toydemir, Reha; Kelley, Todd W; Xu, Xinjie
2018-04-01
Genetic abnormalities, including copy number variants (CNV), copy number neutral loss of heterozygosity (CN-LOH) and gene mutations, underlie the pathogenesis of myeloid malignancies and serve as important diagnostic, prognostic and/or therapeutic markers. Currently, multiple testing strategies are required for comprehensive genetic testing in myeloid malignancies. The aim of this proof-of-principle study was to investigate the feasibility of combining detection of genome-wide large CNVs, CN-LOH and targeted gene mutations into a single assay using next-generation sequencing (NGS). For genome-wide CNV detection, we designed a single nucleotide polymorphism (SNP) sequencing backbone with 22 762 SNP regions evenly distributed across the entire genome. For targeted mutation detection, 62 frequently mutated genes in myeloid malignancies were targeted. We combined this SNP sequencing backbone with a targeted mutation panel, and sequenced 9 healthy individuals and 16 patients with myeloid malignancies using NGS. We detected 52 somatic CNVs, 11 instances of CN-LOH and 39 oncogenic mutations in the 16 patients with myeloid malignancies, and none in the 9 healthy individuals. All CNVs and CN-LOH were confirmed by SNP microarray analysis. We describe a genome-wide SNP sequencing backbone which allows for sensitive detection of genome-wide CNVs and CN-LOH using NGS. This proof-of-principle study has demonstrated that this strategy can provide more comprehensive genetic profiling for patients with myeloid malignancies using a single assay. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Karas, Vlad O; Sinnott-Armstrong, Nicholas A; Varghese, Vici; Shafer, Robert W; Greenleaf, William J; Sherlock, Gavin
2018-01-01
Abstract Much of the within species genetic variation is in the form of single nucleotide polymorphisms (SNPs), typically detected by whole genome sequencing (WGS) or microarray-based technologies. However, WGS produces mostly uninformative reads that perfectly match the reference, while microarrays require genome-specific reagents. We have developed Diff-seq, a sequencing-based mismatch detection assay for SNP discovery without the requirement for specialized nucleic-acid reagents. Diff-seq leverages the Surveyor endonuclease to cleave mismatched DNA molecules that are generated after cross-annealing of a complex pool of DNA fragments. Sequencing libraries enriched for Surveyor-cleaved molecules result in increased coverage at the variant sites. Diff-seq detected all mismatches present in an initial test substrate, with specific enrichment dependent on the identity and context of the variation. Application to viral sequences resulted in increased observation of variant alleles in a biologically relevant context. Diff-Seq has the potential to increase the sensitivity and efficiency of high-throughput sequencing in the detection of variation. PMID:29361139
Development of an Automated DNA Detection System Using an Electrochemical DNA Chip Technology
NASA Astrophysics Data System (ADS)
Hongo, Sadato; Okada, Jun; Hashimoto, Koji; Tsuji, Koichi; Nikaido, Masaru; Gemma, Nobuhiro
A new compact automated DNA detection system Genelyzer™ has been developed. After injecting a sample solution into a cassette with a built-in electrochemical DNA chip, processes from hybridization reaction to detection and analysis are all operated fully automatically. In order to detect a sample DNA, electrical currents from electrodes due to an oxidization reaction of electrochemically active intercalator molecules bound to hybridized DNAs are detected. The intercalator is supplied as a reagent solution by a fluid supply unit of the system. The feasibility test proved that the simultaneous typing of six single nucleotide polymorphisms (SNPs) associated with a rheumatoid arthritis (RA) was carried out within two hours and that all the results were consistent with those by conventional typing methods. It is expected that this system opens a new way to a DNA testing such as a test for infectious diseases, a personalized medicine, a food inspection, a forensic application and any other applications.
Method for nucleic acid hybridization using single-stranded DNA binding protein
Tabor, Stanley; Richardson, Charles C.
1996-01-01
Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.
Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying
2010-01-01
Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K′ = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be ≈2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in south China contain tremendous genetic resources for cultivar improvement. PMID:20566681
Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu
2016-04-11
Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.
Leung, Kaston; Klaus, Anders; Lin, Bill K; Laks, Emma; Biele, Justina; Lai, Daniel; Bashashati, Ali; Huang, Yi-Fei; Aniba, Radhouane; Moksa, Michelle; Steif, Adi; Mes-Masson, Anne-Marie; Hirst, Martin; Shah, Sohrab P; Aparicio, Samuel; Hansen, Carl L
2016-07-26
The genomes of large numbers of single cells must be sequenced to further understanding of the biological significance of genomic heterogeneity in complex systems. Whole genome amplification (WGA) of single cells is generally the first step in such studies, but is prone to nonuniformity that can compromise genomic measurement accuracy. Despite recent advances, robust performance in high-throughput single-cell WGA remains elusive. Here, we introduce droplet multiple displacement amplification (MDA), a method that uses commercially available liquid dispensing to perform high-throughput single-cell MDA in nanoliter volumes. The performance of droplet MDA is characterized using a large dataset of 129 normal diploid cells, and is shown to exceed previously reported single-cell WGA methods in amplification uniformity, genome coverage, and/or robustness. We achieve up to 80% coverage of a single-cell genome at 5× sequencing depth, and demonstrate excellent single-nucleotide variant (SNV) detection using targeted sequencing of droplet MDA product to achieve a median allelic dropout of 15%, and using whole genome sequencing to achieve false and true positive rates of 9.66 × 10(-6) and 68.8%, respectively, in a G1-phase cell. We further show that droplet MDA allows for the detection of copy number variants (CNVs) as small as 30 kb in single cells of an ovarian cancer cell line and as small as 9 Mb in two high-grade serous ovarian cancer samples using only 0.02× depth. Droplet MDA provides an accessible and scalable method for performing robust and accurate CNV and SNV measurements on large numbers of single cells.
2013-10-01
identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year
Single-cell analysis of intercellular heteroplasmy of mtDNA in Leber hereditary optic neuropathy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobayashi, Y.; Sharpe, H.; Brown, N.
1994-07-01
The authors have investigated the distribution of mutant mtDNA molecules in single cells from a patient with Leber hereditary optic neuropathy (LHON). LHON is a maternally inherited disease that is characterized by a sudden-onset bilateral loss of central vision, which typically occurs in early adulthood. More than 50% of all LHON patients carry an mtDNA mutation at nucleotide position 11778. This nucleotide change converts a highly conserved arginine residue to histidine at codon 340 in the NADH-ubiquinone oxidoreductase subunit 4 (ND4) gene of mtDNA. In the present study, the authors used PCR amplification of mtDNA from lymphocytes to investigate mtDNAmore » heteroplasmy at the single-cell level in a LHON patient. They found that most cells were either homoplasmic normal or homoplasmic mutant at nucleotide position 11778. Some (16%) cells contained both mutant and normal mtDNA.« less
Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt
2009-12-01
The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.
A deep intronic mutation in the SLC12A3 gene leads to Gitelman syndrome.
Nozu, Kandai; Iijima, Kazumoto; Nozu, Yoshimi; Ikegami, Ei; Imai, Takehide; Fu, Xue Jun; Kaito, Hiroshi; Nakanishi, Koichi; Yoshikawa, Norishige; Matsuo, Masafumi
2009-11-01
Many mutations have been detected in the SLC12A3 gene of Gitelman syndrome (GS, OMIM 263800) patients. In previous studies, only one mutant allele was detected in approximately 20 to 41% of patients with GS; however, the exact reason for the nonidentification has not been established. In this study, we used RT-PCR using mRNA to investigate for the first time transcript abnormalities caused by deep intronic mutation. Direct sequencing analysis of leukocyte DNA identified one base insertion in exon 6 (c.818_819insG), but no mutation was detected in another allele. We analyzed RNA extracted from leukocytes and urine sediments and detected unknown sequence containing 238bp between exons 13 and 14. The genomic DNA analysis of intron 13 revealed a single-base substitution (c.1670-191C>T) that creates a new donor splice site within the intron resulting in the inclusion of a novel cryptic exon in mRNA. This is the first report of creation of a splice site by a deep intronic single-nucleotide change in GS and the first report to detect the onset mechanism in a patient with GS and missing mutation in one allele. This molecular onset mechanism may partly explain the poor success rate of mutation detection in both alleles of patients with GS.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-03-18
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-01-01
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems. PMID:26999129
Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann
2004-01-01
Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524
Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer
Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.
2009-01-01
Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer. ?? 2009 Pearson et al; licensee BioMed Central Ltd.
A new class of homogeneous nucleic acid probes based on specific displacement hybridization
Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan
2002-01-01
We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731
Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang
2014-11-01
Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.
Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader
2016-07-22
High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.
Zhao, X H; Wang, J Y; Zhang, G X; Wei, Y; Gu, Y P; Yu, Y B
2012-04-01
In our research, signal transducer and activator of transcription 5b (STAT5b) gene was studied as candidate gene associated with body weight and reproductive traits of Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of STAT5b gene were examined in both Jinghai Yellow chicken and three reference chicken populations including the Bian, Youxi and Arbor Acre chickens. Two SNPs (C-1591T and G-250A) were detected in the 5' flanking region of STAT5b gene. Association indicated that the C-1591T mutation is significantly associated with age at fist egg, The G-250A mutation is significantly related with hatch weight and body weight at 300 days. Additionally four STAT5b haplotypes (H1, CG; H2, TG; H3, AC and H4, TA) and their frequency distributions were estimated using the phase program. Diplotype H3H4 is dominant for 8, 16 week-age-weight and body weight at first egg. Thus STAT5b gene may be served as a potential genetic marker for growth and reproduction traits evaluation of the Jinghai Yellow chicken. This study will provide valuable information for the protection and breeding of Jinghai Yellow chicken.
Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z
2014-03-01
To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.
Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech
2010-06-01
Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.
NASA Astrophysics Data System (ADS)
Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli
2013-09-01
Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.
Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G
2000-06-01
cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.
Range-wide parallel climate-associated genomic clines in Atlantic salmon
Stanley, Ryan R. E.; Wringe, Brendan F.; Guijarro-Sabaniel, Javier; Bourret, Vincent; Bernatchez, Louis; Bentzen, Paul; Beiko, Robert G.; Gilbey, John; Clément, Marie; Bradbury, Ian R.
2017-01-01
Clinal variation across replicated environmental gradients can reveal evidence of local adaptation, providing insight into the demographic and evolutionary processes that shape intraspecific diversity. Using 1773 genome-wide single nucleotide polymorphisms we evaluated latitudinal variation in allele frequency for 134 populations of North American and European Atlantic salmon (Salmo salar). We detected 84 (4.74%) and 195 (11%) loci showing clinal patterns in North America and Europe, respectively, with 12 clinal loci in common between continents. Clinal single nucleotide polymorphisms were evenly distributed across the salmon genome and logistic regression revealed significant associations with latitude and seasonal temperatures, particularly average spring temperature in both continents. Loci displaying parallel clines were associated with several metabolic and immune functions, suggesting a potential basis for climate-associated adaptive differentiation. These climate-based clines collectively suggest evidence of large-scale environmental associated differences on either side of the North Atlantic. Our results support patterns of parallel evolution on both sides of the North Atlantic, with evidence of both similar and divergent underlying genetic architecture. The identification of climate-associated genomic clines illuminates the role of selection and demographic processes on intraspecific diversity in this species and provides a context in which to evaluate the impacts of climate change. PMID:29291123
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doerk, T.; Wulbrand, U.; Tuemmler, B.
1993-03-01
Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less
Kang, In-Nee; Musa, Maslinda; Harun, Fatimah; Junit, Sarni Mat
2010-02-01
The FOXE1 gene was screened for mutations in a cohort of 34 unrelated patients with congenital hypothyroidism, 14 of whom had thyroid dysgenesis and 18 were normal (the thyroid status for 2 patients was unknown). The entire coding region of the FOXE1 gene was PCR-amplified, then analyzed using single-stranded conformational polymorphism, followed by confirmation by direct DNA sequencing. DNA sequencing analysis revealed a heterozygous A>G transition at nucleotide position 394 in one of the patients. The nucleotide transition changed asparagine to aspartate at codon 132 in the highly conserved region of the forkhead DNA binding domain of the FOXE1 gene. This mutation was not detected in a total of 104 normal healthy individuals screened. The binding ability of the mutant FOXE1 protein to the human thyroperoxidase (TPO) promoter was slightly reduced compared with the wild-type FOXE1. The mutation also caused a 5% loss of TPO transcriptional activity.
Kinetic gating mechanism of DNA damage recognition by Rad4/XPC
NASA Astrophysics Data System (ADS)
Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; Park, Beomseok; Shim, Yoonjung; Kim, Youngchang; Liu, Lili; van Houten, Bennett; He, Chuan; Ansari, Anjum; Min, Jung-Hyun
2015-01-01
The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivity arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.
Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J
2017-10-09
IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.
Cho, Suk-Woo; Cho, Jeong-Hoon; Song, Hyun-Ok; Park, Chul-Seung
2005-02-28
Cyclic nucleotide-gated (CNG) channels encoded by the tax-4 and tax-2 genes are required for chemosensing and thermosensing in the nematode C. elegans. We identified a gene in the C. elegans genome, which we designated cng-1, that is highly homologous to tax-4. Partial CNG-1 protein tagged with green fluorescent protein was expressed in several sensory neurons of the amphid. We created a deletion mutant of cng-1, cng-1 (jh111), to investigate its in vivo function. The mutant worms had no detectable abnormalities in terms of their basic behavior or morphology. Whereas tax-4 and tax-2 mutants failed to respond to water-soluble or volatile chemical attractants, the cng-1 null mutant exhibited normal chemotaxis to such chemicals and a tax-4;cng-1 double mutant had a similar phenotype to tax-4 single mutants. Interestingly, cng-1 and tax-4 had a synergistic effect on brood size.
Kinetic gating mechanism of DNA damage recognition by Rad4/XPC
Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; ...
2015-01-06
The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivitymore » arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Lastly, kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.« less
Molecular epidemiology of measles viruses in China, 1995–2003
Zhang, Yan; Zhu, Zhen; Rota, Paul A; Jiang, Xiaohong; Hu, Jiayu; Wang, Jianguo; Tang, Wei; Zhang, Zhenying; Li, Congyong; Wang, Changyin; Wang, Tongzhan; Zheng, Lei; Tian, Hong; Ling, Hua; Zhao, Chunfang; Ma, Yan; Lin, Chunyan; He, Jilan; Tian, Jiang; Ma, Yan; Li, Ping; Guan, Ronghui; He, Weikuan; Zhou, Jianhui; Liu, Guiyan; Zhang, Hong; Yan, Xinge; Yang, Xuelei; Zhang, Jinlin; Lu, Yiyu; Zhou, Shunde; Ba, Zhuoma; Liu, Wei; Yang , Xiuhui; Ma, Yujie; Liang, Yong; Li, Yeqiang; Ji, Yixin; Featherstone, David; Bellini, William J; Xu, Songtao; Liang, Guodong; Xu, Wenbo
2007-01-01
This report describes the genetic characterization of 297 wild-type measles viruses that were isolated in 24 provinces of China between 1995 and 2003. Phylogenetic analysis of the N gene sequences showed that all of the isolates belonged to genotype H1 except 3 isolates, which were genotype A. The nucleotide sequence and predicted amino acid homologies of the 294-genotype H1 strains were 94.7%–100% and 93.3%–100%, respectively. The genotype H1 isolates were divided into 2 clusters, which differed by approximately 2.9% at the nucleotide level. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Even though other measles genotypes have been detected in countries that border China, this report shows that genotype H1 is widely distributed throughout the country and that China has a single, endemic genotype. This important baseline data will help to monitor the progress of measles control in China. PMID:17280609
Hernández-Frederick, C J; Cereb, N; Giani, A S; Ruppel, J; Maraszek, A; Pingel, J; Sauter, J; Schmidt, A H; Yang, S Y
2016-01-01
We characterized 549 new human leukocyte antigen (HLA) class I and class II alleles found in newly registered stem cell donors as a result of high-throughput HLA typing. New alleles include 101 HLA-A, 132 HLA-B, 105 HLA-C, 2 HLA-DRB1, 89 HLA-DQB1 and 120 HLA-DPB1 alleles. Mainly, new alleles comprised single nucleotide variations when compared with homologous sequences. We identified nonsynonymous nucleotide mutations in 70.7% of all new alleles, synonymous variations in 26.4% and nonsense substitutions in 2.9% (null alleles). Some new alleles (55, 10.0%) were found multiple times, HLA-DPB1 alleles being the most frequent among these. Furthermore, as several new alleles were identified in individuals from ethnic minority groups, the relevance of recruiting donors belonging to such groups and the importance of ethnicity data collection in donor centers and registries is highlighted. © 2015 The Authors. HLA published by John Wiley & Sons Ltd.
Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam
2010-04-15
High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.
Electron attachment to DNA single strands: gas phase and aqueous solution.
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F
2007-01-01
The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.
Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A
2012-03-01
Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.
A Novel Center Star Multiple Sequence Alignment Algorithm Based on Affine Gap Penalty and K-Band
NASA Astrophysics Data System (ADS)
Zou, Quan; Shan, Xiao; Jiang, Yi
Multiple sequence alignment is one of the most important topics in computational biology, but it cannot deal with the large data so far. As the development of copy-number variant(CNV) and Single Nucleotide Polymorphisms(SNP) research, many researchers want to align numbers of similar sequences for detecting CNV and SNP. In this paper, we propose a novel multiple sequence alignment algorithm based on affine gap penalty and k-band. It can align more quickly and accurately, that will be helpful for mining CNV and SNP. Experiments prove the performance of our algorithm.
Schermerhorn, Kelly M.; Gardner, Andrew F.
2015-01-01
Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Microelectronic DNA assay for the detection of BRCA1 gene mutations
NASA Technical Reports Server (NTRS)
Chen, Hua; Han, Jie; Li, Jun; Meyyappan, Meyya
2004-01-01
Mutations in BRCA1 are characterized by predisposition to breast cancer, ovarian cancer and prostate cancer as well as colon cancer. Prognosis for this cancer survival depends upon the stage at which cancer is diagnosed. Reliable and rapid mutation detection is crucial for the early diagnosis and treatment. We developed an electronic assay for the detection of a representative single nucleotide polymorphism (SNP), deletion and insertion in BRCA1 gene by the microelectronics microarray instrumentation. The assay is rapid, and it takes 30 minutes for the immobilization of target DNA samples, hybridization, washing and readout. The assay is multiplexing since it is carried out at the same temperature and buffer conditions for each step. The assay is also highly specific, as the signal-to-noise ratio is much larger than recommended value (72.86 to 321.05 vs. 5) for homozygotes genotyping, and signal ratio close to the perfect value 1 for heterozygotes genotyping (1.04).
Modular probes for enriching and detecting complex nucleic acid sequences
NASA Astrophysics Data System (ADS)
Wang, Juexiao Sherry; Yan, Yan Helen; Zhang, David Yu
2017-12-01
Complex DNA sequences are difficult to detect and profile, but are important contributors to human health and disease. Existing hybridization probes lack the capability to selectively bind and enrich hypervariable, long or repetitive sequences. Here, we present a generalized strategy for constructing modular hybridization probes (M-Probes) that overcomes these challenges. We demonstrate that M-Probes can tolerate sequence variations of up to 7 nt at prescribed positions while maintaining single nucleotide sensitivity at other positions. M-Probes are also shown to be capable of sequence-selectively binding a continuous DNA sequence of more than 500 nt. Furthermore, we show that M-Probes can detect genes with triplet repeats exceeding a programmed threshold. As a demonstration of this technology, we have developed a hybrid capture method to determine the exact triplet repeat expansion number in the Huntington's gene of genomic DNA using quantitative PCR.
Bartels, Stephan; Schipper, Elisa; Hasemeier, Britta; Kreipe, Hans; Lehmann, Ulrich
2018-05-27
The detection of hotspot mutations in key cancer genes is now an essential part of the diagnostic work-up in molecular pathology. Nearly all assays for mutation detection involve an amplification step. A second single nucleotide variant (SNV) on the same allele adjacent to a mutational hotspot can interfere with primer binding, leading to unnoticed allele-specific amplification of the wild type allele and thereby false-negative mutation testing. We present two diagnostic cases with false negative sequence results for JAK2 and SRSF2. In both cases mutations would have escaped detection if only one strand of DNA had been analysed. Because many commercially available diagnostic kits rely on the analysis of only one DNA strand they are prone to fail in cases like these. Detailed protocols and quality control measures to prevent corresponding pitfalls are presented. Copyright © 2017. Published by Elsevier Inc.
A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties
Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.
2017-01-01
Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129
Yan, Liying; Huang, Lei; Xu, Liya; Huang, Jin; Ma, Fei; Zhu, Xiaohui; Tang, Yaqiong; Liu, Mingshan; Lian, Ying; Liu, Ping; Li, Rong; Lu, Sijia; Tang, Fuchou; Qiao, Jie; Xie, X Sunney
2015-12-29
In vitro fertilization (IVF), preimplantation genetic diagnosis (PGD), and preimplantation genetic screening (PGS) help patients to select embryos free of monogenic diseases and aneuploidy (chromosome abnormality). Next-generation sequencing (NGS) methods, while experiencing a rapid cost reduction, have improved the precision of PGD/PGS. However, the precision of PGD has been limited by the false-positive and false-negative single-nucleotide variations (SNVs), which are not acceptable in IVF and can be circumvented by linkage analyses, such as short tandem repeats or karyomapping. It is noteworthy that existing methods of detecting SNV/copy number variation (CNV) and linkage analysis often require separate procedures for the same embryo. Here we report an NGS-based PGD/PGS procedure that can simultaneously detect a single-gene disorder and aneuploidy and is capable of linkage analysis in a cost-effective way. This method, called "mutated allele revealed by sequencing with aneuploidy and linkage analyses" (MARSALA), involves multiple annealing and looping-based amplification cycles (MALBAC) for single-cell whole-genome amplification. Aneuploidy is determined by CNVs, whereas SNVs associated with the monogenic diseases are detected by PCR amplification of the MALBAC product. The false-positive and -negative SNVs are avoided by an NGS-based linkage analysis. Two healthy babies, free of the monogenic diseases of their parents, were born after such embryo selection. The monogenic diseases originated from a single base mutation on the autosome and the X-chromosome of the disease-carrying father and mother, respectively.
Single molecule detection with graphene and other two-dimensional materials: nanopores and beyond
Arjmandi-Tash, Hadi; Belyaeva, Liubov A.
2016-01-01
Graphene and other two dimensional (2D) materials are currently integrated into nanoscaled devices that may – one day – sequence genomes. The challenge to solve is conceptually straightforward: cut a sheet out of a 2D material and use the edge of the sheet to scan an unfolded biomolecule from head to tail. As the scan proceeds – and because 2D materials are atomically thin – the information provided by the edge might be used to identify different segments – ideally single nucleotides – in the biomolecular strand. So far, the most efficient approach was to drill a nano-sized pore in the sheet and use this pore as a channel to guide and detect individual molecules by measuring the electrochemical ionic current. Nanoscaled gaps between two electrodes in 2D materials recently emerged as powerful alternatives to nanopores. This article reviews the current status and prospects of integrating 2D materials in nanopores, nanogaps and similar devices for single molecule biosensing applications. We discuss the pros and cons, the challenges, and the latest achievements in the field. To achieve high-throughput sequencing with 2D materials, interdisciplinary research is essential. PMID:26612268
2012-01-01
Background Significant quantitative trait loci (QTL) for carcass weight were previously mapped on several chromosomes in Japanese Black half-sib families. Two QTL, CW-1 and CW-2, were narrowed down to 1.1-Mb and 591-kb regions, respectively. Recent advances in genomic tools allowed us to perform a genome-wide association study (GWAS) in cattle to detect associations in a general population and estimate their effect size. Here, we performed a GWAS for carcass weight using 1156 Japanese Black steers. Results Bonferroni-corrected genome-wide significant associations were detected in three chromosomal regions on bovine chromosomes (BTA) 6, 8, and 14. The associated single nucleotide polymorphisms (SNP) on BTA 6 were in linkage disequilibrium with the SNP encoding NCAPG Ile442Met, which was previously identified as a candidate quantitative trait nucleotide for CW-2. In contrast, the most highly associated SNP on BTA 14 was located 2.3-Mb centromeric from the previously identified CW-1 region. Linkage disequilibrium mapping led to a revision of the CW-1 region within a 0.9-Mb interval around the associated SNP, and targeted resequencing followed by association analysis highlighted the quantitative trait nucleotides for bovine stature in the PLAG1-CHCHD7 intergenic region. The association on BTA 8 was accounted for by two SNP on the BovineSNP50 BeadChip and corresponded to CW-3, which was simultaneously detected by linkage analyses using half-sib families. The allele substitution effects of CW-1, CW-2, and CW-3 were 28.4, 35.3, and 35.0 kg per allele, respectively. Conclusion The GWAS revealed the genetic architecture underlying carcass weight variation in Japanese Black cattle in which three major QTL accounted for approximately one-third of the genetic variance. PMID:22607022
Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.
Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin
2018-07-01
We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.
Pfundt, Rolph; del Rosario, Marisol; Vissers, Lisenka E.L.M.; Kwint, Michael P.; Janssen, Irene M.; de Leeuw, Nicole; Yntema, Helger G.; Nelen, Marcel R.; Lugtenberg, Dorien; Kamsteeg, Erik-Jan; Wieskamp, Nienke; Stegmann, Alexander P.A.; Stevens, Servi J.C.; Rodenburg, Richard J.T.; Simons, Annet; Mensenkamp, Arjen R.; Rinne, Tuula; Gilissen, Christian; Scheffer, Hans; Veltman, Joris A.; Hehir-Kwa, Jayne Y.
2017-01-01
Purpose: Copy-number variation is a common source of genomic variation and an important genetic cause of disease. Microarray-based analysis of copy-number variants (CNVs) has become a first-tier diagnostic test for patients with neurodevelopmental disorders, with a diagnostic yield of 10–20%. However, for most other genetic disorders, the role of CNVs is less clear and most diagnostic genetic studies are generally limited to the study of single-nucleotide variants (SNVs) and other small variants. With the introduction of exome and genome sequencing, it is now possible to detect both SNVs and CNVs using an exome- or genome-wide approach with a single test. Methods: We performed exome-based read-depth CNV screening on data from 2,603 patients affected by a range of genetic disorders for which exome sequencing was performed in a diagnostic setting. Results: In total, 123 clinically relevant CNVs ranging in size from 727 bp to 15.3 Mb were detected, which resulted in 51 conclusive diagnoses and an overall increase in diagnostic yield of ~2% (ranging from 0 to –5.8% per disorder). Conclusions: This study shows that CNVs play an important role in a broad range of genetic disorders and that detection via exome-based CNV profiling results in an increase in the diagnostic yield without additional testing, bringing us closer to single-test genomics. Genet Med advance online publication 27 October 2016 PMID:28574513
Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.
2000-01-01
There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235
Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M
2000-08-01
There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P=.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.
Pulido-Landínez, M; Sánchez-Ingunza, R; Guard, J; do Nascimento, V Pinheiro
2013-01-01
To assess diversity of Salmonella enterica serotypes present in poultry and their environment from southern Brazil, the Kauffmann–White–Le Minor (KWL) scheme was used to serotype a total of 155 isolates. Isolates were then re-examined with nested PCR and sequencing of the dkgB-linked intergenic sequence ribotyping (ISR) region that assesses single nucleotide polymorphisms occurring around a 5S ribosomal gene. Serotypes identified were Heidelberg (40·6%), Enteritidis (34·2%), Hadar (8·4%), Typhimurium (3·9%), Gallinarum (3·2%), Agona (1·3%), Cerro (1·3%), Livingstone (1·3%), Infantis (0·6%), Isangi (0·6%), Mbandaka (0·6%), Montevideo (0·6%) and Senftenberg (0·6%). Three unique ISRs were detected from four strains. Day old chicks yielded only S. Enteritidis, whereas S. Heidelberg was most often associated with poultry carcasses. Overall agreement between KWL and ISR was 85·2%, with disagreement possibly due to the ability of ISR to detect mixtures of serotypes in culture. Overall, ISR provided more information than did KWL about the ecology of Salm. enterica on-farm. The O-antigen group D Salm. enterica serovars such as Pullorum, Gallinarum and Enteritidis appear susceptible to overgrowth by other serotypes. Significance and Impact of the Study Single nucleotide polymorphisms found in a group of poultry-associated Salmonella isolates from southern Brazil provided evidence of mixtures of serovar group D serotypes on-farm and in single samples from birds. This finding suggests that co-infection and interserotype competition of Salmonella enterica in poultry could impact the incidence of disease in animals or humans. In addition, unique serotypes were identified on-farm that escaped characterization by antibody typing. Application of cost-efficient and highly discriminatory genomic methods for assigning serotype may alter concepts about the epidemiology of Salm. enterica on-farm and in foods. PMID:23734786
Stadler, Julia; Eder, Johanna; Pratscher, Barbara; Brandt, Sabine; Schneller, Doris; Müllegger, Robert; Vogl, Claus; Trautinger, Franz; Brem, Gottfried; Burgstaller, Joerg P.
2015-01-01
Cell-free circulating tumor DNA in the plasma of cancer patients has become a common point of interest as indicator of therapy options and treatment response in clinical cancer research. Especially patient- and tumor-specific single nucleotide variants that accurately distinguish tumor DNA from wild type DNA are promising targets. The reliable detection and quantification of these single-base DNA variants is technically challenging. Currently, a variety of techniques is applied, with no apparent “gold standard”. Here we present a novel qPCR protocol that meets the conditions of extreme sensitivity and specificity that are required for detection and quantification of tumor DNA. By consecutive application of two polymerases, one of them designed for extreme base-specificity, the method reaches unprecedented sensitivity and specificity. Three qPCR assays were tested with spike-in experiments, specific for point mutations BRAF V600E, PTEN T167A and NRAS Q61L of melanoma cell lines. It was possible to detect down to one copy of tumor DNA per reaction (Poisson distribution), at a background of up to 200 000 wild type DNAs. To prove its clinical applicability, the method was successfully tested on a small cohort of BRAF V600E positive melanoma patients. PMID:26562020
Gomes, Sónia; Castro, Cláudia; Barrias, Sara; Pereira, Leonor; Jorge, Pedro; Fernandes, José R; Martins-Lopes, Paula
2018-04-11
The wine sector requires quick and reliable methods for Vitis vinifera L. varietal identification. The number of V. vinifera varieties is estimated in about 5,000 worldwide. Single Nucleotide Polymorphisms (SNPs) represent the most basic and abundant form of genetic sequence variation, being adequate for varietal discrimination. The aim of this work was to develop DNA-based assays suitable to detect SNP variation in V. vinifera, allowing varietal discrimination. Genotyping by sequencing allowed the detection of eleven SNPs on two genes of the anthocyanin pathway, the flavanone 3-hydroxylase (F3H, EC: 1.14.11.9), and the leucoanthocyanidin dioxygenase (LDOX, EC 1.14.11.19; synonym anthocyanidin synthase, ANS) in twenty V. vinifera varieties. Three High Resolution Melting (HRM) assays were designed based on the sequencing information, discriminating five of the 20 varieties: Alicante Bouschet, Donzelinho Tinto, Merlot, Moscatel Galego and Tinta Roriz. Sanger sequencing of the HRM assay products confirmed the HRM profiles. Three probes, with different lengths and sequences, were used as bio-recognition elements in an optical biosensor platform based on a long period grating (LPG) fiber optic sensor. The label free platform detected a difference of a single SNP using genomic DNA samples. The two different platforms were successfully applied for grapevine varietal identification.
NASA Astrophysics Data System (ADS)
Rahman, M. Saifur; Anower, Md. Shamim; Hasan, Md. Rabiul; Hossain, Md. Biplob; Haque, Md. Ismail
2017-08-01
We demonstrate a highly sensitive Au-MoS2-Graphene based hybrid surface plasmon resonance (SPR) biosensor for the detection of DNA hybridization. The performance parameters of the proposed sensor are investigated in terms of sensitivity, detection accuracy and quality factor at operating wavelength of 633 nm. We observed in the numerical study that sensitivity can be greatly increased by adding MoS2 layer in the middle of a Graphene-on-Au layer. It is shown that by using single layer of MoS2 in between gold and graphene layer, the proposed biosensor exhibits simultaneously high sensitivity of 87.8 deg/RIU, high detection accuracy of 1.28 and quality factor of 17.56 with gold layer thickness of 50 nm. This increased performance is due to the absorption ability and optical characteristics of graphene biomolecules and high fluorescence quenching ability of MoS2. On the basis of changing in SPR angle and minimum reflectance, the proposed sensor can sense nucleotides bonding happened between double-stranded DNA (dsDNA) helix structures. Therefore, this sensor can successfully detect the hybridization of target DNAs to the probe DNAs pre-immobilized on the Au-MoS2-Graphene hybrid with capability of distinguishing single-base mismatch.
Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.
Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S
2017-09-01
We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.
A TaqI PCR-RFLP detecting a novel SNP in exon 2 of the bovine POU1F1 gene.
Pan, Chuanying; Lan, Xianyong; Chen, Hong; Guo, Yikun; Shu, Jianhong; Lei, Chuzhao; Wang, Xinzhuang
2008-08-01
PCR-SSCP and DNA sequencing methods were applied to reveal three novel single nucleotide polymorphisms (SNPs) in exon 2 of the POU1F1 gene in 963 Chinese cattle belonging to eight breeds. Among them, a silent SNP (NM_174579:c.545G > A) detected by TaqI endonuclease is described. Frequencies of the POU1F1-G allele varied from 0.685 to 1.000. The association of TaqI polymorphism with growth traits was analyzed in 251 Nanyang cattle. No significant associations of the TaqI polymorphism with body weight and average daily gain for different growth periods (6, 12, 18, and 24 months old) were observed (P > 0.05), as well as for body sizes (P > 0.05).
Tunable graphene quantum point contact transistor for DNA detection and characterization
Girdhar, Anuj; Sathe, Chaitanya; Schulten, Klaus; Leburton, Jean-Pierre
2015-01-01
A graphene membrane conductor containing a nanopore in a quantum point contact (QPC) geometry is a promising candidate to sense, and potentially sequence, DNA molecules translocating through the nanopore. Within this geometry, the shape, size, and position of the nanopore as well as the edge configuration influences the membrane conductance caused by the electrostatic interaction between the DNA nucleotides and the nanopore edge. It is shown that the graphene conductance variations resulting from DNA translocation can be enhanced by choosing a particular geometry as well as by modulating the graphene Fermi energy, which demonstrates the ability to detect conformational transformations of a double-stranded DNA, as well as the passage of individual base pairs of a single-stranded DNA molecule through the nanopore. PMID:25765702
Optimized MOL-PCR for Characterization of Microbial Pathogens.
Wuyts, Véronique; Roosens, Nancy H C; Bertrand, Sophie; Marchal, Kathleen; De Keersmaecker, Sigrid C J
2016-01-06
Characterization of microbial pathogens is necessary for surveillance, outbreak detection, and tracing of outbreak sources. This unit describes a multiplex oligonucleotide ligation-PCR (MOL-PCR) optimized for characterization of microbial pathogens. With MOL-PCR, different types of markers, like unique sequences, single-nucleotide polymorphisms (SNPs) and indels, can be simultaneously analyzed in one assay. This assay consists of a multiplex ligation for detection of the markers, a singleplex PCR for signal amplification, and hybridization to MagPlex-TAG beads for readout on a Luminex platform after fluorescent staining. The current protocol describes the MOL-PCR, as well as methods for DNA isolation, probe design, and data interpretation and it is based on an optimized MOL-PCR assay for subtyping of Salmonella Typhimurium. Copyright © 2016 John Wiley & Sons, Inc.
Yang, W C; Zhu, L; Zhou, B X; Tania, S; Zhou, Q; Khan, M A; Fu, X L; Cheng, J L; Lv, H B; Fu, J J
2015-09-25
Retinitis pigmentosa (RP) is a retinal degenerative disorder that often causes complete blindness. Mutations of more than 50 genes have been identified as associated with RP, including the CACNA1F gene. In a recent study, by employing next-generation sequencing, we identified a novel mutation in the CACNA1F gene. In this study, we used the amplification refractory mutation system (ARMS) and identified a single nucleotide change c.1555C>T in exon 13 of the CACNA1F gene, leading to the substitution of arginine by tryptophan (p.R519W) in a Chinese individual affected by RP. This study actually confirms this novel mutation, and establishes the ARMS technique for the detection of mutations in RP.
Development and characterization of a microheater array device for real-time DNA mutation detection
NASA Astrophysics Data System (ADS)
Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve
2008-04-01
DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.
Development and characterization of a microheater array device for real-time DNA mutation detection
NASA Astrophysics Data System (ADS)
Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve
2008-02-01
DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.
White, Marquitta J.; Tacconelli, Alessandra; Chen, Jane S.; Wejse, Christian; Hill, Philip C.; Gomez, Victor F; Velez-Edwards, Digna R.; Østergaard, Lars J.; Hu, Ting; Moore, Jason H.; Novelli, Giuseppe; Scott, William K.; Williams, Scott M.; Sirugo, Giorgio
2017-01-01
We analyzed two West African samples (Guinea-Bissau: n = 289 cases, 322 controls; The Gambia: n = 240 cases, 248 controls) to evaluate single nucleotide polymorphisms (SNPs) in Epiregulin (EREG) and V-ATPase (T cell immune regulator 1, TCIRG1) using single and multi-locus analyses to determine whether previously described associations with pulmonary tuberculosis (PTB) in Vietnamese and Italians would replicate in African populations. We did not detect any significant single locus or haplotype associations in either sample. We also performed exploratory pairwise interaction analyses using Visualization of Statistical Epistasis Networks (ViSEN), a novel method to detect only interactions among multiple variables, to elucidate possible interaction effects between SNPs and demographic factors. Although we found no strong evidence of marginal effects, there were several significant pairwise interactions that were identified in either the Guinea-Bissau or The Gambia samples, two of which replicated across populations. Our results indicate that the effects of EREG and TCIRG1 variants on PTB susceptibility, to the extent that they exist, are dependent on gene-gene interactions in West African populations as detected with ViSEN. In addition, epistatic effects are likely to be influenced by inter- and intra-population differences in genetic or environmental context and/or the mycobacterial lineages causing disease. PMID:24898387
Lühr, B; Scheller, J; Meyer, P; Kramer, W
1998-02-01
We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.
A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat
2010-01-01
Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
1988-01-01
Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102
Sequence of a cDNA encoding pancreatic preprosomatostatin-22.
Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E
1982-01-01
We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673
Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.
Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C
2015-03-01
Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.
Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections
Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.
2015-01-01
Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890
Wu, Jiaxin; Li, Yanda; Jiang, Rui
2014-03-01
Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs) for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data) for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP) and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations), SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.
Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean
2008-01-01
Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225
Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano
2013-10-01
The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.
Xiao, Shijun; Wang, Panpan; Dong, Linsong; Zhang, Yaguang; Han, Zhaofang; Wang, Qiurong
2016-01-01
Whole-genome single-nucleotide polymorphism (SNP) markers are valuable genetic resources for the association and conservation studies. Genome-wide SNP development in many teleost species are still challenging because of the genome complexity and the cost of re-sequencing. Genotyping-By-Sequencing (GBS) provided an efficient reduced representative method to squeeze cost for SNP detection; however, most of recent GBS applications were reported on plant organisms. In this work, we used an EcoRI-NlaIII based GBS protocol to teleost large yellow croaker, an important commercial fish in China and East-Asia, and reported the first whole-genome SNP development for the species. 69,845 high quality SNP markers that evenly distributed along genome were detected in at least 80% of 500 individuals. Nearly 95% randomly selected genotypes were successfully validated by Sequenom MassARRAY assay. The association studies with the muscle eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) content discovered 39 significant SNP markers, contributing as high up to ∼63% genetic variance that explained by all markers. Functional genes that involved in fat digestion and absorption pathway were identified, such as APOB, CRAT and OSBPL10. Notably, PPT2 Gene, previously identified in the association study of the plasma n-3 and n-6 polyunsaturated fatty acid level in human, was re-discovered in large yellow croaker. Our study verified that EcoRI-NlaIII based GBS could produce quality SNP markers in a cost-efficient manner in teleost genome. The developed SNP markers and the EPA and DHA associated SNP loci provided invaluable resources for the population structure, conservation genetics and genomic selection of large yellow croaker and other fish organisms. PMID:28028455
Zou, Zhen; Qing, Zhihe; He, Xiaoxiao; Wang, Kemin; He, Dinggeng; Shi, Hui; Yang, Xue; Qing, Taiping; Yang, Xiaoxiao
2014-07-01
A novel approach for highly sensitive and selective genotyping of single-nucleotide polymorphism (SNP) has been developed based on ligation-rolling circle amplification (L-RCA) and stemless molecular beacon. In this approach, two tailored DNA probes were involved. The stemless molecular beacon, formed through the inclusion interactions of γ-cyclodextrin (γ-CD) and bis-pyrene labeled DNA fragment, was served as signal probe. In the absence of mutant target, the two pyrene molecules were bound in the γ-CD cavity to form an excimer and showed a strong fluorescence at 475 nm. It was here named γ-CD-P-MB. The padlock DNA probe was designed as recognition probe. Upon the recognition of a point mutation DNA targets, the padlock probe was ligated to generate a circular template. An RCA amplification was then initiated using the circular template in the presence of Phi29 polymerase and dNTPs. The L-RCA products, containing repetitive sequence units, subsequently hybridized with the γ-CD-P-MB. This made pyrene molecules away from γ-CD cavity and caused a decrease of excimer fluorescence. As a proof-of-concept, SNP typing of β-thalassemia gene at position -28 was investigated using this approach. The detection limit of mutated target was determined to be 40 fM. In addition, DNA ligase offered high fidelity in distinguishing the mismatched bases at the ligation site, resulting in positive detection of mutant target even when the ratio of the wildtype to the mutant is 999:1. Given these attractive characteristics, the developed approach might provide a great genotyping platform for pathogenic diagnosis and genetic analysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min
2017-04-30
The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).
Khalil, Uzma; Younus, Mahwish; Asghar, Naeem; Siddiqui, Fariha; Gómez-Duarte, Oscar G; Wren, Brendan W; Bokhari, Habib
2016-10-01
Enteroaggregative Escherichia coli (EAEC) are a leading cause of diarrhea among children. The objective of this study was to define the frequency of EAEC among diarrheal children from flood-affected areas as well as sporadic cases, determine multidrug resistance, and evaluation of virulence using an in vivo model of pathogenesis. Stool samples were collected from 225 diarrheal children from 2010 to 2011 from flood-affected areas as well as from sporadic cases in Pakistan. Identified EAEC isolates were characterized by phylogrouping, antibiotic resistance patterns including the extended-spectrum beta lactamase spectrum, single nucleotide polymorphism detection in gyrA and parC, and virulence potential using wax worm, G. mellonella. A total of 35 (12.5%) confirmed EAEC isolates were identified among 225 E. coli isolates. EAEC isolates displayed high resistance to tetracycline, ampicillin, and cefaclor. A total of 34.28% were ESBL positive. Single nucleotide polymorphism detection revealed 37.14% and 68.57% isolates were positive for SNPs in gyrA (A660 -T660 ) and parC (C330 -T330 ), respectively. Phylogrouping revealed that B2 phylogroup was more prevalent among all EAEC isolates tested followed by D, A, B1, and non-typeable (NT). Infection of G. mellonella with EAEC showed that killing infective dose was 100% higher than E. coli DH5 alpha control. EAEC are prevalent among Pakistani children with diarrhea, they are highly resistant to antibiotics, and predominantly fall into B2 phylogroup. Epidemiologic surveillance of EAEC and other E. coli pathotypes is critical to assess not only the role of these pathogens in diarrheal disease but also to determine the extent of multidrug resistance among the population. © 2016 APMIS. Published by John Wiley & Sons Ltd.
Ye, Pohao; Luan, Yizhao; Chen, Kaining; Liu, Yizhi; Xiao, Chuanle; Xie, Zhi
2017-01-04
DNA methylation is an important type of epigenetic modifications, where 5- methylcytosine (5mC), 6-methyadenine (6mA) and 4-methylcytosine (4mC) are the most common types. Previous efforts have been largely focused on 5mC, providing invaluable insights into epigenetic regulation through DNA methylation. Recently developed single-molecule real-time (SMRT) sequencing technology provides a unique opportunity to detect the less studied DNA 6mA and 4mC modifications at single-nucleotide resolution. With a rapidly increased amount of SMRT sequencing data generated, there is an emerging demand to systematically explore DNA 6mA and 4mC modifications from these data sets. MethSMRT is the first resource hosting DNA 6mA and 4mC methylomes. All the data sets were processed using the same analysis pipeline with the same quality control. The current version of the database provides a platform to store, browse, search and download epigenome-wide methylation profiles of 156 species, including seven eukaryotes such as Arabidopsis, C. elegans, Drosophila, mouse and yeast, as well as 149 prokaryotes. It also offers a genome browser to visualize the methylation sites and related information such as single nucleotide polymorphisms (SNP) and genomic annotation. Furthermore, the database provides a quick summary of statistics of methylome of 6mA and 4mC and predicted methylation motifs for each species. MethSMRT is publicly available at http://sysbio.sysu.edu.cn/methsmrt/ without use restriction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N
2015-02-03
The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.
Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.
Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki
2010-07-01
Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.
One Bacterial Cell, One Complete Genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woyke, Tanja; Tighe, Damon; Mavrommatis, Konstantinos
2010-04-26
While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated frommore » the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200?900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA). Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs), indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.« less
Haugum, K; Brandal, L T; Løbersli, I; Kapperud, G; Lindstedt, B-A
2011-06-01
To compare 167 Norwegian human and nonhuman Escherichia coli O157:H7/NM (nonmotile) isolates with respect to an A/T single nucleotide polymorphism (SNP) in the tir gene and to detect specific SNPs that differentiate STEC O157 into distinct virulence clades (1-3 and 8). We developed a multiplex PCR followed by single base sequencing for detection of the SNPs, and examined the association among SNP genotype, virulence profile (stx and eae status), multilocus variable number of tandem repeats analysis (MLVA) profile and clinical outcome. We found an over-representation of the T allele among human strains compared to nonhuman strains, including 5/6 haemolytic-uraemic syndrome cases. Fourteen strains belonged to clade 8, followed by two clade 2 strains. No clade 1 nor 3 isolates were observed. stx1 in combination with either stx2(EDL933) or stx2c were frequently observed among human strains, whereas stx2c was dominating in nonhuman strains. MLVA indicated that only single cases or small outbreaks with E. coli O157 have been observed in Norway through the years 1993-2008. We observed that the tir-255 A/T SNP and the stx status were different between human and nonhuman O157 strains. No major outbreaks were observed, and only a few strains were differentiated into the virulence clades 2 and 8. The detection of virulence clade-specific SNPs enables the rapid designation of virulent E. coli O157 strains, especially in outbreak situations. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing
2009-06-01
The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.
A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification
Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.
2016-01-01
The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544
Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing
2014-12-01
Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.
Worrell, V E; Nagle, D P
1990-01-01
The enzymes involved in the purine interconversion pathway of wild-type and purine analog-resistant strains of Methanobacterium thermoautotrophicum Marburg were assayed by radiometric and spectrophotometric methods. Wild-type cells incorporated labeled adenine, guanine, and hypoxanthine, whereas mutant strains varied in their ability to incorporate these bases. Adenine, guanine, hypoxanthine, and xanthine were activated by phosphoribosyltransferase activities present in wild-type cell extracts. Some mutant strains simultaneously lost the ability to convert both guanine and hypoxanthine to the respective nucleotide, suggesting that the same enzyme activates both bases. Adenosine, guanosine, and inosine phosphorylase activities were detected for the conversion of base to nucleoside. Adenine deaminase activity was detected at low levels. Guanine deaminase activity was not detected. Nucleoside kinase activities for the conversion of adenosine, guanosine, and inosine to the respective nucleotides were detected by a new assay. The nucleotide-interconverting enzymes AMP deaminase, succinyl-AMP synthetase, succinyl-AMP lyase, IMP dehydrogenase, and GMP synthetase were present in extracts; GMP reductase was not detected. The results indicate that this autotrophic methanogen has a complex system for the utilization of exogenous purines. PMID:2345148
DNA Nucleotides Detection via capacitance properties of Graphene
NASA Astrophysics Data System (ADS)
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten
2013-01-01
Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002
Urschitz, Johann; Sultan, Omar; Ward, Kenneth
2011-01-01
Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308
Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E
2007-09-01
HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.
Double-stranded RNA virus in the human pathogenic fungus Blastomyces dermatitidis.
Kohno, S; Fujimura, T; Rulong, S; Kwon-Chung, K J
1994-01-01
Double-stranded RNA viruses were detected in a strain of Blastomyces dermatitidis isolated from a patient in Uganda. The viral particles are spherical (mostly 44 to 50 nm in diameter) and consist of about 25% double-stranded RNA (5 kb) and 75% protein (90 kDa). The virus contains transcriptional RNA polymerase activity; it synthesized single-stranded RNA in vitro in a conservative manner. The newly synthesized single-stranded RNA was a full-length strand, and the rate of chain elongation was approximately 170 nucleotides per min. The virus-containing strain shows no morphological difference from virus-free strains in the mycelial phase. Although the association with the presence of the virus is unclear, the virus-infected strain converts to the yeast form at 37 degrees C, but the yeast cells fail to multiply at that temperature. Images PMID:7933142
Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT
2009-01-01
The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539
Electron attachment to DNA single strands: gas phase and aqueous solution
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.
2007-01-01
The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage. PMID:17660189
Wang, Jiqing; Zhou, Huitong; Forrest, Rachel H J; Hu, Jiang; Liu, Xiu; Li, Shaobin; Luo, Yuzhu; Hickford, Jon G H
2017-09-01
Myogenic factor 5 (MYF5) plays an important role in regulating skeletal muscle, but to date there have been no reports on whether the gene is variable and whether this variation is associated with meat yield in sheep. In this study, four variants (A to D) of ovine MYF5 containing two Single Nucleotide Polymorphisms (SNPs) and one basepair (bp) insertion/deletion were detected by Polymerase Chain Reaction - Single Stranded Conformational Polymorphism (PCR-SSCP) analysis. Breed differences in variant frequencies were observed. The effect of variation in ovine MYF5 on lean meat yield, predicted using VIAScan® technology, was investigated in 388 male NZ Romney lambs. Only genotypes AA and AB were found in these lambs. Lambs with genotype AA had a higher leg yield (P=0.044), loin yield (P=0.002) and total yield (P=0.012) than those with genotype AB. No association with shoulder yield was detected. These results suggest that ovine MYF5 may be a valuable genetic marker for improved lean meat yield. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...
A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes
Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom
2017-01-01
This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528
C9orf72 hexanucleotide repeat expansions in Chinese sporadic amyotrophic lateral sclerosis.
He, Ji; Tang, Lu; Benyamin, Beben; Shah, Sonia; Hemani, Gib; Liu, Rong; Ye, Shan; Liu, Xiaolu; Ma, Yan; Zhang, Huagang; Cremin, Katie; Leo, Paul; Wray, Naomi R; Visscher, Peter M; Xu, Huji; Brown, Matthew A; Bartlett, Perry F; Mangelsdorf, Marie; Fan, Dongsheng
2015-09-01
A hexanucleotide repeat expansion (HRE) in the C9orf72 gene has been identified as the most common mutation in amyotrophic lateral sclerosis (ALS) among Caucasian populations. We sought to comprehensively evaluate genetic and epigenetic variants of C9orf72 and the contribution of the HRE in Chinese ALS cases. We performed fragment-length and repeat-primed polymerase chain reaction to determine GGGGCC copy number and expansion within the C9orf72 gene in 1092 sporadic ALS (sALS) and 1062 controls from China. We performed haplotype analysis of 23 single-nucleotide polymorphisms within and surrounding C9orf72. The C9orf72 HRE was found in 3 sALS patients (0.3%) but not in control subjects (p = 0.25). For 2 of the cases with the HRE, genotypes of 8 single-nucleotide polymorphisms flanking the HRE were inconsistent with the haplotype reported to be strongly associated with ALS in Caucasian populations. For these 2 individuals, we found hypermethylation of the CpG island upstream of the repeat, an observation not detected in other sALS patients (p < 10(-8)) or controls. The detailed analysis of the C9orf72 locus in a large cohort of Chinese samples provides robust evidence that may not be consistent with a single Caucasian founder event. Both the Caucasian and Chinese haplotypes associated with HRE were highly associated with repeat lengths >8 repeats implying that both haplotypes may confer instability of repeat length. Copyright © 2015 Elsevier Inc. All rights reserved.
van Riet, Job; Krol, Niels M G; Atmodimedjo, Peggy N; Brosens, Erwin; van IJcken, Wilfred F J; Jansen, Maurice P H M; Martens, John W M; Looijenga, Leendert H; Jenster, Guido; Dubbink, Hendrikus J; Dinjens, Winand N M; van de Werken, Harmen J G
2018-03-01
Exploration and visualization of next-generation sequencing data are crucial for clinical diagnostics. Software allowing simultaneous visualization of multiple regions of interest coupled with dynamic heuristic filtering of genetic aberrations is, however, lacking. Therefore, the authors developed the web application SNPitty that allows interactive visualization and interrogation of variant call format files by using B-allele frequencies of single-nucleotide polymorphisms and single-nucleotide variants, coverage metrics, and copy numbers analysis results. SNPitty displays variant alleles and allelic imbalances with a focus on loss of heterozygosity and copy number variation using genome-wide heterozygous markers and somatic mutations. In addition, SNPitty is capable of generating predefined reports that summarize and highlight disease-specific targets of interest. SNPitty was validated for diagnostic interpretation of somatic events by showcasing a serial dilution series of glioma tissue. Additionally, SNPitty is demonstrated in four cancer-related scenarios encountered in daily clinical practice and on whole-exome sequencing data of peripheral blood from a Down syndrome patient. SNPitty allows detection of loss of heterozygosity, chromosomal and gene amplifications, homozygous or heterozygous deletions, somatic mutations, or any combination thereof in regions or genes of interest. Furthermore, SNPitty can be used to distinguish molecular relationships between multiple tumors from a single patient. On the basis of these data, the authors demonstrate that SNPitty is robust and user friendly in a wide range of diagnostic scenarios. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Association mapping of seed and disease resistance traits in Theobroma cacao L.
Motilal, Lambert A; Zhang, Dapeng; Mischke, Sue; Meinhardt, Lyndel W; Boccara, Michel; Fouet, Olivier; Lanaud, Claire; Umaharan, Pathmanathan
2016-12-01
Microsatellite and single nucleotide polymorphism markers that could be used in marker assisted breeding of cacao were identified for number of filled seeds, black pod resistance and witches' broom disease resistance. An association mapping approach was employed to identify markers for seed number and resistance to black pod and witches' broom disease (WBD) in cacao (Theobroma cacao L.). Ninety-five microsatellites (SSRs) and 775 single nucleotide polymorphisms (SNPs) were assessed on 483 unique trees in the International Cocoa Genebank Trinidad (ICGT). Linkage disequilibrium (LD) and association mapping studies were conducted to identify markers to tag the phenotypic traits. Decay of LD occurred over an average 9.3 cM for chromosomes 1-9 and 2.5 cM for chromosome 10. Marker/trait associations were generally identified based on general linear models (GLMs) that incorporated principal components from molecular information on relatedness factor. Seven markers (mTcCIR 8, 66, 126, 212; TcSNP368, 697, 1370) on chromosomes 1 and 9 were identified for number of filled seeds (NSEED). A single marker was found for black pod resistance (mTcCIR280) on chromosome 3, whereas six markers on chromosomes 4, 5, 6, 8, and 10 were detected for WBD (mTcCIR91, 183; TcSNP375, 720, 1230 and 1374). It is expected that this association mapping study in cacao would contribute to the knowledge of the genetic determinism of cocoa traits and that the markers identified herein would prove useful in marker assisted breeding of cacao.
Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl
2012-07-30
This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pathogenesis and Consequences of Uniparental Disomy in Cancer
Makishima, Hideki; Maciejewski, Jaroslaw P.
2012-01-01
Systematic application of new genome-wide single nucleotide polymorphism arrays has demonstrated that somatically acquired regions of loss of heterozygosity (LOH) without changes in copy number frequently occur in many types of cancer. Until recently, the ubiquity of this type of chromosomal defect had remained unrecognized as it cannot be detected using routine cytogenetic technologies. Random and recurrent patterns of copy-neutral LOH, also referred to as uniparental disomy (UPD), can be found in specific cancer types and probably contribute to clonal outgrowth owing to various mechanisms. In this review we explore the types, topography, genesis, pathophysiological consequences and clinical implications of UPD. PMID:21518781
NASA Astrophysics Data System (ADS)
Stuart, M. R.; Pinsky, M. L.
2016-02-01
The ability to use DNA to identify individuals and their offspring has begun to revolutionize marine ecology. However, genetic mark-recapture and parentage studies typically require large numbers of individuals and associated high genotyping costs. Here, we describe a rapid and relatively low-cost protocol for genotyping non-model organisms at thousands of Single Nucleotide Polymorphisms (SNPs) using massively parallel sequencing. We apply the approach to a population of yellowtail clownfish, Amphiprion clarkii, to detect genetic mark-recaptures and parent-offspring relationships. We test multiple bioinformatic approaches and describe how this method could be applied to a wide variety of marine organisms.
Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard
2014-01-01
High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323
Han, Lin; Xin, Ruosai; Sun, Jian; Hou, Feng; Li, Changgui; Hu, Xinlin; Liu, Zhen; Wang, Yao; Li, Xinde; Ren, Wei; Wang, Xuefeng; Jia, Zhaotong
2015-10-01
OBJECTIVE To assess the association of single nucleotide polymorphisms (SNPs) of susceptibility genes of type 2 diabetes mellitus (T2DM) with liability to gout among ethnic Han Chinese males from coastal region of Shandong province. METHODS Seven SNPs within the susceptibility genes of T2DM, including rs10773971(G/C) and rs4766398(G/C) of WNT5B gene, rs10225163(G/C) of JAZF1 gene, rs2069590(T/A) of BDKRB2 gene, rs5745709(G/A) of HGF gene, rs1991914(C/A) of OTOP1 gene and rs2236479(G/A) of COL18A1 gene, were typed with a custom-made Illumina GoldenGate Genotyping assay in 480 male patients with gout and 480 male controls. Potential association was assessed with the chi-square test. RESULTS No significant difference was detected for the 7 selected SNPs in terms of genotypic and allelic frequencies (P > 0.05). When age and body mass index (BMI) were adjusted, the 7 genetic variants still showed no significant association with gout. CONCLUSION The genotypes of the 7 selected SNPs are not associated with gout in ethnic Han Chinese male patients from the coastal region of Shandong province. However, the results need to be replicated in larger sets of patients collected from other regions and populations.
Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Saijo, Y; Namiki, M; Sengoku, K
2014-04-01
Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, ten novel genes involved in human spermatogenesis, including human LRWD1, have been identified by expression microarray analysis of human testictissue. The human LRWD1 protein mediates the origin recognition complex in chromatin, which is critical for the initiation of pre-replication complex assembly in G1 and chromatin organization in post-G1 cells. The Lrwd1 gene expression is specific to the testis in mice. Therefore, we hypothesized that mutation or polymorphisms of LRWD1 participate in male infertility, especially azoospermia. To investigate whether LRWD1 gene defects are associated with azoospermia caused by SCOS and meiotic arrest (MA), mutational analysis was performed in 100 and 30 Japanese patients by direct sequencing of the coding regions, respectively. Statistical analysis was performed for patients with SCOS and MA and in 100 healthy control men. No mutations were found in LRWD1; however, three coding single-nucleotide polymorphisms (SNP1-SNP3) could be detected in the patients. The genotype and allele frequencies in SNP1 and SNP2 were notably higher in the SCOS group than in the control group (P < 0.05). These results suggest the critical role of LRWD1 in human spermatogenesis. © 2013 Blackwell Verlag GmbH.
Fluorescent signatures for variable DNA sequences
Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.
2012-01-01
Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378
Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.
2013-01-01
Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145
Wu, Jiangdong; Lu, Lijun; Zhang, Le; Ding, Yulei; Wu, Fang; Zuo, Weize; Zhang, Wanjiang
2015-01-01
Objective. Our study investigated the association between single nucleotide polymorphisms (SNPs) in P2X7 gene and serum immunoglobulin G (IgG) responses to mycobacterium tuberculosis (MTB) in TB patients. Methods. A total of 103 TB patients were enrolled as case group and 87 healthy individuals at same geographical region as control group. The SNP detection of 1513A>C and -762T>C was performed using PCR-RFLP, and the levels of serum IgG responses to MTB in all subjects were determined. Results. AC and CC of 1513A>C and TC and CC of -762T>C had higher frequencies in case group than in control group. TB patients carrying TC and CC of -762T>C had higher positive rate of IgG responses to MTB than those carrying TT. Additionally, patients carrying TC and CC of -762T>C had more MTB in sputum than those carrying TT. Conclusion. P2X7 SNPs, 1513A>C and -762T>C, may be associated with the susceptibility to tuberculosis, and -762T>C SNP may contribute to the development of MTB. The mutant genotype of -762T>C (TC and CC) may lower human capability of phagocytosis to MTB, leading to an increased morbidity of TB. PMID:26798189
Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica
2013-01-01
Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929
Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica
2014-01-01
The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.
Zhao, Na; Xiao, Jianqiu; Zheng, Zhiyong; Fei, Guoqiang; Zhang, Feng; Jin, Lirong; Zhong, Chunjiu
2015-04-01
Our previous studies have demonstrated that ceruloplasmin (CP) dysmetabolism is correlated with Parkinson's disease (PD). However, the causes of decreased serum CP levels in PD patients remain to be clarified. This study aimed to explore the potential association between genetic variants of the CP gene and PD. Clinical features, serum CP levels, and the CP gene (both promoter and coding regions) were analyzed in 60 PD patients and 50 controls. A luciferase reporter system was used to investigate the function of promoter single-nucleotide polymorphisms (SNPs). High-density comparative genomic hybridization microarrays were also used to detect large-scale copy-number variations in CP and an additional 47 genes involved in PD and/or copper/iron metabolism. The frequencies of eight SNPs (one intronic SNP and seven promoter SNPs of the CP gene) and their haplotypes were significantly different between PD patients, especially those with lowered serum CP levels, and controls. However, the luciferase reporter system revealed no significant effect of the risk haplotype on promoter activity of the CP gene. Neither these SNPs nor their haplotypes were correlated with the Hoehn and Yahr staging of PD. The results of this study suggest that common genetic variants of CP are associated with PD and further investigation is needed to explore their functions in PD.
Feng, Xing-Ling; Sun, Qi-Fan; Liu, Hong; Wei, Yi-Liang; DU, Wei-An; Li, Cai-Xia; Chen, Ling; Liu, Chao
2016-04-20
To validate the efficiency of 27-plex single nucleotide polymorphism (SNP) multiplex system for ancestry inference. The 27-plex SNP system was validated for its sensitivity and species specificity. A total of 533 samples were collected from African, Southern Chinese Han, China's ethic minorities (Yi, Hui, Miao, Tibet, and Uygur), European, Central Asian, Western Asian, Southern Asian, Southeast Asian and South American populations for clustering analysis of the genotypes by citing 3 representative continental ancestral groups [East Asia (CHB), Europe (CEU), and Africa (YRI)] from HapMap database. The system sensitivity is 0.125 ng. Twenty and six genotypes were detected in chimpanzee and monkeys, respectively. Except in rs10496971, no more products were found in other animals. The system was capable of differentiating intercontinental populations but not of distinguishing between East Asian and Southeast Asian population or between Southern Chinese Han population and Chinese Ethnic populations (Hui, Miao, Yi and Tibet). This system achieved a 100% accuracy for intercontinental population source inference for 46 blind test samples. 27-plex SNPs multiplex system has a high sensitivity and species specificity and can correctly differentiate the ancestry origins of individuals from African, European and East Asian for criminal case investigation. But this system is not capable of distinguishing subpopulation groups and more specific ancestry-informative markers are needed to improve its recognition of Southeast Asian and Chinese ethnic populations.