Sample records for detection limit reached

  1. Reaching quantum limits for phase-shift detection with semiclassical states

    NASA Astrophysics Data System (ADS)

    Luis, Alfredo

    2004-01-01

    We present two measuring strategies reaching the Heisenberg limit for phase-shift measurements using semiclassical coherent states exclusively. We examine their performance by assuming practical experimental conditions such as losses and nonideal detectors.

  2. Failure detection system risk reduction assessment

    NASA Technical Reports Server (NTRS)

    Aguilar, Robert B. (Inventor); Huang, Zhaofeng (Inventor)

    2012-01-01

    A process includes determining a probability of a failure mode of a system being analyzed reaching a failure limit as a function of time to failure limit, determining a probability of a mitigation of the failure mode as a function of a time to failure limit, and quantifying a risk reduction based on the probability of the failure mode reaching the failure limit and the probability of the mitigation.

  3. Detection of Brucellosis in Sika Deer ( Cervus nippon ) through Loop-mediated Isothermal Amplification (LAMP).

    PubMed

    Liu, Qianhong; Wei, Jie; Sun, Qingsong; Wang, Ben; Wang, Yuting; Hu, Ying; Wu, Wenrong

    2017-07-01

    Brucellosis (Brucella bovis) in sika deer ( Cervus nippon ) can cause enormous losses to stag breeding, especially in areas in which stag breeding has become an important industry. It also poses a threat to humans because it is a zoonotic disease. Use of the loop-mediated isothermal amplification (LAMP) assay has been poorly described in the diagnosis of brucellosis in deer. We developed a LAMP assay targeting the omp25 gene sequence to detect brucellosis in sika deer. The reaction can be completed in 60 min at 63 C and, with a detection limit of 17 pg, it was more sensitive than conventional PCR, with its detection limit of 1.7 ng. No cross-reactivity was observed with four bacteria: Escherichia coli , Salmonella enterica subsp. enterica, Clostridium pasteurianum , and Pseudomonas aeruginosa . We used 263 samples of blood to evaluate the reaction. The percentage of agreement between LAMP and PCR reached 91%; relative specificity reached 87%, and relative sensitivity reached 100%. The results indicate LAMP can be a simple and rapid diagnostic tool for detecting brucellosis in sika deer, particularly in the field, where it is essential to control brucellosis in deer with a rapid and accurate diagnosis for removal of positive animals.

  4. Modeling of a Single-Notch Microfiber Coupler for High-Sensitivity and Low Detection-Limit Refractive Index Sensing.

    PubMed

    Zhang, Jiali; Shi, Lei; Zhu, Song; Xu, Xinbiao; Zhang, Xinliang

    2016-05-11

    A highly sensitive refractive index sensor with low detection limit based on an asymmetric optical microfiber coupler is proposed. It is composed of a silica optical microfiber and an As₂Se₃ optical microfiber. Due to the asymmetry of the microfiber materials, a single-notch transmission spectrum is demonstrated by the large refractive index difference between the two optical microfibers. Compared with the symmetric coupler, the bandwidth of the asymmetric structure is over one order of magnitude narrower than that of the former. Therefore, the asymmetric optical microfiber coupler based sensor can reach over one order of magnitude smaller detection limit, which is defined as the minimal detectable refractive index change caused by the surrounding analyte. With the advantage of large evanescent field, the results also show that a sensitivity of up to 3212 nm per refractive index unit with a bandwidth of 12 nm is achieved with the asymmetric optical microfiber coupler. Furthermore, a maximum sensitivity of 4549 nm per refractive index unit can be reached while the radii of the silica optical microfiber and As₂Se₃ optical microfiber are 0.5 μm and a 0.128 μm, respectively. This sensor component may have important potential for low detection-limit physical and biochemical sensing applications.

  5. High-Field Quench Behavior and Protection of $$Bi_2 Sr_2 Ca Cu_2 O_x$$ Coils: Minimum and Maximum Quench Detection Voltages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shen, Tengming; Ye, Liyang; Turrioni, Daniele

    Small insert coils have been built using a multifilamentary Bi2Sr2CaCu2Ox round wire, and characterized in background fields to explore the quench behaviors and limits of Bi2Sr2CaCu2Ox superconducting magnets, with an emphasis on assessing the impact of slow normal zone propagation on quench detection. Using heaters of various lengths to initiate a small normal zone, a coil was quenched safely more than 70 times without degradation, with the maximum coil temperature reaching 280 K. Coils withstood a resistive voltage of tens of mV for seconds without quenching, showing the high stability of these coils and suggesting that the quench detection voltagemore » shall be greater than 50 mV to not to falsely trigger protection. The hot spot temperature for the resistive voltage of the normal zone to reach 100 mV increases from ~40 K to ~80 K with increasing the operating wire current density Jo from 89 A/mm2 to 354 A/mm2 whereas for the voltage to reach 1 V, it increases from ~60 K to ~140 K, showing the increasing negative impact of slow normal zone propagation on quench detection with increasing Jo and the need to limit the quench detection voltage to < 1 V. These measurements, coupled with an analytical quench model, were used to access the impact of the maximum allowable voltage and temperature upon quench detection on the quench protection, assuming to limit the hot spot temperature to <300 K.« less

  6. Sensor Fusion to Infer Locations of Standing and Reaching Within the Home in Incomplete Spinal Cord Injury.

    PubMed

    Lonini, Luca; Reissman, Timothy; Ochoa, Jose M; Mummidisetty, Chaithanya K; Kording, Konrad; Jayaraman, Arun

    2017-10-01

    The objective of rehabilitation after spinal cord injury is to enable successful function in everyday life and independence at home. Clinical tests can assess whether patients are able to execute functional movements but are limited in assessing such information at home. A prototype system is developed that detects stand-to-reach activities, a movement with important functional implications, at multiple locations within a mock kitchen. Ten individuals with incomplete spinal cord injuries performed a sequence of standing and reaching tasks. The system monitored their movements by combining two sources of information: a triaxial accelerometer, placed on the subject's thigh, detected sitting or standing, and a network of radio frequency tags, wirelessly connected to a wrist-worn device, detected reaching at three locations. A threshold-based algorithm detected execution of the combined tasks and accuracy was measured by the number of correctly identified events. The system was shown to have an average accuracy of 98% for inferring when individuals performed stand-to-reach activities at each tag location within the same room. The combination of accelerometry and tags yielded accurate assessments of functional stand-to-reach activities within a home environment. Optimization of this technology could simplify patient compliance and allow clinicians to assess functional home activities.

  7. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  8. Heisenberg limit for displacements with semiclassical states

    NASA Astrophysics Data System (ADS)

    Luis, Alfredo

    2004-04-01

    We analyze the quantum limit to the sensitivity of the detection of small displacements. We focus on the case of free particles and harmonic oscillators as the systems experiencing the displacement. We show that the minimum displacement detectable is proportional to the inverse of the square root of the mean value of the energy in the state experiencing the displacement (Heisenberg limit). We present a measuring scheme that reaches this limit using semiclassical states. We examine the performance of this strategy under realistic practical conditions by computing the effect of imperfections such as losses and nonunit detection efficiencies. This analysis confirms the robustness of this measuring strategy by showing that the experimental imperfections can be suitably compensated by increasing the mean energy of the input state.

  9. Determination of Trace Available Heavy Metals in Soil Using Laser-Induced Breakdown Spectroscopy Assisted with Phase Transformation Method.

    PubMed

    Yi, Rongxing; Yang, Xinyan; Zhou, Ran; Li, Jiaming; Yu, Huiwu; Hao, Zhongqi; Guo, Lianbo; Li, Xiangyou; Lu, Yongfeng; Zeng, Xiaoyan

    2018-05-18

    To detect available heavy metals in soil using laser-induced breakdown spectroscopy (LIBS) and improve its poor detection sensitivity, a simple and low cost sample pretreatment method named solid-liquid-solid transformation was proposed. By this method, available heavy metals were extracted from soil through ultrasonic vibration and centrifuging and then deposited on a glass slide. Utilization of this solid-liquid-solid transformation method, available Cd and Pb elements in soil were detected successfully. The results show that the regression coefficients of calibration curves for soil analyses reach to more than 0.98. The limits of detection could reach to 0.067 and 0.94 ppm for available Cd and Pb elements in soil under optimized conditions, respectively, which are much better than those obtained by conventional LIBS.

  10. Cicada wing decorated by silver nanoparticles as low-cost and active/sensitive substrates for surface-enhanced Raman scattering

    NASA Astrophysics Data System (ADS)

    Guo, Lei; Zhang, Chang Xing; Deng, Li; Zhang, Guo Xin; Xu, Hai Jun; Sun, Xiao Ming

    2014-06-01

    A green, low-cost and highly efficient surface-enhanced Raman scattering (SERS) substrate was achieved by a chemical deposition of silver nanoparticles on a cicada wing, which has the large-scale nanosized protrusions on its surface. Employing the already-formed Ag/cicada wing as substrate for SERS detection, the detection limit for rhodamine 6G could reach 10-7M, the Raman enhancement factor of the substrate was as large as 106 and the relative standard deviation remains lower than 7%. The three-dimensional finite-difference time-domain simulation results showed that two types of inter-Ag-nanoparticle nanogaps in the formed geometry created a huge number of SERS "hot spots" where the electromagnetic field is substantially amplified and contributes to the higher SERS sensitivity. Meanwhile, the water contact angle of the SERS substrate is roughly 150°, which indicates the super-hydrophobic surface of the substrate. This feature may be conducive to the gathering of target molecules during the SERS detection, which in turn further improves the detection limit of target molecules. In order to improve the application of the substrate, thiram was used as the probe molecule, and the detection limit also reached 10-7 M. Meanwhile, the calibration of the Raman peak intensities of Rhodamine 6G and thiram allowed their quantitative detection. Therefore, the green and low-cost SERS substrates could be used for fast and quantitative detection of trace organic molecules. Our findings may contribute to the development of the green and low-cost SERS substrates and will allow the fast and quantitative detection of trace organic molecules.

  11. Laser-induced fluorescence microscopic system using an optical parametric oscillator for tunable detection in microchip analysis.

    PubMed

    Kumemura, Momoko; Odake, Tamao; Korenaga, Takashi

    2005-06-01

    A laser-induced fluorescence microscopic system based on optical parametric oscillation has been constructed as a tunable detector for microchip analysis. The detection limit of sulforhodamine B (Ex. 520 nm, Em. 570 nm) was 0.2 mumol, which was approximately eight orders of magnitude better than with a conventional fluorophotometer. The system was applied to the determination of fluorescence-labeled DNA (Ex. 494 nm, Em. 519 nm) in a microchannel and the detection limit reached a single molecule. These results showed the feasibility of this system as a highly sensitive and tunable fluorescence detector for microchip analysis.

  12. New improvements in methane detection using a Helmholtz resonant photoacoustic laser sensor: a comparison between near-IR diode lasers and mid-IR quantum cascade lasers.

    PubMed

    Grossel, Agnès; Zeninari, Virginie; Joly, Lilian; Parvitte, Bertrand; Courtois, Daniel; Durry, Georges

    2006-04-01

    Atmospheric methane was detected by combining a photoacoustic (PA) sensor with several lasers emitting in both the near- and mid-infrared spectral ranges to check the achievable detection limits. The PA spectrometer is based on differential Helmholtz resonance. Near-infrared telecommunication-type laser diodes of increasing power, from Sensors Unlimited Inc. and Anritsu, were first used to scan the 2 nu(3) band of CH(4) near 1.65 microm. The best achieved detection limit is 0.15 ppm of methane at atmospheric pressure and with a 1s integration time. The PA sensor was then operated in conjunction with a quantum cascade laser from Alpes Lasers emitting near 7.9 microm on the nu(4) band of CH(4). The achieved detection limit is then of 3 ppb. The dramatic improvement in the detection limit obtained with the QC laser is due to the stronger optical power as well as to the capability of reaching the fundamental bands of methane lying in the mid-infrared spectral range.

  13. Radio-frequency Electrometry Using Rydberg Atoms in Vapor Cells: Towards the Shot Noise Limit

    NASA Astrophysics Data System (ADS)

    Kumar, Santosh; Fan, Haoquan; Jahangiri, Akbar; Kuebler, Harald; Shaffer, James P.; 5. Physikalisches Institut, Universitat Stuttgart, Germany Collaboration

    2016-05-01

    Rydberg atoms are a promising candidate for radio frequency (RF) electric field sensing. Our method uses electromagnetically induced transparency with Rydberg atoms in vapor cells to read out the effect that the RF electric field has on the Rydberg atoms. The method has the potential for high sensitivity (pV cm-1 Hz- 1 / 2) and can be self-calibrated. Some of the main factors limiting the sensitivity of RF electric field sensing from reaching the shot noise limit are the residual Doppler effect and the sensitivity of the optical read-out using the probe laser. We present progress on overcoming the residual Doppler effect by using a new multi-photon scheme and reaching the shot noise detection limit using frequency modulated spectroscopy. Our experiments also show promise for studying quantum optical effects such as superradiance in vapor cells using Rydberg atoms. This work is supported by DARPA, ARO, and NRO.

  14. Ultrasensitive detection of phenolic antioxidants by surface enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Ornelas-Soto, N.; Aguilar-Hernández, I. A.; Afseth, N.; López-Luke, T.; Contreras-Torres, F. F.; Wold, J. P.

    2017-08-01

    Surface-Enhanced Raman Spectroscopy (SERS) is a powerful surface-sensitive technique to study the vibrational properties of analytes at very low concentrations. In this study, ferulic acid, p-coumaric acid, caffeic acid and sinapic acid were analyzed by SERS using Ag colloids. Analytes were detected up to 2.5x10-9M. For caffeic acid and coumaric acid, this detection limit has been reached for the first time, as well as the SERS analysis of sinapic acid using silver colloids.

  15. Reaching the quantum limit of sensitivity in electron spin resonance

    DOE PAGES

    Bienfait, A.; Pla, J. J.; Kubo, Y.; ...

    2015-12-14

    The detection and characterization of paramagnetic species by electron spin resonance (ESR) spectroscopy is widely used throughout chemistry, biology and materials science, from in vivo imaging to distance measurements in spin-labelled proteins. ESR relies on the inductive detection of microwave signals emitted by the spins into a coupled microwave resonator during their Larmor precession. However, such signals can be very small, prohibiting the application of ESR at the nanoscale (for example, at the single-cell level or on individual nanoparticles). Here in this work, using a Josephson parametric microwave amplifier combined with high-quality-factor superconducting microresonators cooled at millikelvin temperatures, we improvemore » the state-of-the-art sensitivity of inductive ESR detection by nearly four orders of magnitude. We demonstrate the detection of 1,700 bismuth donor spins in silicon within a single Hahn echo with unit signal-to-noise ratio, reduced to 150 spins by averaging a single Carr-Purcell-Meiboom-Gill sequence. This unprecedented sensitivity reaches the limit set by quantum fluctuations of the electromagnetic field instead of thermal or technical noise, which constitutes a novel regime for magnetic resonance. In conclusion, the detection volume of our resonator is ~0.02nl, and our approach can be readily scaled down further to improve sensitivity, providing a new versatile toolbox for ESR at the nanoscale.« less

  16. Optimization and characterization of condensation nucleation light scattering detection coupled with supercritical fluid chromatography

    NASA Astrophysics Data System (ADS)

    Yang, Shaoping

    This dissertation is an investigation of two aspects of coupling condensation nucleation light scattering detection (CNLSD) with supercritical fluid chromatography (SFC). In the first part, it was demonstrated that CNLSD was compatible with packed column SFC using either pure CO2 or organic solvent modified CO2 as mobile phases. Factors which were expected to affect the interface between SFC and CNLSD were optimized for the detector to reach low detection limits. With SFC using pure CO2 as mobile phase, the detection limit of CNLSD with SFC was observed to be at low nanogram levels, which was at the same level of flame ionization detection (FID) coupled with SFC. For SFC using modified CO2 as mobile phase, detection limits at the picogram level were observed for CNLSD at optimal conditions, which were at least ten times lower than those reached by evaporative light scattering detection. In the second part, particle size distributions of aerosols produced from rapid expansion of supercritical solutions were measured with a scanning mobility particle sizer. The effect of the factors, which were investigated in the first part for their effects on signal intensities and signal to noise ratios (S/N), on particle size distributions (PSDs) of both analyte and background were investigated. Whenever possible, both particle sizes and particle number obtained from PSDs were used to explain the optimization results. In general, PSD data support the observations made in the first part. The detection limits of CNLSD obtained were much higher than predicted. PSDs did not provide direct explanation of this problem. The amount of analyte deposited in the transport tubing, evaporated to gas phase, and condensed to form particles was determined experimentally. Almost no analyte was found in the gas phase. Less than 3% was found in the particle forms. The vast majority of analyte was lost in the transport tubing, especially in the short distance after supercritical fluid expansion. A mechanism was proposed to explain the loss of analyte in the transport tubing.

  17. Fast Detection of Copper Content in Rice by Laser-Induced Breakdown Spectroscopy with Uni- and Multivariate Analysis.

    PubMed

    Liu, Fei; Ye, Lanhan; Peng, Jiyu; Song, Kunlin; Shen, Tingting; Zhang, Chu; He, Yong

    2018-02-27

    Fast detection of heavy metals is very important for ensuring the quality and safety of crops. Laser-induced breakdown spectroscopy (LIBS), coupled with uni- and multivariate analysis, was applied for quantitative analysis of copper in three kinds of rice (Jiangsu rice, regular rice, and Simiao rice). For univariate analysis, three pre-processing methods were applied to reduce fluctuations, including background normalization, the internal standard method, and the standard normal variate (SNV). Linear regression models showed a strong correlation between spectral intensity and Cu content, with an R 2 more than 0.97. The limit of detection (LOD) was around 5 ppm, lower than the tolerance limit of copper in foods. For multivariate analysis, partial least squares regression (PLSR) showed its advantage in extracting effective information for prediction, and its sensitivity reached 1.95 ppm, while support vector machine regression (SVMR) performed better in both calibration and prediction sets, where R c 2 and R p 2 reached 0.9979 and 0.9879, respectively. This study showed that LIBS could be considered as a constructive tool for the quantification of copper contamination in rice.

  18. Fast Detection of Copper Content in Rice by Laser-Induced Breakdown Spectroscopy with Uni- and Multivariate Analysis

    PubMed Central

    Ye, Lanhan; Song, Kunlin; Shen, Tingting

    2018-01-01

    Fast detection of heavy metals is very important for ensuring the quality and safety of crops. Laser-induced breakdown spectroscopy (LIBS), coupled with uni- and multivariate analysis, was applied for quantitative analysis of copper in three kinds of rice (Jiangsu rice, regular rice, and Simiao rice). For univariate analysis, three pre-processing methods were applied to reduce fluctuations, including background normalization, the internal standard method, and the standard normal variate (SNV). Linear regression models showed a strong correlation between spectral intensity and Cu content, with an R2 more than 0.97. The limit of detection (LOD) was around 5 ppm, lower than the tolerance limit of copper in foods. For multivariate analysis, partial least squares regression (PLSR) showed its advantage in extracting effective information for prediction, and its sensitivity reached 1.95 ppm, while support vector machine regression (SVMR) performed better in both calibration and prediction sets, where Rc2 and Rp2 reached 0.9979 and 0.9879, respectively. This study showed that LIBS could be considered as a constructive tool for the quantification of copper contamination in rice. PMID:29495445

  19. Development of capillary electrophoresis methods for quantitative determination of taurine in vehicle system and biological media.

    PubMed

    da Silva, Dayse L P; Rüttinger, Hans H; Mrestani, Yahia; Baum, Walter F; Neubert, Reinhard H H

    2006-06-01

    CE methods have been developed for the determination of taurine in pharmaceutical formulation (microemulsion) and in biological media such as sweat. The CE system with end-column pulsed amperometric detection has been found to be an interesting method in comparison with UV and fluorescence detection for its simplicity and rapidity. A gold-disk electrode of 100 mm diameter was used as the working electrode. The effects of a field decoupler at the end of the capillary, separation voltage, injection and pressure times were investigated. A detection limit of 4 x 10(-5) mol/L was reached using integrated pulsed amperometric detection, a method successfully applied to taurine analysis of the biological samples such as sweat. For taurine analysis of oil-in-water microemulsion, fluorescence detector was the favored method, the detection limit of which was 4 x 10(-11) mol/L.

  20. Non-contact photoacoustic tomography and ultrasonography for tissue imaging

    PubMed Central

    Rousseau, Guy; Blouin, Alain; Monchalin, Jean-Pierre

    2011-01-01

    The detection of ultrasound in photoacoustic tomography (PAT) and ultrasonography (US) usually relies on ultrasonic transducers in contact with the biological tissue. This is a major drawback for important potential applications such as surgery and small animal imaging. Here we report the use of remote optical detection, as used in industrial laser-ultrasonics, to detect ultrasound in biological tissues. This strategy enables non-contact implementation of PAT and US without exceeding laser exposure safety limits. The method uses suitably shaped laser pulses and a confocal Fabry-Perot interferometer in differential configuration to reach quantum-limited sensitivity. Endogenous and exogenous inclusions exhibiting optical and acoustic contrasts were detected ex vivo in chicken breast and calf brain specimens. Inclusions down to 0.5 mm in size were detected at depths well exceeding 1 cm. The method could significantly expand the scope of applications of PAT and US in biomedical imaging. PMID:22254164

  1. Phase magnification by two-axis countertwisting for detection-noise robust interferometry

    NASA Astrophysics Data System (ADS)

    Anders, Fabian; Pezzè, Luca; Smerzi, Augusto; Klempt, Carsten

    2018-04-01

    Entanglement-enhanced atom interferometry has the potential of surpassing the standard quantum limit and eventually reaching the ultimate Heisenberg bound. The experimental progress is, however, hindered by various technical noise sources, including the noise in the detection of the output quantum state. The influence of detection noise can be largely overcome by exploiting echo schemes, where the entanglement-generating interaction is repeated after the interferometer sequence. Here, we propose an echo protocol that uses two-axis countertwisting as the main nonlinear interaction. We demonstrate that the scheme is robust to detection noise and its performance is superior compared to the already demonstrated one-axis twisting echo scheme. In particular, the sensitivity maintains the Heisenberg scaling in the limit of a large particle number. Finally, we show that the protocol can be implemented with spinor Bose-Einstein condensates. Our results thus outline a realistic approach to mitigate the detection noise in quantum-enhanced interferometry.

  2. Highly sensitive sandwich immunoassay and immunochromatographic test for the detection of Clostridial epsilon toxin in complex matrices.

    PubMed

    Féraudet-Tarisse, Cécile; Mazuet, Christelle; Pauillac, Serge; Krüger, Maren; Lacroux, Caroline; Popoff, Michel R; Dorner, Brigitte G; Andréoletti, Olivier; Plaisance, Marc; Volland, Hervé; Simon, Stéphanie

    2017-01-01

    Epsilon toxin is one of the four major toxins of Clostridium perfringens. It is the third most potent clostridial toxin after botulinum and tetanus toxins and is thus considered as a potential biological weapon classified as category B by the Centers for Disease Control and Prevention (CDC). In the case of a bioterrorist attack, there will be a need for a rapid, sensitive and specific detection method to monitor food and water contamination by this toxin, and for a simple human diagnostic test. We have produced and characterized five monoclonal antibodies against common epitopes of epsilon toxin and prototoxin. Three of them neutralize the cytotoxic effects of epsilon toxin in vitro. With these antibodies, we have developed highly sensitive tests, overnight and 4-h sandwich enzyme immunoassays and an immunochromatographic test performed in 20 min, reaching detection limits of at least 5 pg/mL (0.15 pM), 30 pg/mL (0.9 pM) and 100 pg/mL (3.5 pM) in buffer, respectively. These tests were also evaluated for detection of epsilon toxin in different matrices: milk and tap water for biological threat detection, serum, stool and intestinal content for human or veterinary diagnostic purposes. Detection limits in these complex matrices were at least 5-fold better than those described in the literature (around 1 to 5 ng/mL), reaching 10 to 300 pg/mL using the enzyme immunoassay and 100 to 2000 pg/mL using the immunochromatographic test.

  3. Highly sensitive sandwich immunoassay and immunochromatographic test for the detection of Clostridial epsilon toxin in complex matrices

    PubMed Central

    Mazuet, Christelle; Pauillac, Serge; Krüger, Maren; Lacroux, Caroline; Popoff, Michel R.; Dorner, Brigitte G.; Andréoletti, Olivier; Plaisance, Marc; Volland, Hervé; Simon, Stéphanie

    2017-01-01

    Epsilon toxin is one of the four major toxins of Clostridium perfringens. It is the third most potent clostridial toxin after botulinum and tetanus toxins and is thus considered as a potential biological weapon classified as category B by the Centers for Disease Control and Prevention (CDC). In the case of a bioterrorist attack, there will be a need for a rapid, sensitive and specific detection method to monitor food and water contamination by this toxin, and for a simple human diagnostic test. We have produced and characterized five monoclonal antibodies against common epitopes of epsilon toxin and prototoxin. Three of them neutralize the cytotoxic effects of epsilon toxin in vitro. With these antibodies, we have developed highly sensitive tests, overnight and 4-h sandwich enzyme immunoassays and an immunochromatographic test performed in 20 min, reaching detection limits of at least 5 pg/mL (0.15 pM), 30 pg/mL (0.9 pM) and 100 pg/mL (3.5 pM) in buffer, respectively. These tests were also evaluated for detection of epsilon toxin in different matrices: milk and tap water for biological threat detection, serum, stool and intestinal content for human or veterinary diagnostic purposes. Detection limits in these complex matrices were at least 5-fold better than those described in the literature (around 1 to 5 ng/mL), reaching 10 to 300 pg/mL using the enzyme immunoassay and 100 to 2000 pg/mL using the immunochromatographic test. PMID:28700661

  4. A green, reusable SERS film with high sensitivity for in-situ detection of thiram in apple juice

    NASA Astrophysics Data System (ADS)

    Sun, Hongbao; Liu, Hai; Wu, Yiyong

    2017-09-01

    We report a green and reusable surface-enhanced Raman scattering (SERS) film based on PMMA/Ag NPs/graphene. By using this Raman substrate, the SERS signals of R6G were significantly enhanced reaching a minimum detectable concentration of 5 × 10-8 M, due to having lots of hot spots adhered backside to the exposed graphene. The SERS film can be used for in-situ monitoring of trace thiram in apple juice with a detection limit of 1 × 10-6 M (0.24 ppm), which is below the maximal residue limit (MRL) of 7 ppm in fruit prescribed by the U.S. Environmental Protection Agency (EPA). Furthermore, reusability studies show that the SERS film can be used repeatedly. In addition, the graphene-enhanced SERS technique shows great potential applications for the in-situ detection and identification of pesticide residues in environmental water, fruits and vegetables.

  5. Enhanced aerodynamic reach of vapor and aerosol sampling for real-time mass spectrometric detection using Venturi-assisted entrainment and ionization

    PubMed Central

    Forbes, Thomas P.; Staymates, Matthew

    2017-01-01

    Venturi-assisted ENTrainment and Ionization (VENTI) was developed, demonstrating efficient entrainment, collection, and transport of remotely sampled vapors, aerosols, and dust particulate for real-time mass spectrometry (MS) detection. Integrating the Venturi and Coandă effects at multiple locations generated flow and analyte transport from non-proximate locations and more importantly enhanced the aerodynamic reach at the point of collection. Transport through remote sampling probes up to 2.5 m in length was achieved with residence times on the order of 10-2 s to 10-1 s and Reynolds numbers on the order of 103 to 104. The Venturi-assisted entrainment successfully enhanced vapor collection and detection by greater than an order of magnitude at 20 cm stand-off (limit of simple suction). This enhancement is imperative, as simple suction restricts sampling to the immediate vicinity, requiring close proximity to the vapor source. In addition, the overall aerodynamic reach distance was increased by approximately 3-fold over simple suction under the investigated conditions. Enhanced aerodynamic reach was corroborated and observed with laser-light sheet flow visualization and schlieren imaging. Coupled with atmospheric pressure chemical ionization (APCI), the detection of a range of volatile chemical vapors; explosive vapors; explosive, narcotic, and mustard gas surrogate (methyl salicylate) aerosols; and explosive dust particulate was demonstrated. Continuous real-time Venturi-assisted monitoring of a large room (approximately 90 m2 area, 570 m3 volume) was demonstrated for a 60-minute period without the remote sampling probe, exhibiting detection of chemical vapors and methyl salicylate at approximately 3 m stand-off distances within 2 minutes of exposure. PMID:28107830

  6. Enhanced aerodynamic reach of vapor and aerosol sampling for real-time mass spectrometric detection using Venturi-assisted entrainment and ionization.

    PubMed

    Forbes, Thomas P; Staymates, Matthew

    2017-03-08

    Venturi-assisted ENTrainment and Ionization (VENTI) was developed, demonstrating efficient entrainment, collection, and transport of remotely sampled vapors, aerosols, and dust particulate for real-time mass spectrometry (MS) detection. Integrating the Venturi and Coandă effects at multiple locations generated flow and analyte transport from non-proximate locations and more importantly enhanced the aerodynamic reach at the point of collection. Transport through remote sampling probes up to 2.5 m in length was achieved with residence times on the order of 10 -2  s to 10 -1  s and Reynolds numbers on the order of 10 3 to 10 4 . The Venturi-assisted entrainment successfully enhanced vapor collection and detection by greater than an order of magnitude at 20 cm stand-off (limit of simple suction). This enhancement is imperative, as simple suction restricts sampling to the immediate vicinity, requiring close proximity to the vapor source. In addition, the overall aerodynamic reach distance was increased by approximately 3-fold over simple suction under the investigated conditions. Enhanced aerodynamic reach was corroborated and observed with laser-light sheet flow visualization and schlieren imaging. Coupled with atmospheric pressure chemical ionization (APCI), the detection of a range of volatile chemical vapors; explosive vapors; explosive, narcotic, and mustard gas surrogate (methyl salicylate) aerosols; and explosive dust particulate was demonstrated. Continuous real-time Venturi-assisted monitoring of a large room (approximately 90 m 2 area, 570 m 3 volume) was demonstrated for a 60-min period without the remote sampling probe, exhibiting detection of chemical vapors and methyl salicylate at approximately 3 m stand-off distances within 2 min of exposure. Published by Elsevier B.V.

  7. Tin speciation in the femtogram range in open ocean seawater by gas chromatography/inductively coupled plasma mass spectrometry using a shield torch at normal plasma conditions.

    PubMed

    Tao, H; Rajendran, R B; Quetel, C R; Nakazato, T; Tominaga, M; Miyazaki, A

    1999-10-01

    A sensitive method for the determination of ultratrace organotin species in seawater is described. The merits and demerits of derivatization methods using Grignard reagent or sodium tetraethylborate (NaBEt4) were evaluated in terms of derivatization efficiency, applicability to the programmed temperature vaporization (PTV) method, and procedural blanks. The sensitivity of the gas chromatography/inductively coupled plasma mass spectrometry (GC/ICPMS) was improved by more than 100-fold by operating the shield torch at normal plasma conditions, compared with that obtained without using it. The absolute detection limit as tin reached subfemtogram (fg) levels. Furthermore, the detection limit in terms of relative concentration was improved 100-fold by using the PTV method, which enabled the injection of a large sample volume of as much as 100 microL without loss of analyte. When the organotin species in seawater were extracted into hexane with a preconcentration factor of 1000 after ethylation with NaBEt4 and a 100 microL aliquot of the extract was injected into the GC, the instrumental detection limit in relative concentration reached 0.01 pg/L in original seawater. Sources of contamination of organotin species during the sample preparation were examined, and a purification method of NaBEt4 was developed. Finally, the method was successfully applied to open ocean seawater samples containing organotin species at the level of 1-100 pg/L.

  8. Fast and Accurate Detection of Spread Source in Large Complex Networks

    DTIC Science & Technology

    the patient one in epidemics, or source of rumor spreading in social network. Pinto, Thiran and Vetterli introduced an algorithm (PTVA) to solve the...important case of this problem in which a limited set of nodes act as observers and report times at which the spread reached them. PTVA uses all

  9. Amplification of interference color by using liquid crystal for protein detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Qingdi; Yang, Kun-Lin, E-mail: cheyk@nus.edu.sg

    Micrometer-sized, periodic protein lines printed on a solid surface cause interference color which is invisible to the naked eye. However, the interference color can be amplified by using a thin layer of liquid crystal (LC) covered on the surface to form a phase diffraction grating. Strong interference color can thus be observed under ambient light. By using the LC-amplified interference color, we demonstrate naked-eye detection of a model protein—immunoglobulin G (IgG). Limit of detection can reach 20 μg/ml of IgG without using any instrumentation. This detection method is potentially useful for the development of low-cost and portable biosensors.

  10. An improved method for undertaking limiting dilution assays for in vitro cloning of Plasmodium falciparum parasites.

    PubMed

    Butterworth, Alice S; Robertson, Alan J; Ho, Mei-Fong; Gatton, Michelle L; McCarthy, James S; Trenholme, Katharine R

    2011-04-18

    Obtaining single parasite clones is required for many techniques in malaria research. Cloning by limiting dilution using microscopy-based assessment for parasite growth is an arduous and labor-intensive process. An alternative method for the detection of parasite growth in limiting dilution assays is using a commercial ELISA histidine-rich protein II (HRP2) detection kit. Detection of parasite growth was undertaken using HRP2 ELISA and compared to thick film microscopy. An HRP2 protein standard was used to determine the detection threshold of the HRP2 ELISA assay, and a HRP2 release model was used to extrapolate the amount of parasite growth required for a positive result. The HRP2 ELISA was more sensitive than microscopy for detecting parasite growth. The minimum level of HRP2 protein detection of the ELISA was 0.11 ng/ml. Modeling of HRP2 release determined that 2,116 parasites are required to complete a full erythrocytic cycle to produce sufficient HRP2 to be detected by the ELISA. Under standard culture conditions this number of parasites is likely to be reached between 8 to 14 days of culture. This method provides an accurate and simple way for the detection of parasite growth in limiting dilution assays, reducing time and resources required in traditional methods. Furthermore the method uses spent culture media instead of the parasite-infected red blood cells, enabling culture to continue. © 2011 Butterworth et al; licensee BioMed Central Ltd.

  11. Boosting the oxidase mimicking activity of nanoceria by fluoride capping: rivaling protein enzymes and ultrasensitive F- detection

    NASA Astrophysics Data System (ADS)

    Liu, Biwu; Huang, Zhicheng; Liu, Juewen

    2016-07-01

    Nanomaterial-based enzyme mimics (nanozymes) are currently a new forefront of chemical research. However, the application of nanozymes is limited by their low catalytic activity and low turnover numbers. Cerium dioxide nanoparticles (nanoceria) are among the few with oxidase activity. Herein, we report an interesting finding addressing their limitations. The oxidase activity of nanoceria is improved by over 100-fold by fluoride capping, making it more close to real oxidases. The turnover number reached 700 in 15 min, drastically improved from ~15 turnovers for the naked particles. The mechanism is attributed to surface charge modulation and facilitated electron transfer by F- capping based on ζ-potential and free radical measurements. Ultrasensitive sensing of fluoride was achieved with a detection limit of 0.64 μM F- in water and in toothpastes, while no other tested anions can achieve the activity enhancement.Nanomaterial-based enzyme mimics (nanozymes) are currently a new forefront of chemical research. However, the application of nanozymes is limited by their low catalytic activity and low turnover numbers. Cerium dioxide nanoparticles (nanoceria) are among the few with oxidase activity. Herein, we report an interesting finding addressing their limitations. The oxidase activity of nanoceria is improved by over 100-fold by fluoride capping, making it more close to real oxidases. The turnover number reached 700 in 15 min, drastically improved from ~15 turnovers for the naked particles. The mechanism is attributed to surface charge modulation and facilitated electron transfer by F- capping based on ζ-potential and free radical measurements. Ultrasensitive sensing of fluoride was achieved with a detection limit of 0.64 μM F- in water and in toothpastes, while no other tested anions can achieve the activity enhancement. Electronic supplementary information (ESI) available: Methods, TMB oxidation kinetics and control experiments. See DOI: 10.1039/c6nr02730j

  12. Observing Strategies for the Detection of Jupiter Analogs

    NASA Astrophysics Data System (ADS)

    Wittenmyer, Robert A.; Tinney, C. G.; Horner, J.; Butler, R. P.; Jones, H. R. A.; O'Toole, S. J.; Bailey, J.; Carter, B. D.; Salter, G. S.; Wright, D.

    2013-04-01

    To understand the frequency, and thus the formation and evolution, of planetary systems like our own solar system, it is critical to detect Jupiter-like planets in Jupiter-like orbits. For long-term radial-velocity monitoring, it is useful to estimate the observational effort required to reliably detect such objects, particularly in light of severe competition for limited telescope time. We perform detailed simulations of observational campaigns, maximizing the realism of the sampling of a set of simulated observations. We then compute the detection limits for each campaign to quantify the effect of increasing the number of observational epochs and varying their time coverage. We show that once there is sufficient time baseline to detect a given orbital period, it becomes less effective to add further time coverage—rather, the detectability of a planet scales roughly as the square root of the number of observations, independently of the number of orbital cycles included in the data string. We also show that no noise floor is reached, with a continuing improvement in detectability at the maximum number of observations N = 500 tested here.

  13. Electrochemical sample matrix elimination for trace-level potentiometric detection with polymeric membrane ion-selective electrodes.

    PubMed

    Chumbimuni-Torres, Karin Y; Calvo-Marzal, Percy; Wang, Joseph; Bakker, Eric

    2008-08-01

    Potentiometric sensors are today sufficiently well understood and optimized to reach ultratrace level (subnanomolar) detection limits for numerous ions. In many cases of practical relevance, however, a high electrolyte background hampers the attainable detection limits. A particularly difficult sample matrix for potentiometric detection is seawater, where the high saline concentration forms a major interfering background and reduces the activity of most trace metals by complexation. This paper describes for the first time a hyphenated system for the online electrochemically modulated preconcentration and matrix elimination of trace metals, combined with a downstream potentiometric detection with solid contact polymeric membrane ion-selective microelectrodes. Following the preconcentration at the bismuth-coated electrode, the deposited metals are oxidized and released to a medium favorable to potentiometric detection, in this case calcium nitrate. Matrix interferences arising from the saline sample medium are thus circumvented. This concept is successfully evaluated with cadmium as a model trace element and offers potentiometric detection down to low parts per billion levels in samples containing 0.5 M NaCl background electrolyte.

  14. Electrochemical Sample Matrix Elimination for Trace Level Potentiometric Detection with Polymeric Membrane Ion-Selective Electrodes

    PubMed Central

    Chumbimuni-Torres, Karin Y.; Calvo-Marzal, Percy; Wang, Joseph; Bakker, Eric

    2008-01-01

    Potentiometric sensors are today sufficiently well understood and optimized to reach ultra-trace level (sub-nanomolar) detection limits for numerous ions. In many cases of practical relevance, however, a high electrolyte background hampers the attainable detection limits. A particularly difficult sample matrix for potentiometric detection is seawater, where the high saline concentration forms a major interfering background and reduces the activity of most trace metals by complexation. This paper describes for the first time a hyphenated system for the online electrochemically modulated preconcentration and matrix elimination (EMPM) of trace metals, combined with a downstream potentiometric detection with solid contact polymeric membrane ion-selective microelectrodes. Following the preconcentration at the bismuth coated electrodes, the deposited metals are oxidized and released to a medium favorable to potentiometric detection, in this case calcium nitrate. Matrix interferences arising from the saline sample medium are thus circumvented. This concept is successfully evaluated with cadmium as a model trace element and offers potentiometric detection down to low parts per billion levels in samples containing 0.5 M NaCl background electrolyte. PMID:18570385

  15. Two-dimensional on-line detection of brominated and iodinated volatile organic compounds by ECD and ICP-MS after GC separation.

    PubMed

    Schwarz, A; Heumann, K G

    2002-09-01

    Inductively coupled plasma-mass spectrometry (ICP-MS) was coupled to a gas chromatographic (GC) system with electron capture detector (ECD), which enables relatively easy characterization and quantification of brominated and iodinated (halogenated) volatile organic compounds (HVOCs) in aquatic and air samples. The GC-ECD system is connected in series with an ICP-MS by a directly heated transfer line and an outlet port-hole for elimination of the ECD make-up gas during ignition of the plasma. The hyphenated GC-ECD/ICP-MS system provides high selectivity and sensitivity for monitoring individual HVOCs under fast chromatographic conditions. The ECD is most sensitive for the detection of chlorinated and brominated but the ICP-MS for iodinated compounds. The greatest advantage of the use of an ICP-MS is its element-specific detection, which allows clear identification of compounds in most cases. The absolute detection limits for ICP-MS are 0.5 pg for iodinated, 10 pg for brominated, and 50 pg for chlorinated HVOCs with the additional advantage that calibration is almost independent on different compounds of the same halogen. In contrast to that detection limits for ECD vary for the different halogenated compounds and lie in the range of 0.03-11 pg. The two-dimensional GC-ECD/ICP-MS instrumentation is compared with electron impact mass spectrometry (EI-MS) and microwave induced plasma atomic emission detection (MIP-AED). Even if EI-MS has additional power in identifying unknown peaks by its scan mode, the detection limits are much higher compared with GC-ECD/ICP-MS, whereas the selective ion monitoring mode (SIM) reaches similar detection limits. The MIP-AED detection limits are at the same level as EI-MS in the scan mode.

  16. Fast Coherent Differential Imaging for Exoplanet Imaging

    NASA Astrophysics Data System (ADS)

    Gerard, Benjamin; Marois, Christian; Galicher, Raphael; Veran, Jean-Pierre; Macintosh, B.; Guyon, O.; Lozi, J.; Pathak, P.; Sahoo, A.

    2018-06-01

    Direct detection and detailed characterization of exoplanets using extreme adaptive optics (ExAO) is a key science goal of future extremely large telescopes and space observatories. However, quasi-static wavefront errors will limit the sensitivity of this endeavor. Additional limitations for ground-based telescopes arise from residual AO-corrected atmospheric wavefront errors, generating short-lived aberrations that will average into a halo over a long exposure, also limiting the sensitivity of exoplanet detection. We develop the framework for a solution to both of these problems using the self-coherent camera (SCC), to be applied to ground-based telescopes, called Fast Atmospheric SCC Technique (FAST). Simulations show that for typical ExAO targets the FAST approach can reach ~100 times better in raw contrast than what is currently achieved with ExAO instruments if we extrapolate for an hour of observing time, illustrating that the sensitivity improvement from this method could play an essential role in the future ground-based detection and characterization of lower mass/colder exoplanets.

  17. The detection of dissolved gases in transformer oil by gas chromatography with helium ionization detector

    NASA Astrophysics Data System (ADS)

    Deng, Xian-qin; Fang, Hua; Li, Min-xian

    2017-07-01

    The GC-PDD with the technology of valve cutting and helium ionization detector was used to analyze the dissolved gases in ultra-high voltage(UHV) and extra-high voltage(EHV) transformer oil. The detection limit(DL) reached ppb grade, especially for the featuring gas—C2H2 and H2, whose DL could reach 5ppb and 11ppb respectively. The test reproducibility of the instrument was about 1% and the correlation coefficient of standard curve-r is greater or equal to 0.99, which showed obvious advantage compared with normal GC. In addition, the auxiliary gas of H2 was not used in this instrument, which completely improved the safety performance. Thus, the application of GC-PDD has significant meaning in warning potential malfunction inside the ultra-high voltage transformer in advance.

  18. Bloch Surface Waves Biosensors for High Sensitivity Detection of Soluble ERBB2 in a Complex Biological Environment.

    PubMed

    Sinibaldi, Alberto; Sampaoli, Camilla; Danz, Norbert; Munzert, Peter; Sonntag, Frank; Centola, Fabio; Occhicone, Agostino; Tremante, Elisa; Giacomini, Patrizio; Michelotti, Francesco

    2017-08-17

    We report on the use of one-dimensional photonic crystals to detect clinically relevant concentrations of the cancer biomarker ERBB2 in cell lysates. Overexpression of the ERBB2 protein is associated with aggressive breast cancer subtypes. To detect soluble ERBB2, we developed an optical set-up which operates in both label-free and fluorescence modes. The detection approach makes use of a sandwich assay, in which the one-dimensional photonic crystals sustaining Bloch surface waves are modified with monoclonal antibodies, in order to guarantee high specificity during the biological recognition. We present the results of exemplary protein G based label-free assays in complex biological matrices, reaching an estimated limit of detection of 0.5 ng/mL. On-chip and chip-to-chip variability of the results is addressed too, providing repeatability rates. Moreover, results on fluorescence operation demonstrate the capability to perform high sensitive cancer biomarker assays reaching a resolution of 0.6 ng/mL, without protein G assistance. The resolution obtained in both modes meets international guidelines and recommendations (15 ng/mL) for ERBB2 quantification assays, providing an alternative tool to phenotype and diagnose molecular cancer subtypes.

  19. Sensitive indoor air monitoring of formaldehyde and other carbonyl compounds using the 2,4-dinitrophenylhydrazine method.

    PubMed

    Sandner, F; Dott, W; Hollender, J

    2001-03-01

    The toxic potential of formaldehyde and other aliphatic/aromatic carbonyl compounds requires the determination of even low amounts of these compounds in indoor air. The existing DFG-method for workplace monitoring using adsorption at 2,4-dinitrophenylhydrazine (DNPH)-coated sorbents followed by HPLC-UV/DAD analysis of the extract was modified in order to decrease detection limits. The improvement included an increase in volume and rate of the air sampling, testing applicability of different adsorption materials and a decrease of the extraction volume of the hydrazones. 13 DNPH-derivatives could be separated well on a RP18-column followed by UV/DAD-detection at 365 nm. Recovery rates of 70-100% were determined (apart from acetone with 19%) using dynamically produced artifical carbonyl atmospheres. Detection limits of 0.05-0.4 microgram/m3 were reached by this method which are sufficient for indoor air monitoring.

  20. Detection of trace cobalt ions in in vivo plant cells using a voltammetric interlocking system.

    PubMed

    Ly, Suw Young; Shin, Myoung Ho; Lee, Chang Hyun; Lee, Jin Hui; Kim, Mi Sook; Ji, Sang Woo; Park, Dong Won

    2013-01-01

    This experiment was conducted to establish a system for detecting trace cobalt ions in water and plant tissues using a voltammetric in vivo sensor. Cyclic and stripping voltammetry was devised from hand-made, macro-type implantable three-electrode systems. The results reached micro and nano working ranges at 100 sec accumulation time. The statistical detection limit (S/N) was attained at 6.0 ng L(-1). For the in vivo application, direct assay of cobalt ions was carried out in Eichhornia crassipes (EC) deep tissue in real time with a preconcentration time of 100 s. Interfaced techniques can be interlocked with other control systems.

  1. Use of x-ray fluorescence for in-situ detection of metals

    NASA Astrophysics Data System (ADS)

    Elam, W. T. E.; Whitlock, Robert R.; Gilfrich, John V.

    1995-01-01

    X-ray fluorescence (XRF) is a well-established, non-destructive method of determining elemental concentrations at ppm levels in complex samples. It can operate in atmosphere with no sample preparation, and provides accuracies of 1% or better under optimum conditions. This report addresses two sets of issues concerning the use of x-ray fluorescence as a sensor technology for the cone penetrometer, for shipboard waste disposal, or for other in-situ, real- time environmental applications. The first issue concerns the applicability of XRF to these applications, and includes investigation of detection limits and matrix effects. We have evaluated the detection limits and quantitative accuracy of a sensor mock-up for metals in soils under conditions expected in the field. In addition, several novel ways of improving the lower limits of detection to reach the drinking water regulatory limits have been explored. The second issue is the engineering involved with constructing a spectrometer within the 1.75 inch diameter of the penetrometer pipe, which is the most rigorous physical constraint. Only small improvements over current state-of-the-art are required. Additional advantages of XRF are that no radioactive sources or hazardous materials are used in the sensor design, and no reagents or any possible sources of ignition are involved.

  2. Market analysis of food products for detection of allergenic walnut (Juglans regia) and pecan (Carya illinoinensis) by real-time PCR.

    PubMed

    López-Calleja, Inés María; de la Cruz, Silvia; González, Isabel; García, Teresa; Martín, Rosario

    2015-06-15

    Two real-time polymerase chain reaction (PCR)-based assays for detection of walnut (Juglans regia) and pecan (Carya illinoinensis) traces in a wide range of processed foods are described here. The method consists on a real-time PCR assay targeting the ITS1 region, using a nuclease (TaqMan) probe labeled with FAM and BBQ. The method was positive for walnut and pecan respectively, and negative for all other heterologous plants and animals tested. Using a series of model samples with defined raw walnut in wheat flour and heat-treated walnut in wheat flour with a range of concentrations of 0.1-100,000 mg kg(-1), a practical detection limit of 0.1 mg kg(-1) of walnut content was estimated. Identical binary mixtures were done for pecan, reaching the same limit of detection of 0.1 mg kg(-1). The assay was successfully trialed on a total of 232 commercial foodstuffs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Dual-wavelength quantum cascade laser for trace gas spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jágerská, J.; Tuzson, B.; Mangold, M.

    2014-10-20

    We demonstrate a sequentially operating dual-wavelength quantum cascade laser with electrically separated laser sections, emitting single-mode at 5.25 and 6.25 μm. Based on a single waveguide ridge, this laser represents a considerable asset to optical sensing and trace gas spectroscopy, as it allows probing multiple gas species with spectrally distant absorption features using conventional optical setups without any beam combining optics. The laser capability was demonstrated in simultaneous NO and NO{sub 2} detection, reaching sub-ppb detection limits and selectivity comparable to conventional high-end spectroscopic systems.

  4. Europium(III) complex-functionalized magnetic nanoparticle as a chemosensor for ultrasensitive detection and removal of copper(II) from aqueous solution.

    PubMed

    Liu, Jing; Zuo, Wei; Zhang, Wei; Liu, Jian; Wang, Zhiyi; Yang, Zhengyin; Wang, Baodui

    2014-10-07

    Ultrasensitive, accurate detection and separation of heavy metal ions is very important in environmental monitoring and biological detection. In this paper, a highly sensitive and specific detection method for Cu(2+) based on the fluorescence quenching of a europium(III) hybrid magnetic nanoprobe is presented. This nanoprobe can detect Cu(2+) over a wide pH range (5.0-10.0) with a detection limit as low as 0.1 nM and it can be used for detecting Cu(2+) in living cells. After the magnetic separation, the Cu(2+) concentration decreased to 1.18 ppm, which is less than the US EPA drinking water standard (1.3 ppm), and more than 70% Cu(2+) could be removed when the amount of nanocomposite 1 reached 1 mg.

  5. Detecting the response of fish assemblages to stream restoration: Effects of different sampling designsf

    USGS Publications Warehouse

    Baldigo, Barry P.; Warren, D.R.

    2008-01-01

    Increased trout production within limited stream reaches is a popular goal for restoration projects, yet investigators seldom monitor, assess, or publish the associated effects on fish assemblages. Fish community data from a total of 40 surveys at restored and reference reaches in three streams of the Catskill Mountains, New York, were analyzed a posteriori to determine how the ability to detect significant changes in biomass of brown trout Salmo trutta, all salmonids, or the entire fish community differs with effect size, number of streams assessed, process used to quantify the index response, and number of replicates collected before and after restoration. Analyses of statistical power (probability of detecting a meaningful difference or effect) and integrated power (average power over all possible ??-values) were combined with before-after, control-impact analyses to assess the effectiveness of alternate sampling and analysis designs. In general, the more robust analyses indicated that biomass of brown trout and salmonid populations increased significantly in restored reaches but that the net increases (relative to the reference reach) were significant only at two of four restored reaches. Restoration alone could not account for the net increases in total biomass of fish communities. Power analyses generally showed that integrated power was greater than 0.95 when (1) biomass increases were larger than 5.0 g/m2, (2) the total number of replicates ranged from 4 to 8, and (3) coefficients of variation (CVs) for responses were less than 40%. Integrated power was often greater than 0.95 for responses as low as 1.0 g/m2 if the response CVs were less than 30%. Considering that brown trout, salmonid, and community biomass increased by 2.99 g/m2 on average (SD= 1.17 g/m2) in the four restored reaches, use of two to three replicates both before and after restoration would have an integrated power of about 0.95 and would help detect significant changes in fish biomass under similar situations. ?? Copyright by the American Fisheries Society 2008.

  6. Towards a direct measurement of vacuum magnetic birefringence: PVLAS achievements

    NASA Astrophysics Data System (ADS)

    Della Valle, F.; Di Domenico, G.; Gastaldi, U.; Milotti, E.; Pengo, R.; Ruoso, G.; Zavattini, G.

    2010-11-01

    Nonlinear effects in vacuum have been predicted but never observed yet directly. The PVLAS collaboration has long been working on an apparatus aimed at detecting such effects by measuring vacuum magnetic birefringence. Unfortunately the sensitivity has been affected by unaccounted noise and systematics since the beginning. A new small prototype ellipsometer has been designed and characterized at the Department of Physics of the University of Ferrara, Italy entirely mounted on a single seismically isolated optical bench. With a finesse F = 414,000 and a cavity length L = 0.5 m we have reached the sensitivity of ψ=2ṡ101/√{Hz} given the laser power at the output of the ellipsometer of P = 24 mW. This record result, very close to the predicted limit, demonstrates the feasibility of reaching such sensitivities, and opens the way to designing a dedicated apparatus for a first detection of vacuum magnetic birefringence.

  7. A global hydrographic array for early detection of floods and droughts

    NASA Astrophysics Data System (ADS)

    Brakenridge, G.; Nghiem, S.; Caquard, S.

    An array of over 700 20 km-long river gaging reaches, distributed world-wide, is imaged by the SeaWinds radar scatterometer aboard QuikSCAT every 2.5 days. Strongly negative HH/VV polarity ratios indicate large amounts of surface water. We set individual reach thresholds so that the transition from bankfull to overbank river flow can be identified according to changes in this ratio. Similarly, the wide-swath MODIS optical sensors provide frequent repeat coverage of the reaches at much higher spatial resolution (250 m). In this case, several reach water surface area thresholds can be identified: low flow or drought conditions, normal in-channel flow, overbank flow, and extreme flood conditions. Sustained data collection for the reaches by both sensors allows the radar response to changing surface water to be defined, and allows evaluation of the sensitivity of the MODIS data to river discharge changes. New approaches, such as ``unmixing'' analysis of mixed water/land MODIS pixels can extend detection limits to smaller rivers and streams. It is now possible for wide-area, frequent revisit terrestrial remote sensing to provide human society with early warning of both floods and droughts and by direct observation of the runoff component of the Earth's hydrologic cycle. Examples of both radar and optical approaches towards this end are at the web sites below: http://www.dartmouth.edu/˜ floods/Modisrapidresponse.html http://www.dartmouth.edu/˜ floods/sensorweb/SensorWebindex.html http://www.dartmouth.edu/˜ floods/Quikscat/Regional2/CurrentTisza.jpg} In particular, early flood detection results are obtained over an extensive region in eastern Europe including the Tisza River basin, Romania, Hungary, and adjacent nations. Flood detection maps are updated weekly at the web site. The combination of QuikSCAT and MODIS takes advantage of the large-area coverage of these sensors together with the high temporal resolution of QuikSCAT and the high spatial resolution of MODIS. Such capabilities are also appropriate for early flood detection in Asian monsoon regions including India, Pakistan, Bangladesh, China, and southeast Asia.

  8. Pressure-Dependent Detection of Carbon Monoxide Employing Wavelength Modulation Spectroscopy Using a Herriott-Type Cell.

    PubMed

    Li, Chuanliang; Wu, Yingfa; Qiu, Xuanbing; Wei, Jilin; Deng, Lunhua

    2017-05-01

    Wavelength modulation spectroscopy (WMS) combined with a multipass absorption cell has been used to measure a weak absorption line of carbon monoxide (CO) at 1.578 µm. A 0.95m Herriott-type cell provides an effective absorption path length of 55.1 m. The WMS signals from the first and second harmonic output of a lock-in amplifier (WMS-1 f and 2 f, respectively) agree with the Beer-Lambert law, especially at low concentrations. After boxcar averaging, the minimum detection limit achieved is 4.3 ppm for a measurement time of 0.125 s. The corresponding normalized detection limit is 84 ppm m Hz -1/2 . If the integrated time is increased to 88 s, the minimum detectable limit of CO can reach to 0.29 ppm based on an Allan variation analysis. The pressure-dependent relationship is validated after accounting for the pressure factor in data processing. Finally, a linear correlation between the WMS-2 f amplitudes and gas concentrations is obtained at concentration ratios less than 15.5%, and the accuracy is better than 92% at total pressure less than 62.7 Torr.

  9. Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

    PubMed

    Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

    2017-07-01

    The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

  10. Assembling substrate-less plasmonic metacrystals at the oil/water interface for multiplex ultratrace analyte detection.

    PubMed

    Lee, Yih Hong; Lee, Hiang Kwee; Ho, Jonathan Yong Chew; Yang, Yijie; Ling, Xing Yi

    2016-08-15

    Current substrate-less SERS platforms are limited to uncontrolled aggregation of plasmonic nanoparticles or quasi-crystalline arrays of spherical nanoparticles, with no study on how the lattice structures formed by nanoparticle self-assembly affect their detection capabilities. Here, we organize Ag octahedral building blocks into two large-area plasmonic metacrystals at the oil/water interface, and investigate their in situ SERS sensing capabilities. Amphiphilic octahedra assemble into a hexagonal close-packed metacrystal, while hydrophobic octahedra assemble into an open square metacrystal. The lower packing density square metacrystal gives rise to much stronger SERS enhancement than the denser packing hexagonal metacrystal, arising from the larger areas of plasmonic hotspots within the square metacrystal at the excitation wavelength. We further demonstrate the ability of the square metacrystal to achieve quantitative ultratrace detection of analytes from both the aqueous and organic phases. Detection limits are at the nano-molar levels, with analytical enhancement factors reaching 10(8). In addition, multiplex detection across both phases can be achieved in situ without any loss of signal quantitation.

  11. Multiplexed BioCD for prostate specific antigen detection

    NASA Astrophysics Data System (ADS)

    Wang, Xuefeng; Zhao, Ming; Nolte, David D.

    2008-02-01

    Specific protein concentrations in human body fluid can serve as diagnostic markers for some diseases, and a quantitative and high-throughput technique for multiplexed protein detection would speed up diagnosis and facilitate medical research. For this purpose, our group developed the BioCD, a spinning-disc interferometric biosensor on which antibody is immobilized. The detection system adopts a common-path scheme making it ultra stable. The scaling mass sensitivity is below 10 pg/mm for protein surface density. A 25000-spot antibody BioCD was fabricated to measure the concentration of prostate specific antigen (PSA), a protein indicating prostate cancer if its level is high. Statistical analysis of our immunoassay results projects that the detection limit of PSA would reach 20 pg/ml in a 2 mg/ml background solution. For future prospects, a multiplexed BioCD can be produced for simultaneous diagnosis of diverse diseases. For instance, 100 markers above 200 pg/ml could be measured on a single disc given that the detection limit is inversely proportional to square root of the number of spots.

  12. Detection of Thrombin Based on Fluorescence Energy Transfer between Semiconducting Polymer Dots and BHQ-Labelled Aptamers.

    PubMed

    Liu, Yizhang; Jiang, Xuekai; Cao, Wenfeng; Sun, Junyong; Gao, Feng

    2018-02-14

    Carboxyl-functionalized semiconducting polymer dots (Pdots) were synthesized as an energy donor by the nanoprecipitation method. A black hole quenching dye (BHQ-labelled thrombin aptamers) was used as the energy acceptor, and fluorescence resonance energy transfer between the aptamers and Pdots was used for fluorescence quenching of the Pdots. The addition of thrombin restored the fluorescence intensity. Under the optimized experimental conditions, the fluorescence of the system was restored to the maximum when the concentration of thrombin reached 130 nM, with a linear range of 0-50 nM (R² = 0.990) and a detection limit of 0.33 nM. This sensor was less disturbed by impurities, showing good specificity and signal response to thrombin, with good application in actual samples. The detection of human serum showed good linearity in the range of 0-30 nM (R² = 0.997), with a detection limit of 0.56 nM and a recovery rate of 96.2-104.1%, indicating that this fluorescence sensor can be used for the detection of thrombin content in human serum.

  13. Nanoporous Glass Integrated in Volumetric Bar-Chart Chip for Point-of-Care Diagnostics of Non-Small Cell Lung Cancer.

    PubMed

    Li, Ying; Xuan, Jie; Song, Yujun; Qi, Wenjin; He, Bangshun; Wang, Ping; Qin, Lidong

    2016-01-26

    Point-of-care (POC) testing has the potential to enable rapid, low-cost, and large-scale screening. POC detection of a multiplexed biomarker panel can facilitate the early diagnosis of non-small cell lung cancer (NSCLC) and, thus, may allow for more timely surgical intervention for life-saving treatment. Herein, we report the nanoporous glass (NPG) integrated volumetric bar-chart chip (V-Chip) for POC detection of the three NSCLC biomarkers CEA, CYFRA 21-1, and SCCA, by the naked eye. The 3D nanostructures in the NPG membrane efficiently increase the number of binding sites for antibodies and decrease the diffusion distance between antibody and antigen, enabling the low detection limit and rapid analysis time of the NPG-V-Chip. We utilized the NPG-V-Chip to test the NSCLC biomarker panel and found that the limit of detection can reach 50 pg/mL (10-fold improvement over the original V-Chip), and the total assay time can be decreased from 4 to 0.5 h. We then detected CEA in 21 serum samples from patients with common cancers, and the on-chip results showed good correlation with the clinical results. We further assayed 10 lung cancer samples using the device and confirmed the results obtained using conventional ELISA methods. In summary, the NPG-V-Chip platform has the ability of multiplex, low detection limit, low cost, lack of need for accessory equipment, and rapid analysis time, which may render the V-Chip a useful platform for quantitative POC detection in resource-limited settings and personalized diagnostics.

  14. Isocurvature forecast in the anthropic axion window

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamann, J.; Hannestad, S.; Raffelt, G.G.

    2009-06-01

    We explore the cosmological sensitivity to the amplitude of isocurvature fluctuations that would be caused by axions in the ''anthropic window'' where the axion decay constant f{sub a} >> 10{sup 12} GeV and the initial misalignment angle Θ{sub i} << 1. In a minimal ΛCDM cosmology extended with subdominant scale-invariant isocurvature fluctuations, existing data constrain the isocurvature fraction to α < 0.09 at 95% C.L. If no signal shows up, Planck can improve this constraint to 0.042 while an ultimate CMB probe limited only by cosmic variance in both temperature and E-polarisation can reach 0.017, about a factor of fivemore » better than the current limit. In the parameter space of f{sub a} and H{sub I} (Hubble parameter during inflation) we identify a small region where axion detection remains within the reach of realistic cosmological probes.« less

  15. Stream food web response to a salmon carcass analogue addition in two central Idaho, U.S.A. streams

    PubMed Central

    KOHLER, ANDRE E; RUGENSKI, AMANDA; TAKI, DOUG

    2008-01-01

    Pacific salmon and steelhead once contributed large amounts of marine-derived carbon, nitrogen and phosphorus to freshwater ecosystems in the Pacific Northwest of the United States of America (California, Oregon, Washington and Idaho). Declines in historically abundant anadromous salmonid populations represent a significant loss of returning nutrients across a large spatial scale. Recently, a manufactured salmon carcass analogue was developed and tested as a safe and effective method of delivering nutrients to freshwater and linked riparian ecosystems where marine-derived nutrients have been reduced or eliminated. We compared four streams: two reference and two treatment streams using salmon carcass analogue(s) (SCA) as a treatment. Response variables measured included: surface streamwater chemistry; nutrient limitation status; carbon and nitrogen stable isotopes; periphyton chlorophyll a and ash-free dry mass (AFDM); macroinvertebrate density and biomass; and leaf litter decomposition rates. Within each stream, upstream reference and downstream treatment reaches were sampled 1 year before, during, and 1 year after the addition of SCA. Periphyton chlorophyll a and AFDM and macroinvertebrate biomass were significantly higher in stream reaches treated with SCA. Enriched stable isotope (δ15N) signatures were observed in periphyton and macroinvertebrate samples collected from treatment reaches in both treatment streams, indicating trophic transfer from SCA to consumers. Densities of Ephemerellidae, Elmidae and Brachycentridae were significantly higher in treatment reaches. Macroinvertebrate community composition and structure, as measured by taxonomic richness and diversity, did not appear to respond significantly to SCA treatment. Leaf breakdown rates were variable among treatment streams: significantly higher in one stream treatment reach but not the other. Salmon carcass analogue treatments had no detectable effect on measured water chemistry variables. Our results suggest that SCA addition successfully increased periphyton and macroinvertebrate biomass with no detectable response in streamwater nutrient concentrations. Correspondingly, no change in nutrient limitation status was detected based on dissolved inorganic nitrogen to soluble reactive phosphorus ratios (DIN/SRP) and nutrient-diffusing substrata experiments. Salmon carcass analogues appear to increase freshwater productivity. Salmon carcass analogues represent a pathogen-free nutrient enhancement tool that mimics natural trophic transfer pathways, can be manufactured using recycled fish products, and is easily transported; however, salmon carcass analogues should not be viewed as a replacement for naturally spawning salmon and the important ecological processes they provide.

  16. Underwater linear polarization: physical limitations to biological functions

    PubMed Central

    Shashar, Nadav; Johnsen, Sönke; Lerner, Amit; Sabbah, Shai; Chiao, Chuan-Chin; Mäthger, Lydia M.; Hanlon, Roger T.

    2011-01-01

    Polarization sensitivity is documented in a range of marine animals. The variety of tasks for which animals can use this sensitivity, and the range over which they do so, are confined by the visual systems of these animals and by the propagation of the polarization information in the aquatic environment. We examine the environmental physical constraints in an attempt to reveal the depth, range and other limitations to the use of polarization sensitivity by marine animals. In clear oceanic waters, navigation that is based on the polarization pattern of the sky appears to be limited to shallow waters, while solar-based navigation is possible down to 200–400 m. When combined with intensity difference, polarization sensitivity allows an increase in target detection range by 70–80% with an upper limit of 15 m for large-eyed animals. This distance will be significantly smaller for small animals, such as plankton, and in turbid waters. Polarization-contrast detection, which is relevant to object detection and communication, is strongly affected by water conditions and in clear waters its range limit may reach 15 m as well. We show that polarization sensitivity may also serve for target distance estimation, when examining point source bioluminescent objects in the photic mesopelagic depth range. PMID:21282168

  17. Detecting depression stigma on social media: A linguistic analysis.

    PubMed

    Li, Ang; Jiao, Dongdong; Zhu, Tingshao

    2018-05-01

    Efficient detection of depression stigma in mass media is important for designing effective stigma reduction strategies. Using linguistic analysis methods, this paper aims to build computational models for detecting stigma expressions in Chinese social media posts (Sina Weibo). A total of 15,879 Weibo posts with keywords were collected and analyzed. First, a content analysis was conducted on all 15,879 posts to determine whether each of them reflected depression stigma or not. Second, using four algorithms (Simple Logistic Regression, Multilayer Perceptron Neural Networks, Support Vector Machine, and Random Forest), two groups of classification models were built based on selected linguistic features; one for differentiating between posts with and without depression stigma, and one for differentiating among posts with three specific types of depression stigma. First, 967 of 15,879 posts (6.09%) indicated depression stigma. 39.30%, 15.82%, and 14.99% of them endorsed the stigmatizing view that "People with depression are unpredictable", "Depression is a sign of personal weakness", and "Depression is not a real medical illness", respectively. Second, the highest F-Measure value for differentiating between stigma and non-stigma reached 75.2%. The highest F-Measure value for differentiating among three specific types of stigma reached 86.2%. Due to the limited and imbalanced dataset of Chinese Weibo posts, the findings of this study might have limited generalizability. This paper confirms that incorporating linguistic analysis methods into online detection of stigma can be beneficial to improve the performance of stigma reduction programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Search for High-Energy Emission from GRBs with the ARGO-YBJ Detector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Di Girolamo, T.

    2009-05-25

    ARGO-YBJ is a 'full coverage' air shower detector consisting of a 6700 m{sup 2} carpet of Resistive Plate Counters, located at Yangbajing (Tibet, P.R. China, 4300 m a.s.l). Its large field of view ({approx}2 sr, limited only by the atmospheric absorption) and high duty-cycle make ARGO-YBJ particularly suitable to detect unpredictable and short duration events such as GRBs. ARGO-YBJ works using two techniques: the 'Scaler Mode', which reaches the lower energy limit ({approx}1 GeV) of the detector, and the 'Shower Mode', with an energy threshold of a few hundreds of GeV. Here we present the results of the search formore » high-energy emission from GRBs in coincidence with satellite detections.« less

  19. Heavy metals and hydrocarbon concentrations in water, sediments and tissue of Cyclope neritea from two sites in Suez Canal, Egypt and histopathological effects.

    PubMed

    Sharaf, Hesham M; Shehata, Abdalla M

    2015-01-01

    Heavy metals and hydrocarbons are of the most common marine pollutants around the world. The present study aimed to assess the concentration of petroleum hydrocarbons and heavy metals in tissues of the snail cyclope neritea, water and sediments from two sites of the study area (Temsah lake and Suez canal) represent polluted and unpolluted sites respectively. The results showed that, the levels of the heavy metals (Pb, Cd, Co, Mg and Zn) in the polluted area have reached harmful limits recorded globally. Lead in water, sediment and tissue of the snail reached to 0.95 ppm, 4.54 ppm and 7.93 ppm respectively. Cadmium reached 0.31 ppm, 1.15 ppm and 3.08 ppm in the corresponding samples. Cobalt was not detected in water, but it reached 1.42 ppm and 10.36 ppm in the sediment and snails tissue respectively. Magnesium in water, sediment and tissue of the snail reached 3.73 ppm, 9.44 ppm and12.6 ppm respectively. Zinc reached 0.11 ppm, 3.89 ppm and 12.60ppm in the corresponding samples. Meanwhile, hydrocarbons in the polluted area (site1) reached 110.10 μg/L, 980.15 μg/g and 228.00 μg/g in water sediment and digestive gland tissues of the snails respectively. Whereas, hydrocarbons in the unpolluted area (site2) were estimated as 14.20 μg/L, 55.60 μg/g and 22.66 μg/g in water, sediment and tissue of the snails respectively. The combination of histopathological image with monitoring of the metal level in the digestive gland of the present snail provides an important tool for early detection of impending environmental problems and potential public health issues. Petroleum hydrocarbons are toxic to the marine fauna when present above certain limit in the marine water. The major detoxification organ in molluscs is the digestive gland, which has been used as a bioindicator organ for toxicity assessment. The effect of high crude oil on the digestive gland tubules of exposed snails when examined microscopically reveals a series of histological changes which indicates that the cellular compensatory mechanism is activated by hydrocarbons. These changes include vacuolation and presence of pyknotic nuclei.

  20. An Ru(II)-Fe(III) bimetallic complex as a multifunctional device for detecting, signal amplifying, and degrading oxalate.

    PubMed

    Chow, Cheuk-Fai; Ho, Pui-Yu; Gong, Cheng-Bin

    2014-09-07

    A tetranuclear bimetallic complex, [Ru(II)((t)Bubpy)(CN)4]2-[Fe(III)(H2O)3Cl]2·8H2O (1) has been synthesized and characterized. It was found to be a multifunctional device that can detect, signal amplify, and degrade an organic pollutant, oxalate. Results of the chemosensing studies of 1 toward common anions show that only oxalate selectively induces naked-eye colorimetric and luminometric responses with method detection limits down to 78.7 and 5.5 ppm, respectively from 1. Meanwhile, results of the photo-degradation studies of 1 toward oxalate show that the dissolved organic carbon content of oxalate decreased and reached complete mineralization into CO2 within 6 hours. Complex 1 was also found as the catalyst that amplified the detection signal toward oxalate. Through the photoassisted Fenton reaction by 1, methyl orange, an additional coloring agent, could be degraded so that the visual detection limit of 1 toward oxalate was magnified 50 times from 100 to 2 ppm. The detection, degradation, mineralization and signal amplification were found applicable in real water bodies such as river, pond and underground water with excellent recoveries and relative standard deviation.

  1. Results from the MWA EoR Experiment

    NASA Astrophysics Data System (ADS)

    Webster, Rachel L.; MWA EoR Collaboration

    2018-05-01

    The MWA EoR is one of a small handful of experiments designed to detect the statistical signal from the Epoch of Reionisation. Each of these experiments has reached a level of maturity, where the challenges, in particular of foreground removal, are being more fully understood. Over the past decade, the MWA EoR Collaboration has developed expertise and an understanding of the elements of the telescope array, the end-to-end pipelines, ionospheric conditions, and and the foreground emissions. Sufficient data has been collected to detect the theoretically predicted EoR signal. Limits have been published regularly, however we still several orders of magnitude from a possible detection. This paper outlines recent progress and indicates directions for future efforts.

  2. Microcantilever-based platforms as biosensing tools.

    PubMed

    Alvarez, Mar; Lechuga, Laura M

    2010-05-01

    The fast and progressive growth of the biotechnology and pharmaceutical fields forces the development of new and powerful sensing techniques for process optimization and detection of biomolecules at very low concentrations. During the last years, the simplest MEMS structures, i.e. microcantilevers, have become an emerging and promising technology for biosensing applications, due to their small size, fast response, high sensitivity and their compatible integration into "lab-on-a-chip" devices. This article provides an overview of some of the most interesting bio-detections carried out during the last 2-3 years with the microcantilever-based platforms, which highlight the continuous expansion of this kind of sensor in the medical diagnosis field, reaching limits of detection at the single molecule level.

  3. Compact binary merger rates: Comparison with LIGO/Virgo upper limits

    DOE PAGES

    Belczynski, Krzysztof; Repetto, Serena; Holz, Daniel E.; ...

    2016-03-03

    Here, we compare evolutionary predictions of double compact object merger rate densities with initial and forthcoming LIGO/Virgo upper limits. We find that: (i) Due to the cosmological reach of advanced detectors, current conversion methods of population synthesis predictions into merger rate densities are insufficient. (ii) Our optimistic models are a factor of 18 below the initial LIGO/Virgo upper limits for BH–BH systems, indicating that a modest increase in observational sensitivity (by a factor of ~2.5) may bring the first detections or first gravitational wave constraints on binary evolution. (iii) Stellar-origin massive BH–BH mergers should dominate event rates in advanced LIGO/Virgo and can be detected out to redshift z sime 2 with templates including inspiral, merger, and ringdown. Normal stars (more » $$\\lt 150\\;{M}_{\\odot }$$) can produce such mergers with total redshifted mass up to $${M}_{{\\rm{tot,z}}}\\simeq 400\\;{M}_{\\odot }$$. (iv) High black hole (BH) natal kicks can severely limit the formation of massive BH–BH systems (both in isolated binary and in dynamical dense cluster evolution), and thus would eliminate detection of these systems even at full advanced LIGO/Virgo sensitivity. We find that low and high BH natal kicks are allowed by current observational electromagnetic constraints. (v) The majority of our models yield detections of all types of mergers (NS–NS, BH–NS, BH–BH) with advanced detectors. Numerous massive BH–BH merger detections will indicate small (if any) natal kicks for massive BHs.« less

  4. Identifying fecal sources in a selected catchment reach using multiple source-tracking tools

    USGS Publications Warehouse

    Vogel, J.R.; Stoeckel, D.M.; Lamendella, R.; Zelt, R.B.; Santo, Domingo J.W.; Walker, S.R.; Oerther, D.B.

    2007-01-01

    Given known limitations of current microbial source-tracking (MST) tools, emphasis on small, simple study areas may enhance interpretations of fecal contamination sources in streams. In this study, three MST tools - Escherichia coli repetitive element polymerase chain reaction (rep-PCR), coliphage typing, and Bacteroidales 16S rDNA host-associated markers - were evaluated in a selected reach of Plum Creek in sooth-central Nebraska. Water-quality samples were collected from six sites. One reach was selected for MST evaluation based on observed patterns of E. coli contamination. Despite high E. coli concentrations, coliphages were detected only once among water samples, precluding their use as a MST tool in this setting. Rep-PCR classification of E. coli isolates from both water and sediment samples supported the hypothesis that cattle and wildlife were dominant sources of fecal contamination, with minor contributions by horses and humans. Conversely, neither ruminant nor human sources were detected by Bacteroidales markers in most water samples. In bed sediment, ruminant- and human-associated Bacteroidales markers were detected throughout the interval from 0 to 0.3 m, with detections independent of E. coli concentrations in the sediment. Although results by E. coli-based and Bacteroidales-based MST methods led to similar interpretations, detection of Bacteroidales markers in sediment more commonly than in water indicates that different tools to track fecal contamination (in this case, tools based on Bacteroidales DNA and E. coli isolates) may have varying relevance to the more specific goal of tracking the sources of E. coli in watersheds. This is the first report of simultaneous, toolbox approach application of a library-based and marker-based MST analyses to lowing surface water. ?? ASA, CSSA, SSSA.

  5. Development of a large volume injection method using a programmed temperature vaporization injector - gas chromatography hyphenated to ICP-MS for the simultaneous determination of mercury, tin and lead species at ultra-trace levels in natural waters.

    PubMed

    Terán-Baamonde, J; Bouchet, S; Tessier, E; Amouroux, D

    2018-04-27

    The current EU legislation lays down Environmental Quality Standards (EQS) for 45 priority substances in surface waters; among them levels for (organo)metallic species of Hg, Sn and Pb are set between ng L -1 (for Hg and Sn) and μg L -1 (for Pb). To date, only a few analytical methods can reach these very restrictive limits and there is thus a need for comprehensive methods able to analyze these species down to these levels in natural waters. The aim of this work was to develop an online automated pre-concentration method using large volume injections with a Programmed Temperature Vaporization (PTV) injector fitted with a sorbent packed liner coupled to GC-ICP-MS to further improve the detection limits associated to this well-established method. The influence of several parameters such as the PTV transfer temperature and time, carrier gas flow rate and amount of packing material was investigated. Finally, the maximum volume injected through single or multiple injection modes was optimized to obtain the best compromise between chromatographic resolution and sensitivity. After optimization, very satisfactory results in terms of absolute and methodological detection limits were achieved, down to the pg L -1 level for all species studied. The potential of the method was exemplified by determining the concentrations of organometallic compounds in unpolluted river waters samples from the Adour river basin (SW France) and results were compared with conventional (splitless) GC-ICP-MS. The strength of this analytical method lies in the low detection limits reached for the simultaneous analysis of a wide group of organometallic compounds, and the potential to transfer this method to other gas chromatographic applications with inherent lower sensitivity. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. [Mid-infrared distributed-feedback quantum cascade laser-based photoacoustic detection of trace methane gas].

    PubMed

    Tan, Song; Liu, Wan-feng; Wang, Li-jun; Zhang, Jin-chuan; Li, Lu; Liu, Jun-qi; Liu, Feng-qi; Wang, Zhan-guo

    2012-05-01

    There have been considerable interests in methane detection based on infrared absorption spectroscopy for industrial and environment monitoring. The authors report on the realization of photoacoustic detection of methane (CH4) using mid-infrared distributed-feedback quantum cascade laser (DFB-QCL). The absorption line at 1316.83 cm(-1) was selected for CH4 detection, which can be reached by the self-manufactured DFB-QCL source operating in pulsed mode near 7.6 microm at room-temperature. The CH4 gas is filled to a Helmholtz resonant photoacoustic cell, which was equipped with a commercial electret microphone. The DFB-QCL was operated at 234 Hz with an 80 mW optical peak power. A detection limit of 189 parts per billion in volume was derived when the signal-to-noise ratio equaled 1.

  7. Porous silicon micro-resonator implemented by standard photolithography process for sensing application

    NASA Astrophysics Data System (ADS)

    Girault, P.; Azuelos, P.; Lorrain, N.; Poffo, L.; Lemaitre, J.; Pirasteh, P.; Hardy, I.; Thual, M.; Guendouz, M.; Charrier, J.

    2017-10-01

    A micro-resonator based on porous silicon ridge waveguides is implemented by a large scale standard photolithography process to obtain a low cost and sensitive sensor based on volume detection principle instead of the evanescent one usually used. The porous nature of the ridge waveguides allows the target molecules to be infiltrated in the core and to be detected by direct interaction with the propagated light. Racetrack resonator with radius of 100 μm and a coupling length of 70 μm is optically characterized for the volume detection of different concentrations of glucose. A high sensitivity of 560 nm/RIU is reached with only one micro-resonator and a limit of detection of 8.10-5 RIU, equivalent to a glucose concentration of 0.7 g/L, is obtained.

  8. Radioastronomie d'amateur, détection de pulsars a 21 cm

    NASA Astrophysics Data System (ADS)

    Maintoux, Jean-Jacques

    2017-01-01

    Since the discovery of PSR B1919+21 in 1967, the study of radio pulsars has been so far the work of professional teams using large aperture arrays or single dish antennas. While the discovery of new pulsars is so far out of reach of amateurs astronomers with limited resources, we report the successful detection of 3 pulsars at 1420MHz with a 3.3m prime focus dish antenna, namely: B0329+54, B0950+08 and B1133+16. According to the Neutron Star list [6], this sets a new detection record given the very limited aperture of the antenna. In this paper, we expose how the sensibility and stability to achieve such detection was obtained with our constrained setup, then we discuss the data processing aspects, including the period calculation and folding for each PSR, as well as pulse profiles. With the upcoming upgrades to the telescope, more detections are likely to come. An ongoing observation of B2020+28 already yields promising results. Follow the last results here : http://www.f1ehn.org "radioastro"

  9. An Enzyme-Free Signal Amplification Technique for Ultrasensitive Colorimetric Assay of Disease Biomarkers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ye, Haihang; Yang, Kuikun; Tao, Jing

    Enzyme-based colorimetric assays have been widely used in research labs and clinical diagnosis for decades. Nevertheless, as constrained by the performance of enzymes, their detection sensitivity has not been substantially improved in recent years, which inhibits many critical applications such as early detection of cancers. In this work, we demonstrate an enzyme-free signal amplification technique, based on gold vesicles encapsulated with Pd-Ir nanoparticles as peroxidase mimics, for colorimetric assay of disease biomarkers with significantly enhanced sensitivity. This technique overcomes the intrinsic limitations of enzymes, thanks to the superior catalytic efficiency of peroxidase mimics and the efficient loading and release ofmore » these mimics. Using human prostate surface antigen as a model biomarker, we demonstrated that the enzyme-free assay could reach a limit of detection at the femtogram/mL level, which is over 10 3-fold lower than that of conventional enzyme-based assay when the same antibodies and similar procedure were used.« less

  10. An Enzyme-Free Signal Amplification Technique for Ultrasensitive Colorimetric Assay of Disease Biomarkers

    DOE PAGES

    Ye, Haihang; Yang, Kuikun; Tao, Jing; ...

    2017-01-30

    Enzyme-based colorimetric assays have been widely used in research labs and clinical diagnosis for decades. Nevertheless, as constrained by the performance of enzymes, their detection sensitivity has not been substantially improved in recent years, which inhibits many critical applications such as early detection of cancers. In this work, we demonstrate an enzyme-free signal amplification technique, based on gold vesicles encapsulated with Pd-Ir nanoparticles as peroxidase mimics, for colorimetric assay of disease biomarkers with significantly enhanced sensitivity. This technique overcomes the intrinsic limitations of enzymes, thanks to the superior catalytic efficiency of peroxidase mimics and the efficient loading and release ofmore » these mimics. Using human prostate surface antigen as a model biomarker, we demonstrated that the enzyme-free assay could reach a limit of detection at the femtogram/mL level, which is over 10 3-fold lower than that of conventional enzyme-based assay when the same antibodies and similar procedure were used.« less

  11. Determination of patulin in commercial apple juice by micellar electrokinetic chromatography.

    PubMed

    Murillo, M; González-Peñas, E; Amézqueta, S

    2008-01-01

    A novel and validated micellar electrokinetic capillary chromatography (MEKC) method using ultraviolet detection (UV) has been applied to the quantitative analysis of patulin (PAT) in commercial apple juice. Patulin was extracted from samples with an ethylacetate solution. The micellar electrokinetic capillary chromatography (MECK) parameters studied for method optimization were buffer composition, voltage, temperature, and a separation between PAT and 5-hydroxymethylfurfural (HMF) (main interference in apple juice PAT analysis) peaks until reaching baseline. The method passes a series of validation tests including selectivity, linearity, limit of detection and quantification (0.7 and 2.5 microgL(-1), respectively), precision (within and between-day variability) and recovery (80.2% RSD=4%), accuracy, and robustness. This method was successfully applied to the measurement of 20 apple juice samples obtained from different supermarkets. One hundred percent of the samples were contaminated with a level greater than the limit of detection, with mean and median values of 41.3 and 35.7 microgL(-1), respectively.

  12. High-Velocity Clouds in M 83 and M 51

    NASA Astrophysics Data System (ADS)

    Miller, E. D.; Bregman, J. N.

    2005-06-01

    Various scenarios have been proposed to explain the origin of the Galactic high-velocity clouds, predicting different distances and implying widely varying properties for the Galaxy's gaseous halo. To eliminate the difficulties of studying the Galactic halo from within, we have embarked on a program to study anomalous neutral gas in external galaxies, and here we present the results for two nearby, face-on spiral galaxies, M 83 and M 51. Significant amounts of anomalous-velocity H I are detected in deep VLA 21-cm observations, including an extended, slowly rotating disk and several discrete H I clouds. Our detection algorithm reaches a limiting H I source mass of 7×105 M⊙, and it allows for detailed statistical analysis of the false detection rate. We use this to place limits on the HVC mass distributions in these galaxies and the Milky Way; if the HVC populations are similar, then the Galacto-centric HVC distances must be less than about 25 kpc.

  13. Plasmonic gold mushroom arrays with refractive index sensing figures of merit approaching the theoretical limit

    NASA Astrophysics Data System (ADS)

    Shen, Yang; Zhou, Jianhua; Liu, Tianran; Tao, Yuting; Jiang, Ruibin; Liu, Mingxuan; Xiao, Guohui; Zhu, Jinhao; Zhou, Zhang-Kai; Wang, Xuehua; Jin, Chongjun; Wang, Jianfang

    2013-08-01

    Localized surface plasmon resonance (LSPR)-based sensing has found wide applications in medical diagnosis, food safety regulation and environmental monitoring. Compared with commercial propagating surface plasmon resonance (PSPR)-based sensors, LSPR ones are simple, cost-effective and suitable for measuring local refractive index changes. However, the figure of merit (FOM) values of LSPR sensors are generally 1-2 orders of magnitude smaller than those of PSPR ones, preventing the widespread use of LSPR sensors. Here we describe an array of submicrometer gold mushrooms with a FOM reaching ~108, which is comparable to the theoretically predicted upper limit for standard PSPR sensors. Such a high FOM arises from the interference between Wood’s anomaly and the LSPRs. We further demonstrate the array as a biosensor for detecting cytochrome c and alpha-fetoprotein, with their detection limits down to 200 pM and 15 ng ml-1, respectively, suggesting that the array is a promising candidate for label-free biomedical sensing.

  14. Development of gas fire detection system using tunable diode laser absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Jiang, Y. L.; Li, G.; Yang, T.; Wang, J. J.

    2017-01-01

    The conventional fire detection methods mainly produce an alarm through detecting the changes in smoke concentration, flame radiation, heat and other physical parameters in the environment, but are unable to provide an early warning of a fire emergency. We have designed a gas fire detection system with a high detection sensitivity and high selectivity using the tunable semiconductor diode laser as a light source and combining wavelength modulation and harmonic detection technology. This system can invert the second harmonic signal obtained to obtain the concentration of carbon monoxide gas (a fire characteristic gas) so as to provide an early warning of fire. We reduce the system offset noise and the background noise generated due to the laser interference by deducting the system background spectrum lines from the second harmonic signal. This can also eliminate the interference of other gas spectral lines to a large extent. We detected the concentration of the carbon monoxide gas generated in smoldering sandalwood fire and open beech wood fire with the homemade fire simulator, and tested the lowest detectable limit of system. The test results show that the lowest detectable limit can reach 5×10-6 the system can maintain stable operation for a long period of time and can automatically trigger a water mist fire extinguishing system, which can fully meet the needs of early fire warning.

  15. Polydopamine Nanotubes as an Effective Fluorescent Quencher for Highly Sensitive and Selective Detection of Biomolecules Assisted with Exonuclease III Amplification.

    PubMed

    Fan, Daoqing; Zhu, Xiaoqing; Zhai, Qingfeng; Wang, Erkang; Dong, Shaojun

    2016-09-20

    In this work, the effective fluorescence quenching ability of polydopamine nanotubes (PDANTs) toward various fluorescent dyes was studied and further applied to fluorescent biosensing for the first time. The PDANTs could quench the fluorophores with different emission frequencies, aminomethylcoumarin acetate (AMCA), 6-carboxyfluorescein (FAM), 6-carboxytetramethylrhodamine (TAMRA), and Cy5. All the quenching efficiencies reached to more than 97%. Taking advantage of PDANTs' different affinities toward ssDNA and dsDNA and utilizing the complex of FAM-labeled ssDNA and PDANTs as a sensing platform, we achieved highly sensitive and selective detection of human immunodeficiency virus (HIV) DNA and adenosine triphosphate (ATP) assisted with Exonuclease III amplification. The limits of detection (LODs) of HIV DNA and ATP reached to 3.5 pM and 150 nM, respectively, which were all lower than that of previous nanoquenchers with Exo III amplification, and the platform also presented good applicability in biological samples. Fluorescent sensing applications of this nanotube enlightened other targets detection based upon it and enriched the building blocks of fluorescent sensing platforms. This polydopamine nanotube also possesses excellent biocompatibility and biodegradability, which is suitable for future drug delivery, cell imaging, and other biological applications.

  16. Optical and non-optical methods for detection and characterization of microparticles and exosomes.

    PubMed

    van der Pol, E; Hoekstra, A G; Sturk, A; Otto, C; van Leeuwen, T G; Nieuwland, R

    2010-12-01

    Microparticles and exosomes are cell-derived microvesicles present in body fluids that play a role in coagulation, inflammation, cellular homeostasis and survival, intercellular communication, and transport. Despite increasing scientific and clinical interest, no standard procedures are available for the isolation, detection and characterization of microparticles and exosomes, because their size is below the reach of conventional detection methods. Our objective is to give an overview of currently available and potentially applicable methods for optical and non-optical determination of the size, concentration, morphology, biochemical composition and cellular origin of microparticles and exosomes. The working principle of all methods is briefly discussed, as well as their applications and limitations based on the underlying physical parameters of the technique. For most methods, the expected size distribution for a given microvesicle population is determined. The explanations of the physical background and the outcomes of our calculations provide insights into the capabilities of each method and make a comparison possible between the discussed methods. In conclusion, several (combinations of) methods can detect clinically relevant properties of microparticles and exosomes. These methods should be further explored and validated by comparing measurement results so that accurate, reliable and fast solutions come within reach. © 2010 International Society on Thrombosis and Haemostasis.

  17. Limits to magnetic resonance microscopy

    NASA Astrophysics Data System (ADS)

    Glover, Paul; Mansfield, Peter, Sir

    2002-10-01

    The last quarter of the twentieth century saw the development of magnetic resonance imaging (MRI) grow from a laboratory demonstration to a multi-billion dollar worldwide industry. There is a clinical body scanner in almost every hospital of the developed nations. The field of magnetic resonance microscopy (MRM), after mostly being abandoned by researchers in the first decade of MRI, has become an established branch of the science. This paper reviews the development of MRM over the last decade with an emphasis on the current state of the art. The fundamental principles of imaging and signal detection are examined to determine the physical principles which limit the available resolution. The limits are discussed with reference to liquid, solid and gas phase microscopy. In each area, the novel approaches employed by researchers to push back the limits of resolution are discussed. Although the limits to resolution are well known, the developments and applications of MRM have not reached their limit.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, Yue; Ahmadi, Ehsaneh D.; Shayan, Kamran

    Single-walled carbon nanotubes (SWCNTs) are promising absorbers and emitters to enable novel photonic applications and devices but are also known to suffer from low optical quantum yields. Here we demonstrate SWCNT excitons coupled to plasmonic nanocavity arrays reaching deeply into the Purcell regime with Purcell factors (F P) up to F P = 180 (average F P = 57), Purcell-enhanced quantum yields of 62% (average 42%), and a photon emission rate of 15 MHz into the first lens. The cavity coupling is quasi-deterministic since the photophysical properties of every SWCNT are enhanced by at least one order of magnitude. Furthermore,more » the measured ultra-narrow exciton linewidth (18 ueV) reaches the radiative lifetime limit, which is promising towards generation of transform-limited single photons. Furthermore, to demonstrate utility beyond quantum light sources we show that nanocavity-coupled SWCNTs perform as single-molecule thermometers detecting plasmonically induced heat at cryogenic temperatures in a unique interplay of excitons, phonons, and plasmons at the nanoscale.« less

  19. Purcell-enhanced quantum yield from carbon nanotube excitons coupled to plasmonic nanocavities

    DOE PAGES

    Luo, Yue; Ahmadi, Ehsaneh D.; Shayan, Kamran; ...

    2017-11-10

    Single-walled carbon nanotubes (SWCNTs) are promising absorbers and emitters to enable novel photonic applications and devices but are also known to suffer from low optical quantum yields. Here we demonstrate SWCNT excitons coupled to plasmonic nanocavity arrays reaching deeply into the Purcell regime with Purcell factors (F P) up to F P = 180 (average F P = 57), Purcell-enhanced quantum yields of 62% (average 42%), and a photon emission rate of 15 MHz into the first lens. The cavity coupling is quasi-deterministic since the photophysical properties of every SWCNT are enhanced by at least one order of magnitude. Furthermore,more » the measured ultra-narrow exciton linewidth (18 ueV) reaches the radiative lifetime limit, which is promising towards generation of transform-limited single photons. Furthermore, to demonstrate utility beyond quantum light sources we show that nanocavity-coupled SWCNTs perform as single-molecule thermometers detecting plasmonically induced heat at cryogenic temperatures in a unique interplay of excitons, phonons, and plasmons at the nanoscale.« less

  20. Leaky electronic states for photovoltaic photodetectors based on asymmetric superlattices

    NASA Astrophysics Data System (ADS)

    Penello, Germano Maioli; Pereira, Pedro Henrique; Pires, Mauricio Pamplona; Sivco, Deborah; Gmachl, Claire; Souza, Patricia Lustoza

    2018-01-01

    The concept of leaky electronic states in the continuum is used to achieve room temperature operation of photovoltaic superlattice infrared photodetectors. A structural asymmetric InGaAs/InAlAs potential profile is designed to create states in the continuum with the preferential direction for electron extraction and, consequently, to obtain photovoltaic operation at room temperature. Due to the photovoltaic operation and virtual increase in the bandoffset, the device presents both low dark current and low noise. The Johnson noise limited specific detectivity reaches values as high as 1.4 × 1011 Jones at 80 K. At 300 K, the detectivity obtained is 7.0 × 105 Jones.

  1. UV Absorption Spectroscopy in Water-Filled Antiresonant Hollow Core Fibers for Pharmaceutical Detection.

    PubMed

    Nissen, Mona; Doherty, Brenda; Hamperl, Jonas; Kobelke, Jens; Weber, Karina; Henkel, Thomas; Schmidt, Markus A

    2018-02-06

    Due to a worldwide increased use of pharmaceuticals and, in particular, antibiotics, a growing number of these substance residues now contaminate natural water resources and drinking supplies. This triggers a considerable demand for low-cost, high-sensitivity methods for monitoring water quality. Since many biological substances exhibit strong and characteristic absorption features at wavelengths shorter than 300 nm, UV spectroscopy presents a suitable approach for the quantitative identification of such water-contaminating species. However, current UV spectroscopic devices often show limited light-matter interaction lengths, demand sophisticated and bulky experimental infrastructure which is not compatible with microfluidics, and leave large fractions of the sample analyte unused. Here, we introduce the concept of UV spectroscopy in liquid-filled anti-resonant hollow core fibers, with large core diameters and lengths of approximately 1 m, as a means to overcome such limitations. This extended light-matter interaction length principally improves the concentration detection limit by two orders of magnitude while using almost the entire sample volume-that is three orders of magnitude smaller compared to cuvette based approaches. By integrating the fibers into an optofluidic chip environment and operating within the lowest experimentally feasible transmission band, concentrations of the application-relevant pharmaceutical substances, sulfamethoxazole (SMX) and sodium salicylate (SS), were detectable down to 0.1 µM (26 ppb) and 0.4 µM (64 ppb), respectively, with the potential to reach significantly lower detection limits for further device integration.

  2. UV Absorption Spectroscopy in Water-Filled Antiresonant Hollow Core Fibers for Pharmaceutical Detection

    PubMed Central

    Nissen, Mona; Doherty, Brenda; Hamperl, Jonas; Kobelke, Jens; Weber, Karina; Henkel, Thomas; Schmidt, Markus A.

    2018-01-01

    Due to a worldwide increased use of pharmaceuticals and, in particular, antibiotics, a growing number of these substance residues now contaminate natural water resources and drinking supplies. This triggers a considerable demand for low-cost, high-sensitivity methods for monitoring water quality. Since many biological substances exhibit strong and characteristic absorption features at wavelengths shorter than 300 nm, UV spectroscopy presents a suitable approach for the quantitative identification of such water-contaminating species. However, current UV spectroscopic devices often show limited light-matter interaction lengths, demand sophisticated and bulky experimental infrastructure which is not compatible with microfluidics, and leave large fractions of the sample analyte unused. Here, we introduce the concept of UV spectroscopy in liquid-filled anti-resonant hollow core fibers, with large core diameters and lengths of approximately 1 m, as a means to overcome such limitations. This extended light-matter interaction length principally improves the concentration detection limit by two orders of magnitude while using almost the entire sample volume—that is three orders of magnitude smaller compared to cuvette based approaches. By integrating the fibers into an optofluidic chip environment and operating within the lowest experimentally feasible transmission band, concentrations of the application-relevant pharmaceutical substances, sulfamethoxazole (SMX) and sodium salicylate (SS), were detectable down to 0.1 µM (26 ppb) and 0.4 µM (64 ppb), respectively, with the potential to reach significantly lower detection limits for further device integration. PMID:29415468

  3. A localized surface plasmon resonance (LSPR) immunosensor for CRP detection using 4-chloro-1-naphtol (4-CN) precipitation

    NASA Astrophysics Data System (ADS)

    Ha, Su-Ji; Park, Jin-Ho; Byun, Ju-Young; Ahn, Young-Deok; Kim, Min-Gon

    2017-07-01

    In this study, C-reactive protein (CRP) was detected by monitoring of LSPR shift promoted by precipitation of 4-chloro-1-naphthol (4-CN). The precipitation occurred by horseradish peroxide (HRP) catalyst which is modified at CRP-detection antibody utilized in sandwich enzyme-linked immunosorbent assay (ELISA) on gold nano bipyramid (GNBP) substrate. Due to 4-CN precipitates which are located nearby the surface of GNBP, local refractive index (RI) and molecular density were greatly increased. This phenomenon eventually induced strong spectral red-shift of absorption band of GNBP. An excellent linear relationship (R2=0.9895) between the LSPR shift and CRP concentration was obtained in the range from 100 pg/mL to 100 ng/mL and limit of detection (LOD) was reached to 87 pg/mL.

  4. [Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].

    PubMed

    Luo, Yuwen; Li, Yao

    2018-03-25

    This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.

  5. How to comprehensively evaluate river corridor conditions? A comparison of different biotic and morphological indices in northern Italy

    NASA Astrophysics Data System (ADS)

    Golfieri, Bruno; Surian, Nicola; Hardersen, Sönke; Maiolini, Bruno

    2016-04-01

    The assessment of river conditions is crucial for planning appropriate management actions. The European Water Framework Directive 2000/60/EC (WFD) requires the assessment of biological, physical-chemical and hydromorphological elements to define the ecological status of rivers. The WFD suggests the use of different bioindicators (i.e. benthic macroinvertebrates, diatoms, aquatic macrophytes and fish), the so called "biological quality elements" (BQEs). However, recent studies showed that BQEs-based indices have two main limitations: (i) their standard application is limited to flowing channels and (ii) they are not sensitive to hydromorphological alteration. Hydromorphological conditions are usually evaluated applying methods for physical habitat assessment (i.e. the River Habitat Survey or derived methods) that consist in site-scale inventories of river forms and anthropic structures. The lack of consideration of wider spatial (i.e. reach or catchment scale) and temporal scales (e.g. channel evolution over the last 50-100 years) make such methods inadequate for a sound diagnosis of morphological alterations. The Morphological Quality Index (MQI) and the dragonfly-based Odonate River Index (ORI) were developed in the recent years to overcome the above-mentioned limitations and to assess the condition of the whole river corridor (i.e. the channel and its adjacent floodplain) at reach scale. In this study we correlated the assessments of MQI, ORI and two BQEs-based biotic indices (i.e. STAR_ICMi for benthic macroinvertebrates and ICMi for diatoms) in 15 lowland river reaches in northern Italy. The selected reaches are characterized by a wide range of morphological degradation. MQI and ORI were highly correlated, probably because both methods work at reach scale and consider the integrity of the whole river corridor, either in terms of morphology or considering ecological aspects. In contrast, no significant relationships were found between MQI and ORI and the BQEs-based indices (i.e. ICMi and STAR_ICMi). This can be probably attributed to the differences in spatial scale (i.e. site scale) at which the BQEs-based indices apply and to the human pressure that they were originally designed to detect (i.e. water quality). These results show that MQI and ORI are useful tools to evaluate the integrity of the river corridor, at reach scale. The ORI provides information on the ecological condition of the river not covered by the other biotic indices, thanks to the sampling strategy that considers also secondary channels and ponds. We underline the importance of integrating the assessment of the lateral dimension of the river corridor in the evaluation and the need to choose appropriate indicators. The choice of the indicators must also consider the spatial and temporal scale of their application, in order to detect pressures operating at various scales (e.g. water quality and hydromorphological alteration). Only the integration of reach-scale indicators, such as MQI and ORI, would allow for a comprehensive evaluation of river corridor conditions and to define sound and appropriate management actions.

  6. Limitation in the detection of Listeria monocytogenes in food in the presence of competing Listeria innocua.

    PubMed

    Oravcová, K; Trncíková, T; Kuchta, T; Kaclíková, E

    2008-02-01

    Detectability of Listeria monocytogenes at 10(0) CFU per food sample in the presence of Listeria innocua using standard microbiological detection was evaluated and compared with the real-time PCR-based method. Enrichment in half-Fraser broth followed by subculture in Fraser broth according to EN ISO 11290-1 was used. False-negative detection of 10(0) CFU L. monocytogenes was obtained in the presence of 10(1) CFU L. innocua per sample using the standard detection method in contrast to more than 10(5) CFU L. innocua per sample using real-time PCR. Identification of L. monocytogenes on the chromogenic medium by the standard procedure was impossible if L. innocua was able to overgrow L. monocytogenes by more than three orders of magnitude after the enrichment in model samples. These results were confirmed using naturally contaminated food samples. Standard microbiological method was insufficient for the reliable detection of 10(0) CFU L. monocytogenes in the presence of more than 10(0) CFU of L. innocua per sample. On the other hand, if the growth of L. monocytogenes was sufficient to reach the concentration equal to the detection limit of PCR, the amount of the other microflora present in the food sample including L. innocua was not relevant for success of the PCR detection of L. monocytogenes. After the enrichment, the PCR detection is more convenient than the standard one as PCR detection is not compromised by other present microflora.

  7. Theoretical utmost performance of the (1 0 0) long-wave HgCdTe Auger suppressed photodetectors grown on GaAs

    NASA Astrophysics Data System (ADS)

    Martyniuk, P.; Gawron, W.; Madejczyk, P.; Rogalski, A.

    2017-08-01

    The vast majority of HgCdTe detectors designed to detect long wavelength (8-14 μm) infrared radiation must be cooled to achieve the required performance. It must be stressed that cooling requirement is both expensive and bulky and the main objective is to reach higher operating temperature condition preserving near background limited performance and high speed response. In order to reach that goal the thermal generation rate needs to be reduced below the photon generation rate. Except Auger 7, p-type HgCdTe active layers are mostly limited by technology dependent Shockley-Read-Hall generation-recombination processes. One of the ways to reduce of the trap density is a growth of the (1 0 0) HgCdTe epilayers on GaAs substrates. In addition, that orientation allows reaching lower carrier concentration in comparison to the commonly used (1 1 1) orientation (5 × 1015-1016 cm-3). In this paper we report on theoretical utmost performance of (1 0 0) HgCdTe Auger suppressed photodetectors grown on GaAs substrates. (1 0 0) HgCdTe orientation allows to reduce p-type doping to the level of ∼5 × 1014 cm-3 in analyzed long wavelength range. In addition Shockley-Read-Hall traps could be reduced to the level of ∼4.4 × 108 cm-3 resulting in suppression of the dark current by nearly two orders of magnitude within the range ∼20 ÷ 0.31 A/cm2 and detectivity, ∼1010-1011 cmHz1/2/W at temperature 230 K, voltage 200 mV.

  8. A Monitoring System for Laying Hens That Uses a Detection Sensor Based on Infrared Technology and Image Pattern Recognition.

    PubMed

    Zaninelli, Mauro; Redaelli, Veronica; Luzi, Fabio; Bontempo, Valentino; Dell'Orto, Vittorio; Savoini, Giovanni

    2017-05-24

    In Italy, organic egg production farms use free-range housing systems with a big outdoor area and a flock of no more than 500 hens. With additional devices and/or farming procedures, the whole flock could be forced to stay in the outdoor area for a limited time of the day. As a consequence, ozone treatments of housing areas could be performed in order to reduce the levels of atmospheric ammonia and bacterial load without risks, due by its toxicity, both for hens and workers. However, an automatic monitoring system, and a sensor able to detect the presence of animals, would be necessary. For this purpose, a first sensor was developed but some limits, related to the time necessary to detect a hen, were observed. In this study, significant improvements, for this sensor, are proposed. They were reached by an image pattern recognition technique that was applied to thermografic images acquired from the housing system. An experimental group of seven laying hens was selected for the tests, carried out for three weeks. The first week was used to set-up the sensor. Different templates, to use for the pattern recognition, were studied and different floor temperature shifts were investigated. At the end of these evaluations, a template of elliptical shape, and sizes of 135 × 63 pixels, was chosen. Furthermore, a temperature shift of one degree was selected to calculate, for each image, a color background threshold to apply in the following field tests. Obtained results showed an improvement of the sensor detection accuracy that reached values of sensitivity and specificity of 95.1% and 98.7%. In addition, the range of time necessary to detect a hen, or classify a case, was reduced at two seconds. This result could allow the sensor to control a bigger area of the housing system. Thus, the resulting monitoring system could allow to perform the sanitary treatments without risks both for animals and humans.

  9. A Monitoring System for Laying Hens That Uses a Detection Sensor Based on Infrared Technology and Image Pattern Recognition

    PubMed Central

    Zaninelli, Mauro; Redaelli, Veronica; Luzi, Fabio; Bontempo, Valentino; Dell’Orto, Vittorio; Savoini, Giovanni

    2017-01-01

    In Italy, organic egg production farms use free-range housing systems with a big outdoor area and a flock of no more than 500 hens. With additional devices and/or farming procedures, the whole flock could be forced to stay in the outdoor area for a limited time of the day. As a consequence, ozone treatments of housing areas could be performed in order to reduce the levels of atmospheric ammonia and bacterial load without risks, due by its toxicity, both for hens and workers. However, an automatic monitoring system, and a sensor able to detect the presence of animals, would be necessary. For this purpose, a first sensor was developed but some limits, related to the time necessary to detect a hen, were observed. In this study, significant improvements, for this sensor, are proposed. They were reached by an image pattern recognition technique that was applied to thermografic images acquired from the housing system. An experimental group of seven laying hens was selected for the tests, carried out for three weeks. The first week was used to set-up the sensor. Different templates, to use for the pattern recognition, were studied and different floor temperature shifts were investigated. At the end of these evaluations, a template of elliptical shape, and sizes of 135 × 63 pixels, was chosen. Furthermore, a temperature shift of one degree was selected to calculate, for each image, a color background threshold to apply in the following field tests. Obtained results showed an improvement of the sensor detection accuracy that reached values of sensitivity and specificity of 95.1% and 98.7%. In addition, the range of time necessary to detect a hen, or classify a case, was reduced at two seconds. This result could allow the sensor to control a bigger area of the housing system. Thus, the resulting monitoring system could allow to perform the sanitary treatments without risks both for animals and humans. PMID:28538654

  10. Magnetic resonance imaging for the detection, localisation, and characterisation of prostate cancer: recommendations from a European consensus meeting.

    PubMed

    Dickinson, Louise; Ahmed, Hashim U; Allen, Clare; Barentsz, Jelle O; Carey, Brendan; Futterer, Jurgen J; Heijmink, Stijn W; Hoskin, Peter J; Kirkham, Alex; Padhani, Anwar R; Persad, Raj; Puech, Philippe; Punwani, Shonit; Sohaib, Aslam S; Tombal, Bertrand; Villers, Arnauld; van der Meulen, Jan; Emberton, Mark

    2011-04-01

    Multiparametric magnetic resonance imaging (mpMRI) may have a role in detecting clinically significant prostate cancer in men with raised serum prostate-specific antigen levels. Variations in technique and the interpretation of images have contributed to inconsistency in its reported performance characteristics. Our aim was to make recommendations on a standardised method for the conduct, interpretation, and reporting of prostate mpMRI for prostate cancer detection and localisation. A consensus meeting of 16 European prostate cancer experts was held that followed the UCLA-RAND Appropriateness Method and facilitated by an independent chair. Before the meeting, 520 items were scored for "appropriateness" by panel members, discussed face to face, and rescored. Agreement was reached in 67% of 260 items related to imaging sequence parameters. T2-weighted, dynamic contrast-enhanced, and diffusion-weighted MRI were the key sequences incorporated into the minimum requirements. Consensus was also reached on 54% of 260 items related to image interpretation and reporting, including features of malignancy on individual sequences. A 5-point scale was agreed on for communicating the probability of malignancy, with a minimum of 16 prostatic regions of interest, to include a pictorial representation of suspicious foci. Limitations relate to consensus methodology. Dominant personalities are known to affect the opinions of the group and were countered by a neutral chairperson. Consensus was reached on a number of areas related to the conduct, interpretation, and reporting of mpMRI for the detection, localisation, and characterisation of prostate cancer. Before optimal dissemination of this technology, these outcomes will require formal validation in prospective trials. Copyright © 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  11. Online solid phase extraction liquid chromatography tandem mass spectrometry (SPE-LC-MS/MS) method for the determination of sucralose in reclaimed and drinking waters and its photo degradation in natural waters from South Florida

    PubMed Central

    2013-01-01

    Background Sucralose has gained popularity as a low calorie artificial sweetener worldwide. Due to its high stability and persistence, sucralose has shown widespread occurrence in environmental waters, at concentrations that could reach up to several μg/L. Previous studies have used time consuming sample preparation methods (offline solid phase extraction/derivatization) or methods with rather high detection limits (direct injection) for sucralose analysis. This study described a faster and sensitive analytical method for the determination of sucralose in environmental samples. Results An online SPE-LC–MS/MS method was developed, being capable to quantify sucralose in 12 minutes using only 10 mL of sample, with method detection limits (MDLs) of 4.5 ng/L, 8.5 ng/L and 45 ng/L for deionized water, drinking and reclaimed waters (1:10 diluted with deionized water), respectively. Sucralose was detected in 82% of the reclaimed water samples at concentrations reaching up to 18 μg/L. The monthly average for a period of one year was 9.1 ± 2.9 μg/L. The calculated mass loads per capita of sucralose discharged through WWTP effluents based on the concentrations detected in wastewaters in the U. S. is 5.0 mg/day/person. As expected, the concentrations observed in drinking water were much lower but still relevant reaching as high as 465 ng/L. In order to evaluate the stability of sucralose, photodegradation experiments were performed in natural waters. Significant photodegradation of sucralose was observed only in freshwater at 254 nm. Minimal degradation (<20%) was observed for all matrices under more natural conditions (350 nm or solar simulator). The only photolysis product of sucralose identified by high resolution mass spectrometry was a de-chlorinated molecule at m/z 362.0535, with molecular formula C12H20Cl2O8. Conclusions Online SPE LC-APCI/MS/MS developed in the study was applied to more than 100 environmental samples. Sucralose was frequently detected (>80%) indicating that the conventional treatment process employed in the sewage treatment plants is not efficient for its removal. Detection of sucralose in drinking waters suggests potential contamination of surface and ground waters sources with anthropogenic wastewater streams. Its high resistance to photodegradation, minimal sorption and high solubility indicate that sucralose could be a good tracer of anthropogenic wastewater intrusion into the environment. PMID:23965251

  12. Statistical mechanics of few-particle systems: exact results for two useful models

    NASA Astrophysics Data System (ADS)

    Miranda, Enrique N.

    2017-11-01

    The statistical mechanics of small clusters (n ˜ 10-50 elements) of harmonic oscillators and two-level systems is studied exactly, following the microcanonical, canonical and grand canonical formalisms. For clusters with several hundred particles, the results from the three formalisms coincide with those found in the thermodynamic limit. However, for clusters formed by a few tens of elements, the three ensembles yield different results. For a cluster with a few tens of harmonic oscillators, when the heat capacity per oscillator is evaluated within the canonical formalism, it reaches a limit value equal to k B , as in the thermodynamic case, while within the microcanonical formalism the limit value is k B (1-1/n). This difference could be measured experimentally. For a cluster with a few tens of two-level systems, the heat capacity evaluated within the canonical and microcanonical ensembles also presents differences that could be detected experimentally. Both the microcanonical and grand canonical formalism show that the entropy is non-additive for systems this small, while the canonical ensemble reaches the opposite conclusion. These results suggest that the microcanonical ensemble is the most appropriate for dealing with systems with tens of particles.

  13. Selenium analysis by an integrated microwave digestion-needle trap device with hydride sorption on carbon nanotubes and electrothermal atomic absorption spectrometry determination

    NASA Astrophysics Data System (ADS)

    Maratta Martínez, Ariel; Vázquez, Sandra; Lara, Rodolfo; Martínez, Luis Dante; Pacheco, Pablo

    2018-02-01

    An integrated microwave assisted digestion (MW-AD) - needle trap device (NTD) for selenium determination in grape pomace samples is presented. The NTD was filled with oxidized multiwall carbon nanotubes (oxMWCNTS) where Se hydrides were preconcentrated. Determination was carried out by flow injection-electrothermal atomic absorption spectrometry (FI-ETAAS). The variables affecting the system were established by a multivariate design (Plackett Burman), indicating that the following variables significantly affect the system: sample amount, HNO3 digestion solution concentration, NaBH4 volume and elution volume. A Box-Behnken design was implemented to determine the optimized values of these variables. The system improved Se atomization in the graphite furnace, since only trapped hydrides reached the graphite furnace, and the pyrolysis stage was eliminated according to the aqueous matrix of the eluate. Under optimized conditions the system reached a limit of quantification of 0.11 μg kg- 1, a detection limit of 0.032 μg kg- 1, a relative standard deviation of 4% and a preconcentration factor (PF) of 100, reaching a throughput sample of 5 samples per hour. Sample analysis show Se concentrations between 0.34 ± 0.03 μg kg- 1 to 0.48 ± 0.03 μg kg- 1 in grape pomace. This system provides minimal reagents and sample consumption, eliminates discontinuous stages between samples processing reaching a simpler and faster Se analysis.

  14. "Paper Machine" for Molecular Diagnostics.

    PubMed

    Connelly, John T; Rolland, Jason P; Whitesides, George M

    2015-08-04

    Clinical tests based on primer-initiated amplification of specific nucleic acid sequences achieve high levels of sensitivity and specificity. Despite these desirable characteristics, these tests have not reached their full potential because their complexity and expense limit their usefulness to centralized laboratories. This paper describes a device that integrates sample preparation and loop-mediated isothermal amplification (LAMP) with end point detection using a hand-held UV source and camera phone. The prototype device integrates paper microfluidics (to enable fluid handling) and a multilayer structure, or a "paper machine", that allows a central patterned paper strip to slide in and out of fluidic path and thus allows introduction of sample, wash buffers, amplification master mix, and detection reagents with minimal pipetting, in a hand-held, disposable device intended for point-of-care use in resource-limited environments. This device creates a dynamic seal that prevents evaporation during incubation at 65 °C for 1 h. This interval is sufficient to allow a LAMP reaction for the Escherichia coli malB gene to proceed with an analytical sensitivity of 1 double-stranded DNA target copy. Starting with human plasma spiked with whole, live E. coli cells, this paper demonstrates full integration of sample preparation with LAMP amplification and end point detection with a limit of detection of 5 cells. Further, it shows that the method used to prepare sample enables concentration of DNA from sample volumes commonly available from fingerstick blood draw.

  15. Full evaporation headspace gas chromatography for sensitive determination of high boiling point volatile organic compounds in low boiling matrices.

    PubMed

    Mana Kialengila, Didi; Wolfs, Kris; Bugalama, John; Van Schepdael, Ann; Adams, Erwin

    2013-11-08

    Determination of volatile organic components (VOC's) is often done by static headspace gas chromatography as this technique is very robust and combines easy sample preparation with good selectivity and low detection limits. This technique is used nowadays in different applications which have in common that they have a dirty matrix which would be problematic in direct injection approaches. Headspace by nature favors the most volatile compounds, avoiding the less volatile to reach the injector and column. As a consequence, determination of a high boiling solvent in a lower boiling matrix becomes challenging. Determination of VOCs like: xylenes, cumene, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), N,N-dimethylacetamide (DMA), N-methyl-2-pyrrolidone (NMP), 1,3-dimethyl-2-imidazolidinone (DMI), benzyl alcohol (BA) and anisole in water or water soluble products are an interesting example of the arising problems. In this work, a headspace variant called full evaporation technique is worked out and validated for the mentioned solvents. Detection limits below 0.1 μg/vial are reached with RSD values below 10%. Mean recovery values ranged from 92.5 to 110%. The optimized method was applied to determine residual DMSO in a water based cell culture and DMSO and DMA in tetracycline hydrochloride (a water soluble sample). Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A Detailed Look at the Performance Characteristics of the Lightning Imaging Sensor

    NASA Technical Reports Server (NTRS)

    Zhang, Daile; Cummins, Kenneth L.; Bitzer, Phillip; Koshak, William J.

    2018-01-01

    The Lightning Imaging Sensor (LIS) on board the Tropical Rainfall Measuring Mission (TRMM) effectively reached its end of life on April 15, 2015 after 17+ years of observation. Given the wealth of information in the archived LIS lightning data, and growing use of optical observations of lightning from space throughout the world, it is still of importance to better understand LIS calibration and performance characteristics. In this work, we continue our efforts to quantify the optical characteristics of the LIS pixel array, and to further characterize the detection efficiency and location accuracy of LIS. The LIS pixel array was partitioned into four quadrants, each having its own signal amplifier and digital conversion hardware. In addition, the sensor optics resulted in a decreasing sensitivity with increasing displacement from the center of the array. These engineering limitations resulted in differences in the optical emissions detected across the pixel array. Our work to date has shown a 20% increase in the count of the lightning events detected in one of the LIS quadrants, because of a lower detection threshold. In this study, we will discuss our work in progress on these limitations, and their potential impact on the group- and flash-level parameters.

  17. Quantum sensing with arbitrary frequency resolution

    NASA Astrophysics Data System (ADS)

    Boss, J. M.; Cujia, K. S.; Zopes, J.; Degen, C. L.

    2017-05-01

    Quantum sensing takes advantage of well-controlled quantum systems for performing measurements with high sensitivity and precision. We have implemented a concept for quantum sensing with arbitrary frequency resolution, independent of the qubit probe and limited only by the stability of an external synchronization clock. Our concept makes use of quantum lock-in detection to continuously probe a signal of interest. Using the electronic spin of a single nitrogen-vacancy center in diamond, we demonstrate detection of oscillating magnetic fields with a frequency resolution of 70 microhertz over a megahertz bandwidth. The continuous sampling further guarantees an enhanced sensitivity, reaching a signal-to-noise ratio in excess of 104 for a 170-nanotesla test signal measured during a 1-hour interval. Our technique has applications in magnetic resonance spectroscopy, quantum simulation, and sensitive signal detection.

  18. Gravitational wave detection using laser interferometry beyond the standard quantum limit

    NASA Astrophysics Data System (ADS)

    Heurs, M.

    2018-05-01

    Interferometric gravitational wave detectors (such as advanced LIGO) employ high-power solid-state lasers to maximize their detection sensitivity and hence their reach into the universe. These sophisticated light sources are ultra-stabilized with regard to output power, emission frequency and beam geometry; this is crucial to obtain low detector noise. However, even when all laser noise is reduced as far as technically possible, unavoidable quantum noise of the laser still remains. This is a consequence of the Heisenberg Uncertainty Principle, the basis of quantum mechanics: in this case, it is fundamentally impossible to simultaneously reduce both the phase noise and the amplitude noise of a laser to arbitrarily low levels. This fact manifests in the detector noise budget as two distinct noise sources-photon shot noise and quantum radiation pressure noise-which together form a lower boundary for current-day gravitational wave detector sensitivities, the standard quantum limit of interferometry. To overcome this limit, various techniques are being proposed, among them different uses of non-classical light and alternative interferometer topologies. This article explains how quantum noise enters and manifests in an interferometric gravitational wave detector, and gives an overview of some of the schemes proposed to overcome this seemingly fundamental limitation, all aimed at the goal of higher gravitational wave event detection rates. This article is part of a discussion meeting issue `The promises of gravitational-wave astronomy'.

  19. Gravitational wave detection using laser interferometry beyond the standard quantum limit.

    PubMed

    Heurs, M

    2018-05-28

    Interferometric gravitational wave detectors (such as advanced LIGO) employ high-power solid-state lasers to maximize their detection sensitivity and hence their reach into the universe. These sophisticated light sources are ultra-stabilized with regard to output power, emission frequency and beam geometry; this is crucial to obtain low detector noise. However, even when all laser noise is reduced as far as technically possible, unavoidable quantum noise of the laser still remains. This is a consequence of the Heisenberg Uncertainty Principle, the basis of quantum mechanics: in this case, it is fundamentally impossible to simultaneously reduce both the phase noise and the amplitude noise of a laser to arbitrarily low levels. This fact manifests in the detector noise budget as two distinct noise sources-photon shot noise and quantum radiation pressure noise-which together form a lower boundary for current-day gravitational wave detector sensitivities, the standard quantum limit of interferometry. To overcome this limit, various techniques are being proposed, among them different uses of non-classical light and alternative interferometer topologies. This article explains how quantum noise enters and manifests in an interferometric gravitational wave detector, and gives an overview of some of the schemes proposed to overcome this seemingly fundamental limitation, all aimed at the goal of higher gravitational wave event detection rates.This article is part of a discussion meeting issue 'The promises of gravitational-wave astronomy'. © 2018 The Author(s).

  20. SERS detection of Biomolecules at Physiological pH via aggregation of Gold Nanorods mediated by Optical Forces and Plasmonic Heating

    NASA Astrophysics Data System (ADS)

    Fazio, Barbara; D'Andrea, Cristiano; Foti, Antonino; Messina, Elena; Irrera, Alessia; Donato, Maria Grazia; Villari, Valentina; Micali, Norberto; Maragò, Onofrio M.; Gucciardi, Pietro G.

    2016-06-01

    Strategies for in-liquid molecular detection via Surface Enhanced Raman Scattering (SERS) are currently based on chemically-driven aggregation or optical trapping of metal nanoparticles in presence of the target molecules. Such strategies allow the formation of SERS-active clusters that efficiently embed the molecule at the “hot spots” of the nanoparticles and enhance its Raman scattering by orders of magnitude. Here we report on a novel scheme that exploits the radiation pressure to locally push gold nanorods and induce their aggregation in buffered solutions of biomolecules, achieving biomolecular SERS detection at almost neutral pH. The sensor is applied to detect non-resonant amino acids and proteins, namely Phenylalanine (Phe), Bovine Serum Albumin (BSA) and Lysozyme (Lys), reaching detection limits in the μg/mL range. Being a chemical free and contactless technique, our methodology is easy to implement, fast to operate, needs small sample volumes and has potential for integration in microfluidic circuits for biomarkers detection.

  1. SERS detection of Biomolecules at Physiological pH via aggregation of Gold Nanorods mediated by Optical Forces and Plasmonic Heating

    PubMed Central

    Fazio, Barbara; D’Andrea, Cristiano; Foti, Antonino; Messina, Elena; Irrera, Alessia; Donato, Maria Grazia; Villari, Valentina; Micali, Norberto; Maragò, Onofrio M.; Gucciardi, Pietro G.

    2016-01-01

    Strategies for in-liquid molecular detection via Surface Enhanced Raman Scattering (SERS) are currently based on chemically-driven aggregation or optical trapping of metal nanoparticles in presence of the target molecules. Such strategies allow the formation of SERS-active clusters that efficiently embed the molecule at the “hot spots” of the nanoparticles and enhance its Raman scattering by orders of magnitude. Here we report on a novel scheme that exploits the radiation pressure to locally push gold nanorods and induce their aggregation in buffered solutions of biomolecules, achieving biomolecular SERS detection at almost neutral pH. The sensor is applied to detect non-resonant amino acids and proteins, namely Phenylalanine (Phe), Bovine Serum Albumin (BSA) and Lysozyme (Lys), reaching detection limits in the μg/mL range. Being a chemical free and contactless technique, our methodology is easy to implement, fast to operate, needs small sample volumes and has potential for integration in microfluidic circuits for biomarkers detection. PMID:27246267

  2. Near infrared transillumination compared with radiography to detect and monitor proximal caries: A clinical retrospective study.

    PubMed

    Abdelaziz, Marwa; Krejci, Ivo; Perneger, Thomas; Feilzer, Albert; Vazquez, Lydia

    2018-03-01

    To compare near infrared transillumination device, DIAGNOcam (DC) and bitewing radiography (BW) for the detection of proximal caries. This retrospective analysis of DC and BW images of 18 students in dental medicine who had consented to the anonymous use of their dental record. The data included BW and DC images performed for a check-up in 2013, and corresponding follow-up images performed in 2015. Two observers rated 376 proximal surfaces on a 4-level dentin lesion scale and reached a unanimous rating for each surface. Calculated measures of agreement for each assessment method over time provided the reproducibility of the information obtained by each method. Agreement between 2013 and 2015 within each method was excellent (intraclass correlation coefficient, BW: 0.86, DC: 0.90). Agreement between DC and BW was similar for dentin lesion detection, but was low for enamel caries detection; DC detected more enamel caries than BW. Agreement between DC and BW was modest (0.33 in 2013 and 0.36 in 2015), chiefly because DC identified more enamel caries. This study shows that DC is as reliable as BW to detect proximal dentin lesions. DC detects proximal enamel lesions at an earlier stage than BW. DC enables clinicians to differentiate lesions limited to the enamel from lesions that have reached the enamel dentin junction. Regular monitoring with DC should help provide individualized preventive measures and early non-invasive caries management. The early detection of enamel lesions with near infrared transillumination can help clinicians undertake early non invasive treatments to prevent or slow down the progression of initial proximal lesions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Dextran hydrogel coated surface plasmon resonance imaging (SPRi) sensor for sensitive and label-free detection of small molecule drugs

    NASA Astrophysics Data System (ADS)

    Li, Shaopeng; Yang, Mo; Zhou, Wenfei; Johnston, Trevor G.; Wang, Rui; Zhu, Jinsong

    2015-11-01

    The label-free and sensitive detection of small molecule drugs on SPRi is still a challenging task, mainly due to the limited surface immobilization capacity of the sensor. In this research, a dextran hydrogel-coated gold sensor chip for SPRi was successfully fabricated via photo-cross-linking for enhanced surface immobilization capacity. The density of the dextran hydrogel was optimized for protein immobilization and sensitive small molecule detection. The protein immobilization capacity of the hydrogel was 10 times greater than a bare gold surface, and 20 times greater than an 11-mercaptoundecanoic acid (MUA) surface. Such a drastic improvement in immobilization capacity allowed the SPRi sensor to detect adequate response signals when probing small molecule binding events. The binding signal of 4 nM liquid-phase biotin to streptavidin immobilized on the dextran surface reached 435 RU, while no response was observed on bare gold or MUA surfaces. The dextran hydrogel-coated SPRi sensor was also applied in a kinetic study of the binding between an immunosuppressive drug (FK506) and its target protein (FKBP12) in a high-throughput microarray format. The measured binding affinity was shown to be consistent with reported literature values, and a detection limit of 0.5 nM was achieved.

  4. Facile fabrication of Ag dendrite-integrated anodic aluminum oxide membrane as effective three-dimensional SERS substrate

    NASA Astrophysics Data System (ADS)

    Zhang, Cong-yun; Lu, Ya; Zhao, Bin; Hao, Yao-wu; Liu, Ya-qing

    2016-07-01

    A novel surface enhanced Raman scattering (SERS)-active substrate has been successfully developed, where Ag-dendrites are assembled on the surface and embedded in the channels of anodic aluminum oxide (AAO) membrane, via electrodeposition in AgNO3/PVP aqueous system. Reaction conditions were systematically investigated to attain the best Raman enhancement. The growth mechanism of Ag dendritic nanostructures has been proposed. The Ag dendrite-integrated AAO membrane with unique hierarchical structures exhibits high SERS activity for detecting rhodamine 6G with a detection limit as low as 1 × 10-11 M. Furthermore, the three-dimensional (3D) substrates display a good reproducibility with the average intensity variations at the major Raman peak less than 12%. Most importantly, the 3D SERS substrates without any surface modification show an outstanding SERS response for the molecules with weak affinity for noble metal surfaces. The potential application for the detection of polycyclic aromatic hydrocarbons (PAHs) was evaluated with fluoranthene as Raman target molecule and a sensitive SERS detection with a limit down to 10-8 M was reached. The 3D SERS-active substrate shows promising potential for rapid detection of trace organic pollutants even weak affinity molecules in the environment.

  5. Wavefront control methods for high-contrast integral field spectroscopy

    NASA Astrophysics Data System (ADS)

    Groff, Tyler D.; Mejia Prada, Camilo; Cady, Eric; Rizzo, Maxime J.; Mandell, Avi; Gong, Qian; McElwain, Michael; Zimmerman, Neil; Saxena, Prabal; Guyon, Olivier

    2017-09-01

    Direct Imaging of exoplanets using a coronagraph has become a major field of research both on the ground and in space. Key to the science of direct imaging is the spectroscopic capabilities of the instrument, our ability to fit spectra, and understanding the composition of the observed planets. Direct imaging instruments generally use an integral field spectrograph (IFS), which encodes the spectrum into a two-dimensional image on the detector. This results in more efficient detection and characterization of targets, and the spectral information is critical to achieving detection limits below the speckle floor of the imager. The most mature application of these techniques is at more modest contrast ratios on ground-based telescopes, achieving approximately 5-6 orders of magnitude suppression. In space, where we are attempting to detect Earth-analogs, the contrast requirements are more severe and the IFS must be incorporated into the wavefront control loop to reach 1e-10 detection limits required for Earth-like planet detection. We present the objectives and application of IFS imagery for both a speckle control loop and post-processing of images. Results, tested methodologies, and the future work using the Coronagraphic High Angular Resolution Imaging Spectrograph (CHARIS) and the Prototype Imaging Spectrograph for Coronagraphic Exoplanet Studies (PISCES) at the JPL High Contrast Imaging Testbed are presented.

  6. Solar atmospheric neutrinos: A new neutrino floor for dark matter searches

    NASA Astrophysics Data System (ADS)

    Ng, Kenny C. Y.; Beacom, John F.; Peter, Annika H. G.; Rott, Carsten

    2017-11-01

    As is well known, dark matter direct detection experiments will ultimately be limited by a "neutrino floor," due to the scattering of nuclei by MeV neutrinos from, e.g., nuclear fusion in the Sun. Here we point out the existence of a new neutrino floor that will similarly limit indirect detection with the Sun, due to high-energy neutrinos from cosmic-ray interactions with the solar atmosphere. We have two key findings. First, solar atmospheric neutrinos ≲1 TeV cause a sensitivity floor for standard weakly interacting massive particles (WIMP) scenarios, for which higher-energy neutrinos are absorbed in the Sun. This floor will be reached once the present sensitivity is improved by just 1 order of magnitude. Second, for neutrinos ≳1 TeV , which can be isolated by muon energy loss rate, solar atmospheric neutrinos should soon be detectable in IceCube. Discovery will help probe the complicated effects of solar magnetic fields on cosmic rays. These events will be backgrounds to WIMP scenarios with long-lived mediators, for which higher-energy neutrinos can escape from the Sun.

  7. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction.

    PubMed

    Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin

    2009-02-01

    Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.

  8. Fast analysis of domoic acid using microchip electrophoresis with laser-induced fluorescence detection.

    PubMed

    Cheng, Yongqiang; Guo, Cuilian; Zhao, Bin; Yang, Li

    2017-04-01

    A fast and effective method was developed to detect domoic acid based upon microchip electrophoresis combined with laser-induced fluorescence detection. Through study of the gated injection process on the cross channel of the microchip, the low-voltage mode with relatively longer sample loading time was adopted to reduce the sample discrimination and improve the signal sensitivity. Fluorescein isothiocyanate was used as the derivatizing reagent for domoic acid. Under the optimized conditions, domoic acid was completely separated in 60 s with separation efficiency of 1.35 × 10 5  m -1 . The calibration curve was obtained in the range of 1.0 × 10 -9 to 1.0 × 10 -7  mol/L, and the detection limit reached 2.8 × 10 -10  mol/L. This developed method was successfully applied to analyze domoic acid in real samples. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Assembly of potassium niobate nanosheets/silver oxide composite films with good SERS performance towards crystal violet detection

    NASA Astrophysics Data System (ADS)

    Zhu, Kun; Hong, Zhen; Kang, Shi-Zhao; Qin, Lixia; Li, Guodong; Li, Xiangqing

    2018-04-01

    The orderly potassium niobate nanosheets/silver oxide (Ag2O) composite films with uniform morphology were achieved by layer-by-layer self-assembly combined with ultraviolet light irradiation. The composition, structure and morphology of the potassium niobate nanosheets/Ag2O composite films were studied by XPS, XRD and SEM. Furthermore, the films were used as a SERS probe to detect crystal violet molecules. The results showed that the potassium niobate nanosheets/Ag2O composite films were an active substrate for fast and sensitive detection of crystal violet with low concentration. The limit of detection by the films can reach 1 × 10-6 mol L-1. Both electromagnetic enhancement and chemical enhancement contributed to the enhanced SERS in the (potassium niobate nanosheets/Ag2O)4 films. Moreover, it was found that the films were relatively stable under light irradiation or heat treatment in a certain range.

  10. [Monolithic column-gold composite substrate preparation and application to SERS detection of pigment].

    PubMed

    Xie, Yun-Fei; Li, Yan; Yu, Hui; Qian, He; Yao, Wei-Rong

    2014-03-01

    In the present study, we developed a novel SERS substrate with the porous monolith material combined with classic gold nanoparticles, and erythrosine as the research object, by adjusting the different experimental conditions for optimal SERS enhancements, including system pH and mixing time, and ultimately selected the optimum pH value 5.06 and mixing time 25 min. Compared with the traditional gold plastic substrate enhancement effect, the experimental conditions were applied to the monolith substrate SERS detection of dye erythrosine, different concentrations of samples were used for erythrosine SERS detection, and the detection limit reached 0.1 g x mL(-1). The method uses the payload of gold nanoparticles in mesoporous materials to effectively enhance the SERS signal. And this method has the advantages of simpleness and good stability, which provides a favorable theoretical basis for the rapid prohibited colorings screening.

  11. Development of a qualitative real-time PCR method to detect 19 targets for identification of genetically modified organisms.

    PubMed

    Peng, Cheng; Wang, Pengfei; Xu, Xiaoli; Wang, Xiaofu; Wei, Wei; Chen, Xiaoyun; Xu, Junfeng

    2016-01-01

    As the amount of commercially available genetically modified organisms (GMOs) grows recent years, the diversity of target sequences for molecular detection techniques are eagerly needed. Considered as the gold standard for GMO analysis, the real-time PCR technology was optimized to produce a high-throughput GMO screening method. With this method we can detect 19 transgenic targets. The specificity of the assays was demonstrated to be 100 % by the specific amplification of DNA derived from reference material from 20 genetically modified crops and 4 non modified crops. Furthermore, most assays showed a very sensitive detection, reaching the limit of ten copies. The 19 assays are the most frequently used genetic elements present in GM crops and theoretically enable the screening of the known GMO described in Chinese markets. Easy to use, fast and cost efficient, this method approach fits the purpose of GMO testing laboratories.

  12. Electrochemical lateral flow immunosensor for detection and quantification of dengue NS1 protein.

    PubMed

    Sinawang, Prima Dewi; Rai, Varun; Ionescu, Rodica E; Marks, Robert S

    2016-03-15

    An Electrochemical Lateral Flow Immunosensor (ELFI) is developed combining screen-printed gold electrodes (SPGE) enabling quantification together with the convenience of a lateral flow test strip. A cellulose glassy fiber paper conjugate pad retains the marker immunoelectroactive nanobeads which will bind to the target analyte of interest. The specific immunorecognition event continues to occur along the lateral flow bed until reaching the SPGE-capture antibodies at the end of the cellulosic lateral flow strip. The rationale of the immunoassay consists in the analyte antigen NS1 protein being captured selectively and specifically by the dengue NS1 antibody conjugated onto the immunonanobeads thus forming an immunocomplex. With the aid of a running buffer, the immunocomplexes flow and reach the immuno-conjugated electrode surface and form specific sandwich-type detection due to specific, molecular recognition, while unbound beads move along past the electrodes. The successful sandwich immunocomplex formation is then recorded electrochemically. Specific detection of NS1 is translated into an electrochemical signal contributed by a redox label present on the bead-immobilized detection dengue NS1 antibody while a proportional increase of faradic current is observed with increase in analyte NS1 protein concentration. The first generation ELFI prototype is simply assembled in a cassette and successfully demonstrates wide linear range over a concentration range of 1-25 ng/mL with an ultrasensitive detection limit of 0.5 ng/mL for the qualitative and quantitative detection of analyte dengue NS1 protein. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. NMR spectroscopy of single sub-nL ova with inductive ultra-compact single-chip probes

    PubMed Central

    Grisi, Marco; Vincent, Franck; Volpe, Beatrice; Guidetti, Roberto; Harris, Nicola; Beck, Armin; Boero, Giovanni

    2017-01-01

    Nuclear magnetic resonance (NMR) spectroscopy enables non-invasive chemical studies of intact living matter. However, the use of NMR at the volume scale typical of microorganisms is hindered by sensitivity limitations, and experiments on single intact organisms have so far been limited to entities having volumes larger than 5 nL. Here we show NMR spectroscopy experiments conducted on single intact ova of 0.1 and 0.5 nL (i.e. 10 to 50 times smaller than previously achieved), thereby reaching the relevant volume scale where life development begins for a broad variety of organisms, humans included. Performing experiments with inductive ultra-compact (1 mm2) single-chip NMR probes, consisting of a low noise transceiver and a multilayer 150 μm planar microcoil, we demonstrate that the achieved limit of detection (about 5 pmol of 1H nuclei) is sufficient to detect endogenous compounds. Our findings suggest that single-chip probes are promising candidates to enable NMR-based study and selection of microscopic entities at biologically relevant volume scales. PMID:28317887

  14. Modeling the Dynamics of High-Grade Serous Ovarian Cancer Progression for Transvaginal Ultrasound-Based Screening and Early Detection

    PubMed Central

    Lee, Jung-Min; Levy, Doron

    2016-01-01

    High-grade serous ovarian cancer (HGSOC) represents the majority of ovarian cancers and accounts for the largest proportion of deaths from the disease. A timely detection of low volume HGSOC should be the goal of any screening studies. However, numerous transvaginal ultrasound (TVU) detection-based population studies aimed at detecting low-volume disease have not yielded reduced mortality rates. A quantitative invalidation of TVU as an effective HGSOC screening strategy is a necessary next step. Herein, we propose a mathematical model for a quantitative explanation on the reported failure of TVU-based screening to improve HGSOC low-volume detectability and overall survival.We develop a novel in silico mathematical assessment of the efficacy of a unimodal TVU monitoring regimen as a strategy aimed at detecting low-volume HGSOC in cancer-positive cases, defined as cases for which the inception of the first malignant cell has already occurred. Our findings show that the median window of opportunity interval length for TVU monitoring and HGSOC detection is approximately 1.76 years. This does not translate into reduced mortality levels or improved detection accuracy in an in silico cohort across multiple TVU monitoring frequencies or detection sensitivities. We demonstrate that even a semiannual, unimodal TVU monitoring protocol is expected to miss detectable HGSOC. Lastly, we find that circa 50% of the simulated HGSOC growth curves never reach the baseline detectability threshold, and that on average, 5–7 infrequent, rate-limiting stochastic changes in the growth parameters are associated with reaching HGSOC detectability and mortality thresholds respectively. Focusing on a malignancy poorly studied in the mathematical oncology community, our model captures the dynamic, temporal evolution of HGSOC progression. Our mathematical model is consistent with recent case reports and prospective TVU screening population studies, and provides support to the empirical recommendation against frequent HGSOC screening. PMID:27257824

  15. Experimental test of fidelity limits in six-photon interferometry and of rotational invariance properties of the photonic six-qubit entanglement singlet state.

    PubMed

    Rådmark, Magnus; Zukowski, Marek; Bourennane, Mohamed

    2009-10-09

    Quantum multiphoton interferometry has now reached the six-photon stage. Thus far, the observed fidelities of entangled states never reached 2/3. We report a high fidelity (estimated at 88%) experiment in which six-qubit singlet correlations were observed. With such a high fidelity we are able to demonstrate the central property of these "singlet" correlations, their "rotational invariance," by performing a full set of measurements in three complementary polarization bases. The patterns are almost indistinguishable. The data reveal genuine six-photon entanglement. We also study several five-photon states, which result upon detection of one of the photons. Multiphoton singlet states survive some types of depolarization and are thus important in quantum communication schemes.

  16. Improved Sensor Fault Detection, Isolation, and Mitigation Using Multiple Observers Approach

    PubMed Central

    Wang, Zheng; Anand, D. M.; Moyne, J.; Tilbury, D. M.

    2017-01-01

    Traditional Fault Detection and Isolation (FDI) methods analyze a residual signal to detect and isolate sensor faults. The residual signal is the difference between the sensor measurements and the estimated outputs of the system based on an observer. The traditional residual-based FDI methods, however, have some limitations. First, they require that the observer has reached its steady state. In addition, residual-based methods may not detect some sensor faults, such as faults on critical sensors that result in an unobservable system. Furthermore, the system may be in jeopardy if actions required for mitigating the impact of the faulty sensors are not taken before the faulty sensors are identified. The contribution of this paper is to propose three new methods to address these limitations. Faults that occur during the observers' transient state can be detected by analyzing the convergence rate of the estimation error. Open-loop observers, which do not rely on sensor information, are used to detect faults on critical sensors. By switching among different observers, we can potentially mitigate the impact of the faulty sensor during the FDI process. These three methods are systematically integrated with a previously developed residual-based method to provide an improved FDI and mitigation capability framework. The overall approach is validated mathematically, and the effectiveness of the overall approach is demonstrated through simulation on a 5-state suspension system. PMID:28924303

  17. Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

    DOE PAGES

    Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; ...

    2015-01-09

    We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: m DM, M med , g DM and g q, the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework canmore » be used to establish an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches.« less

  18. Optical Vector Receiver Operating Near the Quantum Limit

    NASA Astrophysics Data System (ADS)

    Vilnrotter, V. A.; Lau, C.-W.

    2005-05-01

    An optical receiver concept for binary signals with performance approaching the quantum limit at low average-signal energies is developed and analyzed. A conditionally nulling receiver that reaches the quantum limit in the absence of background photons has been devised by Dolinar. However, this receiver requires ideal optical combining and complicated real-time shaping of the local field; hence, it tends to be difficult to implement at high data rates. A simpler nulling receiver that approaches the quantum limit without complex optical processing, suitable for high-rate operation, had been suggested earlier by Kennedy. Here we formulate a vector receiver concept that incorporates the Kennedy receiver with a physical beamsplitter, but it also utilizes the reflected signal component to improve signal detection. It is found that augmenting the Kennedy receiver with classical coherent detection at the auxiliary beamsplitter output, and optimally processing the vector observations, always improves on the performance of the Kennedy receiver alone, significantly so at low average-photon rates. This is precisely the region of operation where modern codes approach channel capacity. It is also shown that the addition of background radiation has little effect on the performance of the coherent receiver component, suggesting a viable approach for near-quantum-limited performance in high background environments.

  19. Direct and precise determination of environmental radionuclides in solid materials using a modified Marinelli beaker and a HPGe detector.

    PubMed

    Seo, B K; Lee, K Y; Yoon, Y Y; Lee, D W

    2001-06-01

    A simple but precise detection method was studied for the determination of natural radionuclides using a conventional HPGe detector. A new aluminium beaker instead of a plastic Marinelli beaker was constructed and examined to reach radioactive equilibrium conditions between radon and its daughter elements without the escape of gaseous radon. Using this beaker fifteen natural radionuclides from three natural decay series could be determined by direct gamma-ray measurement and sixteen radionuclides could be determined indirectly after radioactive equilibrium had been reached. Analytical results from ground water were compared with those from conventional alpha spectroscopy and the results agreed well within 12% difference. Nitrogen gas purge was used to replace the surrounding air of the detector to obtain a stable background and reducing the interference of radon daughter nuclides in the atmosphere. The use of nitrogen purging and the aluminium Marinelli beaker results in an approximately tenfold increase of sensitivity and a decrease of the detection limit of 226Ra to about 0.74 Bq kg(-1) in soil samples.

  20. Electrochemical DNA biosensors based on long-range electron transfer: investigating the efficiency of a fluidic channel microelectrode compared to an ultramicroelectrode in a two-electrode setup.

    PubMed

    Horny, M-C; Lazerges, M; Siaugue, J-M; Pallandre, A; Rose, D; Bedioui, F; Deslouis, C; Haghiri-Gosnet, A-M; Gamby, J

    2016-11-01

    Here, we describe the transposition of an ultramicroelectrode (UME) setup into a microfluidic chip configuration for DNA biosensors. The hydrodynamic properties of the fluidic channel microelectrode were screened with an [Fe(iii)(CN) 6 ] 3- /[Fe(ii)(CN) 6 ] 4- redox couple by cyclic voltammetry to provide a basis for further biological processes. A 23-base DNA probe was self-assembled into a monolayer on gold microelectrodes both in classical configuration and integrated in a microfluidic setup. Special interest was focused on the DNA target mimicking the liver-specific micro-ribonucleic acid 122 (miRNA122). Long-range electron transfer was chosen for transducing the hybridization. This direct transduction was indeed significantly enhanced after hybridization due to DNA-duplex π-stacking and the use of redox methylene blue as a DNA intercalator. Quantification of the target was deduced from the resulting electrical signal characterized by cyclic voltammetry. The limit of detection for DNA hybridization was 0.1 fM in stopped flow experiments, where it can reach 1 aM over a 0.5 μL s -1 flow rate, a value 10 4 -fold lower than the one measured with a conventional UME dipped into an electrolyte droplet under the same analytical conditions. An explanation was that forced convection drives more biomolecules to the area of detection even if a balance between the speed of collection and the number of biomolecules collected has been found. The latter point is discussed here along with an attempt to explain why the sensor has reached such an unexpected value for the limit of detection.

  1. Label-free and high-sensitive detection for genetic point mutation based on hyperspectral interferometry

    NASA Astrophysics Data System (ADS)

    Fu, Rongxin; Li, Qi; Zhang, Junqi; Wang, Ruliang; Lin, Xue; Xue, Ning; Su, Ya; Jiang, Kai; Huang, Guoliang

    2016-10-01

    Label free point mutation detection is particularly momentous in the area of biomedical research and clinical diagnosis since gene mutations naturally occur and bring about highly fatal diseases. In this paper, a label free and high sensitive approach is proposed for point mutation detection based on hyperspectral interferometry. A hybridization strategy is designed to discriminate a single-base substitution with sequence-specific DNA ligase. Double-strand structures will take place only if added oligonucleotides are perfectly paired to the probe sequence. The proposed approach takes full use of the inherent conformation of double-strand DNA molecules on the substrate and a spectrum analysis method is established to point out the sub-nanoscale thickness variation, which benefits to high sensitive mutation detection. The limit of detection reach 4pg/mm2 according to the experimental result. A lung cancer gene point mutation was demonstrated, proving the high selectivity and multiplex analysis capability of the proposed biosensor.

  2. Multiplex DNA detection of food allergens on a digital versatile disk.

    PubMed

    Tortajada-Genaro, Luis A; Santiago-Felipe, Sara; Morais, Sergi; Gabaldón, José Antonio; Puchades, Rosa; Maquieira, Ángel

    2012-01-11

    The development of a DNA microarray method on a digital versatile disk (DVD) is described for the simultaneous detection of traces of hazelnut ( Corylus avellana L.), peanut ( Arachis hypogaea ), and soybean ( Glycine max ) in foods. After DNA extraction, multiplex PCR was set up using 5'-labeled specific primers for Cor a 1, Ar h 2, and Le genes, respectively. Digoxin-labeled PCR products were detected by hybridization with 5'-biotinylated probes immobilized on a streptavidin-modified DVD surface. The reaction product attenuates the signal intensity of the laser that reached the DVD drive used as detector, correlating well with the amount of amplified sequence. Analytical performances showed a detection limit of 1 μg/g and good assay reproducibility (RSD 8%), suitable for the simultaneous detection of the three targeted allergens. The developed methodology was tested with several commercially available foodstuffs, demonstrating its applicability. The results were in good agreement, in terms of sensitivity and reproducibility, with those obtained with ELISA, PCR-gel agarose electrophoresis, and RT-PCR.

  3. NIFTE: The Near Infrared Faint-Object Telescope Experiment

    NASA Technical Reports Server (NTRS)

    Bock, James J.; Lange, Andrew E.; Matsumoto, T.; Eisenhardt, Peter B.; Hacking, Perry B.; Schember, Helene R.

    1994-01-01

    The high sensitivity of large format InSb arrays can be used to obtain deep images of the sky at 3-5 micrometers. In this spectral range cool or highly redshifted objects (e.g. brown dwarfs and protogalaxies) which are not visible at shorter wavelengths may be observed. Sensitivity at these wavelengths in ground-based observations is severly limited by the thermal flux from the telescope and from the earth's atmosphere. The Near Infrared Faint-Object Telescope Experiment (NIFTE), a 50 cm cooled rocket-borne telescope combined with large format, high performance InSb arrays, can reach a limiting flux less than 1 micro-Jy(1-sigma) over a large field-of-view in a single flight. In comparison, the Infrared Space Observatory (ISO) will require days of observation to reach a sensitivity more than one order of magnitude worse over a similar area of the sky. The deep 3-5 micrometer images obtained by the rocket-borne telescope will assist in determining the nature of faint red objects detected by ground-based telescopes at 2 micrometers, and by ISO at wavelengths longer than 5 micrometers.

  4. Depth-resolved mid-infrared photothermal imaging of living cells and organisms with submicrometer spatial resolution

    PubMed Central

    Zhang, Delong; Li, Chen; Zhang, Chi; Slipchenko, Mikhail N.; Eakins, Gregory; Cheng, Ji-Xin

    2016-01-01

    Chemical contrast has long been sought for label-free visualization of biomolecules and materials in complex living systems. Although infrared spectroscopic imaging has come a long way in this direction, it is thus far only applicable to dried tissues because of the strong infrared absorption by water. It also suffers from low spatial resolution due to long wavelengths and lacks optical sectioning capabilities. We overcome these limitations through sensing vibrational absorption–induced photothermal effect by a visible laser beam. Our mid-infrared photothermal (MIP) approach reached 10 μM detection sensitivity and submicrometer lateral spatial resolution. This performance has exceeded the diffraction limit of infrared microscopy and allowed label-free three-dimensional chemical imaging of live cells and organisms. Distributions of endogenous lipid and exogenous drug inside single cells were visualized. We further demonstrated in vivo MIP imaging of lipids and proteins in Caenorhabditis elegans. The reported MIP imaging technology promises broad applications from monitoring metabolic activities to high-resolution mapping of drug molecules in living systems, which are beyond the reach of current infrared microscopy. PMID:27704043

  5. Depth-resolved mid-infrared photothermal imaging of living cells and organisms with submicrometer spatial resolution.

    PubMed

    Zhang, Delong; Li, Chen; Zhang, Chi; Slipchenko, Mikhail N; Eakins, Gregory; Cheng, Ji-Xin

    2016-09-01

    Chemical contrast has long been sought for label-free visualization of biomolecules and materials in complex living systems. Although infrared spectroscopic imaging has come a long way in this direction, it is thus far only applicable to dried tissues because of the strong infrared absorption by water. It also suffers from low spatial resolution due to long wavelengths and lacks optical sectioning capabilities. We overcome these limitations through sensing vibrational absorption-induced photothermal effect by a visible laser beam. Our mid-infrared photothermal (MIP) approach reached 10 μM detection sensitivity and submicrometer lateral spatial resolution. This performance has exceeded the diffraction limit of infrared microscopy and allowed label-free three-dimensional chemical imaging of live cells and organisms. Distributions of endogenous lipid and exogenous drug inside single cells were visualized. We further demonstrated in vivo MIP imaging of lipids and proteins in Caenorhabditis elegans . The reported MIP imaging technology promises broad applications from monitoring metabolic activities to high-resolution mapping of drug molecules in living systems, which are beyond the reach of current infrared microscopy.

  6. The development of the room temperature LWIR HgCdTe detectors for free space optics communication systems

    NASA Astrophysics Data System (ADS)

    Martyniuk, Piotr; Gawron, Waldemar; Mikołajczyk, Janusz

    2017-10-01

    There are many room temperature applications to include free space optics (FSO) communication system combining quantum cascade lasers sources where HgCdTe long-wave (8-12 micrometer) infrared radiation (LWIR) detector reaching ultrafast response time < 1 ns and nearly background limited infrared photodetection (BLIP) condition are implemented. Both nearly BLIP detectivity and ultra-response time stay in contradiction in detector's optimization process. That issue could be circumvented by implementation of the hyperhemispherical GaAs immersion lens into structure to increase optical to electrical area ratio giving flexibility in terms of response time optimization. The optimization approach depends on voltage condition. The generation - recombination (GR) mechanism within active layer was found to be important for forward and weak reverse conditions while photogenerated carrier transport is significant for higher reverse bias. Except of applied voltage, the drift time strongly depends on thickness of the absorption region. Reducing the thickness of the active region, the short drift times could be reached, but that solution significantly reduces quantum efficiency and lowers detectivity. Taking that into consideration a special multilayer heterostructure designs are developed. The p-type absorber is promising due to both high ambipolar mobility and low thermal GR driven by the Auger 7 mechanism. Theoretical simulations indicate that depending on bias condition and T = 300 K the multilayer barrier LWIR HgCdTe structure could reach response time below < 100 ps while biased and <= 1 ns while unbiased. Immersed detectivity reaches > 109 cmHz1/2/W. Since commercially available FSO could operate separately in SWIR, MWIR and LWIR range - the dual band detectors should be implemented into FSO. This paper shows theoretical performance of the dual band back-to-back MWIR and LWIR HgCdTe detector operating at 300 K pointing out the MWIR active layer influence on LWIR operating regime.

  7. Upconversion nanoparticle-based fluorescence resonance energy transfer assay for organophosphorus pesticides.

    PubMed

    Long, Qian; Li, Haitao; Zhang, Youyu; Yao, Shouzhuo

    2015-06-15

    This paper reports a novel nanosensor for organophosphorus pesticides based on the fluorescence resonance energy transfer (FRET) between NaYF4:Yb,Er upconversion nanoparticles (UCNPs) and gold nanoparticles (AuNPs). The detection mechanism is based on the facts that AuNPs quench the fluorescence of UCNPs and organophosphorus pesticides (OPs) inhibit the activity of acetylcholinesterase (AChE) which catalyzes the hydrolysis of acetylthiocholine (ATC) into thiocholine. Under the optimized conditions, the logarithm of the pesticides concentration was proportional to the inhibition efficiency. The detection limits of parathion-methyl, monocrotophos and dimethoate reached 0.67, 23, and 67 ng/L, respectively. Meanwhile, the biosensor shows good sensitivity, stability, and could be successfully applied to detection of OPs in real food samples, suggesting the biosensor has potentially extensive application clinic diagnoses assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Validation of shortened 2-day sterility testing of mesenchymal stem cell-based therapeutic preparation on an automated culture system.

    PubMed

    Lysák, Daniel; Holubová, Monika; Bergerová, Tamara; Vávrová, Monika; Cangemi, Giuseppina Cristina; Ciccocioppo, Rachele; Kruzliak, Peter; Jindra, Pavel

    2016-03-01

    Cell therapy products represent a new trend of treatment in the field of immunotherapy and regenerative medicine. Their biological nature and multistep preparation procedure require the application of complex release criteria and quality control. Microbial contamination of cell therapy products is a potential source of morbidity in recipients. The automated blood culture systems are widely used for the detection of microorganisms in cell therapy products. However the standard 2-week cultivation period is too long for some cell-based treatments and alternative methods have to be devised. We tried to verify whether a shortened cultivation of the supernatant from the mesenchymal stem cell (MSC) culture obtained 2 days before the cell harvest could sufficiently detect microbial growth and allow the release of MSC for clinical application. We compared the standard Ph. Eur. cultivation method and the automated blood culture system BACTEC (Becton Dickinson). The time to detection (TTD) and the detection limit were analyzed for three bacterial and two fungal strains. The Staphylococcus aureus and Pseudomonas aeruginosa were recognized within 24 h with both methods (detection limit ~10 CFU). The time required for the detection of Bacillus subtilis was shorter with the automated method (TTD 10.3 vs. 60 h for 10-100 CFU). The BACTEC system reached significantly shorter times to the detection of Candida albicans and Aspergillus brasiliensis growth compared to the classical method (15.5 vs. 48 and 31.5 vs. 48 h, respectively; 10-100 CFU). The positivity was demonstrated within 48 h in all bottles, regardless of the size of the inoculum. This study validated the automated cultivation system as a method able to detect all tested microorganisms within a 48-h period with a detection limit of ~10 CFU. Only in case of B. subtilis, the lowest inoculum (~10 CFU) was not recognized. The 2-day cultivation technique is then capable of confirming the microbiological safety of MSC and allows their timely release for clinical application.

  9. Recommendations for fluorescence instrument qualification: the new ASTM Standard Guide.

    PubMed

    DeRose, Paul C; Resch-Genger, Ute

    2010-03-01

    Aimed at improving quality assurance and quantitation for modern fluorescence techniques, ASTM International (ASTM) is about to release a Standard Guide for Fluorescence, reviewed here. The guide's main focus is on steady state fluorometry, for which available standards and instrument characterization procedures are discussed along with their purpose, suitability, and general instructions for use. These include the most relevant instrument properties needing qualification, such as linearity and spectral responsivity of the detection system, spectral irradiance reaching the sample, wavelength accuracy, sensitivity or limit of detection for an analyte, and day-to-day performance verification. With proper consideration of method-inherent requirements and limitations, many of these procedures and standards can be adapted to other fluorescence techniques. In addition, procedures for the determination of other relevant fluorometric quantities including fluorescence quantum yields and fluorescence lifetimes are briefly introduced. The guide is a clear and concise reference geared for users of fluorescence instrumentation at all levels of experience and is intended to aid in the ongoing standardization of fluorescence measurements.

  10. A multiple hollow fibre liquid-phase microextraction method for the determination of halogenated solvent residues in olive oil.

    PubMed

    Manso, J; García-Barrera, T; Gómez-Ariza, J L; González, A G

    2014-02-01

    The present paper describes a method based on the extraction of analytes by multiple hollow fibre liquid-phase microextraction and detection by ion-trap mass spectrometry and electron capture detectors after gas chromatographic separation. The limits of detection are in the range of 0.13-0.67 μg kg(-1), five orders of magnitude lower than those reached with the European Commission Official method of analysis, with three orders of magnitude of linear range (from the quantification limits to 400 μg kg(-1) for all the analytes) and recoveries in fortified olive oils in the range of 78-104 %. The main advantages of the analytical method are the absence of sample carryover (due to the disposable nature of the membranes), high enrichment factors in the range of 79-488, high throughput and low cost. The repeatability of the analytical method ranged from 8 to 15 % for all the analytes, showing a good performance.

  11. Dual Transition Edge Sensor Bolometer for Enhanced Dynamic Range

    NASA Technical Reports Server (NTRS)

    Chervenak, J. A.; Benford, D. J.; Moseley, S. H.; Irwin, K. D.

    2004-01-01

    Broadband surveys at the millimeter and submillimeter wavelengths will require bolometers that can reach new limits of sensitivity and also operate under high background conditions. To address this need, we present results on a dual transition edge sensor (TES) device with two operating modes: one for low background, ultrasensitive detection and one for high background, enhanced dynamic range detection. The device consists of a detector element with two transition temperatures (T(sub c)) of 0.25 and 0.51 K located on the same micromachined, thermally isolated membrane structure. It can be biased on either transition, and features phonon-limited noise performance at the lower T(sub c). We measure noise performance on the lower transition 7 x 10(exp -18) W/rt(Hz) and the bias power on the upper transition of 12.5 pW, giving a factor of 10 enhancement of the dynamic range for the device. We discuss the biasable range of this type of device and present a design concept to optimize utility of the device.

  12. Terahertz sensing of chlorpyrifos-methyl using metamaterials.

    PubMed

    Xu, Wendao; Xie, Lijuan; Zhu, Jianfei; Wang, Wei; Ye, Zunzhong; Ma, Yungui; Tsai, Chao-Yin; Chen, Suming; Ying, Yibin

    2017-03-01

    By squeezing electromagnetic energy into small volumes near a metal-dielectric interface, plasmonics provide many routes to enhance and manipulate light-matter interactions, which presents new strategies for signal enhancing technologies. As an extension of the ideas of plasmonics to the terahertz (THz) range, metamaterials have shown great potential in sensing applications. In this study, terahertz time-domain spectroscopy (THz-TDS) combined with metamaterials was used to detect chlorpyrifos-methyl (CM), which is one type of the broad-spectrum organophosphorus pesticides. The results demonstrate that sensitivity is greatly improved using THz metamaterials, with the limit of detection (LOD) of CM reaching 0.204mgL -1 , which is lower than the World Health Organization's provisional guideline limit for CM in vegetables (1mgL -1 ). The results indicated that THz spectroscopy combined with metamaterials could be a valuable method for highly sensitive THz applications, presenting a new strategy for food quality and safety control in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Searches for continuous gravitational waves from Scorpius X-1 and XTE J1751-305 in LIGO's sixth science run

    NASA Astrophysics Data System (ADS)

    Meadors, G. D.; Goetz, E.; Riles, K.; Creighton, T.; Robinet, F.

    2017-02-01

    Scorpius X-1 (Sco X-1) and x-ray transient XTE J1751-305 are low-mass x-ray binaries (LMXBs) that may emit continuous gravitational waves detectable in the band of ground-based interferometric observatories. Neutron stars in LMXBs could reach a torque-balance steady-state equilibrium in which angular momentum addition from infalling matter from the binary companion is balanced by angular momentum loss, conceivably due to gravitational-wave emission. Torque balance predicts a scale for detectable gravitational-wave strain based on observed x-ray flux. This paper describes a search for Sco X-1 and XTE J1751-305 in LIGO science run 6 data using the TwoSpect algorithm, based on searching for orbital modulations in the frequency domain. While no detections are claimed, upper limits on continuous gravitational-wave emission from Sco X-1 are obtained, spanning gravitational-wave frequencies from 40 to 2040 Hz and projected semimajor axes from 0.90 to 1.98 light-seconds. These upper limits are injection validated, equal any previous set in initial LIGO data, and extend over a broader parameter range. At optimal strain sensitivity, achieved at 165 Hz, the 95% confidence level random-polarization upper limit on dimensionless strain h0 is approximately 1.8 ×10-24. The closest approach to the torque-balance limit, within a factor of 27, is also at 165 Hz. Upper limits are set in particular narrow frequency bands of interest for J1751-305. These are the first upper limits known to date on r -mode emission from this XTE source. The TwoSpect method will be used in upcoming searches of Advanced LIGO and Virgo data.

  14. An ultrasensitive bio-surrogate for nanoporous filter membrane performance metrology directed towards contamination control in microlithography applications

    NASA Astrophysics Data System (ADS)

    Ahmad, Farhan; Mish, Barbara; Qiu, Jian; Singh, Amarnauth; Varanasi, Rao; Bedford, Eilidh; Smith, Martin

    2016-03-01

    Contamination tolerances in semiconductor manufacturing processes have changed dramatically in the past two decades, reaching below 20 nm according to the guidelines of the International Technology Roadmap for Semiconductors. The move to narrower line widths drives the need for innovative filtration technologies that can achieve higher particle/contaminant removal performance resulting in cleaner process fluids. Nanoporous filter membrane metrology tools that have been the workhorse over the past decade are also now reaching limits. For example, nanoparticle (NP) challenge testing is commonly applied for assessing particle retention performance of filter membranes. Factors such as high NP size dispersity, low NP detection sensitivity, and high NP particle-filter affinity impose challenges in characterizing the next generation of nanoporous filter membranes. We report a novel bio-surrogate, 5 nm DNA-dendrimer conjugate for evaluating particle retention performance of nanoporous filter membranes. A technique capable of single molecule detection is employed to detect sparse concentration of conjugate in filter permeate, providing >1000- fold higher detection sensitivity than any existing 5 nm-sized particle enumeration technique. This bio-surrogate also offers narrow size distribution, high stability and chemical tunability. This bio-surrogate can discriminate various sub-15 nm pore-rated nanoporous filter membranes based on their particle retention performance. Due to high bio-surrogate detection sensitivity, a lower challenge concentration of bio-surrogate (as compared to other NPs of this size) can be used for filter testing, providing a better representation of customer applications. This new method should provide better understanding of the next generation filter membranes for removing defect-causing contaminants from lithography processes.

  15. High Surface Area MoS 2/Graphene Hybrid Aerogel for Ultrasensitive NO 2 Detection

    DOE PAGES

    Long, Hu; Harley-Trochimczyk, Anna; Pham, Thang; ...

    2016-05-23

    A MoS 2/graphene hybrid aerogel synthesized with two-dimensional MoS 2 sheets coating a high surface area graphene aerogel scaffold is characterized and used for ultrasensitive NO 2 detection. The combination of graphene and MoS 2 leads to improved sensing properties with the graphene scaffold providing high specific surface area and high electrical and thermal conductivity and the single to few-layer MoS2 sheets providing high sensitivity and selectivity to NO 2. The hybrid aerogel is integrated onto a low-power microheater platform to probe the gas sensing performance. At room temperature, the sensor exhibits an ultralow detection limit of 50 ppb NOmore » 2. By heating the material to 200 °C, the response and recovery times to reach 90% of the final signal decrease to <1 min, while retaining the low detection limit. The MoS 2/graphene hybrid also shows good selectivity for NO 2 against H 2 and CO, especially when compared to bare graphene aerogel. The unique structure of the hybrid aerogel is responsible for the ultrasensitive, selective, and fast NO 2 sensing. The improved sensing performance of this hybrid aerogel also suggests the possibility of other 2D material combinations for further sensing applications.« less

  16. Cu0.89Zn0.11O, A New Peroxidase-Mimicking Nanozyme with High Sensitivity for Glucose and Antioxidant Detection.

    PubMed

    Nagvenkar, Anjani P; Gedanken, Aharon

    2016-08-31

    Nanomaterial-based enzyme mimetics (nanozymes) is an emerging field of research that promises to produce alternatives to natural enzymes for a variety of applications. The search for the most cost-effective and efficient inorganic nanomaterials, such as metal oxides, cannot be won by pristine CuO. However, unlike CuO, the Zn-doped CuO (Zn-CuO) nanoparticles reported in this paper reveal superior peroxidase-like enzyme activity. This places Zn-CuO in a good position to participate in a range of activities aimed at developing diverse enzyme applications. The peroxidase-like activity was tested and confirmed against various chromogenic substrates in the presence of H2O2 and obeyed the Michaelis-Menten enzymatic pathway. The mechanism of enhanced enzymatic activity was proved by employing terephthalic acid as a fluorescence probe and by electron spin resonance. The nanozyme, when tested for the detection of glucose, showed a substantial enhancement in the detection selectivity. The limit of detection (LOD) was also decreased reaching a limit as low as 0.27 ppm. Such a low LOD has not been reported so far for the metal oxides without any surface modifications. Moreover, the nanozyme (Zn-CuO) was utilized to detect the three antioxidants tannic acid, tartaric acid, and ascorbic acid and the relative strength of their antioxidant capacity was compared.

  17. Blowing snow detection from ground-based ceilometers: application to East Antarctica

    NASA Astrophysics Data System (ADS)

    Gossart, Alexandra; Souverijns, Niels; Gorodetskaya, Irina V.; Lhermitte, Stef; Lenaerts, Jan T. M.; Schween, Jan H.; Mangold, Alexander; Laffineur, Quentin; van Lipzig, Nicole P. M.

    2017-12-01

    Blowing snow impacts Antarctic ice sheet surface mass balance by snow redistribution and sublimation. However, numerical models poorly represent blowing snow processes, while direct observations are limited in space and time. Satellite retrieval of blowing snow is hindered by clouds and only the strongest events are considered. Here, we develop a blowing snow detection (BSD) algorithm for ground-based remote-sensing ceilometers in polar regions and apply it to ceilometers at Neumayer III and Princess Elisabeth (PE) stations, East Antarctica. The algorithm is able to detect (heavy) blowing snow layers reaching 30 m height. Results show that 78 % of the detected events are in agreement with visual observations at Neumayer III station. The BSD algorithm detects heavy blowing snow 36 % of the time at Neumayer (2011-2015) and 13 % at PE station (2010-2016). Blowing snow occurrence peaks during the austral winter and shows around 5 % interannual variability. The BSD algorithm is capable of detecting blowing snow both lifted from the ground and occurring during precipitation, which is an added value since results indicate that 92 % of the blowing snow is during synoptic events, often combined with precipitation. Analysis of atmospheric meteorological variables shows that blowing snow occurrence strongly depends on fresh snow availability in addition to wind speed. This finding challenges the commonly used parametrizations, where the threshold for snow particles to be lifted is a function of wind speed only. Blowing snow occurs predominantly during storms and overcast conditions, shortly after precipitation events, and can reach up to 1300 m a. g. l. in the case of heavy mixed events (precipitation and blowing snow together). These results suggest that synoptic conditions play an important role in generating blowing snow events and that fresh snow availability should be considered in determining the blowing snow onset.

  18. Direct detection of sub-GeV dark matter with semiconductor targets

    DOE PAGES

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; ...

    2016-05-09

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their O(1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcomingmore » several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark, with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. In conclusion, the searches we propose will probe vast new regions of unexplored dark matter model and parameter space.« less

  19. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  20. Development of the fast and efficient gamma detector using Cherenkov light for TOF-PET

    NASA Astrophysics Data System (ADS)

    Canot, C.; Alokhina, M.; Abbon, P.; Bard, J. P.; Tauzin, G.; Yvon, D.; Sharyy, V.

    2017-12-01

    In this paper we present two configurations of innovative gamma detectors using Cherenkov light for time-of-flight—Positron Emission Tomography (PET). The first uses heavy crystals as a Cherenkov radiator to develop a demonstrator for a whole body PET scanner with high detection efficiency. We demonstrated a 30% detection efficiency and a 180 ps (FWHM) time resolution, mainly limited by the time transit spread of the photomultiplier. The second configuration uses an innovative liquid, the TriMethyl Bismuth, to develop a high precision brain-scanning PET device with time-of-flight capability. According to Geant4 simulation, we expect to reach a precision of 150 ps (FWHM) and an efficiency of about 25%.

  1. Sensing Parts per Million Level Ammonia and Parts per Billion Level Acetic Acid in the Gas Phase by Common Black Film with a Fluorescent pH Probe.

    PubMed

    Fu, Jingni; Zhang, Luning

    2018-01-16

    Relying on the nanometer-thick water core and large surface area-to-volume ratio (∼2 × 10 8 m -1 ) of common black film (CBF), we are able to use a pH-sensitive dye (carboxy-seminaphthorhodafluor-1, SNARF-1) to detect ammonia and acetic acid gas adsorption into the CBF, with the limit of detection reaching 0.8 ppm for NH 3 gas and 3 ppb for CH 3 COOH gas in the air. Data analysis reveals that fluorescence signal change is linearly proportional to the gas concentration up to 15 ppm and 65 ppb for NH 3 and CH 3 COOH, respectively.

  2. Enhanced Raman scattering of single nanoparticles in a high-Q whispering-gallery microresonator

    NASA Astrophysics Data System (ADS)

    Liu, Rui-Shan; Jin, Wei-Liang; Yu, Xiao-Chong; Liu, Yong-Chun; Xiao, Yun-Feng

    2015-04-01

    We study Raman scattering of single nanoparticles coupled to a high-Q whispering-gallery microresonator. It is found that cavity resonances greatly enhance the Raman signal, and the enhancement factor is as high as 108. Unlike the noncavity case, the signal power exhibits a nonmonotonic dependence on particle size, and it reaches the maximum when the Rayleigh scattering loss and the cavity intrinsic loss are comparable. We further analyze how the Raman signal intensity is influenced by different parameters including cavity quality factors and taper-cavity coupling strength. The detection limit of observing single-nanoparticle Raman signal is discussed finally. As a potential application, this mechanism may provide an alternative way to detect specific biological targets without the need of precovered biorecognitions.

  3. Comparing the outcomes of two strategies for colorectal tumor detection: policy-promoted screening program versus health promotion service.

    PubMed

    Wu, Ping-Hsiu; Lin, Yu-Min; Liao, Chao-Sheng; Chang, Hung-Chuen; Chen, Yu-Hung; Yang, Kuo-Ching; Shih, Chia-Hui

    2013-06-01

    The Taiwanese government has proposed a population-based colorectal tumor detection program for the average-risk population. This study's objectives were to understand the outcomes of these screening policies and to evaluate the effectiveness of the program. We compared two databases compiled in one medical center. The "policy-promoted cancer screening" (PPS) database was built on the basis of the policy of the Taiwan Bureau of National Health Insurance for cancer screening. The "health promotion service" (HPS) database was built to provide health check-ups for self-paid volunteers. Both the PPS and HPS databases employ the immunochemical fecal occult blood test (iFOBT) and colonoscopy for colorectal tumor screening using different strategies. A comparison of outcomes between the PPS and HPS included: (1) quality indicators-compliance rate, cecum reaching rate, and tumor detection rate; and (2) validity indicators-sensitivity, specificity, positive, and negative predictive values for detecting colorectal neoplasms. A total of 10,563 and 1481 individuals were enrolled in PPS and HPS, respectively. Among quality indicators, there was no statistically significant difference in the cecum reaching rate between PPS and HPS. The compliance rates were 56.1% for PPS and 91.8% for HPS (p < 0.001). The advanced adenoma detection rates of PPS and HPS were 1.0% and 3.6%, respectively (p < 0.01). The carcinoma detection rates were 0.3% and 0.4%, respectively (p = 0.59). For validity indicators, PPS provides only a positive predictive value for colorectal tumor detection. HPS provides additional validity indicators, including sensitivity, specificity, positive predictive value, and negative predictive value, for colorectal tumor screening. In comparison with the outcomes of the HPS database, the screening efficacy of the PPS database is even for detecting colorectal carcinoma but is limited in detecting advanced adenoma. HPS may provide comprehensive validity indicators and will be helpful in adjusting current policies for improving screening performance. Copyright © 2013. Published by Elsevier B.V.

  4. The search for radio emission from exoplanets using LOFAR low-frequency beam-formed observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Griessmeier, Jean-Mathias; Zarka, Philippe

    2018-01-01

    Detection of radio emission from exoplanets can provide information on the star-planet system that is very difficult or impossible to study otherwise, such as the planet’s magnetic field, magnetosphere, rotation period, orbit inclination, and star-planet interactions. Such a detection in the radio domain would open up a whole new field in the study of exoplanets, however, currently there are no confirmed detections of an exoplanet at radio frequencies. In this study, we discuss our ongoing observational campaign searching for exoplanetary radio emissions using beam-formed observations within the Low Band of the Low-Frequency Array (LOFAR). To date we have observed three exoplanets: 55 Cnc, Upsilon Andromedae, and Tau Boötis. These planets were selected according to theoretical predictions, which indicated them as among the best candidates for an observation. During the observations we usually recorded three beams simultaneously, one on the exoplanet and two on patches of nearby “empty” sky. An automatic pipeline was created to automatically find RFI, calibrate the data due to instrumental effects, and to search for emission in the exoplanet beam. Additionally, we observed Jupiter with LOFAR with the same exact observational setup as the exoplanet observations. The main goals of the Jupiter observations are to train the detection algorithm and to calculate upper limits in the case of a non-detection. Data analysis is currently ongoing. Conclusions reached at the time of the meeting, about detection of or upper limit to the planetary signal, will be presented.

  5. LOFAR Searches for Radio Exoplanets

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Griessmeier, Jean-Mathias; Zarka, Philippe; Vasylieva, Iaroslavna

    2018-06-01

    Detection of radio emission from exoplanets can provide information on the star-planet system that is very difficult or impossible to study otherwise, such as the planet’s magnetic field, magnetosphere, rotation period, orbit inclination, and star-planet interactions. Such a detection in the radio domain would open up a whole new field in the study of exoplanets, however, currently there are no confirmed detections of an exoplanet at radio frequencies. In this study, we discuss our ongoing observational campaign searching for exoplanetary radio emissions using beam-formed observations within the Low Band of the Low-Frequency Array (LOFAR). To date we have observed three exoplanets: 55 Cnc, Upsilon Andromedae, and Tau Boötis. These planets were selected according to theoretical predictions, which indicated them as among the best candidates for an observation. During the observations we usually recorded three beams simultaneously, one on the exoplanet and two on patches of nearby “empty” sky. An automatic pipeline was created to automatically find RFI, calibrate the data due to instrumental effects, and to search for emission in the exoplanet beam. Additionally, we observed Jupiter with LOFAR with the same exact observational setup as the exoplanet observations. The main goals of the Jupiter observations are to train the detection algorithm and to calculate upper limits in the case of a non-detection. Data analysis is currently ongoing. Conclusions reached at the time of the meeting, about detection of or upper limit to the planetary signal, will be presented.

  6. HS-SPME determination of volatile carbonyl and carboxylic compounds in different matrices.

    PubMed

    Stashenko, Elena E; Mora, Amanda L; Cervantes, Martha E; Martínez, Jairo R

    2006-07-01

    Specific chromatographic methodologies are developed for the analysis of carboxylic acids (C(2)-C(6), benzoic) and aldehydes (C(2)-C(10)) of low molecular weight in diverse matrices, such as air, automotive exhaust gases, human breath, and aqueous matrices. For carboxylic acids, the method is based on their reaction with pentafluorobenzyl bromide in aqueous solution, followed by the separation and identification of the resultant pentafluorobenzyl esters by means of headspace (HS)-solid-phase microextraction (SPME) combined with gas chromatography (GC) and electron capture detection (ECD). Detection limits in the microg/m(3) range are reached, with relative standard deviation (RSD) less than 10% and linear response (R(2) > 0.99) over two orders of magnitude. The analytical methodology for aldehydes is based on SPME with simultaneous derivatization of the analytes on the fiber, by reaction with pentafluorophenylhydrazine. The derivatization reagent is previously deposited on the SPME fiber, which is then exposed to the gaseous matrix or the HS of the sample solution. The pentafluorophenyl hydrazones formed on the fiber are analyzed selectively by means of GC-ECD, with detection limits in the ng/m(3) range, RSD less than 10%, and linear response (R(2) > 0.99) over two orders of magnitude.

  7. Immunological detection of Fusarium species in cornmeal.

    PubMed

    Iyer, M S; Cousin, M A

    2003-03-01

    An indirect enzyme-linked immunosorbent assay (ELISA) was developed to detect Fusarium species in foods. Antibodies to proteins extracted from the mycelia of Fusarium graminearum and Fusarium moniliforme (verticillioides) were produced in New Zealand white rabbits. These antibodies detected 13 Fusarium species in addition to the producer strains. Levels of Fusarium semitectum and Fusarium tricinctum strains were below the detection threshold. The specificity of the assay was tested against 70 molds and yeasts belonging to 23 genera. One strain of Monascus species and one strain of Phoma exigua were detected; however, these two molds are not common contaminants of cereal grains or foods and should not interfere with the assay. The indirect ELISA's detection limits for F. graminearum and F. moniliforme were 0.1 and 1 microg of mold mycelium per ml of a cornmeal mixture, respectively. When spores of each mold were added individually to cornmeal mixtures (at ca. 10 spores per g) and incubated at 25 degrees C, these spores were detected by the indirect ELISA when they reached levels of 10(2) to 10(3) CFU/ml after 24 to 36 h. The indirect ELISA developed here shows promise for the detection of Fusarium species in grains or foods.

  8. Multi-Station Broad Regional Event Detection Using Waveform Correlation

    NASA Astrophysics Data System (ADS)

    Slinkard, M.; Stephen, H.; Young, C. J.; Eckert, R.; Schaff, D. P.; Richards, P. G.

    2013-12-01

    Previous waveform correlation studies have established the occurrence of repeating seismic events in various regions, and the utility of waveform-correlation event-detection on broad regional or even global scales to find events currently not included in traditionally-prepared bulletins. The computational burden, however, is high, limiting previous experiments to relatively modest template libraries and/or processing time periods. We have developed a distributed computing waveform correlation event detection utility that allows us to process years of continuous waveform data with template libraries numbering in the thousands. We have used this system to process several years of waveform data from IRIS stations in East Asia, using libraries of template events taken from global and regional bulletins. Detections at a given station are confirmed by 1) comparison with independent bulletins of seismicity, and 2) consistent detections at other stations. We find that many of the detected events are not in traditional catalogs, hence the multi-station comparison is essential. In addition to detecting the similar events, we also estimate magnitudes very precisely based on comparison with the template events (when magnitudes are available). We have investigated magnitude variation within detected families of similar events, false alarm rates, and the temporal and spatial reach of templates.

  9. Part per trillion nitric oxide measurement by optical feedback cavity-enhanced absorption spectroscopy in the mid-infrared

    NASA Astrophysics Data System (ADS)

    Ventrillard, Irène; Gorrotxategi-Carbajo, Paula; Romanini, Daniele

    2017-06-01

    While nitric oxide (NO) is being monitored in various fields of application, there is still a lack of available instruments at a sub-ppb level of sensitivity. We report on the first application of Optical Feedback Cavity-Enhanced Absorption Spectroscopy (OF-CEAS) to NO trace gas analysis, with a room-temperature quantum-cascade laser at 5.26 µm (1900.5 cm^{-1}). A detection limit of 60 ppt is reached in a single measurement performed in 140 ms. The stability of the instrument allows to average for 10 s down to 8.3 ppt, limited by drift of etalon fringes in the spectra. This work opens the path towards new applications notably in breath analysis and environment sciences.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Meiye; Davis, Ryan Wesley; Hatch, Anson

    In the early stages of infection, patients develop non-specific or no symptoms at all. While waiting for identification of the infectious agent, precious window of opportunity for early intervention is lost. The standard diagnostics require affinity reagents and sufficient pathogen titers to reach the limit of detection. In the event of a disease outbreak, triaging the at-risk population rapidly and reliably for quarantine and countermeasure is more important than the identification of the pathogen by name. To expand Sandia's portfolio of Biological threat management capabilities, we will utilize Raman spectrometry to analyze immune subsets in whole blood to rapidly distinguishmore » infected from non-infected, and bacterial from viral infection, for the purpose of triage during an emergency outbreak. The goal of this one year LDRD is to determine whether Raman spectroscopy can provide label-free detection of early disease signatures, and define a miniaturized Raman detection system meeting requirements for low- resource settings.« less

  11. A ratiometric fluorescent probe for rapid and sensitive detection of biothiols in fetal bovine serum.

    PubMed

    Wang, Fengyang; Feng, Chongchong; Lu, Linlin; Xu, Zhiai; Zhang, Wen

    2017-07-01

    Herein, a ratiometric turn-on fluorescent probe for sensitive detection of biothiols was designed. The probe consisted of two parts: one was rhodamine B serving as a fluorescence reference, and the other was coumarin derivative as the responsive fluorophore with an acrylate group for biothiols recognition. The response was based on the mechanism of Michael addition and intramolecular cyclization reaction, and the probe showed ratiometric and sensitive response to biothiols. Especially, the detection limit of this probe for cysteine was found to be 0.13μΜ. More importantly, the probe showed the advantage of fast response, of which the fluorescence intensity can reach the maximum within 10min. The ratiometric fluorescent probe has been successfully applied for the determination of biothiols in fetal bovine serum samples and the result was in good agreement with that tested by Ellman method. Copyright © 2017. Published by Elsevier B.V.

  12. Detection and period measurements of GX1+4 at hard x ray energies with the SIGMA telescope

    NASA Technical Reports Server (NTRS)

    Laurent, PH.; Salotti, L.; Lebrun, F.; Paul, J.; Denis, M.; Barret, D.; Jourdain, E.; Roques, J. P.; Churazov, E.; Gilfanov, M.

    1992-01-01

    The galactic Low Mass X ray Binary GX1+4 was detected by the coded aperture hard X ray gamma ray SIGMA telescope during the Feb. to April 1991 observations of the galactic center regions. The source, whose emission varied during the survey of a factor greater than 40 pct., reached a maximum luminosity in the 40 to 140 energy range of 1.03 x 10(exp 37) erg/s (D = 8.5 kpc), thus approaching the emission level of the 1970 to 1980 high state. Two minute flux pulsations were detected on Mar. 22 and on Mar. 31 and Apr. 1. Comparison with the last period measurements shows that the current spin-down phase of GX1+4 is ending. Concerning the proposed association of this source with the galactic center 511 keV annihilation emission, upper limits were derived.

  13. Dual quantum cascade laser-based sensor for simultaneous NO and NO2 detection using a wavelength modulation-division multiplexing technique

    NASA Astrophysics Data System (ADS)

    Yu, Yajun; Sanchez, Nancy P.; Yi, Fan; Zheng, Chuantao; Ye, Weilin; Wu, Hongpeng; Griffin, Robert J.; Tittel, Frank K.

    2017-05-01

    A sensor system capable of simultaneous measurements of NO and NO2 was developed using a wavelength modulation-division multiplexing (WMDM) scheme and multi-pass absorption spectroscopy. A continuous wave (CW), distributed-feedback (DFB) quantum cascade laser (QCL) and a CW external-cavity (EC) QCL were employed for targeting a NO absorption doublet at 1900.075 cm-1 and a NO2 absorption line at 1630.33 cm-1, respectively. Simultaneous detection was realized by modulating both QCLs independently at different frequencies and demodulating the detector signals with LabView-programmed lock-in amplifiers. The sensor operated at a reduced pressure of 40 Torr and a data sampling rate of 1 Hz. An Allan-Werle deviation analysis indicated that the minimum detection limits of NO and NO2 can reach sub-ppbv concentration levels with averaging times of 100 and 200 s, respectively.

  14. Nickel-Cobalt Oxide Decorated Three-Dimensional Graphene as an Enzyme Mimic for Glucose and Calcium Detection.

    PubMed

    Wu, Meiyan; Meng, Shangjun; Wang, Qian; Si, Weili; Huang, Wei; Dong, Xiaochen

    2015-09-30

    Glucose and calcium ion play key roles in human bodies. The needlelike NiCo2O4 nanostructures are in situ deposited on three-dimensional graphene foam (3DGF) by a facile hydrothermal procedure. The structure and morphology of the hierarchical NiCo2O4/3DGF are characterized by scanning electron microscopy, transmission electron microscopy, and X-ray diffraction. With the self-standing NiCo2O4/3DGF as electrochemical electrode, it can realize the high-sensitivity detections for glucose and calcium ion. The limit of detection can reach 0.38 and 4.45 μM, respectively. In addition, the electrochemical electrode presents excellent selectivity for glucose and calcium ion. This study demonstrates that NiCo2O4/3DGF is a unique and promising material for practical application in both glucose and calcium ion sensing.

  15. Single-Shot Quantum Nondemolition Detection of Individual Itinerant Microwave Photons

    NASA Astrophysics Data System (ADS)

    Besse, Jean-Claude; Gasparinetti, Simone; Collodo, Michele C.; Walter, Theo; Kurpiers, Philipp; Pechal, Marek; Eichler, Christopher; Wallraff, Andreas

    2018-04-01

    Single-photon detection is an essential component in many experiments in quantum optics, but it remains challenging in the microwave domain. We realize a quantum nondemolition detector for propagating microwave photons and characterize its performance using a single-photon source. To this aim, we implement a cavity-assisted conditional phase gate between the incoming photon and a superconducting artificial atom. By reading out the state of this atom in a single shot, we reach an external (internal) photon-detection fidelity of 50% (71%), limited by transmission efficiency between the source and the detector (75%) and the coherence properties of the qubit. By characterizing the coherence and average number of photons in the field reflected off the detector, we demonstrate its quantum nondemolition nature. We envisage applications in generating heralded remote entanglement between qubits and for realizing logic gates between propagating microwave photons.

  16. High Data Rate Quantum Cryptography

    NASA Astrophysics Data System (ADS)

    Kwiat, Paul; Christensen, Bradley; McCusker, Kevin; Kumor, Daniel; Gauthier, Daniel

    2015-05-01

    While quantum key distribution (QKD) systems are now commercially available, the data rate is a limiting factor for some desired applications (e.g., secure video transmission). Most QKD systems receive at most a single random bit per detection event, causing the data rate to be limited by the saturation of the single-photon detectors. Recent experiments have begun to explore using larger degree of freedoms, i.e., temporal or spatial qubits, to optimize the data rate. Here, we continue this exploration using entanglement in multiple degrees of freedom. That is, we use simultaneous temporal and polarization entanglement to reach up to 8.3 bits of randomness per coincident detection. Due to current technology, we are unable to fully secure the temporal degree of freedom against all possible future attacks; however, by assuming a technologically-limited eavesdropper, we are able to obtain 23.4 MB/s secure key rate across an optical table, after error reconciliation and privacy amplification. In this talk, we will describe our high-rate QKD experiment, with a short discussion on our work towards extending this system to ship-to-ship and ship-to-shore communication, aiming to secure the temporal degree of freedom and to implement a 30-km free-space link over a marine environment.

  17. Breast cancer in South Asia: a Bangladeshi perspective.

    PubMed

    Hossain, Mohammad Sorowar; Ferdous, Shameema; Karim-Kos, Henrike E

    2014-10-01

    South Asian countries are facing a hidden breast cancer epidemic. A significant proportion of the breast cancer cases occur in premenopausal women. Knowledge of the various aspects of breast cancer in different geographical regions is limited in South Asia. In this article, we review the Bangladeshi perspective of the epidemiology, risk factors, pathology, diagnosis and treatment of breast cancer. As in other developing countries, because of the lack of breast cancer awareness in Bangladeshi population and inadequate access to health care, most patients are diagnosed at an advanced stage of the disease. Early detection has a crucial impact on overall treatment outcomes. To battle against breast cancer in resource-limited countries like Bangladesh, it is not feasible to set up a parallel health service system solely dedicated to cancer. Therefore, a cost-effective public health strategy is needed which could reach a large number of women in the country. Considering all these issues, we propose an innovative female-based primary healthcare approach focused on awareness, screening and early detection of breast cancer in Bangladesh. This preventive strategy could be a model for other resource-limited developing countries. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Detectability of Light Dark Matter with Superfluid Helium.

    PubMed

    Schutz, Katelin; Zurek, Kathryn M

    2016-09-16

    We show that a two-excitation process in superfluid helium, combined with sensitivity to meV energy depositions, can probe dark matter down to the ∼keV warm dark matter mass limit. This mass reach is 3 orders of magnitude below what can be probed with ordinary nuclear recoils in helium at the same energy resolution. For dark matter lighter than ∼100  keV, the kinematics of the process requires the two athermal excitations to have nearly equal and opposite momentum, potentially providing a built-in coincidence mechanism for controlling backgrounds.

  19. Sensitivity of the Cherenkov Telescope Array to the detection of a dark matter signal in comparison to direct detection and collider experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balazs, Csaba; Conrad, Jan; Farmer, Ben

    Imaging atmospheric Cherenkov telescopes (IACTs) that are sensitive to potential γ-ray signals from dark matter (DM) annihilation above ~50 GeV will soon be superseded by the Cherenkov Telescope Array (CTA). CTA will have a point source sensitivity an order of magnitude better than currently operating IACTs and will cover a broad energy range between 20 GeV and 300 TeV. Using effective field theory and simplified models to calculate γ-ray spectra resulting from DM annihilation, we compare the prospects to constrain such models with CTA observations of the Galactic center with current and near-future measurements at the Large Hadron Collider (LHC)more » and direct detection experiments. Here, for DM annihilations via vector or pseudoscalar couplings, CTA observations will be able to probe DM models out of reach of the LHC, and, if DM is coupled to standard fermions by a pseudoscalar particle, beyond the limits of current direct detection experiments.« less

  20. An ordered array of hierarchical spheres for surface-enhanced Raman scattering detection of traces of pesticide

    NASA Astrophysics Data System (ADS)

    Hu, Xiaoye; Zheng, Peng; Meng, Guowen; Huang, Qing; Zhu, Chuhong; Han, Fangming; Huang, Zhulin; Li, Zhongbo; Wang, Zhaoming; Wu, Nianqiang

    2016-09-01

    An ordered array of hierarchically-structured core-nanosphere@space-layer@shell-nanoparticles has been fabricated for surface-enhanced Raman scattering (SERS) detection. To fabricate this hierarchically-structured chip, a long-range ordered array of Au/Ag-nanospheres is first patterned in the nano-bowls on the planar surface of ordered nanoporous anodic titanium oxide template. A ultra-thin alumina middle space-layer is then conformally coated on the Au/Ag-nanospheres, and Ag-nanoparticles are finally deposited on the surface of the alumina space-layer to form an ordered array of Au/Ag-nanosphere@Al2O3-layer@Ag-nanoparticles. Finite-difference time-domain simulation shows that SERS hot spots are created between the neighboring Ag-nanoparticles. The ordered array of hierarchical nanostructures is used as the SERS-substrate for a trial detection of methyl parathion (a pesticide) in water and a limit of detection of 1 nM is reached, indicating its promising potential in rapid monitoring of organic pollutants in aquatic environment.

  1. Biomimetic ELISA detection of malachite green based on molecularly imprinted polymer film.

    PubMed

    Li, Lu; Peng, Ai-Hong; Lin, Zheng-Zhong; Zhong, Hui-Ping; Chen, Xiao-Mei; Huang, Zhi-Yong

    2017-08-15

    A highly selective and sensitive enzyme-linked immunosorbent assay (ELISA) was developed for the detection of malachite green (MG) using a molecularly imprinted polymer (MIP) film as bionic antibody. The MIP film, based on the self-polymerization of dopamine, was fabricated on the surfaces of a 96-well microplate. It showed specific recognition for MG in aqueous solution. A direct competitive ELISA method was established with the sensitivity reaching 10.31μgL -1 and the detection limit being 0.3μgL -1 . The cross-reactivity of two structural analogues to MG was less than 10%. The average recovery tested by MG standard spiking was 88.8% for bass and 90.4% for water, and the relative standard deviations were less than 3.6%. All the above results indicated that the developed method could be used to detect MG in fish and water samples rapidly, specifically and accurately. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Sensitivity of the Cherenkov Telescope Array to the detection of a dark matter signal in comparison to direct detection and collider experiments

    DOE PAGES

    Balazs, Csaba; Conrad, Jan; Farmer, Ben; ...

    2017-10-04

    Imaging atmospheric Cherenkov telescopes (IACTs) that are sensitive to potential γ-ray signals from dark matter (DM) annihilation above ~50 GeV will soon be superseded by the Cherenkov Telescope Array (CTA). CTA will have a point source sensitivity an order of magnitude better than currently operating IACTs and will cover a broad energy range between 20 GeV and 300 TeV. Using effective field theory and simplified models to calculate γ-ray spectra resulting from DM annihilation, we compare the prospects to constrain such models with CTA observations of the Galactic center with current and near-future measurements at the Large Hadron Collider (LHC)more » and direct detection experiments. Here, for DM annihilations via vector or pseudoscalar couplings, CTA observations will be able to probe DM models out of reach of the LHC, and, if DM is coupled to standard fermions by a pseudoscalar particle, beyond the limits of current direct detection experiments.« less

  3. Selective and reversible ammonia gas detection with nanoporous film functionalized silicon photonic micro-ring resonator.

    PubMed

    Yebo, Nebiyu A; Sree, Sreeprasanth Pulinthanathu; Levrau, Elisabeth; Detavernier, Christophe; Hens, Zeger; Martens, Johan A; Baets, Roel

    2012-05-21

    Portable, low cost and real-time gas sensors have a considerable potential in various biomedical and industrial applications. For such applications, nano-photonic gas sensors based on standard silicon fabrication technology offer attractive opportunities. Deposition of high surface area nano-porous coatings on silicon photonic sensors is a means to achieve selective, highly sensitive and multiplexed gas detection on an optical chip. Here we demonstrate selective and reversible ammonia gas detection with functionalized silicon-on-insulator optical micro-ring resonators. The micro-ring resonators are coated with acidic nano-porous aluminosilicate films for specific ammonia sensing, which results in a reversible response to NH(3)with selectivity relative to CO(2). The ammonia detection limit is estimated at about 5 ppm. The detectors reach a steady response to NH(3) within 30 and return to their base level within 60 to 90 seconds. The work opens perspectives on development of nano-photonic sensors for real-time, non-invasive, low cost and light weight biomedical and industrial sensing applications.

  4. Speed limiter integrated fatigue analyzer (SLIFA) for speed and fatigue control on diesel engine truck and bus

    NASA Astrophysics Data System (ADS)

    Wahyudi, Haris; Pranoto, Hadi; Leman, A. M.; Sebayang, Darwin; Baba, I.

    2017-09-01

    Every second, the number of road traffic deaths is increased globally with millions more sustaining severe injuries and living with long-term adverse health consequences. Jakarta alone in year 2015 had recorded 556 people died due to road accidents, approximately reached 6.231 road accident cases. The identified major contributory factors of such unfortunate events are both driver fatigue and over speeding habit especially related to the driving of truck and bus. This paper presents the idea on how to control the electronic system from input fuel system of injection pump and the combustion chamber engine will control the valve solenoid in injection pump which can lock and fuel will stop for moment, and speed limit can be success, by using sensor heart rate we can input reduce speed limit when fatigue detection driver. Integration process this tool can be relevant when Speed Limiter Integrated Fatigue Analyser (SLIFA) trial in the diesel engine for truck and bus, the result of this research Speed Limiter Integrated Fatigue Analyser (SLIFA) able to control speed of diesel engine for truck and bus almost 30km/h, 60km/h, and until 70 km/h. The installation of the sensor heart rate as the input speed limit SLIFA would work when the driver is detected to be in the fatigue condition. We make Speed Limiter Integrated Fatigue Analyser (SLIFA) for control and monitoring system for diesel engine in truck and bus. Speed Limiter Integrated Fatigue Analyser (SLIFA) system can save the historical of the speed record, fatigue, rpm, and body temperature of the driver.

  5. Time from first detectable PSA following radical prostatectomy to biochemical recurrence: A competing risk analysis.

    PubMed

    de Boo, Leonora; Pintilie, Melania; Yip, Paul; Baniel, Jack; Fleshner, Neil; Margel, David

    2015-01-01

    In this study, we estimated the time from first detectable prostate-specific antigen (PSA) following radical prostatectomy (RP) to commonly used definitions of biochemical recurrence (BCR). We also identified the predictors of time to BCR. We identified subjects who underwent a RP and had an undetectable PSA after surgery followed by at least 1 detectable PSA between 2000 and 2011. The primary outcome was time to BCR (PSA ≥0.2 and successive PSA ≥0.2) and prediction of the rate of PSA rise. Outcomes were calculated using a competing risk analysis, with univariable and multivariable Fine and Grey models. We employed a mixed effect model to test clinical predictors that are associated with the rate of PSA rise. The cohort included 376 patients. The median follow-up from surgery was 60.5 months (interquartile range [IQR] 40.8-91.5) and from detectable PSA was 18 months (IQR 11-32). Only 45.74% (n = 172) had PSA values ≥0.2 ng/mL, while 15.16% (n = 57) reached the PSA level of ≥0.4 ng/mL and rising. On multivariable analysis, the values of the first detectable PSA and pathologic Gleason grade 8 or higher were consistently independent predictors of time to BCR. In the mixed effect model rate, the PSA rise was associated with time from surgery to first detectable PSA, Gleason score, and prostate volume. The main limitation of this study is the large proportion of patients that received treatment without reaching BCR. It is plausible that shorter estimated median times would occur at a centre that does not use salvage therapy at such an early state. The time from first detectable PSA to BCR may be lengthy. Our analyses of the predictors of the rate of PSA rise can help determine a personalized approach for patients with a detectable PSA after surgery.

  6. Time from first detectable PSA following radical prostatectomy to biochemical recurrence: A competing risk analysis

    PubMed Central

    de Boo, Leonora; Pintilie, Melania; Yip, Paul; Baniel, Jack; Fleshner, Neil; Margel, David

    2015-01-01

    Introduction: In this study, we estimated the time from first detectable prostate-specific antigen (PSA) following radical prostatectomy (RP) to commonly used definitions of biochemical recurrence (BCR). We also identified the predictors of time to BCR. Methods: We identified subjects who underwent a RP and had an undetectable PSA after surgery followed by at least 1 detectable PSA between 2000 and 2011. The primary outcome was time to BCR (PSA ≥0.2 and successive PSA ≥0.2) and prediction of the rate of PSA rise. Outcomes were calculated using a competing risk analysis, with univariable and multivariable Fine and Grey models. We employed a mixed effect model to test clinical predictors that are associated with the rate of PSA rise. Results: The cohort included 376 patients. The median follow-up from surgery was 60.5 months (interquartile range [IQR] 40.8–91.5) and from detectable PSA was 18 months (IQR 11–32). Only 45.74% (n = 172) had PSA values ≥0.2 ng/mL, while 15.16% (n = 57) reached the PSA level of ≥0.4 ng/mL and rising. On multivariable analysis, the values of the first detectable PSA and pathologic Gleason grade 8 or higher were consistently independent predictors of time to BCR. In the mixed effect model rate, the PSA rise was associated with time from surgery to first detectable PSA, Gleason score, and prostate volume. The main limitation of this study is the large proportion of patients that received treatment without reaching BCR. It is plausible that shorter estimated median times would occur at a centre that does not use salvage therapy at such an early state. Conclusion: The time from first detectable PSA to BCR may be lengthy. Our analyses of the predictors of the rate of PSA rise can help determine a personalized approach for patients with a detectable PSA after surgery. PMID:25624961

  7. Human exposure to metals: levels in autopsy tissues of individuals living near a hazardous waste incinerator.

    PubMed

    Mari, Montse; Nadal, Martí; Schuhmacher, Marta; Barbería, Eneko; García, Francisco; Domingo, José L

    2014-06-01

    The concentrations of a number of metals were determined in the brain, bone, kidney, liver, and lung of 20 autopsied subjects who had lived, at least 10 years, in the neighborhood of a hazardous waste incinerator (HWI) in Tarragona (Catalonia, Spain). Results were compared with those obtained in 1998 (baseline survey) and previous surveys (2003 and 2007). Arsenic, Be, Ni, Tl, and V showed concentrations below the corresponding detection limits in all tissues. Cadmium showed the highest levels in the kidney, with a mean value of 21.15 μg/g. However, Cd was found below the detection limit in the brain and bone. Chromium showed similar concentrations in the kidney, brain, and lung (range of mean values, 0.57-0.66 μg/g) and higher in the bone (1.38 μg/g). In turn, Hg was below the detection limit in all tissues with the exception of the kidney, where the mean concentration was 0.15 μg/g (range, <0.05-0.58 μg/g). On the other hand, Mn could be detected in all tissues showing the highest levels in the liver and kidney (1.45 and 1.09 μg/g, respectively). Moreover, Pb showed the highest concentrations in bone (mean, 1.39 μg/g; range, <0.025-4.88 μg/g). Finally, Sn could be detected only in some tissue samples, reaching the highest values in the bone (0.17 μg/g). The current metal levels in human tissues from individuals living near the HWI of Tarragona are comparable and of a similar magnitude to previously reported results corresponding to general populations, as well as those of our previous surveys.

  8. SEARCH FOR GAMMA RAY BURSTS WITH THE ARGO-YBJ DETECTOR IN SCALER MODE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aielli, G.; Camarri, P.; Bacci, C.

    2009-07-10

    We report on the search for gamma ray bursts (GRBs) in the energy range 1-100 GeV in coincidence with the prompt emission detected by satellites using the Astrophysical Radiation with Ground-based Observatory at YangBaJing (ARGO-YBJ) air shower detector. Thanks to its mountain location (Yangbajing, Tibet, People's Republic of China, 4300 m above sea level), active surface ({approx}6700 m{sup 2} of Resistive Plate Chambers), and large field of view ({approx}2 sr, limited only by the atmospheric absorption), the ARGO-YBJ air shower detector is particularly suitable for the detection of unpredictable and short duration events such as GRBs. The search is carriedmore » out using the 'single particle technique', i.e., counting all the particles hitting the detector without measurement of the energy and arrival direction of the primary gamma rays. Between 2004 December 17 and 2009 April 7, 81 GRBs detected by satellites occurred within the field of view of ARGO-YBJ (zenith angle {theta} {<=} 45 deg.). It was possible to examine 62 of these for >1 GeV counterpart in the ARGO-YBJ data finding no statistically significant emission. With a lack of detected spectra in this energy range fluence upper limits are profitable, especially when the redshift is known and the correction for the extragalactic absorption can be considered. The obtained fluence upper limits reach values as low as 10{sup -5} erg cm{sup -2} in the 1-100 GeV energy region. Besides this individual search for a higher energy counterpart, a statistical study of the stack of all the GRBs both in time and in phase was made, looking for a common feature in the GRB high-energy emission. No significant signal has been detected.« less

  9. Tracking Dissolved Methane Concentrations near Active Seeps and Gas Hydrates: Sea of Japan.

    NASA Astrophysics Data System (ADS)

    Snyder, G. T.; Aoki, S.; Matsumoto, R.; Tomaru, H.; Owari, S.; Nakajima, R.; Doolittle, D. F.; Brant, B.

    2015-12-01

    A number of regions in the Sea of Japan are known for active gas venting and for gas hydrate exposures on the sea floor. In this investigation we employed several gas sensors mounted on a ROV in order to determine the concentrations of dissolved methane in the water near these sites. Methane concentrations were determined during two-second intervals throughout each ROV deployment during the cruise. The methane sensor deployments were coupled with seawater sampling using Niskin bottles. Dissolved gas concentrations were later measured using gas chromatography in order to compare with the sensor results taken at the same time. The observed maximum dissolved methane concentrations were much lower than saturation values, even when the ROV manipulators were in contact with gas hydrate. Nonetheless, dissolved concentrations did reach several thousands of nmol/L near gas hydrate exposures and gas bubbles, more than two orders of magnitude over the instrumental detection limits. Most of the sensors tested were able to detect dissolved methane concentrations as low as 10 nmol/L which permitted detection when the ROV approached methane plume sites, even from several tens of meters above the sea floor. Despite the low detection limits, the methane sensors showed variable response times when returning to low-background seawater (~5nM). For some of the sensors, the response time necessary to return to background values occurred in a matter of minutes, while for others it took several hours. Response time, as well as detection limit, should be an important consideration when selecting methane sensors for ROV or AUV investigations. This research was made possible, in part, through funding provided by the Japanese Ministry of Economy, Trade and Industry (METI).

  10. You Spin my Head Right Round: Threshold of Limited Immersion for Rotation Gains in Redirected Walking.

    PubMed

    Schmitz, Patric; Hildebrandt, Julian; Valdez, Andre Calero; Kobbelt, Leif; Ziefle, Martina

    2018-04-01

    In virtual environments, the space that can be explored by real walking is limited by the size of the tracked area. To enable unimpeded walking through large virtual spaces in small real-world surroundings, redirection techniques are used. These unnoticeably manipulate the user's virtual walking trajectory. It is important to know how strongly such techniques can be applied without the user noticing the manipulation-or getting cybersick. Previously, this was estimated by measuring a detection threshold (DT) in highly-controlled psychophysical studies, which experimentally isolate the effect but do not aim for perceived immersion in the context of VR applications. While these studies suggest that only relatively low degrees of manipulation are tolerable, we claim that, besides establishing detection thresholds, it is important to know when the user's immersion breaks. We hypothesize that the degree of unnoticed manipulation is significantly different from the detection threshold when the user is immersed in a task. We conducted three studies: a) to devise an experimental paradigm to measure the threshold of limited immersion (TLI), b) to measure the TLI for slowly decreasing and increasing rotation gains, and c) to establish a baseline of cybersickness for our experimental setup. For rotation gains greater than 1.0, we found that immersion breaks quite late after the gain is detectable. However, for gains lesser than 1.0, some users reported a break of immersion even before established detection thresholds were reached. Apparently, the developed metric measures an additional quality of user experience. This article contributes to the development of effective spatial compression methods by utilizing the break of immersion as a benchmark for redirection techniques.

  11. Breast cancer detection in axillary sentinel lymph nodes: the impact of the method of pathologic examination.

    PubMed

    Calhoun, Benjamin C; Chambers, Karinn; Flippo-Morton, Teresa; Livasy, Chad A; Armstrong, Edward J; Symanowski, James T; Sarantou, Terry; Greene, Frederick L; White, Richard L

    2014-12-01

    At Carolinas Medical Center, before 2008, axillary sentinel lymph nodes (SLNs) from breast cancer patients were evaluated with a single hematoxylin and eosin-stained slide. In 2008, the protocol changed to include a limited step sectioning at 500 μm. In this study, we compared the intraoperative and permanent section pathologic findings for SLN biopsies from 2006 to 2007 to those from 2009 to 2010. We hypothesized that evaluating 2 slides would increase the detection of micrometastases and isolated tumor cells (ITCs) on permanent sections and correspondingly decrease the sensitivity of intraoperative touch preparation cytology (IOTPC). From 2006 to 2007, 140 (23.5%) of 597 of SLN permanent sections contained tumor cells: 92 macrometastases (65.7%), 36 micrometastases (25.7%), and 12 ITCs 0.2 mm or less (8.6%). The sensitivity of IOTPC for 2006 to 2007 was 51.4% for any tumor cells and 71.7% for macrometastases. From 2009 to 2010, 160 (21.9%) of 730 SLN permanent sections were positive for any tumor cells: 76 macrometastases (47.5%), 55 micrometastases (34.4%), and 29 ITCs (18.1%). The sensitivity of IOTPC for 2009 to 2010 was 39.4% for any tumor cells and 76.3% for macrometastases. With limited step sectioning, we observed an approximately 10% increase in the detection of both micrometastases and ITCs in SLN. The increased detection of ITCs on permanent sections reached statistical significance (P = .018). However, under current clinical guidelines, patients with limited SLN involvement may not be required to undergo completion axillary lymph node dissection. The ability to detect SLN tumor deposits less than 2 mm must be balanced with the clinical utility of doing so. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. The joint search for gravitational wave and low energy neutrino signals from core-collapse supernovae: methodology and status report

    NASA Astrophysics Data System (ADS)

    Gromov, M. B.; Casentini, C.

    2017-09-01

    The detection of gravitational waves opens a new era in physics. Now it's possible to observe the Universe using a fundamentally new way. Gravitational waves potentially permit getting insight into the physics of Core-Collapse Supernovae (CCSNe). However, due to significant uncertainties on the theoretical models of gravitational wave emission associated with CCSNe, benefits may come from multi-messenger observations of CCSNe. Such benefits include increased confidence in detection, extending the astrophysical reach of the detectors and allowing deeper understanding of the nature of the phenomenon. Fortunately, CCSNe have a neutrino signature confirmed by the observation of SN1987A. The gravitational and neutrino signals propagate with the speed of light and without significant interaction with interstellar matter. So that they must reach an observer on the Earth almost simultaneously. These facts open a way to search for the correlation between the signals. However, this method is limited by the sensitivity of modern neutrino detectors that allow to observe CCSNe only in the Local Group of galaxies. The methodology and status of a proposed joint search for the correlation signals are presented here.

  13. The joint search for gravitational wave and low energy neutrino signals from core-collapse supernovae: methodology and status report

    NASA Astrophysics Data System (ADS)

    Gromov, M. B.; Casentini, C.

    2017-09-01

    The detection of gravitational waves opens a new era in physics. Now it's possible to observe the Universe using a fundamentally new way. Gravitational waves potentially permit getting insight into the physics of Core-Collapse Supernovae (CCSNe). However, due to signi cant uncertainties on the theoretical models of gravitational wave emission associated with CCSNe, bene ts may come from multi-messenger observations of CCSNe. Such bene ts include increased con dence in detection, extending the astrophysical reach of the detectors and allowing deeper understanding of the nature of the phenomenon. Fortunately, CCSNe have a neutrino signature con rmed by the observation of SN1987A. The gravitational and neutrino signals propagate with the speed of light and without signi cant interaction with interstellar matter. So that they must reach an observer on the Earth almost simultaneously. These facts open a way to search for the correlation between the signals. However, this method is limited by the sensitivity of modern neutrino detectors that allow to observe CCSNe only in the Local Group of galaxies. The methodology and status of a proposed joint search for the correlation signals are presented here.

  14. Detection of conveyance changes in St. Clair River using historical water-level and flow data with inverse one-dimensional hydrodynamic modeling

    USGS Publications Warehouse

    Holtschlag, David J.; Hoard, C.J.

    2009-01-01

    St. Clair River is a connecting channel that transports water from Lake Huron to the St. Clair River Delta and Lake St. Clair. A negative trend has been detected in differences between water levels on Lake Huron and Lake St. Clair. This trend may indicate a combination of flow and conveyance changes within St. Clair River. To identify where conveyance change may be taking place, eight water-level gaging stations along St. Clair River were selected to delimit seven reaches. Positive trends in water-level fall were detected in two reaches, and negative trends were detected in two other reaches. The presence of both positive and negative trends in water-level fall indicates that changes in conveyance are likely occurring among some reaches because all reaches transmit essentially the same flow. Annual water-level fall in reaches and reach lengths was used to compute conveyance ratios for all pairs of reaches by use of water-level data from 1962 to 2007. Positive and negative trends in conveyance ratios indicate that relative conveyance is changing among some reaches. Inverse one-dimensional (1-D) hydrodynamic modeling was used to estimate a partial annual series of effective channel-roughness parameters in reaches forming the St. Clair River for 21 years when flow measurements were sufficient to support parameter estimation. Monotonic, persistent but non-monotonic, and irregular changes in estimated effective channel roughness with time were interpreted as systematic changes in conveyances in five reaches. Time-varying parameter estimates were used to simulate flow throughout the St. Clair River and compute changes in conveyance with time. Based on the partial annual series of parameters, conveyance in the St. Clair River increased about 10 percent from 1962 to 2002. Conveyance decreased, however, about 4.1 percent from 2003 to 2007, so that conveyance was about 5.9 percent higher in 2007 than in 1962.

  15. Beyond the CMSSM without an accelerator: Proton decay and direct dark matter detection

    DOE PAGES

    Ellis, John; Evans, Jason L.; Luo, Feng; ...

    2016-01-05

    Here, we consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale M inbelow the grand unification (GUT) scale M GUT, a scenario referred to as ‘sub-GUT’. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale.more » Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if M in is close to M GUT, but it may lie within its reach if M in≲10 11 GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.« less

  16. Simultaneous quantification of 21 water soluble vitamin circulating forms in human plasma by liquid chromatography-mass spectrometry.

    PubMed

    Meisser Redeuil, Karine; Longet, Karin; Bénet, Sylvie; Munari, Caroline; Campos-Giménez, Esther

    2015-11-27

    This manuscript reports a validated analytical approach for the quantification of 21 water soluble vitamins and their main circulating forms in human plasma. Isotope dilution-based sample preparation consisted of protein precipitation using acidic methanol enriched with stable isotope labelled internal standards. Separation was achieved by reversed-phase liquid chromatography and detection performed by tandem mass spectrometry in positive electrospray ionization mode. Instrumental lower limits of detection and quantification reached <0.1-10nM and 0.2-25nM, respectively. Commercially available pooled human plasma was used to build matrix-matched calibration curves ranging 2-500, 5-1250, 20-5000 or 150-37500nM depending on the analyte. The overall performance of the method was considered adequate, with 2.8-20.9% and 5.2-20.0% intra and inter-day precision, respectively and averaged accuracy reaching 91-108%. Recovery experiments were also performed and reached in average 82%. This analytical approach was then applied for the quantification of circulating water soluble vitamins in human plasma single donor samples. The present report provides a sensitive and reliable approach for the quantification of water soluble vitamins and main circulating forms in human plasma. In the future, the application of this analytical approach will give more confidence to provide a comprehensive assessment of water soluble vitamins nutritional status and bioavailability studies in humans. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection.

    PubMed

    Ellis, John; Evans, Jason L; Luo, Feng; Nagata, Natsumi; Olive, Keith A; Sandick, Pearl

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale [Formula: see text] below the grand unification (GUT) scale [Formula: see text], a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if [Formula: see text] is close to [Formula: see text], but it may lie within its reach if [Formula: see text] GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.

  18. The 4 Ms CHANDRA Deep Field-South Number Counts Apportioned by Source Class: Pervasive Active Galactic Nuclei and the Ascent of Normal Galaxies

    NASA Technical Reports Server (NTRS)

    Lehmer, Bret D.; Xue, Y. Q.; Brandt, W. N.; Alexander, D. M.; Bauer, F. E.; Brusa, M.; Comastri, A.; Gilli, R.; Hornschemeier, A. E.; Luo, B.; hide

    2012-01-01

    We present 0.5-2 keV, 2-8 keV, 4-8 keV, and 0.5-8 keV (hereafter soft, hard, ultra-hard, and full bands, respectively) cumulative and differential number-count (log N-log S ) measurements for the recently completed approx. equal to 4 Ms Chandra Deep Field-South (CDF-S) survey, the deepest X-ray survey to date. We implement a new Bayesian approach, which allows reliable calculation of number counts down to flux limits that are factors of approx. equal to 1.9-4.3 times fainter than the previously deepest number-count investigations. In the soft band (SB), the most sensitive bandpass in our analysis, the approx. equal to 4 Ms CDF-S reaches a maximum source density of approx. equal to 27,800 deg(sup -2). By virtue of the exquisite X-ray and multiwavelength data available in the CDF-S, we are able to measure the number counts from a variety of source populations (active galactic nuclei (AGNs), normal galaxies, and Galactic stars) and subpopulations (as a function of redshift, AGN absorption, luminosity, and galaxy morphology) and test models that describe their evolution. We find that AGNs still dominate the X-ray number counts down to the faintest flux levels for all bands and reach a limiting SB source density of approx. equal to 14,900 deg(sup -2), the highest reliable AGN source density measured at any wavelength. We find that the normal-galaxy counts rise rapidly near the flux limits and, at the limiting SB flux, reach source densities of approx. equal to 12,700 deg(sup -2) and make up 46% plus or minus 5% of the total number counts. The rapid rise of the galaxy counts toward faint fluxes, as well as significant normal-galaxy contributions to the overall number counts, indicates that normal galaxies will overtake AGNs just below the approx. equal to 4 Ms SB flux limit and will provide a numerically significant new X-ray source population in future surveys that reach below the approx. equal to 4 Ms sensitivity limit. We show that a future approx. equal to 10 Ms CDF-S would allow for a significant increase in X-ray-detected sources, with many of the new sources being cosmologically distant (z greater than or approx. equal to 0.6) normal galaxies.

  19. Using detergent to enhance detection sensitivity of African trypanosomes in human CSF and blood by loop-mediated isothermal amplification (LAMP).

    PubMed

    Grab, Dennis J; Nikolskaia, Olga V; Inoue, Noboru; Thekisoe, Oriel M M; Morrison, Liam J; Gibson, Wendy; Dumler, J Stephen

    2011-08-01

    The loop-mediated isothermal amplification (LAMP) assay, with its advantages of simplicity, rapidity and cost effectiveness, has evolved as one of the most sensitive and specific methods for the detection of a broad range of pathogenic microorganisms including African trypanosomes. While many LAMP-based assays are sufficiently sensitive to detect DNA well below the amount present in a single parasite, the detection limit of the assay is restricted by the number of parasites present in the volume of sample assayed; i.e. 1 per µL or 10(3) per mL. We hypothesized that clinical sensitivities that mimic analytical limits based on parasite DNA could be approached or even obtained by simply adding detergent to the samples prior to LAMP assay. For proof of principle we used two different LAMP assays capable of detecting 0.1 fg genomic DNA (0.001 parasite). The assay was tested on dilution series of intact bloodstream form Trypanosoma brucei rhodesiense in human cerebrospinal fluid (CSF) or blood with or without the addition of the detergent Triton X-100 and 60 min incubation at ambient temperature. With human CSF and in the absence of detergent, the LAMP detection limit for live intact parasites using 1 µL of CSF as the source of template was at best 10(3) parasites/mL. Remarkably, detergent enhanced LAMP assay reaches sensitivity about 100 to 1000-fold lower; i.e. 10 to 1 parasite/mL. Similar detergent-mediated increases in LAMP assay analytical sensitivity were also found using DNA extracted from filter paper cards containing blood pretreated with detergent before card spotting or blood samples spotted on detergent pretreated cards. This simple procedure for the enhanced detection of live African trypanosomes in biological fluids by LAMP paves the way for the adaptation of LAMP for the economical and sensitive diagnosis of other protozoan parasites and microorganisms that cause diseases that plague the developing world.

  20. To See or Not to See: Investigating Detectability of Ganges River Dolphins Using a Combined Visual-Acoustic Survey

    PubMed Central

    Richman, Nadia I.; Gibbons, James M.; Turvey, Samuel T.; Akamatsu, Tomonari; Ahmed, Benazir; Mahabub, Emile; Smith, Brian D.; Jones, Julia P. G.

    2014-01-01

    Detection of animals during visual surveys is rarely perfect or constant, and failure to account for imperfect detectability affects the accuracy of abundance estimates. Freshwater cetaceans are among the most threatened group of mammals, and visual surveys are a commonly employed method for estimating population size despite concerns over imperfect and unquantified detectability. We used a combined visual-acoustic survey to estimate detectability of Ganges River dolphins (Platanista gangetica gangetica) in four waterways of southern Bangladesh. The combined visual-acoustic survey resulted in consistently higher detectability than a single observer-team visual survey, thereby improving power to detect trends. Visual detectability was particularly low for dolphins close to meanders where these habitat features temporarily block the view of the preceding river surface. This systematic bias in detectability during visual-only surveys may lead researchers to underestimate the importance of heavily meandering river reaches. Although the benefits of acoustic surveys are increasingly recognised for marine cetaceans, they have not been widely used for monitoring abundance of freshwater cetaceans due to perceived costs and technical skill requirements. We show that acoustic surveys are in fact a relatively cost-effective approach for surveying freshwater cetaceans, once it is acknowledged that methods that do not account for imperfect detectability are of limited value for monitoring. PMID:24805782

  1. To see or not to see: investigating detectability of Ganges River dolphins using a combined visual-acoustic survey.

    PubMed

    Richman, Nadia I; Gibbons, James M; Turvey, Samuel T; Akamatsu, Tomonari; Ahmed, Benazir; Mahabub, Emile; Smith, Brian D; Jones, Julia P G

    2014-01-01

    Detection of animals during visual surveys is rarely perfect or constant, and failure to account for imperfect detectability affects the accuracy of abundance estimates. Freshwater cetaceans are among the most threatened group of mammals, and visual surveys are a commonly employed method for estimating population size despite concerns over imperfect and unquantified detectability. We used a combined visual-acoustic survey to estimate detectability of Ganges River dolphins (Platanista gangetica gangetica) in four waterways of southern Bangladesh. The combined visual-acoustic survey resulted in consistently higher detectability than a single observer-team visual survey, thereby improving power to detect trends. Visual detectability was particularly low for dolphins close to meanders where these habitat features temporarily block the view of the preceding river surface. This systematic bias in detectability during visual-only surveys may lead researchers to underestimate the importance of heavily meandering river reaches. Although the benefits of acoustic surveys are increasingly recognised for marine cetaceans, they have not been widely used for monitoring abundance of freshwater cetaceans due to perceived costs and technical skill requirements. We show that acoustic surveys are in fact a relatively cost-effective approach for surveying freshwater cetaceans, once it is acknowledged that methods that do not account for imperfect detectability are of limited value for monitoring.

  2. Improved limits and portability over currently employed cadmium monitoring systems through preconcentration for detection by way of micro-/nanofluidic mechanisms

    NASA Astrophysics Data System (ADS)

    Wach, Paul

    Due to risk of environmental and biological accumulation of Cadmium (Cd), improved methods of early detection and monitoring must be explored as a preventative measure. Listed as one of the top three toxic heavy metals by the Environmental Protection Agency (EPA), the effects on ecological and human systems have well documented side-effects of physical mutation, reproductive sterility, kidney failure, liver disease, bone loss, and death. Found in batteries, metal plating, pigments, plastics, and cigarettes, Cd is also used as a neutron absorber in the nuclear industry as well as having 3 known radioactive isotopes. Urine Cd levels, which have been widely used to predict whole body levels, increase when kidney damage occurs, thus increasing the importance to monitor and detect as early as possible. Although several methods of detection and monitoring are currently in use, they are insufficient for reasons including massive expense, weak specificity causing false readings, and/or a lack of portability. By exploiting naturally occurring mechanisms known to micro-/nanofluidics, a novel approach to Cd detection, measurement, and preconcentration was explored using the finite element computational software COMSOL. An open flow system of a nanochannel was explored through manipulation of the surface charge density. With a dominant negatively charged density on the walls, positive surface charge densities were adjacently placed at the center of the nanochannel causing a constriction of flow and allowing preconcentration of the analytes. When the open flow system was scaled up to a microchannel, the mechanism was found to have little effect on constriction of the flow. A preconcentration effect was discovered in a closed flow system when the adjacent patches were modeled as being impermeable to charge, causing the molecules to migrate to and remain at the central region of the microchannel once the dynamic process reached steady state. It was found to have the ability to concentrate Cd at an initial concentration of 0.5 mol/m3, which is nearly half the limit of commercially available technology. Additionally, this preconcentration mechanism was demonstrated to potentially advance its capabilities by attaching channels in series or parallel to further preconcentrate for improved detection. Finally, measurement of extremely low concentrations of Cd is possible due to differences seen in the concentration distribution profiles once steady-state is reached.

  3. Fluorescence and visual detection of fluoride ions using a photoluminescent graphene oxide paper sensor

    NASA Astrophysics Data System (ADS)

    Chen, Xiaochun; Yu, Shaoming; Yang, Liang; Wang, Jianping; Jiang, Changlong

    2016-07-01

    The instant and on-site detection of trace aqueous fluoride ions is still a challenge for environmental monitoring and protection. This work demonstrates a new analytical method and its utility of a paper sensor for visual detection of F- on the basis of the fluorescence resonance energy transfer (FRET) between photoluminescent graphene oxide (GO) and silver nanoparticles (AgNPs) through the formation of cyclic esters between phenylborinic acid and diol. The fluorescence of GO was quenched by the AgNPs, and trace F- can recover the fluorescence of the quenched photoluminescent GO. The increase in fluorescence intensity is proportional to the concentration of F- in the range of 0.05-0.55 nM, along with a limit of detection (LOD) as low as 9.07 pM. Following the sensing mechanism, a paper-based sensor for the visual detection of aqueous F- has been successfully developed. The paper sensor showed high sensitivity for aqueous F-, and the LOD could reach as low as 0.1 μM as observed by the naked eye. The very simple and effective strategy reported here could be extended to the visual detection of a wide range of analytes in the environment by the construction of highly efficient FRET nanoprobes.The instant and on-site detection of trace aqueous fluoride ions is still a challenge for environmental monitoring and protection. This work demonstrates a new analytical method and its utility of a paper sensor for visual detection of F- on the basis of the fluorescence resonance energy transfer (FRET) between photoluminescent graphene oxide (GO) and silver nanoparticles (AgNPs) through the formation of cyclic esters between phenylborinic acid and diol. The fluorescence of GO was quenched by the AgNPs, and trace F- can recover the fluorescence of the quenched photoluminescent GO. The increase in fluorescence intensity is proportional to the concentration of F- in the range of 0.05-0.55 nM, along with a limit of detection (LOD) as low as 9.07 pM. Following the sensing mechanism, a paper-based sensor for the visual detection of aqueous F- has been successfully developed. The paper sensor showed high sensitivity for aqueous F-, and the LOD could reach as low as 0.1 μM as observed by the naked eye. The very simple and effective strategy reported here could be extended to the visual detection of a wide range of analytes in the environment by the construction of highly efficient FRET nanoprobes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02878k

  4. Tracing Acetylene Dissolved in Transformer Oil by Tunable Diode Laser Absorption Spectrum.

    PubMed

    Ma, Guo-Ming; Zhao, Shu-Jing; Jiang, Jun; Song, Hong-Tu; Li, Cheng-Rong; Luo, Ying-Ting; Wu, Hao

    2017-11-02

    Dissolved gas analysis (DGA) is widely used in monitoring and diagnosing of power transformer, since the insulation material in the power transformer decomposes gases under abnormal operation condition. Among the gases, acetylene, as a symbol of low energy spark discharge and high energy electrical faults (arc discharge) of power transformer, is an important monitoring parameter. The current gas detection method used by the online DGA equipment suffers from problems such as cross sensitivity, electromagnetic compatibility and reliability. In this paper, an optical gas detection system based on TDLAS technology is proposed to detect acetylene dissolved in transformer oil. We selected a 1530.370 nm laser in the near infrared wavelength range to correspond to the absorption peak of acetylene, while using the wavelength modulation strategy and Herriott cell to improve the detection precision. Results show that the limit of detection reaches 0.49 ppm. The detection system responds quickly to changes of gas concentration and is easily to maintenance while has no electromagnetic interference, cross-sensitivity, or carrier gas. In addition, a complete detection process of the system takes only 8 minutes, implying a practical prospect of online monitoring technology.

  5. Coherent communication link using diode-pumped lasers

    NASA Technical Reports Server (NTRS)

    Kane, Thomas J.; Wallace, Richard W.

    1989-01-01

    Work toward developing a diffraction limited, single frequency, modulated transmitter suitable for coherent optical communication or direct detection communication is discussed. Diode pumped, monolithic Nd:YAG nonplanar ring oscillators were used as the carrier beam. An external modulation technique which can handle high optical powers, has moderate modulation voltage, and which can reach modulation rates of 1 GHz was invented. Semiconductor laser pumped solid-state lasers which have high output power (0.5 Watt) and which oscillate at a single frequency, in a diffraction limited beam, at the wavelength of 1.06 microns were built. A technique for phase modulating the laser output by 180 degrees with a 40-volt peak to peak driving voltage is demonstrated. This technique can be adapted for amplitude modulation of 100 percent with the same voltage. This technique makes use of a resonant bulk modulator, so it does not have the power handling limitations of guided wave modulators.

  6. On the Direct Detection of Dark Matter Annihilation

    DOE PAGES

    Cherry, John Francis Jr.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-06-12

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, but rather, the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a nonstandard and/or even absent annual modulation, and the ability to probe DM masses as low as a ~ 10 MeV. Here, we use current LUX data to show that experimental sensitivity to thermal relic annihilation cross sections hasmore » already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in E min space without making assumptions about DM astrophysics, mass, or scattering form factors. Lastly, when DM has direct couplings to nuclei, the limit from annihilation to relativistic particlesin the Sun can be stronger than that of conventional nonrelativistic direct detection by more than 3 orders of magnitude for masses in a 2–7 GeV window.« less

  7. Counting Particles Emitted by Stratospheric Aircraft and Measuring Size of Particles Emitted by Stratospheric Aircraft

    NASA Technical Reports Server (NTRS)

    Wilson, James Charles

    1994-01-01

    There were two principal objectives of the cooperative agreement between NASA and the University of Denver. The first goal was to modify the design of the ER-2 condensation nuclei counter (CNC) so that the effective lower detection limit would be improved at high altitudes. This improvement was sought because, in the instrument used prior to 1993, diffusion losses prevented the smallest detectable particles from reaching the detection volume of the instrument during operation at low pressure. Therefore, in spite of the sensor's ability to detect particles as small as 0.008 microns in diameter, many of these particles were lost in transport to the sensing region and were not counted. Most of the particles emitted by aircraft are smaller than 0.1 micron in diameter. At the start date of this work, May 1990, continuous sizing techniques available on the ER-2 were only capable of detecting particles larger than 0.17 micron. Thus, the second objective of this work was to evaluate candidate sizing techniques in an effort to gain additional information concerning the size of particles emitted by aircraft.

  8. Gold nanochestnut arrays as ultra-sensitive SERS substrate for detecting trace pesticide residue.

    PubMed

    Geng, Fei; Zhao, Huaping; Fu, Qun; Mi, Yan; Miao, Likun; Li, Wei; Dong, Yulian; Wu, Minghong; Lei, Yong

    2018-07-20

    In comparison to conventional spectroscopic techniques based on chromatography, surface-enhanced Raman spectroscopy (SERS) enables the rapid identification and detection of trace pesticide residues present in trace amounts in the environment and foods. Herein, a facile approach to fabricate unique gold nanochestnuts (GNCs) as an ultra-sensitive SERS substrate for detecting trace pesticide residues has been developed based on anodic aluminum oxide (AAO) templates. The GNCs are synthesized through the galvanic replacement of Ag on the top of Ni nanorod arrays. The as-prepared GNCs have well-controlled structural parameters, and importantly have unique anisotropic morphologies that benefit the enhancement in SERS performance. As a result, rhodamine 6 G (R6G) can be efficiently detected with GNCs as the SERS substrate even with a concentration of only 10 -12 M, and the Raman enhancement factor reaches up to 5.4 × 10 9 at this concentration. Further SERS measurement of thiram indicates a remarkable SERS-active sensitivity of the as-prepared GNCs with a detection limit of thiram up to 10 -14 M. The GNCs also exhibit a high signal-to-noise ratio.

  9. Optimization of spectroscopic surveys for testing non-Gaussianity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raccanelli, Alvise; Doré, Olivier; Dalal, Neal, E-mail: alvise@caltech.edu, E-mail: Olivier.P.Dore@jpl.nasa.gov, E-mail: dalaln@illinois.edu

    We investigate optimization strategies to measure primordial non-Gaussianity with future spectroscopic surveys. We forecast measurements coming from the 3D galaxy power spectrum and compute constraints on primordial non-Gaussianity parameters f{sub NL} and n{sub NG}. After studying the dependence on those parameters upon survey specifications such as redshift range, area, number density, we assume a reference mock survey and investigate the trade-off between number density and area surveyed. We then define the observational requirements to reach the detection of f{sub NL} of order 1. Our results show that power spectrum constraints on non-Gaussianity from future spectroscopic surveys can improve on currentmore » CMB limits, but the multi-tracer technique and higher order correlations will be needed in order to reach an even better precision in the measurements of the non-Gaussianity parameter f{sub NL}.« less

  10. Detection prospects of light NMSSM Higgs pseudoscalar via cascades of heavier scalars from vector boson fusion and Higgs-strahlung

    NASA Astrophysics Data System (ADS)

    Bomark, N.-E.; Moretti, S.; Roszkowski, L.

    2016-10-01

    A detection at the large hadron collider of a light Higgs pseudoscalar would, if interpreted in a supersymmetric framework, be a smoking gun signature of non-minimal supersymmetry. In this work in the framework of the next-to-minimal supersymmetric standard model we focus on vector boson fusion and Higgs-strahlung production of heavier scalars that subsequently decay into pairs of light pseudoscalars. We demonstrate that although these channels have in general very limited reach, they are viable for the detection of light pseudoscalars in some parts of parameter space and can serve as an important complementary probe to the dominant gluon-fusion production mode. We also demonstrate that in a Higgs factory these channels may reach sensitivities comparable to or even exceeding the gluon fusion channels at the Large Hadron Collider, thus possibly rendering this our best option to discover a light pseudoscalar. It is also worth mentioning that for the singlet dominated scalar this may be the only way to measure its couplings to gauge bosons. Especially promising are channels where the initial scalar is radiated off a W as these events have relatively high rates and provide substantial background suppression due to leptons from the W. We identify three benchmark points that well represent the above scenarios. Assuming that the masses of the scalars and pseudoscalars are already measured in the gluon-fusion channel, the event kinematics can be further constrained, hence significantly improving detection prospects. This is especially important in the Higgs-strahlung channels with rather heavy scalars, and results in possible detection at 200 fb-1 for the most favoured parts of the parameter space.

  11. Accessible Buildings for People with Walking and Reaching Limitations.

    ERIC Educational Resources Information Center

    Steinfeld, Edward; And Others

    Research was reviewed and conducted regarding the accessibility of buildings for physically disabled persons. Data was produced regarding anthropometrics (eye level and reach limits for ambulant, semiambulant, and wheelchair bound persons); wheelchair maneuvers; speed and distance (maximum travel distances for people with limitations of stamina);…

  12. IEEE Conference Record of 1982 Fifteenth Power Modulator Symposium, 14-16 June 1982.

    DTIC Science & Technology

    1982-01-01

    equation (10). starts conduction, and thus limiter operation, when the base voltage reaches the cutin value of 0. 6 volts RB + R RB (VBE) for a silicon...the pass transistor and thus reduces output current. Current limit (IMAX ) is reached when the base -emitter of Q1 reaches the cutin value of 0. 6

  13. Detection of Mycobacterium tuberculosis based on H37R(v) binding peptides using surface functionalized magnetic microspheres coupled with quantum dots – a nano detection method for Mycobacterium tuberculosis.

    PubMed

    Yang, Hua; Qin, Lianhua; Wang, Yilong; Zhang, Bingbo; Liu, Zhonghua; Ma, Hui; Lu, Junmei; Huang, Xiaochen; Shi, Donglu; Hu, Zhongyi

    2015-01-01

    Despite suffering from the major disadvantage of low sensitivity, microscopy of direct smear with the Ziehl-Neelsen stain is still broadly used for detection of acid-fast bacilli and diagnosis of tuberculosis. Here, we present a unique detection method of Mycobacterium tuberculosis (MTB) using surface functionalized magnetic microspheres (MMSs) coupled with quantum dots (QDs), conjugated with various antibodies and phage display-derived peptides. The principle is based upon the conformation of the sandwich complex composed of bacterial cells, MMSs, and QDs. The complex system is tagged with QDs for providing the fluorescent signal as part of the detection while magnetic separation is achieved by MMSs. The peptide ligand H8 derived from the phage display library Ph.D.-7 is developed for MTB cells. Using the combinations of MMS-polyclonal antibody+QD-H8 and MMS-H8+QD-H8, a strong signal of 10(3) colony forming units (CFU)/mL H37R(v) was obtained with improved specificity. MS-H8+QD-H8 combination was further optimized by adjusting the concentrations of MMSs, QDs, and incubation time for the maximum detection signal. The limit of detection for MTB was found to reach 10(3) CFU/mL even for the sputum matrices. Positive sputum samples could be distinguished from control. Thus, this novel method is shown to improve the detection limit and specificity of MTB from the sputum samples, and to reduce the testing time for accurate diagnosis of tuberculosis, which needs further confirmation of more clinical samples.

  14. Detection of Mycobacterium tuberculosis based on H37Rv binding peptides using surface functionalized magnetic microspheres coupled with quantum dots – a nano detection method for Mycobacterium tuberculosis

    PubMed Central

    Yang, Hua; Qin, Lianhua; Wang, Yilong; Zhang, Bingbo; Liu, Zhonghua; Ma, Hui; Lu, Junmei; Huang, Xiaochen; Shi, Donglu; Hu, Zhongyi

    2015-01-01

    Despite suffering from the major disadvantage of low sensitivity, microscopy of direct smear with the Ziehl–Neelsen stain is still broadly used for detection of acid-fast bacilli and diagnosis of tuberculosis. Here, we present a unique detection method of Mycobacterium tuberculosis (MTB) using surface functionalized magnetic microspheres (MMSs) coupled with quantum dots (QDs), conjugated with various antibodies and phage display-derived peptides. The principle is based upon the conformation of the sandwich complex composed of bacterial cells, MMSs, and QDs. The complex system is tagged with QDs for providing the fluorescent signal as part of the detection while magnetic separation is achieved by MMSs. The peptide ligand H8 derived from the phage display library Ph.D.-7 is developed for MTB cells. Using the combinations of MMS-polyclonal antibody+QD-H8 and MMS-H8+QD-H8, a strong signal of 103 colony forming units (CFU)/mL H37Rv was obtained with improved specificity. MS-H8+QD-H8 combination was further optimized by adjusting the concentrations of MMSs, QDs, and incubation time for the maximum detection signal. The limit of detection for MTB was found to reach 103 CFU/mL even for the sputum matrices. Positive sputum samples could be distinguished from control. Thus, this novel method is shown to improve the detection limit and specificity of MTB from the sputum samples, and to reduce the testing time for accurate diagnosis of tuberculosis, which needs further confirmation of more clinical samples. PMID:25565805

  15. Sensitive far uv spectrograph with a multispectral element microchannel plate detector for rocket-borne astronomy.

    PubMed

    Weiser, H; Vitz, R C; Moos, H W; Weinstein, A

    1976-12-01

    An evacuated high transmission prism spectrograph using a microchannel plate detection system with resistive strip readout was flown behind a precision pointing telescope on a sounding rocket. The construction, preparation, flight performance, and calibration stability of the system are discussed. Despite the adverse environmental conditions associated with sounding rocket flights, the microchannel detector system performed well. Far uv spectra (1160-1750 A) of stellar and planetary objects were obtained; spectral features with fluxes as low as 0.06 photons cm(-2) sec(-1) were detectable. This was achieved by operating the plates at lower than normal gains, using sensitive pulse counting electronics with both upper and lower limit discriminators, and maintaining the spectrograph and detector at a pressure of ~10(-6) Torr until reaching altitude.

  16. SERS Taper-Fiber Nanoprobe Modified by Gold Nanoparticles Wrapped with Ultrathin Alumina Film by Atomic Layer Deposition

    PubMed Central

    Xu, Wenjie; Chen, Zhenyi; Chen, Na; Zhang, Heng; Liu, Shupeng; Hu, Xinmao; Wen, Jianxiang; Wang, Tingyun

    2017-01-01

    A taper-fiber SERS nanoprobe modified by gold nanoparticles (Au-NPs) with ultrathin alumina layers was fabricated and its ability to perform remote Raman detection was demonstrated. The taper-fiber nanoprobe (TFNP) with a nanoscale tip size under 80 nm was made by heated pulling combined with the chemical etching method. The Au-NPs were deposited on the TFNP surface with the electrostatic self-assembly technology, and then the TFNP was wrapped with ultrathin alumina layers by the atomic layer deposition (ALD) technique. The results told us that with the increasing thickness of the alumina film, the Raman signals decreased. With approximately 1 nm alumina film, the remote detection limit for R6G aqueous solution reached 10−6 mol/L. PMID:28245618

  17. Evaluating adequacy of the representative stream reach used in invertebrate monitoring programs

    USGS Publications Warehouse

    Rabeni, C.F.; Wang, N.; Sarver, R.J.

    1999-01-01

    Selection of a representative stream reach is implicitly or explicitly recommended in many biomonitoring protocols using benthic invertebrates. We evaluated the adequacy of sampling a single stream reach selected on the basis of its appearance. We 1st demonstrated the precision of our within-reach sampling. Then we sampled 3 or 4 reaches (each ~20x mean width) within an 8-16 km segment on each of 8 streams in 3 ecoregions and calculated 4 common metrics: 1) total taxa; 2) Ephemeroptera, Plecoptera, and Trichoptera taxa; 3) biotic index; and 4) Sharmon's diversity index. In only 6% of possible cases was the coefficient of variation for any of the metrics reduced >10% by sampling additional reaches. Sampling a 2nd reach on a stream improved the ability to detect impairment by an average of only 9.3%. Sampling a 3rd reach on a stream additionally improved ability to detect impairment by only 4.5%. We concluded that a single well-chosen reach, if adequately sampled, can be representative of an entire stream segment, and sampling additional reaches within a segment may not be cost effective.

  18. Selective electrochemical detection of 2,4,6-trinitrotoluene (TNT) in water based on poly(styrene-co-acrylic acid) PSA/SiO2/Fe3O4/AuNPs/lignin-modified glassy carbon electrode.

    PubMed

    Mahmoud, Khaled A; Abdel-Wahab, Ahmed; Zourob, Mohammed

    2015-01-01

    A new versatile electrochemical sensor based on poly(styrene-co-acrylic acid) PSA/SiO2/Fe3O4/AuNPs/lignin (L-MMS) modified glassy carbon electrode (GCE) was developed for the selective detection of trace trinitrotoluene (TNT) from aqueous media with high sensitivity. The fabricated magnetic microspheres were characterized by transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDS), and X-ray photoelectron spectroscopy (XPS). L-MMS films were cast on the GCE surface to fabricate the TNT sensing electrode. The limit of detection (LOD) of TNT determined by the amperometric i-t curve reached 35 pM. The lignin film and well packed Fe3O4/AuNPs facilitated the pre-concentration of trace TNT on the electrode surface resulting in a fast amperometric response of 3 seconds near the detection limit. The high sensitivity and excellent catalytic activity of the modified electrode could be attributed to the lignin layer and highly packed Fe3O4/AuNPs on the electrode surface. The total recovery of TNT from tapwater and seawater matrices was 98% and 96%, respectively. The electrode film was highly stable after five repeated adsorption/desorption cycles. The new electrochemical sensing scheme provides a highly selective, sensitive and versatile assay for the in-situ detection of TNT in complex water media.

  19. Cube-like Fe3O4@SiO2@Au@Ag magnetic nanoparticles: a highly efficient SERS substrate for pesticide detection

    NASA Astrophysics Data System (ADS)

    Sun, Mei; Zhao, Aiwu; Wang, Dapeng; Wang, Jin; Chen, Ping; Sun, Henghui

    2018-04-01

    As a novel surface-enhanced Raman spectroscopic (SERS) nanocomposite, cube-like Fe3O4@SiO2@Au@Ag magnetic nanoparticles (NPs) were synthesized for the first time. Cube-like α-Fe2O3 NPs with uniform size were achieved by optimizing reaction temperature and time. Firstly, the cube-like Fe3O4@SiO2 with good dispersity was achieved by calcining α-Fe2O3@SiO2 NPs in hydrogen atmosphere at 360 °C for 2.5 h, followed by self-assembling a PEI shell via sonication. Furthermore, the Au@Ag particles were densely assembled on the Fe3O4@SiO2 NPs to form the Fe3O4@SiO2@Au@Ag composite structure via strong Ag-N interaction. The obtained nanocomposites exhibited an excellent SERS behavior, reflected by the low detection of limit (p-ATP) at the 5 × 10-14 M level. Moreover, these nanocubes were used for the detection of thiram, and the detection limit can reach 5 × 10-11 M. Meanwhile, the U.S. Environmental Protection Agency specifies that the residue in fruit must be lower than 7 ppm. Hence, the resulting substrate with high SERS activity has great practical potential applications in the rapid detection of chemical, biological, and environment pollutants with a simple portable Raman instrument at trace level.

  20. Development and validation of a multiplex quantitative polymerase chain reaction assay for the detection of Mollicutes impurities in human cells, cultured under good manufacturing practice conditions, and following European Pharmacopoeia requirements and the International Conference on Harmonization guidelines.

    PubMed

    Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto

    2012-07-01

    The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.

  1. Cube-like Fe3O4@SiO2@Au@Ag magnetic nanoparticles: a highly efficient SERS substrate for detection of pesticide.

    PubMed

    Sun, Mei; Zhao, Aiwu; Wang, Dapeng; Wang, Jin; Chen, Ping; Sun, Henghui

    2018-02-09

    As a novel SERS nanocomposities, cube-like Fe3O4@SiO2@Au@Ag magnetic nanoparticles have been synthesized for the first time. Cube-like α-Fe2O3 NPs with uniform size can be achieved by optimizing reaction temperature and time. Firstly, the cube-like Fe3O4@SiO2 with good dispersity were achieved by calcining α-Fe2O3@SiO2 NPs in hydrogen atmosphere at 360 °C for 2.5 h, followed by self-assembling PEI shell via sonication. Furthermore, the Au@Ag particles can be densely assembled on the Fe3O4@SiO2 NPs to form the Fe3O4@SiO2@Au@Ag composite structure via strong Ag-N interaction. The obtained nanocomposites exhibit an excellent surface-enhanced Raman (SERS) behavior, reflected from low detection of limit (p-ATP) at 5×10-14 M level. Moreover, these nanocubes are used for detection of thiram and the detection limit can reach up to 5×10-11 M, while the rule of U.S. Environmental Protection Agency specifies that the residue in fruit must be lower than 7 ppm. Hence, the resulting substrate with high SERS activity has great practical potential applications in rapid detection of chemical, biological and environment pollutants with a simple portable Raman instrument at trace level. © 2018 IOP Publishing Ltd.

  2. Submillimeter wave spectroscopy of ethyl isocyanide and its searches in Orion

    NASA Astrophysics Data System (ADS)

    Margulès, L.; Tercero, B.; Guillemin, J. C.; Motiyenko, R. A.; Cernicharo, J.

    2018-02-01

    Context. About 40 cyanide compounds have been detected in the interstellar medium, but only 3 examples of organic isocyanide compounds were observed in this medium. Ethyl isocyanide is one of the best candidates for possible detection. Aim. To date, measurements of rotational spectra are limited to 40 GHz. The extrapolation of the prediction in the millimeter wave domain is inaccurate and does not permit an unambiguous detection. Methods: The rotational spectra were reinvestigated from 0.15 to 1 THz. Using the new prediction, we searched for the compound ethyl isocyanide in Orion KL and Sgr B2. Results: We newly assigned 2906 transitions and fitted these new data with those from previous studies, reaching quantum numbers up to J = 103 and Ka = 30. The asymmetric top Hamiltonian proposed by Watson in the Ir representation was used for the analysis, and both reductions A and S were tested. The search for CH3CH2NC in Sgr B2 (IRAM 30m) and Orion KL (IRAM 30m, ALMA Science Verification) result in a non-detection; upper limits to the column density were derived. Tables S1-S4 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/610/A44

  3. Comparison of Clean-Up Methods for Ochratoxin A on Wine, Beer, Roasted Coffee and Chili Commercialized in Italy

    PubMed Central

    Prelle, Ambra; Spadaro, Davide; Denca, Aleksandra; Garibaldi, Angelo; Gullino, Maria Lodovica

    2013-01-01

    The most common technique used to detect ochratoxin A (OTA) in food matrices is based on extraction, clean-up, and chromatography detection. Different clean-up cartridges, such as immunoaffinity columns (IAC), molecular imprinting polymers (MIP), Mycosep™ 229, Mycospin™, and Oasis® HLB (Hydrophilic Lipophilic balance) as solid phase extraction were tested to optimize the purification for red wine, beer, roasted coffee and chili. Recovery, reproducibility, reproducibility, limit of detection (LOD) and limit of quantification (LOQ) were calculated for each clean-up method. IAC demonstrated to be suitable for OTA analysis in wine and beer with recovery rate >90%, as well as Mycosep™ for wine and chili. On the contrary, MIP columns were the most appropriate to clean up coffee. A total of 120 samples (30 wines, 30 beers, 30 roasted coffee, 30 chili) marketed in Italy were analyzed, by applying the developed clean-up methods. Twenty-seven out of 120 samples analyzed (22.7%: two wines, five beers, eight coffees, and 12 chili) resulted positive to OTA. A higher incidence of OTA was found in chili (40.0%) more than wine (6.6%), beers (16.6%) and coffee (26.6%). Moreover, OTA concentration in chili was the highest detected, reaching 47.8 µg/kg. Furthermore, three samples (2.5%), two wines and one chili, exceeded the European threshold. PMID:24152987

  4. Core-based intrinsic fiber-optic absorption sensor for the detection of volatile organic compounds

    NASA Astrophysics Data System (ADS)

    Klunder, Gregory L.; Russo, Richard E.

    1995-03-01

    A core-based intrinsic fiber-optic absorption sensor has been developed and tested for the detection of volatile organic compounds. The distal ends of transmitting and receiving fibers are connected by a small cylindrical section of an optically clear silicone rubber. The silicone rubber acts both as a light pipe and as a selective membrane into which the analyte molecules can diffuse. The sensor has been used to detect volatile organics (trichloroethylene, 1,1-dichloroethylene, and benzene) in both aqueous solutions and in the vapor phase or headspace. Absorption spectra obtained in the near-infrared (near-IR) provide qualitative and quantitative information about the analyte. Water, which has strong broad-band absorption in the near-IR, is excluded from the spectra because of the hydrophobic properties of the silicone rubber. The rate-limiting step is shown to be the diffusion through the Nernstian boundary layer surrounding the sensor and not the diffusion through the silicone polymer. The rate of analyte diffusion into the sensor, as measured by the t(sub 90) values (the time required for the sensor to reach 90% of the equilibrium value), is 30 min for measurements in aqueous solutions and approximately 3 min for measurements made in the headspace. The limit of detection obtained with this sensor is approximately 1.1 ppm for trichloroethylene in an aqueous solution.

  5. Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.

    PubMed

    Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte

    2018-02-01

    Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.

  6. Pharmacokinetics, safety and tolerability of a novel tocopheryl phosphate mixture/oxycodone transdermal patch system: a Phase I study.

    PubMed

    Gavin, Paul D; Simon, Lee S; Schlagheck, Thomas; Smith, Alisha J; Shakib, Sepehr

    2017-07-01

    To characterize the pharmacokinetic profile and evaluate the safety and tolerability of a transdermal oxycodone patch containing tocopheryl phosphate mixture (TPM). Eleven healthy subjects received a single application of three TPM/oxycodone patches applied to the torso for 72 h. Oxycodone was detected 8.0 ± 2.7-h postpatch administration, reaching a mean maximum plasma concentration of 3.41 ± 1.34 ng/ml at 49.3 ± 21.2 h. The safety profile was consistent with the application method and known side-effect profile of oxycodone and naltrexone. No treatment-limiting skin irritation was observed. A 3-day application of the TPM/oxycodone patch demonstrated an acceptable safety profile and was well tolerated by healthy subjects, with limited dermal irritation following application.

  7. Development of mirror coatings for gravitational-wave detectors

    NASA Astrophysics Data System (ADS)

    Steinlechner, J.

    2018-05-01

    Gravitational waves are detected by measuring length changes between mirrors in the arms of kilometre-long Michelson interferometers. Brownian thermal noise arising from thermal vibrations of the mirrors can limit the sensitivity to distance changes between the mirrors, and, therefore, the ability to measure gravitational-wave signals. Thermal noise arising from the highly reflective mirror coatings will limit the sensitivity both of current detectors (when they reach design performance) and of planned future detectors. Therefore, the development of coatings with low thermal noise, which at the same time meet strict optical requirements, is of great importance. This article gives an overview of the current status of coatings and of the different approaches for coating improvement. This article is part of a discussion meeting issue `The promises of gravitational-wave astronomy'.

  8. Development of mirror coatings for gravitational-wave detectors.

    PubMed

    Steinlechner, J

    2018-05-28

    Gravitational waves are detected by measuring length changes between mirrors in the arms of kilometre-long Michelson interferometers. Brownian thermal noise arising from thermal vibrations of the mirrors can limit the sensitivity to distance changes between the mirrors, and, therefore, the ability to measure gravitational-wave signals. Thermal noise arising from the highly reflective mirror coatings will limit the sensitivity both of current detectors (when they reach design performance) and of planned future detectors. Therefore, the development of coatings with low thermal noise, which at the same time meet strict optical requirements, is of great importance. This article gives an overview of the current status of coatings and of the different approaches for coating improvement.This article is part of a discussion meeting issue 'The promises of gravitational-wave astronomy'. © 2018 The Author(s).

  9. An automatic detection software for differential reflection spectroscopy

    NASA Astrophysics Data System (ADS)

    Yuksel, Seniha Esen; Dubroca, Thierry; Hummel, Rolf E.; Gader, Paul D.

    2012-06-01

    Recent terrorist attacks have sprung a need for a large scale explosive detector. Our group has developed differential reflection spectroscopy which can detect explosive residue on surfaces such as parcel, cargo and luggage. In short, broad band ultra-violet and visible light is shone onto a material (such as a parcel) moving on a conveyor belt. Upon reflection off the surface, the light intensity is recorded with a spectrograph (spectrometer in combination with a CCD camera). This reflected light intensity is then subtracted and normalized with the next data point collected, resulting in differential reflection spectra in the 200-500 nm range. Explosives show spectral finger-prints at specific wavelengths, for example, the spectrum of 2,4,6, trinitrotoluene (TNT) shows an absorption edge at 420 nm. Additionally, we have developed an automated software which detects the characteristic features of explosives. One of the biggest challenges for the algorithm is to reach a practical limit of detection. In this study, we introduce our automatic detection software which is a combination of principal component analysis and support vector machines. Finally we present the sensitivity and selectivity response of our algorithm as a function of the amount of explosive detected on a given surface.

  10. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Improved native UV laser induced fluorescence detection for single cell analysis in poly(dimethylsiloxane) microfluidic devices.

    PubMed

    Hellmich, Wibke; Greif, Dominik; Pelargus, Christoph; Anselmetti, Dario; Ros, Alexandra

    2006-10-20

    Single cell analytics is a key method in the framework of proteom research allowing analyses, which are not subjected to ensemble-averaging, cell-cycle or heterogeneous cell-population effects. Our previous studies on single cell analysis in poly(dimethylsiloxane) microfluidic devices with native label-free laser induced fluorescence detection [W. Hellmich, C. Pelargus, K. Leffhalm, A. Ros, D. Anselmetti, Electrophoresis 26 (2005) 3689] were extended in order to improve separation efficiency and detection sensitivity. Here, we particularly focus on the influence of poly(oxyethylene) based coatings on the separation performance. In addition, the influence on background fluorescence is studied by the variation of the incident laser power as well as the adaptation of the confocal volume to the microfluidic channel dimensions. Last but not least, the use of carbon black particles further enhanced the detection limit to 25 nM, thereby reaching the relevant concentration ranges necessary for the label-free detection of low abundant proteins in single cells. On the basis of these results, we demonstrate the first electropherogram from an individual Spodoptera frugiperda (Sf9) cell with native label-free UV-LIF detection in a microfluidic chip.

  12. SU-E-J-193: Application of Surface Mapping in Detecting Swallowing for Head-&-Neck Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, D; Xie, X; Mehta, V

    2015-06-15

    Purpose: Recent evidence is emerging that long term swallowing function may be improved after radiotherapy for head-&-neck cancer if doses are limited to certain swallowing structures. Immobilization of patients with head-&-neck cancer is typically done with a mask. This mask, however, doesn’t limit patient swallowing. Patient voluntary or involuntary swallowing may introduce significant tumor motion, which can lead to suboptimal delivery. In this study, we have examined the feasibility of using surface mapping technology to detect patient swallowing during treatment and evaluated its magnitude. Methods: The C-RAD Catalyst system was used to detect the patient surface map. A volunteer lyingmore » on the couch was used to simulate the patient under treatment. A virtual marker was placed near the throat and was used to monitor the swallowing action. The target motion calculated by the Catalyst system through deformable registration was also collected. Two treatment isocenters, one placed close to the throat and the other placed posterior to the base-of-tongue, were used to check the sensitivity of surface mapping technique. Results: When the patient’s throat is not in the shadow of the patient’s chest, the Catalyst system can clearly identify the swallowing motion. In our tests, the vertical motion of the skin can reach to about 5mm. The calculated target motion can reach up to 1 cm. The magnitude of this calculated target motion is more dramatic when the plan isocenter is closer to the skin surface, which suggests that the Catalyst motion tracking technique is more sensitive to the swallowing motion with a shallower isocenter. Conclusion: Surface mapping can clearly identify patient swallowing during radiation treatment. This information can be used to evaluate the dosimetric impact of the involuntary swallowing. It may also be used to potentially gate head-&-neck radiation treatments. A prospective IRB approved study is currently enrolling patients in our institution. Research was funded through an Elekta grant.« less

  13. Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy.

    PubMed

    Wang, Kun; Fan, Daoqing; Liu, Yaqing; Wang, Erkang

    2015-11-15

    Simple, rapid, sensitive and specific detection of cancer cells is of great importance for early and accurate cancer diagnostics and therapy. By coupling nanotechnology and dual-aptamer target binding strategies, we developed a colorimetric assay for visually detecting cancer cells with high sensitivity and specificity. The nanotechnology including high catalytic activity of PtAuNP and magnetic separation & concentration plays a vital role on the signal amplification and improvement of detection sensitivity. The color change caused by small amount of target cancer cells (10 cells/mL) can be clearly distinguished by naked eyes. The dual-aptamer target binding strategy guarantees the detection specificity that large amount of non-cancer cells and different cancer cells (10(4) cells/mL) cannot cause obvious color change. A detection limit as low as 10 cells/mL with detection linear range from 10 to 10(5) cells/mL was reached according to the experimental detections in phosphate buffer solution as well as serum sample. The developed enzyme-free and cost effective colorimetric assay is simple and no need of instrument while still provides excellent sensitivity, specificity and repeatability, having potential application on point-of-care cancer diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Millimeter-Wave Spectroscopy for Analytical Chemistry: Thermal Evolution of Low Volatility Impurities and Detection with a Fourier Transform Molecular Rotational Resonance Spectrometer (tev Ft-Mrr

    NASA Astrophysics Data System (ADS)

    Harris, Brent; Fields, Shelby S.; Neill, Justin L.; Pulliam, Robin; Muckle, Matt; Pate, Brooks

    2016-06-01

    Recent advances in Fourier transform millimeter-wave spectroscopy techniques have renewed the application reach of molecular rotational spectroscopy for analytical chemistry. We present a sampling method for sub ppm analysis of low volatility impurities by thermal evolution from solid powders using a millimeter-wave Fourier transform molecular rotational resonance (FT-MRR) spectrometer for detection. This application of FT-MRR is relevant to the manufacturing of safe oral pharmaceuticals. Low volatility impurities can be challenging to detect at 1 ppm levels with chromatographic techniques. One such example of a potentially mutagenic impurity is acetamide (v.p. 1 Torr at 40 C, m.p. 80 C). We measured the pure reference spectrum of acetamide by flowing the sublimated vapor pressure of acetamide crystals through the FT-MRR spectrometer. The spectrometer lower detection level (LDL) for a broadband (> 20 GHz, 10 min.) spectrum is 300 nTorr, 30 pmol, or 2 ng. For a 50 mg powder, perfect sample transfer efficiency can yield a w/w % detection limit of 35 ppb. We extended the sampling method for the acetamide reference measurement to an acetaminophen sample spiked with 5000 ppm acetamide in order to test the sample transfer efficiency when liberated from an pharmaceutical powder. A spectral reference matching algorithm detected the presence of several impurities including acetaldehyde, acetic acid, and acetonitrile that evolved at the melting point of acetaminophen, demonstrating the capability of FT-MRR for identification without a routine chemical standard. The method detection limit (MDL) without further development is less than 10 ppm w/w %. Resolved FT-MRR mixture spectra will be presented with a description of sampling methods.

  15. Use of Malachite Green-Loop Mediated Isothermal Amplification for Detection of Plasmodium spp. Parasites

    PubMed Central

    Lucchi, Naomi W.; Ljolje, Dragan; Silva-Flannery, Luciana; Udhayakumar, Venkatachalam

    2016-01-01

    Malaria elimination efforts are hampered by the lack of sensitive tools to detect infections with low-level parasitemia, usually below the threshold of standard diagnostic methods, microscopy and rapid diagnostic tests. Isothermal nucleic acid amplification assays such as the loop-mediated isothermal amplification (LAMP), are well suited for field use as they do not require thermal cyclers to run the test. However, the use of specialized equipment, as described by many groups, reduces the versatility of the LAMP technique as a simple tool for use in endemic countries. In this study, the use of the malachite green (MG) dye, as a visual endpoint readout, together with a simple mini heat block was evaluated for the detection of malaria parasites. The assay was performed for 1 hour at 63°C and the results scored by 3 independent human readers. The limit of detection of the assay was determined using well-quantified Plasmodium spp. infected reference samples and its utility in testing clinical samples was determined using 190 pre-treatment specimens submitted for reference diagnosis of imported malaria in the United States. Use of a simplified boil and spin methods of DNA extraction from whole blood and filter paper was also investigated. We demonstrate the accurate and sensitive detection of malaria parasites using this assay with a detection limit ranging between 1–8 parasites/μL, supporting its applicability for the detection of infections with low parasite burden. This assay is compatible with the use of a simple boil and spin sample preparation method from both whole blood and filter papers without a loss of sensitivity. The MG-LAMP assay described here has great potential to extend the reach of molecular tools to settings where they are needed. PMID:26967908

  16. Quasars with P v broad absorption in BOSS data release 9

    NASA Astrophysics Data System (ADS)

    Capellupo, D. M.; Hamann, F.; Herbst, H.; Brandt, W. N.; Ge, J.; Pâris, I.; Petitjean, P.; Schneider, D. P.; Streblyanska, A.; York, D.

    2017-07-01

    Broad absorption lines (BALs) found in a significant fraction of quasar spectra identify high-velocity outflows that might be present in all quasars and could be a major factor in feedback to galaxy evolution. Understanding the nature of these flows requires further constraints on their physical properties, including their column densities, for which well-studied BALs, such as C IV λλ1548,1551, typically provide only a lower limit because of saturation effects. Low-abundance lines, such as P v λλ1118,1128, indicate large column densities, implying that outflows more powerful than measurements of C IV alone would indicate. We search through a sample of 2694 BAL quasars from the Sloan Digital Sky Survey III/Baryon Oscillation Spectroscopic Survey data release 9 quasar catalogue for such absorption, and we identify 81 'definite' and 86 'probable' detections of P v broad absorption, yielding a firm lower limit of 3.0-6.2 per cent for the incidence of such absorption among BAL quasars. The P v-detected quasars tend to have stronger C IV and Si IV absorption, as well as a higher incidence of LoBAL absorption, than the overall BAL quasar population. Many of the P v-detected quasars have C IV troughs that do not reach zero intensity (at velocities where P v is detected), confirming that the outflow gas only partially covers the UV continuum source. P v appears significantly in a composite spectrum of non-P v-detected BAL quasars, indicating that P v absorption (and large column densities) is much more common than indicated by our search results. Our sample of P v detections significantly increases the number of known P v detections, providing opportunities for follow-up studies to better understand BAL outflow energetics.

  17. Highly stretchable strain sensor based on polyurethane substrate using hydrogen bond-assisted laminated structure for monitoring of tiny human motions

    NASA Astrophysics Data System (ADS)

    Huang, Ying; Zhao, Yunong; Wang, Yang; Guo, Xiaohui; Zhang, Yangyang; Liu, Ping; Liu, Caixia; Zhang, Yugang

    2018-03-01

    Strain sensors used as flexible and wearable electronic devices have improved prospects in the fields of artificial skin, robotics, human-machine interfaces, and healthcare. This work introduces a highly stretchable fiber-based strain sensor with a laminated structure made up of a graphene nanoplatelet layer and a carbon black/single-walled carbon nanotube synergetic conductive network layer. An ultrathin, flexible, and elastic two-layer polyurethane (PU) yarn substrate was successively deposited by a novel chemical bonding-based layered dip-coating process. These strain sensors demonstrated high stretchability (˜350%), little hysteresis, and long-term durability (over 2400 cycles) due to the favorable tensile properties of the PU substrate. The linearity of the strain sensor could reach an adjusted R-squared of 0.990 at 100% strain, which is better than most of the recently reported strain sensors. Meanwhile, the strain sensor exhibited good sensibility, rapid response, and a lower detection limit. The lower detection limit benefited from the hydrogen bond-assisted laminated structure and continuous conductive path. Finally, a series of experiments were carried out based on the special features of the PU strain sensor to show its capacity of detecting and monitoring tiny human motions.

  18. Longpath-DOAS measurements of BrO on the westcoast of Ireland

    NASA Astrophysics Data System (ADS)

    Buxmann, J.; Seitz, K.; Poehler, D.; Platt, U.

    2009-04-01

    Reactive halogen species (RHS) are of great importance since they influence the atmospheric ozone chemistry. The involved processes are not fully understood yet. Two field campaigns were undertaken at the west coast of Ireland at Mace Head research station and the Martin Ryan Institute (Carna, County Galway) respectively between August and September of 2007. During both campaigns the RHS BrO was investigated by active Differential Optical Absorption Spectroscopy (DOAS) in the marine boundary layer. Expecting very low concentrations of BrO, a low detection limit is necessary. By using a special strategy and an optimized configuration of the instruments, noise was significantly reduced compared to earlier investigations. Boundary layer BrO was detected at peak concentrations of (6,9 ± 1,7) ppt at both measurement sites in the late afternoon and early morning. Furthermore there was an ozone depletion event on August 24th from 40 ppb down to 10 ppb connected with high IO concentrations at the Martin Ryan Institute. At Mace Head diurnal profiles of BrO were measured for 8 days. An anticorrelation with Ozone concentrations was found. During the same period BrO also exceeded the detection limit during three nights reaching levels up to (3 ± 1,2) ppt. Possible causes of this observation are discussed.

  19. Assay for optical determination of biogenic amines using microtiterplates

    NASA Astrophysics Data System (ADS)

    Nedeljko, Polona; Turel, Matejka; Lobnik, Aleksandra

    2013-05-01

    Direct determination of catecholamine noradreanaline (NOR) is presented using o-phthaldialdehyde (OPA) as an indicator reagent. The fluorescent assay in which OPA forms with NOR a fluorescent complex (OPA-NOR) can be monitored at neutral, physiological conditions (pH 7) and performed in microtiterplates. The determination of NOR is optimal in the concentration range from 4.0×10-7 to 1.0×10-5 M and limit of detection is 4.0×10-7 M. The OPA-NOR complex maximum intensity is reached within 5 minutes. Dopamine and adrenaline could not be determined using the same approach.

  20. Plasma density limits for hole boring by intense laser pulses.

    PubMed

    Iwata, Natsumi; Kojima, Sadaoki; Sentoku, Yasuhiko; Hata, Masayasu; Mima, Kunioki

    2018-02-12

    High-power lasers in the relativistic intensity regime with multi-picosecond pulse durations are available in many laboratories around the world. Laser pulses at these intensities reach giga-bar level radiation pressures, which can push the plasma critical surface where laser light is reflected. This process is referred to as the laser hole boring (HB), which is critical for plasma heating, hence essential for laser-based applications. Here we derive the limit density for HB, which is the maximum plasma density the laser can reach, as a function of laser intensity. The time scale for when the laser pulse reaches the limit density is also derived. These theories are confirmed by a series of particle-in-cell simulations. After reaching the limit density, the plasma starts to blowout back toward the laser, and is accompanied by copious superthermal electrons; therefore, the electron energy can be determined by varying the laser pulse length.

  1. A Sneak Peek at the JWST Era: Observing Galaxies Below the Hubble Limit with Gravitational Lensing

    NASA Astrophysics Data System (ADS)

    Livermore, Rachael C.

    2016-01-01

    The installation of WFC3 on the Hubble Space Telescope pushed the frontier of high-redshift galaxy studies to only 500 Myr after the Big Bang. However, observations in this epoch remain challenging and are limited to the brightest galaxies; the fainter sources believed to be responsible for reionizing the Universe remain beyond the grasp of Hubble. With gravitational lensing, however, we can benefit from the magnification of faint sources, which brings them within reach of today's telescopes. The Hubble Frontier Fields program is a deep survey of strongly lensing clusters observed in the optical and near-infrared. Unfortunately, detecting highly magnified, intrinsically faint galaxies in these fields has proved challenging due to the bright foregound cluster galaxies and intracluster light. We have developed a technique using wavelet decomposition to overcome these difficulties and detect galaxies at z~7 with intrinsic UV magnitudes as faint as MUV = -13. We present this method and the resulting luminosity functions, which support a steep faint-end slope extending out to the observational limits. Our method has uncovered hundreds of galaxies at z > 6 fainter than any that have been seen before, providing our first insight into the small galaxy population during the epoch of reionization and a preview of the capabilities of JWST.

  2. Production of gravitational waves during preheating with nonminimal coupling

    NASA Astrophysics Data System (ADS)

    Fu, Chengjie; Wu, Puxun; Yu, Hongwei

    2018-04-01

    We study the preheating and the in-process production of gravitational waves (GWs) after inflation in which the inflaton is nonminimally coupled to the curvature in a self-interacting quartic potential with the method of lattice simulation. We find that the nonminimal coupling enhances the amplitude of the density spectrum of inflaton quanta, and as a result, the peak value of the GW spectrum generated during preheating is enhanced as well and might reach the limit of detection in future GW experiments. The peaks of the GW spectrum not only exhibit distinctive characteristics as compared to those of minimally coupled inflaton potentials but also imprint information on the nonminimal coupling and the parametric resonance, and thus the detection of these peaks in the future will provide us a new avenue to reveal the physics of the early universe.

  3. Direct-methods structure determination of a trypanosome RNA-editing substrate fragment with translational pseudosymmetry

    DOE PAGES

    Mooers, Blaine H. M.

    2016-03-24

    Using direct methods starting from random phases, the crystal structure of a 32-base-pair RNA (675 non-H RNA atoms in the asymmetric unit) was determined using only the native diffraction data (resolution limit 1.05 Å) and the computer program SIR2014. The almost three helical turns of the RNA in the asymmetric unit introduced partial or imperfect translational pseudosymmetry (TPS) that modulated the intensities when averaged by the lMiller indices but still escaped automated detection. Almost six times as many random phase sets had to be tested on average to reach a correct structure compared with a similar-sized RNA hairpin (27 nucleotides,more » 580 non-H RNA atoms) without TPS. Lastly, more sensitive methods are needed for the automated detection of partial TPS.« less

  4. The pristine graphene produced by liquid exfoliation of graphite in mixed solvent and its application to determination of dopamine.

    PubMed

    Zhang, Juan; Xu, Liao; Zhou, Bo; Zhu, Yinyan; Jiang, Xiaoqing

    2018-03-01

    The pristine graphene can be easily prepared in isopropanol-water mixture with salts as assistant via liquid-phase exfoliation method. The concentration of graphene dispersion reaches as high as 0.565 mg/mL. The graphene film prepared by drop-casting method shows an excellent electrical conductivity (7.095 × 10 4  S/m). Furthermore, an electrochemical biosensor based on the pristine graphene shows high selectivity and sensitivity for the determination of dopamine. The linear detection range for dopamine is 2.5-1500 μM with detection limit of 1.5 μM. This method provides a potential process for preparing high-quality graphene ready-to-use in low-boiling point solvent. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Direct-methods structure determination of a trypanosome RNA-editing substrate fragment with translational pseudosymmetry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mooers, Blaine H. M.

    Using direct methods starting from random phases, the crystal structure of a 32-base-pair RNA (675 non-H RNA atoms in the asymmetric unit) was determined using only the native diffraction data (resolution limit 1.05 Å) and the computer program SIR2014. The almost three helical turns of the RNA in the asymmetric unit introduced partial or imperfect translational pseudosymmetry (TPS) that modulated the intensities when averaged by the lMiller indices but still escaped automated detection. Almost six times as many random phase sets had to be tested on average to reach a correct structure compared with a similar-sized RNA hairpin (27 nucleotides,more » 580 non-H RNA atoms) without TPS. Lastly, more sensitive methods are needed for the automated detection of partial TPS.« less

  6. Trace analysis of pollutants in water using the photothermal interferometry as HPLC detector.

    PubMed

    Seidel, B S; Dübel, O; Faubel, W; Ache, H J

    1996-03-01

    A new procedure including high performance liquid chromatography in combination with photothermal interference spectroscopy as detection device (HPLC/PIS) has been proposed, optimized and its figures of merit for pesticide residue analysis are shown. The flowing sample under study is set in one arm of a Mach-Zehnder interferometer, and its refractive index is modulated by a periodically chopped continuous wave argon ion laser. As chopper, an acousto optical modulator has been introduced to switch the excitation laser beam between different lines (457 nm, 488 nm, 514 nm) simultaneously. Thus a multi component analysis can be realized either by using an HPLC-system in front of the PIS device or by a multi line Ar(+)-laser, directly. The limit of detection of the HPLC/PIS system reached 71 microg/l of the pesticide di-nitro-ortho-cresol (DNOC).

  7. Rapid and Quantitative Detection of Vibrio parahemolyticus by the Mixed-Dye-Based Loop-Mediated Isothermal Amplification Assay on a Self-Priming Compartmentalization Microfluidic Chip.

    PubMed

    Pang, Bo; Ding, Xiong; Wang, Guoping; Zhao, Chao; Xu, Yanan; Fu, Kaiyue; Sun, Jingjing; Song, Xiuling; Wu, Wenshuai; Liu, Yushen; Song, Qi; Hu, Jiumei; Li, Juan; Mu, Ying

    2017-12-27

    Vibrio parahemolyticus (VP) mostly isolated from aquatic products is one of the major causes of bacterial food-poisoning events worldwide, which could be reduced using a promising on-site detection method. Herein, a rapid and quantitative method for VP detection was developed by applying a mixed-dye-loaded loop-mediated isothermal amplification (LAMP) assay on a self-priming compartmentalization (SPC) microfluidic chip, termed on-chip mixed-dye-based LAMP (CMD-LAMP). In comparison to conventional approaches, CMD-LAMP was advantageous on the limit of detection, which reached down to 1 × 10 3 CFU/mL in food-contaminated samples without the pre-enrichment of bacteria. Additionally, as a result of the use of a mixed dye and SPC chip, the quantitative result could be easily acquired, avoiding the requirement of sophisticated instruments and tedious operation. Also, CMD-LAMP was rapid and cost-effective. Conclusively, CMD-LAMP has great potential in realizing the on-site quantitative analysis of VP for food safety.

  8. Virtual gastrointestinal colonoscopy in combination with large bowel endoscopy: Clinical application

    PubMed Central

    He, Qing; Rao, Ting; Guan, Yong-Song

    2014-01-01

    Although colorectal cancer (CRC) has no longer been the leading cancer killer worldwide for years with the exponential development in computed tomography (CT) or magnetic resonance imaging, and positron emission tomography/CT as well as virtual colonoscopy for early detection, the CRC related mortality is still high. The objective of CRC screening is to reduce the burden of CRC and thereby the morbidity and mortality rates of the disease. It is believed that this goal can be achieved by regularly screening the average-risk population, enabling the detection of cancer at early, curable stages, and polyps before they become cancerous. Large-scale screening with multimodality imaging approaches plays an important role in reaching that goal to detect polyps, Crohn’s disease, ulcerative colitis and CRC in early stage. This article reviews kinds of presentative imaging procedures for various screening options and updates detecting, staging and re-staging of CRC patients for determining the optimal therapeutic method and forecasting the risk of CRC recurrence and the overall prognosis. The combination use of virtual colonoscopy and conventional endoscopy, advantages and limitations of these modalities are also discussed. PMID:25320519

  9. An effective established biosensor of bifunctional probes-labeled AuNPs combined with LAMP for detection of fish pathogen Streptococcus iniae.

    PubMed

    Zhou, Ya; Xiao, Jingfan; Ma, Xin; Wang, Qiyao; Zhang, Yuanxing

    2018-06-01

    In purpose of valid Streptococcus iniae detection, we established a colorimetric biosensor using gold nanoparticles (AuNPs) labeled with dual functional probes and along with loop-mediated isothermal amplification (LAMP) assay (LAMP-AuNPs). Based on the characteristics of self-aggregation and bio-conjugation with ligands, AuNPs were chosen for observable color change in tandem with LAMP amplification method to reach high sensitivity and easy operation. Meanwhile, the improvement of dual probes that could fully utilize the LAMP product gave the biosensor a stable result exhibition. LAMP-AuNPs targeting gene ftsB, one of the ATP transporter-related genes, turned out favorable specificity in cross reaction among other fish pathogens. The detect limit of 10 2 CFU revealed a better sensitivity compared with polymerase chain reaction (PCR) method and AuNPs lateral flow test strip (LFTS). It was also proved to be effective by zebrafish infection model trials with less than 2-h time consumption and nearly no devices which make it a convenient biosensor for point-to-care S. iniae detection.

  10. A Simple Assay for Ultrasensitive Colorimetric Detection of Ag⁺ at Picomolar Levels Using Platinum Nanoparticles.

    PubMed

    Wang, Yi-Wei; Wang, Meili; Wang, Lixing; Xu, Hui; Tang, Shurong; Yang, Huang-Hao; Zhang, Lan; Song, Hongbo

    2017-11-02

    In this work, uniformly-dispersed platinum nanoparticles (PtNPs) were synthesized by a simple chemical reduction method, in which citric acid and sodium borohydride acted as a stabilizer and reducer, respectively. An ultrasensitive colorimetric sensor for the facile and rapid detection of Ag⁺ ions was constructed based on the peroxidase mimetic activities of the obtained PtNPs, which can catalyze the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H₂O₂ to produce colored products. The introduced Ag⁺ would be reduced to Ag⁰ by the capped citric acid, and the deposition of Ag⁰ on the PtNPs surface, can effectively inhibit the peroxidase-mimetic activity of PtNPs. Through measuring the maximum absorption signal of oxidized TMB at 652 nm, ultra-low detection limits (7.8 pM) of Ag⁺ can be reached. In addition to such high sensitivity, the colorimetric assay also displays excellent selectivity for other ions of interest and shows great potential for the detection of Ag⁺ in real water samples.

  11. Ultrasensitive determination of jasmonic acid in plant tissues using high-performance liquid chromatography with fluorescence detection.

    PubMed

    Xiong, Xu-Jie; Rao, Wan-Bing; Guo, Xiao-Feng; Wang, Hong; Zhang, Hua-Shan

    2012-05-23

    An ultrasensitive and selective high-performance liquid chromatographic method for the volatile signaling hormone, jasmonic acid, has been developed based on precolumn derivatization with 1,3,5,7-tetramethyl-8-aminozide-difluoroboradiaza-s-indacene (BODIPY-aminozide). The derivatization reaction was carried out at 60 °C for 30 min in the presence of phosphoric acid. The formed jasmonic acid derivative was eluted using a mobile phase of methanol/pH 6.50 ammonium formate buffer/tetrahydrofuran (67:30:3, v/v/v) in 10 min on a C(18) column and detected with fluorescence detection at excitation and emission wavelengths of 495 and 505 nm, respectively. The detection limit (signal-to-noise ratio = 4) reached 1.14 × 10(-10) M or 2.29 fmol per injection (20 μL), which is the lowest of the existing methods. The proposed method has been successfully applied to the direct determination of trace jasmonic acid in the crude extracts of soybean leaves from soybean mosaic virus-infected and normal plants with recoveries of 95-104%.

  12. Magnetically optimized SERS assay for rapid detection of trace drug-related biomarkers in saliva and fingerprints.

    PubMed

    Yang, Tianxi; Guo, Xiaoyu; Wang, Hui; Fu, Shuyue; Wen, Ying; Yang, Haifeng

    2015-06-15

    New developments in the fields of human healthcare and social security call for the exploration of an easy and on-field method to detect drug-related biomarkers. In this paper, Au nanoparticles dotted magnetic nanocomposites (AMN) modified with inositol hexakisphosphate (IP6) were used as surface-enhanced Raman scattering (SERS) substrate to quickly monitor trace drug-related biomarkers in saliva and to on-site screen a trace drug biomarker in fingerprints. Due to inducing with an external magnet, such substrate presented a huge SERS activity, which has met the sensitivity requirement for assay to detect the drug biomarkers in saliva from the U.S. Substance Abuse and Mental Health Services Administration, and also the limit of detection for drug biomarker in fingerprint reached 100 nM. In addition, this AMN-based SERS assay was successfully conducted using a portable Raman spectrometer, which could be used to on-site and accurately differentiate between the smokers and drug addicts in near future. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Cerebral microbleed detection in traumatic brain injury patients using 3D convolutional neural networks

    NASA Astrophysics Data System (ADS)

    Standvoss, K.; Crijns, T.; Goerke, L.; Janssen, D.; Kern, S.; van Niedek, T.; van Vugt, J.; Alfonso Burgos, N.; Gerritse, E. J.; Mol, J.; van de Vooren, D.; Ghafoorian, M.; van den Heuvel, T. L. A.; Manniesing, R.

    2018-02-01

    The number and location of cerebral microbleeds (CMBs) in patients with traumatic brain injury (TBI) is important to determine the severity of trauma and may hold prognostic value for patient outcome. However, manual assessment is subjective and time-consuming due to the resemblance of CMBs to blood vessels, the possible presence of imaging artifacts, and the typical heterogeneity of trauma imaging data. In this work, we present a computer aided detection system based on 3D convolutional neural networks for detecting CMBs in 3D susceptibility weighted images. Network architectures with varying depth were evaluated. Data augmentation techniques were employed to improve the networks' generalization ability and selective sampling was implemented to handle class imbalance. The predictions of the models were clustered using a connected component analysis. The system was trained on ten annotated scans and evaluated on an independent test set of eight scans. Despite this limited data set, the system reached a sensitivity of 0.87 at 16.75 false positives per scan (2.5 false positives per CMB), outperforming related work on CMB detection in TBI patients.

  14. An ultrasensitive quantum dots fluorescent polarization immunoassay based on the antibody modified Au nanoparticles amplifying for the detection of adenosine triphosphate.

    PubMed

    He, Yanlong; Tian, Jianniao; Hu, Kun; Zhang, Juanni; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin

    2013-11-13

    In this work, an ultrasensitive fluorescent polarization immunoassay (FPIA) method based on the quantum dot/aptamer/antibody/gold nanoparticles ensemble has been developed for the detection of adenosine triphosphate (ATP). DNA hybridization is formed when ATP is present in the PBS solution containing the DNA-conjugated quantum dots (QDs) and antibody-AuNPs. The substantial sensitivity improvement of the antibody-AuNPs-enhanced method is mainly attributed to the slower rotation of fluorescent unit when QDs-labeled oligonucleotides hybridize with antibody modified the gold nanoparticle. As a result, the fluorescent polarization (FP) values of the system increase significantly. Under the optimal conditions, a linear response with ATP concentration is ranged from 8×10(-12) M to 2.40×10(-4) M. The detection limit reached as low as 1.8 pM. The developed work provides a sensitive and selective immunoassay protocol for ATP detection, which could be applied in more bioanalytical systems. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  15. Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis

    PubMed Central

    Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

    2018-01-01

    Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7–3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through prompt on-site detection of Fno. PMID:29444148

  16. Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis.

    PubMed

    Shahin, Khalid; Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

    2018-01-01

    Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7-3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through prompt on-site detection of Fno.

  17. Toward single electron resolution phonon mediated ionization detectors

    NASA Astrophysics Data System (ADS)

    Mirabolfathi, Nader; Harris, H. Rusty; Mahapatra, Rupak; Sundqvist, Kyle; Jastram, Andrew; Serfass, Bruno; Faiez, Dana; Sadoulet, Bernard

    2017-05-01

    Experiments seeking to detect rare event interactions such as dark matter or coherent elastic neutrino nucleus scattering are striving for large mass detectors with very low detection threshold. Using Neganov-Luke phonon amplification effect, the Cryogenic Dark Matter Search (CDMS) experiment is reaching unprecedented RMS resolutions of ∼14 eVee. CDMSlite is currently the most sensitive experiment to WIMPs of mass ∼5 GeV/c2 but is limited in achieving higher phonon gains due to an early onset of leakage current into Ge crystals. The contact interface geometry is particularly weak for blocking hole injection from the metal, and thus a new design is demonstrated that allows high voltage bias via vacuum separated electrode. With an increased bias voltage and a×2 Luke phonon gain, world best RMS resolution of sigma ∼7 eVee for 0.25 kg (d=75 mm, h=1 cm) Ge detectors was achieved. Since the leakage current is a function of the field and the phonon gain is a function of the applied voltage, appropriately robust interface blocking material combined with thicker substrate (25 mm) will reach a resolution of ∼2.8 eVee. In order to achieve better resolution of ∼ eV, we are investigating a layer of insulator between the phonon readout surface and the semiconductor crystals.

  18. Study on room temperature gas-sensing performance of CuO film-decorated ordered porous ZnO composite by In2O3 sensitization

    NASA Astrophysics Data System (ADS)

    Li, Tian-tian; Bao, Na; Geng, Ai-fang; Yu, Hui; Yang, Ying; Dong, Xiang-ting

    2018-02-01

    For the first time, ordered mesoporous ZnO nanoparticles have been synthesized by a template method. The electroplating after chemical plating method was creatively used to form copper film on the surface of the prepared ZnO, and then a CuO film-decorated ordered porous ZnO composite (CuO/ZnO) was obtained by a high-temperature oxidation method. In2O3 was loaded into the prepared CuO film-ZnO by an ultrasonic-assisted method to sensitize the room temperature gas-sensing performance of the prepared CuO/ZnO materials. The doped In2O3 could effectively improve the gas-sensing properties of the prepared materials to nitrogen oxides (NOx) at room temperature. The 1% In2O3 doped CuO/ZnO sample (1 wt% In2O3-CuO/ZnO) showed the best gas-sensing properties whose response to 100 ppm NOx reached 82%, and the detectable minimum concentration reached 1 ppm at room temperature. The prepared materials had a good selectivity, better response, very low detection limit, and high sensitivity to NOx gas at room temperature, which would have a great development space in the gas sensor field and a great research value.

  19. Detecting Vessels Carrying Migrants Using Machine Learning

    NASA Astrophysics Data System (ADS)

    Sfyridis, A.; Cheng, T.; Vespe, M.

    2017-10-01

    Political instability, conflicts and inequalities result into significant flows of people worldwide, moving to different countries in search of a better life, safety or to be reunited with their families. Irregular crossings into Europe via sea routes, despite not being new, have recently increased together with the loss of lives of people in the attempt to reach EU shores. This highlights the need to find ways to improve the understanding of what is happening at sea. This paper, intends to expand the knowledge available on practices among smugglers and contribute to early warning and maritime situational awareness. By identifying smuggling techniques and based on anomaly detection methods, behaviours of interest are modelled and one class support vector machines are used to classify unlabelled data and detect potential smuggling vessels. Nine vessels are identified as potentially carrying irregular migrants and refugees. Though, further inspection of the results highlights possible misclassifications caused by data gaps and limited knowledge on smuggling tactics. Accepted classifications are considered subject to further investigation by the authorities.

  20. Design of a novel noninvasive spectrometer for pesticide residues monitor

    NASA Astrophysics Data System (ADS)

    Ren, Zhong; Liu, Guodong; Huang, Zhen

    2014-11-01

    Although the gas or liquid chromatography had been widely used into pesticide residues monitoring, some drawbacks such as time-consuming, complicated operation and especially the destructivity for samples were existed. To overcome the limits of destructive detection methods, the noninvasive detection method based on spectroscopy was used to detect the pesticide residues in this paper. To overcome low resolution and light-efficiency due to the drawbacks of the classical plane and holography concave gratings, a novel noninvasive spectrometer for pesticide residues monitor (PRM) based on volume holography transmission (VHT) grating was designed. Meanwhile, a custom-built splitting light system for PRM based on the VHT grating was developed. In addition, the linear charge coupled device (CCD) with combined data acquisition (DAQ) card and the virtual-PRM based on LabVIEW were respectively used as the spectral acquisition hardware and software-platform. Experimental results showed that the spectral resolution of this spectrometer reached 2nm, and the VHT grating's diffraction efficiency was gotten via the simulation experiment.

  1. Fast contactless vibrating structure characterization using real time field programmable gate array-based digital signal processing: demonstrations with a passive wireless acoustic delay line probe and vision.

    PubMed

    Goavec-Mérou, G; Chrétien, N; Friedt, J-M; Sandoz, P; Martin, G; Lenczner, M; Ballandras, S

    2014-01-01

    Vibrating mechanical structure characterization is demonstrated using contactless techniques best suited for mobile and rotating equipments. Fast measurement rates are achieved using Field Programmable Gate Array (FPGA) devices as real-time digital signal processors. Two kinds of algorithms are implemented on FPGA and experimentally validated in the case of the vibrating tuning fork. A first application concerns in-plane displacement detection by vision with sampling rates above 10 kHz, thus reaching frequency ranges above the audio range. A second demonstration concerns pulsed-RADAR cooperative target phase detection and is applied to radiofrequency acoustic transducers used as passive wireless strain gauges. In this case, the 250 ksamples/s refresh rate achieved is only limited by the acoustic sensor design but not by the detection bandwidth. These realizations illustrate the efficiency, interest, and potentialities of FPGA-based real-time digital signal processing for the contactless interrogation of passive embedded probes with high refresh rates.

  2. Hollow-fiber liquid-phase microextraction coupled with miniature capillary electrophoresis for the trace analysis of four aliphatic aldehydes in water samples.

    PubMed

    Li, Ying; Yi, Fan; Zheng, Yiliang; Wang, Yu; Ye, Jiannong; Chu, Qingcui

    2015-08-01

    An environmentally friendly method for the trace analysis of four aliphatic aldehydes as water disinfection byproducts has been developed based on hollow-fiber liquid-phase microextraction followed by miniature capillary electrophoresis with amperometric detection. After derivatization with 2-thiobarbituric acid, four aliphatic aldehydes (formaldehyde, acetaldehyde, propylaldehyde, and butyraldehyde) became detectable by the amperometric detector. Under the optimum conditions, four aliphatic aldehydes can be well separated from the coexisting interferents as well as their homologs (pentanal, glyoxal, and methyl-glyoxal), and the limits of detection (S/N = 3) could reach sub-nanogram-per-milliliter level based on hollow-fiber liquid-phase microextraction. The proposed method has been applied for the analyses of above four aliphatic aldehydes in different water samples such as drinking water, tap water, and river water, and the average recoveries were in the range of 90-113%, providing an alternative to conventional and microchip capillary electrophoresis approaches. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Sodium Laser Guide Star Technique, Spectroscopy and Imaging with Adaptive Optics

    NASA Astrophysics Data System (ADS)

    Ge, Jian

    A sodium laser guide star (LGS) adaptive optics (AO) system developed at Stewart Observatory is to be used at the 6.5m MMT. Annual measurements at Kitt Peak show that the mean mesospheric sodium column density varies from ~2×109cm-2 (summer) to ~5×109cm-2 (winter). The sodium column density also varies by a factor of two during a one hour period. The first simultaneous measurements of sodium LGS brightness, sodium column density and laser power were obtained. The absolute sodium return for a continuous wave circularly polarized beam is 1.2([/pm]0.3)× 106 photons s-1m-2W-1 for the sodium column density of 3.7×109cm-2. Theoretical studies demonstrate that the 6.5m MMT LGS AO can provide Strehl ratios better than 0.15 and about 50% flux concentration within 0.2'' aperture for 1-5.5μm under median seeing. This correction will be available for the full sky. Better Strehl and higher flux concentration can be achieved with natural guide stars, but limited sky coverage. The AO corrected field-of-view is about 60''. The Arizona IR Imager and Echelle Spectrograph (ARIES) was designed to match the 6.5m MMT AO. Detection limits of more than 2 magnitude fainter can be reached with the AO over without the AO. A pre-ARIES wide field near-IR camera was designed, built and tested. The camera provides 1'' images in the near-IR over an 8.5 × 8.5arcmin2 field. The 10-σ detection limit with one minute exposures is 17.9 mag. in the K band. A prototype very high resolution cross-dispersed optical echelle spectrograph was designed and built to match the Starfire Optical Range 1.5m AO images. Interstellar KI 7698A absorption lines have been detected in the spectra of αCyg and ζPer. The spectral resolution is 250.000. About 300A wavelengths were covered in a single exposure. Total detection efficiency of 1% has been achieved. For the first time, a near-single-mode fiber with 10μm core size was applied to transmit the Mt. Wilson 100inch AO corrected beams to a spectrograph. The coupling efficiency of the fiber reached up to 70%. Spectra of αOri were recorded. The spectral resolution is 200,000. The total wavelength coverage is about 650A per exposure.

  4. Validation of the Berlese-funnel technique for thrips extraction.

    PubMed

    Casteels, H; Witters, J; De Bondt, G; Desamblanx, J

    2009-01-01

    In order to get the accreditation EN ISO/IEC 17025 for Thrips palmi the Berlese-funnel technique, which is used for the isolation of quarantine insects out of plant material, was validated. Following parameters were investigated: cleaning of the funnel, temperature during isolation, detection limit and duration of the isolation period. Thrips fuscipennis was collected from heavily infected rosehip and used as target organism. Besides orchids, artificially contaminated maple leaves (Acer pseudoplatanus) were used for the validation. Results showed that thrips and other organisms can be present alive or dead in the funnel after removing the treated plants and can contaminate the next sample or isolate. Cleaning of the funnel with a vacuum cleaner and compressed-air apparatus is necessary before running a new extraction. Contamination of the recipient is also possible from the environment. This can be avoided by closing the opening between the funnel and the recipient. To reach an optimal temperature for isolation of the thrips a 60 Watt bulb is necessary. The results showed that the maximum temperature doesn't reach a temperature above 51 degrees C, the average temperatures were situated between 35, 74 degrees C and 39, 38 degrees C. A 40 Watt bulb doesn't create enough heat to guarantee an efficient isolation of the thrips; the average temperature was 34, 74 degrees C and the maximum temperature 36, 80 degrees C. Based on the results we can conclude that an isolation time of 20 hours is necessary to obtain accurate data. Dependent on the number of thrips in the artificially infected samples 87 to 95% is isolated after 20 hours. The detection limit is 1 thrips with a probability of 95% being isolated after 20 hours.

  5. Through the Looking GLASS: HST Spectroscopy of Faint Galaxies Lensed by the Frontier Fields Cluster MACSJ0717.5+3745

    NASA Astrophysics Data System (ADS)

    Schmidt, K. B.; Treu, T.; Brammer, G. B.; Bradač, M.; Wang, X.; Dijkstra, M.; Dressler, A.; Fontana, A.; Gavazzi, R.; Henry, A. L.; Hoag, A.; Jones, T. A.; Kelly, P. L.; Malkan, M. A.; Mason, C.; Pentericci, L.; Poggianti, B.; Stiavelli, M.; Trenti, M.; von der Linden, A.; Vulcani, B.

    2014-02-01

    The Grism Lens-Amplified Survey from Space (GLASS) is a Hubble Space Telescope (HST) Large Program, which will obtain 140 orbits of grism spectroscopy of the core and infall regions of 10 galaxy clusters, selected to be among the very best cosmic telescopes. Extensive HST imaging is available from many sources including the CLASH and Frontier Fields programs. We introduce the survey by analyzing spectra of faint multiply-imaged galaxies and z >~ 6 galaxy candidates obtained from the first 7 orbits out of 14 targeting the core of the Frontier Fields cluster MACSJ0717.5+3745. Using the G102 and G141 grisms to cover the wavelength range 0.8-1.7 μm, we confirm four strongly lensed systems by detecting emission lines in each of the images. For the 9 z >~ 6 galaxy candidates clear from contamination, we do not detect any emission lines down to a 7 orbit 1σ noise level of ~5 × 10-18 erg s-1 cm-2. Taking lensing magnification into account, our flux sensitivity reaches ~0.2-5 × 10-18 erg s-1cm-2. These limits over an uninterrupted wavelength range rule out the possibility that the high-z galaxy candidates are instead strong line emitters at lower redshift. These results show that by means of careful modeling of the background—and with the assistance of lensing magnification—interesting flux limits can be reached for large numbers of objects, avoiding pre-selection and the wavelength restrictions inherent to ground-based multi-slit spectroscopy. These observations confirm the power of slitless HST spectroscopy even in fields as crowded as a cluster core.

  6. Hot-Volumes as Uniform and Reproducible SERS-Detection Enhancers in Weakly-Coupled Metallic Nanohelices

    NASA Astrophysics Data System (ADS)

    Caridad, José M.; Winters, Sinéad; McCloskey, David; Duesberg, Georg S.; Donegan, John F.; Krstić, Vojislav

    2017-03-01

    Reproducible and enhanced optical detection of molecules in low concentrations demands simultaneously intense and homogeneous electric fields acting as robust signal amplifiers. To generate such sophisticated optical near-fields, different plasmonic nanostructures were investigated in recent years. These, however, exhibit either high enhancement factor (EF) or spatial homogeneity but not both. Small interparticle gaps or sharp nanostructures show enormous EFs but no near-field homogeneity. Meanwhile, approaches using rounded and separated monomers create uniform near-fields with moderate EFs. Here, guided by numerical simulations, we show how arrays of weakly-coupled Ag nanohelices achieve both homogeneous and strong near-field enhancements, reaching even the limit forreproducible detection of individual molecules. The unique near-field distribution of a single nanohelix consists of broad hot-spots, merging with those from neighbouring nanohelices in specific array configurations and generating a wide and uniform detection zone (“hot-volume”). We experimentally assessed these nanostructures via surface-enhanced Raman spectroscopy, obtaining a corresponding EF of ~107 and a relative standard deviation <10%. These values demonstrate arrays of nanohelices as state-of-the-art substrates for reproducible optical detection as well as compelling nanostructures for related fields such as near-field imaging.

  7. Effects of core strength training using stable versus unstable surfaces on physical fitness in adolescents: a randomized controlled trial.

    PubMed

    Granacher, Urs; Schellbach, Jörg; Klein, Katja; Prieske, Olaf; Baeyens, Jean-Pierre; Muehlbauer, Thomas

    2014-01-01

    It has been demonstrated that core strength training is an effective means to enhance trunk muscle strength (TMS) and proxies of physical fitness in youth. Of note, cross-sectional studies revealed that the inclusion of unstable elements in core strengthening exercises produced increases in trunk muscle activity and thus provide potential extra training stimuli for performance enhancement. Thus, utilizing unstable surfaces during core strength training may even produce larger performance gains. However, the effects of core strength training using unstable surfaces are unresolved in youth. This randomized controlled study specifically investigated the effects of core strength training performed on stable surfaces (CSTS) compared to unstable surfaces (CSTU) on physical fitness in school-aged children. Twenty-seven (14 girls, 13 boys) healthy subjects (mean age: 14 ± 1 years, age range: 13-15 years) were randomly assigned to a CSTS (n = 13) or a CSTU (n = 14) group. Both training programs lasted 6 weeks (2 sessions/week) and included frontal, dorsal, and lateral core exercises. During CSTU, these exercises were conducted on unstable surfaces (e.g., TOGU© DYNAIR CUSSIONS, THERA-BAND© STABILITY TRAINER). Significant main effects of Time (pre vs. post) were observed for the TMS tests (8-22%, f = 0.47-0.76), the jumping sideways test (4-5%, f = 1.07), and the Y balance test (2-3%, f = 0.46-0.49). Trends towards significance were found for the standing long jump test (1-3%, f = 0.39) and the stand-and-reach test (0-2%, f = 0.39). We could not detect any significant main effects of Group. Significant Time x Group interactions were detected for the stand-and-reach test in favour of the CSTU group (2%, f = 0.54). Core strength training resulted in significant increases in proxies of physical fitness in adolescents. However, CSTU as compared to CSTS had only limited additional effects (i.e., stand-and-reach test). Consequently, if the goal of training is to enhance physical fitness, then CSTU has limited advantages over CSTS. ClinicalTrials.gov Identifier: NCT02290457 Registered 13 November 2014.

  8. Solid-phase single molecule biosensing using dual-color colocalization of fluorescent quantum dot nanoprobes

    NASA Astrophysics Data System (ADS)

    Liu, Jianbo; Yang, Xiaohai; Wang, Kemin; Wang, Qing; Liu, Wei; Wang, Dong

    2013-10-01

    The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies.The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies. Electronic supplementary information (ESI) available: Absorbance and fluorescence spectra of quantum dot nanoprobes, electrophoresis analysis, and experimental setup for fluorescence imaging with dual channels. See DOI: 10.1039/c3nr03291d

  9. Highly Sensitive and Selective Uranium Detection in Natural Water Systems Using a Luminescent Mesoporous Metal-Organic Framework Equipped with Abundant Lewis Basic Sites: A Combined Batch, X-ray Absorption Spectroscopy, and First Principles Simulation Investigation.

    PubMed

    Liu, Wei; Dai, Xing; Bai, Zhuanling; Wang, Yanlong; Yang, Zaixing; Zhang, Linjuan; Xu, Lin; Chen, Lanhua; Li, Yuxiang; Gui, Daxiang; Diwu, Juan; Wang, Jianqiang; Zhou, Ruhong; Chai, Zhifang; Wang, Shuao

    2017-04-04

    Uranium is not only a strategic resource for the nuclear industry but also a global contaminant with high toxicity. Although several strategies have been established for detecting uranyl ions in water, searching for new uranium sensor material with great sensitivity, selectivity, and stability remains a challenge. We introduce here a hydrolytically stable mesoporous terbium(III)-based MOF material compound 1, whose channels are as large as 27 Å × 23 Å and are equipped with abundant exposed Lewis basic sites, the luminescence intensity of which can be efficiently and selectively quenched by uranyl ions. The detection limit in deionized water reaches 0.9 μg/L, far below the maximum contamination standard of 30 μg/L in drinking water defined by the United States Environmental Protection Agency, making compound 1 currently the only MOF material that can achieve this goal. More importantly, this material exhibits great capability in detecting uranyl ions in natural water systems such as lake water and seawater with pH being adjusted to 4, where huge excesses of competing ions are present. The uranyl detection limits in Dushu Lake water and in seawater were calculated to be 14.0 and 3.5 μg/L, respectively. This great detection capability originates from the selective binding of uranyl ions onto the Lewis basic sites of the MOF material, as demonstrated by synchrotron radiation extended X-ray adsorption fine structure, X-ray adsorption near edge structure, and first principles calculations, further leading to an effective energy transfer between the uranyl ions and the MOF skeleton.

  10. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov; Oi, David H.; Becnel, James J.

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strandmore » of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.« less

  11. New method for analyzing dark matter direct detection data

    NASA Astrophysics Data System (ADS)

    Davis, Jonathan H.; Enßlin, Torsten; BÅ`hm, Céline

    2014-02-01

    The experimental situation of dark matter direct detection has reached an exciting crossroads, with potential hints of a discovery of dark matter (DM) from the CDMS, CoGeNT, CRESST-II and DAMA experiments in tension with null results from xenon-based experiments such as XENON100 and LUX. Given the present controversial experimental status, it is important that the analytical method used to search for DM in direct detection experiments is both robust and flexible enough to deal with data for which the distinction between signal and background points is difficult, and hence where the choice between setting a limit or defining a discovery region is debatable. In this article we propose a novel (Bayesian) analytical method, which can be applied to all direct detection experiments and which extracts the maximum amount of information from the data. We apply our method to the XENON100 experiment data as a worked example, and show that firstly our exclusion limit at 90% confidence is in agreement with their own for the 225 live days data, but is several times stronger for the 100 live days data. Secondly we find that, due to the two points at low values of S1 and S2 in the 225 days data set, our analysis points to either weak consistency with low-mass dark matter or the possible presence of an unknown background. Given the null result from LUX, the latter scenario seems the more plausible.

  12. A survey of benthic sediment contaminants in reaches of the Columbia River Estuary based on channel sedimentation characteristics.

    PubMed

    Counihan, Timothy D; Waite, Ian R; Nilsen, Elena B; Hardiman, Jill M; Elias, Edwin; Gelfenbaum, Guy; Zaugg, Steven D

    2014-06-15

    While previous studies have documented contaminants in fish, sediments, water, and wildlife, few specifics are known about the spatial distribution of contaminants in the Columbia River Estuary (CRE). Our study goal was to characterize sediment contaminant detections and concentrations in reaches of the CRE that were concurrently being sampled to assess contaminants in water, invertebrates, fish, and osprey (Pandion haliaetus) eggs. Our objectives were to develop a survey design based on sedimentation characteristics and then assess whether sediment grain size, total organic carbon (TOC), and contaminant concentrations and detections varied between areas with different sedimentation characteristics. We used a sediment transport model to predict sedimentation characteristics of three 16km river reaches in the CRE. We then compartmentalized the modeled change in bed mass after a two week simulation to define sampling strata with depositional, stable, or erosional conditions. We collected and analyzed bottom sediments to assess whether substrate composition, organic matter composition, and contaminant concentrations and detections varied among strata within and between the reaches. We observed differences in grain size fractions between strata within and between reaches. We found that the fine sediment fraction was positively correlated with TOC. Contaminant concentrations were statistically different between depositional vs. erosional strata for the industrial compounds, personal care products and polycyclic aromatic hydrocarbons class (Indus-PCP-PAH). We also observed significant differences between strata in the number of detections of Indus-PCP-PAH (depositional vs. erosional; stable vs. erosional) and for the flame retardants, polychlorinated biphenyls, and pesticides class (depositional vs. erosional, depositional vs. stable). When we estimated mean contaminant concentrations by reach, we observed higher contaminant concentrations in the furthest downstream reach with a decreasing trend in the two upstream reaches. Contaminant survey designs that account for sedimentation characteristics could increase the probability that sampling is allocated to areas likely to be contaminated. Published by Elsevier B.V.

  13. A survey of benthic sediment contaminants in reaches of the Columbia River Estuary based on channel sedimentation characteristics

    USGS Publications Warehouse

    Counihan, Timothy D.; Waite, Ian R.; Nilsen, Elena B.; Hardiman, Jill M.; Elias, Edwin; Gelfenbaum, Guy; Zaugg, Steven D.

    2014-01-01

    While previous studies have documented contaminants in fish, sediments, water, and wildlife, few specifics are known about the spatial distribution of contaminants in the Columbia River Estuary (CRE). Our study goal was to characterize sediment contaminant detections and concentrations in reaches of the CRE that were concurrently being sampled to assess contaminants in water, invertebrates, fish, and osprey (Pandion haliaetus) eggs. Our objectives were to develop a survey design based on sedimentation characteristics and then assess whether sediment grain size, total organic carbon (TOC), and contaminant concentrations and detections varied between areas with different sedimentation characteristics. We used a sediment transport model to predict sedimentation characteristics of three 16 km river reaches in the CRE. We then compartmentalized the modeled change in bed mass after a two week simulation to define sampling strata with depositional, stable, or erosional conditions. We collected and analyzed bottom sediments to assess whether substrate composition, organic matter composition, and contaminant concentrations and detections varied among strata within and between the reaches. We observed differences in grain size fractions between strata within and between reaches. We found that the fine sediment fraction was positively correlated with TOC. Contaminant concentrations were statistically different between depositional vs. erosional strata for the industrial compounds, personal care products and polycyclic aromatic hydrocarbons class (Indus–PCP–PAH). We also observed significant differences between strata in the number of detections of Indus–PCP–PAH (depositional vs. erosional; stable vs. erosional) and for the flame retardants, polychlorinated biphenyls, and pesticides class (depositional vs. erosional, depositional vs. stable). When we estimated mean contaminant concentrations by reach, we observed higher contaminant concentrations in the furthest downstream reach with a decreasing trend in the two upstream reaches. Contaminant survey designs that account for sedimentation characteristics could increase the probability that sampling is allocated to areas likely to be contaminated.

  14. An assessment of memristor intrinsic fluctuations: a measurement of single atomic motion

    NASA Astrophysics Data System (ADS)

    Borghetti, Julien; Yang, J. Joshua; Medeiros-Ribeiro, Gilberto; Williams, R. Stanley

    2010-03-01

    Memristors provides electrically tunable resistance for upcoming non-volatile memory and future neuromorphic computing. One of the key benefits of such a device is its scalability, which can be demonstrated from an architectural perspective as well as from a fundamental physics limit. 4D addressing schemes utilizing cross bar structures that can be stacked several layers high above the chip embodies unlimited addressing space. On the other limit, the basic operating principles of memristive devices allow one to reach storage of information in a single atom. In this report of nanoscale (sub 50nm) devices, we detect single atom fluctuations, which would then represent the ultimate limit for noise sources thus delineating the boundary conditions for circuit design. We show that electrically induced individual atom migrations do not affect the overall device atomic configuration until a critical bias where a single local fluctuation triggers a general atomic reconfiguration. This instability illustrates the robustness of the device non-volatility upon small electrical stress.

  15. Reaching the Ionic Current Detection Limit in Silicon-Based Nanopores

    NASA Astrophysics Data System (ADS)

    Puster, Matthew; Rodriguez-Manzo, Julio Alejandro; Nicolai, Adrien; Meunier, Vincent; Drndic, Marija

    2015-03-01

    Solid-state nanopores act as single-molecule sensors whereby passage of an individual molecule in aqueous electrolyte through a nanopore is registered as a change in ionic conductance (ΔG). Future nanopore applications such as DNA sequencing at high bandwidth require high ΔG for optimal signal-to-noise ratio. Reducing the nanopore diameter and thickness increase ΔG. Molecule size limits the diameter, thus efforts concentrate on minimizing the thickness by thinning oxide/nitride films or using 2D materials. Weighted by electrolyte conductivity the highest ΔG reported to date for DNA translocations were obtained with nanopores made in oxide/nitride films. We present a controlled electron irradiation technique to thin such films to the limit of their stability, producing nanopores tailored to molecule size in amorphous Si with thicknesses less than 2 nm. We compare ΔG values with results found in the literature for DNA translocation through these nanopores, where access resistance becomes comparable to the resistance through the nanopore itself.

  16. Modeling study of seated reach envelopes based on spherical harmonics with consideration of the difficulty ratings.

    PubMed

    Yu, Xiaozhi; Ren, Jindong; Zhang, Qian; Liu, Qun; Liu, Honghao

    2017-04-01

    Reach envelopes are very useful for the design and layout of controls. In building reach envelopes, one of the key problems is to represent the reach limits accurately and conveniently. Spherical harmonics are proved to be accurate and convenient method for fitting of the reach capability envelopes. However, extensive study are required on what components of spherical harmonics are needed in fitting the envelope surfaces. For applications in the vehicle industry, an inevitable issue is to construct reach limit surfaces with consideration of the seating positions of the drivers, and it is desirable to use population envelopes rather than individual envelopes. However, it is relatively inconvenient to acquire reach envelopes via a test considering the seating positions of the drivers. In addition, the acquired envelopes are usually unsuitable for use with other vehicle models because they are dependent on the current cab packaging parameters. Therefore, it is of great significance to construct reach envelopes for real vehicle conditions based on individual capability data considering seating positions. Moreover, traditional reach envelopes provide little information regarding the assessment of reach difficulty. The application of reach envelopes will improve design quality by providing difficulty-rating information about reach operations. In this paper, using the laboratory data of seated reach with consideration of the subjective difficulty ratings, the method of modeling reach envelopes is studied based on spherical harmonics. The surface fitting using spherical harmonics is conducted for circumstances both with and without seat adjustments. For use with adjustable seat, the seating position model is introduced to re-locate the test data. The surface fitting is conducted for both population and individual reach envelopes, as well as for boundary envelopes. Comparison of the envelopes of adjustable seat and the SAE J287 control reach envelope shows that the latter is nearly at the middle difficulty level. It is also found that the abilities of reach envelope models in expressing the shape of the reach limits based on spherical harmonics depends both on the terms in the model expression and on the data used to fit the envelope surfaces. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Highly sensitive LIDAR with a thumb-sized sensor-head built using an optical fiber preamplifier (3)

    NASA Astrophysics Data System (ADS)

    Inoue, Daisuke; Ichikawa, Tadashi; Matsubara, Hiroyuki; Kagami, Manabu

    2013-05-01

    We have developed a LIDAR system with a sensor head which, although it includes a scanning mechanism, is less than 20 cc in size. The system is not only small, but is also highly sensitive. Our LIDAR system is based on time-of-flight measurements, and incorporates an optical fiber. The main feature of our system is the utilization of optical amplifiers for both the transmitter and the receiver, and the optical amplifiers enable us to exceed the detection limit set by thermal noise. In conventional LIDAR systems the detection limit is determined by the thermal noise, because the avalanche photo-diodes (APD) and trans-impedance amplifiers (TIA) that they use detect the received signals directly. In the case of our LIDAR system, the received signal is amplified by an optical fiber amplifier before reaching the photo diode and the TIA. Therefore, our LIDAR system boosts the signal level before the weak incoming signal is depleted by thermal noise. There are conditions under which the noise figure for the combination of an optical fiber amplifier and a photo diode is superior to the noise figure for an avalanche photo diode. We optimized the gains of the optical fiber amplifier and the TIA in our LIDAR system such that it would be capable of detecting a single photon. As a result, the detection limit of our system is determined by shot noise. We have previously demonstrated scanning up to a range of 80 m with this LIDAR system with a 2 mm diameter of receiving lens. We improved the optical amplifier and the peak output power of LIDAR was over 10KW. We redesigned the sensor-head and improved coupling efficiency. As a result, we succeeded in scanning over a range of 100 m. This small and highly sensitive measurement technology shows great potential for use in LIDAR.

  18. Interferon-γ–Inducible Protein 10 (IP-10) as a Screening Tool to Optimize Human Immunodeficiency Virus RNA Monitoring in Resource-Limited Settings

    PubMed Central

    Pastor, Lucía; Casellas, Aina; Carrillo, Jorge; Maculuve, Sonia; Jairoce, Chenjerai; Paredes, Roger; Blanco, Julià; Naniche, Denise

    2017-01-01

    Abstract Background Achieving effective antiretroviral treatment (ART) monitoring is a key determinant to ensure viral suppression and reach the UNAIDS 90-90-90 targets. The gold standard for detecting virological failure is plasma human immunodeficiency virus (HIV) RNA (viral load [VL]) testing; however, its availability is very limited in low-income countries due to cost and operational constraints. Methods HIV-1–infected adults on first-line ART attending routine visits at the Manhiça District Hospital, Mozambique, were previously evaluated for virologic failure. Plasma levels of interferon-γ–inducible protein 10 (IP-10) were quantified by enzyme-linked immunosorbent assay. Logistic regression was used to build an IP-10–based model able to identify individuals with VL >150 copies/mL. From the 316 individuals analyzed, 253 (80%) were used for model training and 63 (20%) for validation. Receiver operating characteristic curves were employed to evaluate model prediction. Results From the individuals included in the training set, 34% had detectable VL. Mean age was 41 years, 70% were females, and median time on ART was 3.4 years. IP-10 levels were significantly higher in subjects with detectable VL (108.2 pg/mL) as compared to those with undetectable VL (38.0 pg/mL) (P < .0001, U test). IP-10 univariate model demonstrated high classification performance (area under the curve = 0.85 [95% confidence interval {CI}, .80–.90]). Using a cutoff value of IP-10 ≥44.2 pg/mL, the model identified detectable VL with 91.9% sensitivity (95% CI, 83.9%–96.7%) and 59.9% specificity (95% CI, 52.0%–67.4%), values confirmed in the validation set. Conclusions IP-10 is an accurate biomarker to screen individuals on ART for detectable viremia. Further studies should evaluate the benefits of IP-10 as a triage approach to monitor ART in resource-limited settings. PMID:29020145

  19. Perceiving Children's Behavior and Reaching Limits in a Risk Environment

    ERIC Educational Resources Information Center

    Cordovil, Rita; Santos, Carlos; Barreiros, Joao

    2012-01-01

    The purpose of this study was to investigate the accuracy of parents' perception of children's reaching limits in a risk scenario. A sample of 68 parents of 1- to 4-year-olds were asked to make a prior estimate of their children's behavior and action limits in a task that involved retrieving a toy out of the water. The action modes used for…

  20. Reaching Families and Youth Who Have Limited Resources. Proceedings of a Conference for Educators and Practitioners in Family, Youth and Community Development (Columbus, Ohio, September 16-17, 1992).

    ERIC Educational Resources Information Center

    Spiegel, Marilyn R., Ed.; Safrit, R. Dale, Ed.

    These conference proceedings contain abstracts of papers or complete papers that were submitted for presentation, along with descriptions of all workshops from a conference on reaching families and youths who have limited resources. The following are included: "Volunteerism and Limited Resource Audiences" (Safrit, Smith); "Cultural Do's and…

  1. Effect of 2 Bedding Materials on Ammonia Levels in Individually Ventilated Cages

    PubMed Central

    Koontz, Jason M; Kumsher, David M; III, Richard Kelly; Stallings, Jonathan D

    2016-01-01

    This study sought to identify an optimal rodent bedding and cage-change interval to establish standard procedures for the IVC in our rodent vivarium. Disposable cages were prefilled with either corncob or α-cellulose bedding and were used to house 2 adult Sprague–Dawley rats (experimental condition) or contained no animals (control). Rats were observed and intracage ammonia levels measured daily for 21 d. Intracage ammonia accumulation became significant by day 8 in experimental cages containing α-cellulose bedding, whereas experimental cages containing corncob bedding did not reach detectable levels of ammonia until day 14. In all 3 experimental cages containing α-cellulose, ammonia exceeded 100 ppm (our maximum acceptable limit) by day 11. Two experimental corncob cages required changing at days 16 and 17, whereas the remaining cage containing corncob bedding lasted the entire 21 d without reaching the 100-ppm ammonia threshold. These data suggests that corncob bedding provides nearly twice the service life of α-cellulose bedding in the IVC system. PMID:26817976

  2. Effect of 2 Bedding Materials on Ammonia Levels in Individually Ventilated Cages.

    PubMed

    Koontz, Jason M; Kumsher, David M; Kelly, Richard; Stallings, Jonathan D

    2016-01-01

    This study sought to identify an optimal rodent bedding and cage-change interval to establish standard procedures for the IVC in our rodent vivarium. Disposable cages were prefilled with either corncob or α-cellulose bedding and were used to house 2 adult Sprague-Dawley rats (experimental condition) or contained no animals (control). Rats were observed and intracage ammonia levels measured daily for 21 d. Intracage ammonia accumulation became significant by day 8 in experimental cages containing α-cellulose bedding, whereas experimental cages containing corncob bedding did not reach detectable levels of ammonia until day 14. In all 3 experimental cages containing α-cellulose, ammonia exceeded 100 ppm (our maximum acceptable limit) by day 11. Two experimental corncob cages required changing at days 16 and 17, whereas the remaining cage containing corncob bedding lasted the entire 21 d without reaching the 100-ppm ammonia threshold. These data suggests that corncob bedding provides nearly twice the service life of α-cellulose bedding in the IVC system.

  3. A precision search for WIMPs with charged cosmic rays

    NASA Astrophysics Data System (ADS)

    Reinert, Annika; Winkler, Martin Wolfgang

    2018-01-01

    AMS-02 has reached the sensitivity to probe canonical thermal WIMPs by their annihilation into antiprotons. Due to the high precision of the data, uncertainties in the astrophysical background have become the most limiting factor for indirect dark matter detection. In this work we systematically quantify and—where possible—reduce uncertainties in the antiproton background. We constrain the propagation of charged cosmic rays through the combination of antiproton, B/C and positron data. Cross section uncertainties are determined from a wide collection of accelerator data and are—for the first time ever—fully taken into account. This allows us to robustly constrain even subdominant dark matter signals through their spectral properties. For a standard NFW dark matter profile we are able to exclude thermal WIMPs with masses up to 570 GeV which annihilate into bottom quarks. While we confirm a reported excess compatible with dark matter of mass around 80 GeV, its local (global) significance only reaches 2.2 σ (1.1 σ) in our analysis.

  4. [The World Initiative for the Eradication of Poliomyelitis: a long road full of pitfalls].

    PubMed

    Kuss, Jean-Jacques

    2011-01-01

    The World Initiative for the Eradication of Poliomyelitis (IMEP), launched in 1988, is based on two strategies: mass vaccination with oral polio vaccine (OPV) and surveillance of acute flaccid paralysis (AFP). The disease incidence was reduced by 99%, but eradication, originally scheduled for 2000, has still not been reached in 2010, and four countries continue to be endemic (India, Pakistan, Afghanistan and Nigeria). The obstacles to eradication are the difficulty in reaching all children to be vaccinated, especially in areas of insecurity; the imperfections of OPV--irregular efficacy and genetic instability; and the limitations of surveillance in detecting only the paralytic form of the disease, which often remains asymptomatic. The repeated postponements of the ending of the initiative, which greatly increased the cost of IMEP, spark debate about the actual feasibility of eradication and justification to continue funding in a difficult global economic context, so the initiative remains without significant impact on indicators of the Millennium Goals for Development.

  5. Identifying compensatory movement patterns in the upper extremity using a wearable sensor system.

    PubMed

    Ranganathan, Rajiv; Wang, Rui; Dong, Bo; Biswas, Subir

    2017-11-30

    Movement impairments such as those due to stroke often result in the nervous system adopting atypical movements to compensate for movement deficits. Monitoring these compensatory patterns is critical for improving functional outcomes during rehabilitation. The purpose of this study was to test the feasibility and validity of a wearable sensor system for detecting compensatory trunk kinematics during activities of daily living. Participants with no history of neurological impairments performed reaching and manipulation tasks with their upper extremity, and their movements were recorded by a wearable sensor system and validated using a motion capture system. Compensatory movements of the trunk were induced using a brace that limited range of motion at the elbow. Our results showed that the elbow brace elicited compensatory movements of the trunk during reaching tasks but not manipulation tasks, and that a wearable sensor system with two sensors could reliably classify compensatory movements (~90% accuracy). These results show the potential of the wearable system to assess and monitor compensatory movements outside of a lab setting.

  6. Direct analysis of environmental and biological samples for total mercury with comparison of sequential atomic absorption and fluorescence measurements from a single combustion event

    NASA Astrophysics Data System (ADS)

    Cizdziel, James V.; Tolbert, Candice; Brown, Garry

    2010-02-01

    A Direct Mercury Analyzer (DMA) based on sample combustion, concentration of mercury by amalgamation with gold, and cold vapor atomic absorption spectrometry (CVAAS) was coupled to a mercury-specific cold vapor atomic fluorescence spectrometer (CVAFS). The purpose was to evaluate combustion-AFS, a technique which is not commercially available, for low-level analysis of mercury in environmental and biological samples. The experimental setup allowed for comparison of dual measurements of mercury (AAS followed by AFS) for a single combustion event. The AFS instrument control program was modified to properly time capture of mercury from the DMA, avoiding deleterious combustion products from reaching its gold traps. Calibration was carried out using both aqueous solutions and solid reference materials. The absolute detection limits for mercury were 0.002 ng for AFS and 0.016 ng for AAS. Recoveries for reference materials ranged from 89% to 111%, and the precision was generally found to be <10% relative standard deviation (RSD). The two methods produced similar results for samples of hair, finger nails, coal, soil, leaves and food stuffs. However, for samples with mercury near the AAS detection limit (e.g., filter paper spotted with whole blood and segments of tree rings) the signal was still quantifiable with AFS, demonstrating the lower detection limit and greater sensitivity of AFS. This study shows that combustion-AFS is feasible for the direct analysis of low levels of mercury in solid samples that would otherwise require time-consuming and contamination-prone digestion.

  7. Design of the NDUV detection circuit for the NO concentration of the vehicle exhaust emissions

    NASA Astrophysics Data System (ADS)

    Zhang, Kai; Zhang, Yujun; He, Ying; You, Kun; Gao, Yanwei; Chen, Chen; Liu, Guohua; He, Chungui; Lu, Yibing; Liu, Wenqing

    2016-10-01

    With the increasing number of vehicles, the harm from NO to the environment becomes more and more prominent. So the monitoring of the NO concentration of the vehicle exhaust emissions is very important to assess the emission levels. In this paper, the NO detection system designing for vehicle exhaust emissions based on the non-dispersive ultraviolet principle (NDUV) has been researched. The technical indexes of the two-way modulation UV signal detection circuit are discussed in detail. And then a precision detection circuit is designed, which is composed of a trans-impedance amplifier and a lock-in amplifier, with which the output of the UV photoelectric detector can be amplified to a suitable voltage range, and the DC noise of the pre-stage amplifier is effectively removed by the lock-in amplifier. An experimental system was set up to test the designed circuit. To ensure the consistency of the two channels, the method of exchange calibration was adopted in the test. It's drawn that the designed circuit is of high SNR, measuring accuracy and a large dynamic range from the test results. The NO concentration detection limit of vehicle emissions can reach 1ppm, and the detection precision is +/-15ppm.

  8. Estimating the Added Utility of Highly Sensitive Histidine-Rich Protein 2 Detection in Outpatient Clinics in Sub-Saharan Africa.

    PubMed

    Plucinski, Mateusz M; Rogier, Eric; Dimbu, Pedro Rafael; Fortes, Filomeno; Halsey, Eric S; Aidoo, Michael

    2017-10-01

    Most malaria testing is by rapid diagnostic tests (RDTs) that detect Plasmodium falciparum histidine-rich protein 2 (HRP2). Recently, several RDT manufacturers have developed highly sensitive RDTs (hsRDTs), promising a limit of detection (LOD) orders of magnitude lower than conventional RDTs. To model the added utility of hsRDTs, HRP2 concentration in Angolan outpatients was measured quantitatively using an ultrasensitive bead-based assay. The distribution of HRP2 concentration was bimodal in both afebrile and febrile patients. The conventional RDT was able to detect 81% of all HRP2-positive febrile patients and 52-77% of HRP2-positive afebrile patients. The added utility of hsRDTs was estimated to be greater in afebrile patients, where an hsRDT with a LOD of 200 pg/mL would detect an additional 50-60% of HRP2-positive persons compared with a conventional RDT with a LOD of 3,000 pg/mL. In febrile patients, the hsRDT would detect an additional 10-20% of cases. Conventional RDTs already capture the vast majority of symptomatic HRP2-positive individuals, and hsRDTs would have to reach a sufficiently low LOD approaching 200 pg/mL to provide added utility in identifying HRP2-positive, asymptomatic individuals.

  9. Fluorescence and visual detection of fluoride ions using a photoluminescent graphene oxide paper sensor.

    PubMed

    Chen, Xiaochun; Yu, Shaoming; Yang, Liang; Wang, Jianping; Jiang, Changlong

    2016-07-14

    The instant and on-site detection of trace aqueous fluoride ions is still a challenge for environmental monitoring and protection. This work demonstrates a new analytical method and its utility of a paper sensor for visual detection of F(-) on the basis of the fluorescence resonance energy transfer (FRET) between photoluminescent graphene oxide (GO) and silver nanoparticles (AgNPs) through the formation of cyclic esters between phenylborinic acid and diol. The fluorescence of GO was quenched by the AgNPs, and trace F(-) can recover the fluorescence of the quenched photoluminescent GO. The increase in fluorescence intensity is proportional to the concentration of F(-) in the range of 0.05-0.55 nM, along with a limit of detection (LOD) as low as 9.07 pM. Following the sensing mechanism, a paper-based sensor for the visual detection of aqueous F(-) has been successfully developed. The paper sensor showed high sensitivity for aqueous F(-), and the LOD could reach as low as 0.1 μM as observed by the naked eye. The very simple and effective strategy reported here could be extended to the visual detection of a wide range of analytes in the environment by the construction of highly efficient FRET nanoprobes.

  10. On the age and mass function of the globular cluster M 4: A different interpretation of recent deep HST observations

    NASA Astrophysics Data System (ADS)

    De Marchi, G.; Paresce, F.; Straniero, O.; Prada Moroni, P. G.

    2004-03-01

    Very deep images of the Galactic globular cluster M 4 (NGC 6121) through the F606W and F814W filters were taken in 2001 with the WFPC2 on board the HST. A first published analysis of this data set (Richer et al. \\cite{Richer2002}) produced the result that the age of M 4 is 12.7± 0.7 Gyr (Hansen et al. \\cite{Hansen2002}), thus setting a robust lower limit to the age of the universe. In view of the great astronomical importance of getting this number right, we have subjected the same data set to the simplest possible photometric analysis that completely avoids uncertain assumptions about the origin of the detected sources. This analysis clearly reveals both a thin main sequence, from which can be deduced the deepest statistically complete mass function yet determined for a globular cluster, and a white dwarf (WD) sequence extending all the way down to the 5 \\sigma detection limit at I ≃ 27. The WD sequence is abruptly terminated at exactly this limit as expected by detection statistics. Using our most recent theoretical WD models (Prada Moroni & Straniero \\cite{Prada2002}) to obtain the expected WD sequence for different ages in the observed bandpasses, we find that the data so far obtained do not reach the peak of the WD luminosity function, thus only allowing one to set a lower limit to the age of M 4 of ˜9 Gyr. Thus, the problem of determining the absolute age of a globular cluster and, therefore, the onset of GC formation with cosmologically significant accuracy remains completely open. Only observations several magnitudes deeper than the limit obtained so far would allow one to approach this objective. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA for NASA under contract NAS5-26555.

  11. Community structure detection based on the neighbor node degree information

    NASA Astrophysics Data System (ADS)

    Tang, Li-Ying; Li, Sheng-Nan; Lin, Jian-Hong; Guo, Qiang; Liu, Jian-Guo

    2016-11-01

    Community structure detection is of great significance for better understanding the network topology property. By taking into account the neighbor degree information of the topological network as the link weight, we present an improved Nonnegative Matrix Factorization (NMF) method for detecting community structure. The results for empirical networks show that the largest improved ratio of the Normalized Mutual Information value could reach 63.21%. Meanwhile, for synthetic networks, the highest Normalized Mutual Information value could closely reach 1, which suggests that the improved method with the optimal λ can detect the community structure more accurately. This work is helpful for understanding the interplay between the link weight and the community structure detection.

  12. Influence of oxygen availability on the metabolism and morphology of Yarrowia lipolytica: insights into the impact of glucose levels on dimorphism.

    PubMed

    Timoumi, Asma; Bideaux, Carine; Guillouet, Stéphane E; Allouche, Yohan; Molina-Jouve, Carole; Fillaudeau, Luc; Gorret, Nathalie

    2017-10-01

    Dynamic behavior of Yarrowia lipolytica W29 strain under conditions of fluctuating, low, and limited oxygen supply was characterized in batch and glucose-limited chemostat cultures. In batch cultures, transient oscillations between oxygen-rich and -deprived environments induced a slight citric acid accumulation (lower than 29 mg L -1 ). By contrast, no citric acid was detected in continuous fermentations for all stress conditions: full anoxia (zero pO 2 value, 100% N 2 ), limited (zero pO 2 value, 75% of cell needs), and low (pO 2 close to 2%) dissolved oxygen (DO) levels. The macroscopic behavior (kinetic parameters, yields, viability) of Y. lipolytica was not significantly affected by the exposure to DO fluctuations under both modes of culture. Nevertheless, conditions of oxygen limitation resulted in the destabilization of the glucose-limited growth during the continuous cultivations. Morphological responses of Y. lipolytica to DO oscillations were different between batch and chemostat runs. Indeed, a yeast-to-mycelium transition was induced and progressively intensified during the batch fermentations (filamentous subpopulation reaching 74% (v/v)). While, in chemostat bioreactors, the culture consisted mainly of yeast-like cells (mean diameter not exceeding 5.7 μm) with a normal size distribution. During the continuous cultures, growth at low DO concentration did not induce any changes in Y. lipolytica morphology. Dimorphism (up to 80.5% (v/v) of filaments) was only detected under conditions of oxygen limitation in the presence of a residual glucose excess (more than 0.75 g L -1 ). These data suggest an impact of glucose levels on the signaling pathways regulating dimorphic responses in Y. lipolytica.

  13. Wired and wireless convergent extended-reach optical access network using direct-detection of all-optical OFDM super-channel signal.

    PubMed

    Chow, C W; Yeh, C H; Sung, J Y; Hsu, C W

    2014-12-15

    We propose and demonstrate the feasibility of using all-optical orthogonal frequency division multiplexing (AO-OFDM) for the convergent optical wired and wireless access networks. AO-OFDM relies on all-optically generated orthogonal subcarriers; hence, high data rate (> 100 Gb/s) can be easily achieved without hitting the speed limit of electronic digital-to-analog and analog-to-digital converters (DAC/ADC). A proof-of-concept convergent access network using AO-OFDM super-channel (SC) is demonstrated supporting 40 - 100 Gb/s wired and gigabit/s 100 GHz millimeter-wave (MMW) ROF transmissions.

  14. Dual-opposite injection capillary electrophoresis: Principles and misconceptions.

    PubMed

    Blackney, Donna M; Foley, Joe P

    2017-03-01

    Dual-opposite injection capillary electrophoresis (DOI-CE) is a separation technique that utilizes both ends of the capillary for sample introduction. The electroosmotic flow (EOF) is suppressed to allow all ions to reach the detector quickly. Depending on the individual electrophoretic mobilities of the analytes of interest and the effective length that each analyte travels to the detection window, the elution order of analytes in a DOI-CE separation can vary widely. This review discusses the principles, applications, and limitations of dual-opposite injection capillary electrophoresis. Common misconceptions regarding DOI-CE are clarified. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A method for limiting data acquisition in a high-resolution gamma-ray spectrometer during On-Site Inspection activities under the Comprehensive Nuclear-Test-Ban Treaty

    NASA Astrophysics Data System (ADS)

    Aviv, O.; Lipshtat, A.

    2018-05-01

    On-Site Inspection (OSI) activities under the Comprehensive Nuclear-Test-Ban Treaty (CTBT) allow limitations to measurement equipment. Thus, certain detectors require modifications to be operated in a restricted mode. The accuracy and reliability of results obtained by a restricted device may be impaired. We present here a method for limiting data acquisition during OSI. Limitations are applied to a high-resolution high-purity germanium detector system, where the vast majority of the acquired data that is not relevant to the inspection is filtered out. The limited spectrum is displayed to the user and allows analysis using standard gamma spectrometry procedures. The proposed method can be incorporated into commercial gamma-ray spectrometers, including both stationary and mobile-based systems. By applying this procedure to more than 1000 spectra, representing various scenarios, we show that partial data are sufficient for reaching reliable conclusions. A comprehensive survey of potential false-positive identifications of various radionuclides is presented as well. It is evident from the results that the analysis of a limited spectrum is practically identical to that of a standard spectrum in terms of detection and quantification of OSI-relevant radionuclides. A future limited system can be developed making use of the principles outlined by the suggested method.

  16. Progress of ILC High Gradient SRF Cavity R&D at Jefferson Lab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    R.L. Geng, J. Dai, G.V. Eremeev, A.D. Palczewski

    2011-09-01

    Latest progress of ILC high gradient SRF cavity R&D at Jefferson Lab will be presented. 9 out of 10 real 9-cell cavities reached an accelerating gradient of more than 38 MV/m at a unloaded quality factor of more than 8 {center_dot} 109. New understandings of quench limitation in 9-cell cavities are obtained through instrumented studies of cavities at cryogenic temperatures. Our data have shown that present limit reached in 9-cell cavities is predominantly due to localized defects, suggesting that the fundamental material limit of niobium is not yet reached in 9-cell cavities and further gradient improvement is still possible. Somemore » examples of quench-causing defects will be given. Possible solutions to pushing toward the fundamental limit will be described.« less

  17. Carbon-dot-based dual-emission silica nanoparticles as a ratiometric fluorescent probe for vanadium(V) detection in mineral water samples

    NASA Astrophysics Data System (ADS)

    He, Lijun; Zhang, Heng; Fan, Huanhuan; Jiang, Xiuming; Zhao, Wenjie; Xiang, Guo Qiang

    2018-01-01

    Herein, we propose a simple and effective strategy for designing a ratiometric fluorescent nanosensor. We designed and developed a carbon dots (CDs) based dual-emission nanosensor for vanadium(V) by coating the surface of dye-doped silica nanoparticles with CDs. The fluorescence of dual-emission silica nanoparticles was quenched in acetic acid through potassium bromate (KBrO3) oxidation. V(V) could catalyze KBrO3 oxidation reaction process, resulting in the ratiometric fluorescence quenching of dual-emission silica nanoparticles. We investigated several important parameters affecting the performance of the nanosensor. Under the optimized conditions, the detection limit of this nanosensor reached 1.1 ng mL- 1 and the linear range from 10 to 800 ng mL- 1. Furthermore, we found that the sensor was suitable for determination of V(V) in different mineral water samples with satisfactory results.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernard, Laetitia, E-mail: laetitia.bernard@empa.ch; Leemann, Andreas

    In this study, the potential of time-of-flight secondary ion mass spectrometry (ToF-SIMS) for the application in cement-based materials is assessed in combination and comparison with scanning electron microscopy (SEM) and energy dispersive X-ray (EDX). Mortar, concrete and samples from model systems providing products formed by the alkali–silica reaction (ASR) were studied. ToF-SIMS provides qualitative data on alkalis in cases where EDX reaches its limits in regard to detectable concentration, lateral resolution and atomic number of the elements. Due to its high in-depth resolution of a few atomic monolayers, thin layers of reaction products can be detected on the surfaces andmore » chemically analyzed with ToF-SIMS. Additionally, it delivers information on the molecular conformation within the ASR product, its hydrogen content and its isotope ratios, information not provided by EDX. Provided the samples are carefully prepared, ToF-SIMS opens up new possibilities in the analysis of cement-based materials.« less

  19. Extending Raman's reach: enabling applications via greater sensitivity and speed

    NASA Astrophysics Data System (ADS)

    Creasey, David; Sullivan, Mike; Paul, Chris; Rathmell, Cicely

    2018-02-01

    Over the last decade, miniature fiber optic spectrometers have greatly expanded the ability of Raman spectroscopy to tackle practical applications in the field, from mobile pharmaceutical ID to hazardous material assessment in remote locations. There remains a gap, however, between the typical diode array spectrometer and their more sensitive benchtop analogs. High sensitivity, cooled Raman spectrometers have the potential to narrow that gap by providing greater sensitivity, better SNR, and faster measurement times. In this paper, we'll look at the key factors in the design of high sensitivity miniature Raman spectrometers and their associated accessories, as well as the key metric for direct comparison of these systems - limit of detection. With the availability of our high sensitivity Raman systems operating at wavelengths from the UV to NIR, many applications are now becoming practical in the field, from trace level detection to analysis of complex biological samples.

  20. Improved Line Tracing Methods for Removal of Bad Streaks Noise in CCD Line Array Image—A Case Study with GF-1 Images

    PubMed Central

    Wang, Bo; Bao, Jianwei; Wang, Shikui; Wang, Houjun; Sheng, Qinghong

    2017-01-01

    Remote sensing images could provide us with tremendous quantities of large-scale information. Noise artifacts (stripes), however, made the images inappropriate for vitalization and batch process. An effective restoration method would make images ready for further analysis. In this paper, a new method is proposed to correct the stripes and bad abnormal pixels in charge-coupled device (CCD) linear array images. The method involved a line tracing method, limiting the location of noise to a rectangular region, and corrected abnormal pixels with the Lagrange polynomial algorithm. The proposed detection and restoration method were applied to Gaofen-1 satellite (GF-1) images, and the performance of this method was evaluated by omission ratio and false detection ratio, which reached 0.6% and 0%, respectively. This method saved 55.9% of the time, compared with traditional method. PMID:28441754

  1. First application of a microsphere-based immunoassay to the detection of genetically modified organisms (GMOs): quantification of Cry1Ab protein in genetically modified maize.

    PubMed

    Fantozzi, Anna; Ermolli, Monica; Marini, Massimiliano; Scotti, Domenico; Balla, Branko; Querci, Maddalena; Langrell, Stephen R H; Van den Eede, Guy

    2007-02-21

    An innovative covalent microsphere immunoassay, based on the usage of fluorescent beads coupled to a specific antibody, was developed for the quantification of the endotoxin Cry1Ab present in MON810 and Bt11 genetically modified (GM) maize lines. In particular, a specific protocol was developed to assess the presence of Cry1Ab in a very broad range of GM maize concentrations, from 0.1 to 100% [weight of genetically modified organism (GMO)/weight]. Test linearity was achieved in the range of values from 0.1 to 3%, whereas fluorescence signal increased following a nonlinear model, reaching a plateau at 25%. The limits of detection and quantification were equal to 0.018 and 0.054%, respectively. The present study describes the first application of quantitative high-throughput immunoassays in GMO analysis.

  2. Efficiency in SETI

    NASA Astrophysics Data System (ADS)

    Shostak, Seth

    2011-02-01

    While modern SETI experiments are often highly sensitive, reaching detection limits of 10 -25 W/m 2 Hz in the radio, interstellar distances imply that if extraterrestrial societies are using isotropic or broad-beamed transmitters, the power requirements for their emissions are enormous. Indeed, isotropic transmissions to the entire Galaxy, sufficiently intense to be detectable by our current searches, would consume power comparable to the stellar insolation of an Earth-size planet. In this paper we consider how knowledge can be traded for power, and how, and to what degree, astronomical accuracy can reduce the energy costs of a comprehensive transmission program by putative extraterrestrials. Indeed, an exploration of how far this trade-off might be taken suggests that extraterrestrial transmitting strategies of civilizations only modestly more advanced than our own would be, as are our SETI receiving experiments, inexpensive enough to allow multiple efforts. We explore the consequences this supposition has for our SETI listening experiments.

  3. Frequency bandwidth limitation of external pulse electric fields in cylindrical micro-channel electrophoresis with analyte velocity modulation.

    PubMed

    Wang, Shau-Chun; Chen, Hsiao-Ping; Lee, Chia-Yu; Yeo, Leslie Y

    2005-04-15

    In capillary electrophoresis, effective optical signal quality improvement is obtained when high frequency (>100 Hz) external pulse fields modulate analyte velocities with synchronous lock-in detection. However, the pulse frequency is constrained under a critical value corresponding to the time required for the bulk viscous flow, which arises due to viscous momentum diffusion from the electro-osmotic slip in the Debye layer, to reach steady-state. By solving the momentum diffusion equation for transient bulk flow in the micro-channel, we show that this set-in time to steady-state and hence, the upper limit for the pulse frequency is dependent on the characteristic diffusion length scale and therefore the channel geometry; for cylindrical capillaries, the set-in time is approximately one half of that for rectangular slot channels. From our estimation of the set-in time and hence the upper frequency modulation limit, we propose that the half width of planar channels does not exceed 100 microm and that the radii of cylindrical channels be limited to 140 microm such that there is a finite working bandwidth range above 100 Hz and below the upper limit in order for flicker noise to be effectively suppressed.

  4. A Search for Low Surface Brightness Galaxies in the Ultraviolet with GALEX

    NASA Astrophysics Data System (ADS)

    Wyder, Ted K.; GALEX Science Team

    2006-12-01

    Low surface brightness (LSB) galaxies have traditionally been difficult to detect at visible wavelengths due to their low contrast with the night sky and their low numbers per deg2. We describe a new search for LSB galaxies using UV images from the Galaxy Evolution Explorer (GALEX) satellite. The images are from the GALEX Medium Imaging Survey targeting mainly areas of the sky within the Sloan Digital Sky Survey (SDSS) footprint. Due to the UV sky background at high Galactic latitudes reaching levels of only approximately 28 mag arcsec-2 as well as the relatively large sky coverage from GALEX, we can potentially search for LSB galaxies that would be difficult to detect optically.After first convolving the images with a suitable kernel, we select a diameter limited set of objects which we then inspect manually in order to remove image artifacts and other spurious detections. Red galaxies that have high optical surface brightness can be identified using either the ratio of far-UV to near-UV flux or via comparison to SDSS images. We quantify our selection limits using a set of artificial galaxy tests. Our goal is to find blue, ultra-LSB galaxies that would be virtually undetectable in large optical imaging surveys. GALEX is a NASA Small Explorer, launched in April 2003. We gratefully acknowledge NASA's support for construction, operation, and science analysis for the GALEX mission.

  5. Laboratory and Astronomical Detection of the Negative Molecular Ion C3N-

    NASA Astrophysics Data System (ADS)

    Thaddeus, P.; Gottlieb, C. A.; Gupta, H.; Brünken, S.; McCarthy, M. C.; Agúndez, M.; Guélin, M.; Cernicharo, J.

    2008-04-01

    The negative molecular ion C3N- has been detected at millimeter wavelengths in a low-pressure laboratory discharge, and then with frequencies derived from the laboratory data in the molecular envelope of IRC+10216. Spectroscopic constants derived from laboratory measurements of 12 transitions between 97 and 378 GHz allow the rotational spectrum to be calculated well into the submillimeter-wave band to 0.03 km s-1 or better in equivalent radial velocity. Four transitions of C3N- were detected in IRC+10216 with the IRAM 30 m telescope at precisely the frequencies calculated from the laboratory measurements. The column density of C3N- is 0.5% that of C3N, or approximately 20 times greater than that of C4H- relative to C4H. The C3N- abundance in IRC+10216 is compared with a chemical model calculation by Petrie & Herbst. An upper limit in TMC-1 for C3N- relative to C3N (<0.8%) and a limit for C4H- relative to C4H (<0.004%) that is 5 times lower than that found in IRC+10216, were obtained from observations with the NRAO 100 m Green Bank Telescope (GBT). The fairly high concentration of C3N- achieved in the laboratory implies that other molecular anions containing the CN group may be within reach.

  6. Circannual and circadian rhythms in the concentration of corticosterone in the plasma of the edible frog (Rana esculenta L.).

    PubMed

    Dupont, W; Bourgeois, P; Reinberg, A; Vaillant, R

    1979-01-01

    For a period of 21 months between May 1974 and September 1976, circadian variations in the plasma concentration of corticosterone were studied by competitive protein-binding techniques in mature male and female edible frogs living in their natural environment. Blood samples were taken from 8 to 12 frogs six times daily and conventional and cosinor methods were used for statistical analysis. Circadian rhythms were not detected during February and March (time of hibernation). Circannual rhythms were detected in three parameters of the circadian rhythm. The mean concentration of corticosterone over a 24 h period (24 h mean) reached a peak on 1 May (between 15 April and 15 May; 95% limits of confidence); the annual mean value of the 24 h means was 1.97 +/- 0.25 (S.E.M.) microgram/100 ml, with an amplitude of 0.66 microgram/100 ml (0.53--0.79 microgram/100 ml; 95% limits of confidence). Circadian variations in the concentration of corticosterone were largest in May (peak of reproductive activity). The times at which the peak concentration of corticosterone occurred showed circannual variations: peak values were detected around 24.00 h in May, 19.00 h in July and 08.00 h in November. Both circadian and circannual variations have therefore been demonstrated in an endocrine function of an amphibian in its natural habitat.

  7. HUNTING FOR PLANETS IN THE HL TAU DISK

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Testi, L.; Skemer, A.; Bailey, V.

    2015-10-20

    Recent ALMA images of HL Tau show gaps in the dusty disk that may be caused by planetary bodies. Given the young age of this system, if confirmed, this finding would imply very short timescales for planet formation, probably in a gravitationally unstable disk. To test this scenario, we searched for young planets by means of direct imaging in the L′ band using the Large Binocular Telescope Interferometer mid-infrared camera. At the location of two prominent dips in the dust distribution at ∼70 AU (∼0.″5) from the central star, we reach a contrast level of ∼7.5 mag. We did notmore » detect any point sources at the location of the rings. Using evolutionary models we derive upper limits of ∼10–15 M{sub Jup} at ≤0.5–1 Ma for the possible planets. With these sensitivity limits we should have been able to detect companions sufficiently massive to open full gaps in the disk. The structures detected at millimeter wavelengths could be gaps in the distributions of large grains on the disk midplane caused by planets not massive enough to fully open the gaps. Future ALMA observations of the molecular gas density profile and kinematics as well as higher contrast infrared observations may be able to provide a definitive answer.« less

  8. Biosensing near the neutrality point of graphene

    PubMed Central

    Fu, Wangyang; Feng, Lingyan; Panaitov, Gregory; Kireev, Dmitry; Mayer, Dirk; Offenhäusser, Andreas; Krause, Hans-Joachim

    2017-01-01

    Over the past decade, the richness of electronic properties of graphene has attracted enormous interest for electrically detecting chemical and biological species using this two-dimensional material. However, the creation of practical graphene electronic sensors greatly depends on our ability to understand and maintain a low level of electronic noise, the fundamental reason limiting the sensor resolution. Conventionally, to reach the largest sensing response, graphene transistors are operated at the point of maximum transconductance, where 1/f noise is found to be unfavorably high and poses a major limitation in any attempt to further improve the device sensitivity. We show that operating a graphene transistor in an ambipolar mode near its neutrality point can markedly reduce the 1/f noise in graphene. Remarkably, our data reveal that this reduction in the electronic noise is achieved with uncompromised sensing response of the graphene chips and thus significantly improving the signal-to-noise ratio—compared to that of a conventionally operated graphene transistor for conductance measurement. As a proof-of-concept demonstration of the usage of the aforementioned new sensing scheme to a broader range of biochemical sensing applications, we selected an HIV-related DNA hybridization as the test bed and achieved detections at picomolar concentrations. PMID:29075669

  9. Human enteric viruses in a wastewater treatment plant: evaluation of activated sludge combined with UV disinfection process reveals different removal performances for viruses with different features.

    PubMed

    Lizasoain, A; Tort, L F L; García, M; Gillman, L; Alberti, A; Leite, J P G; Miagostovich, M P; Pou, S A; Cagiao, A; Razsap, A; Huertas, J; Berois, M; Victoria, M; Colina, R

    2018-03-01

    This study assess the quality of wastewater through the detection and quantification of important viruses causing gastroenteritis at different stages of the wastewater treatment process in an activated-sludge wastewater treatment plant with ultraviolet disinfection. Ten sampling events were carried out in a campaign along a period of 18 months collecting wastewater samples from the influent, after the activated-sludge treatment, and after the final disinfection with UV radiation. Samples were concentrated through ultracentrifugation and analysed using retro-transcription, PCR and real time quantitative PCR protocols, for detection and quantification of Group A Rotavirus (RVA), Human Astrovirus (HAstV), Norovirus Genogroup II (NoV GII) and Human Adenovirus (HAdV). HAdV (100%), NoV GII (90%), RVA (70%) and HAstV (60%) were detected in influent samples with concentration from 1·4 (NoV GII) to 8·0 (RVA) log 10  gc l -1 . Activated-sludge treatment reached well quality effluents with low organic material concentration, although nonstatistical significant differences were registered among influent and postactivated sludge treatment samples, regarding the presence and concentration for most viruses. All post-UV samples were negative for NoV GII and HAstV, although RVA and HAdV were detected in 38% and 63% of those samples respectively, with concentration ranging from 2·2 to 5·5 and 3·1 to 3·4 log 10  gc l -1 . This study demonstrates that an activated-sludge wastewater treatment plant with UV disinfection reduces to levels below the detection limit those single-stranded RNA viruses as noroviruses and astroviruses and reach significant lower levels of rotaviruses and adenoviruses after the complete treatment process. © 2017 The Society for Applied Microbiology.

  10. A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean

    PubMed Central

    Momper, Lily M; Reese, Brandi Kiel; Carvalho, Gustavo; Lee, Patrick; Webb, Eric A

    2015-01-01

    The cyanobacterial genus Trichodesmium is biogeochemically significant because of its dual role in nitrogen and carbon fixation in the oligotrophic ocean. Trichodesmium species form colonies that can be easily enriched from the water column and used for shipboard rate measurements to estimate their contribution to oceanic carbon and nitrogen budgets. During a July 2010 cruise near the Hawaiian Islands in the oligotrophic North Pacific Subtropical Gyre, a specific morphology of Trichodesmium puff-form colonies were examined under epifluorescent microscopy and found to harbor a colonial endobiont, morphologically identified as the heterocystous diazotrophic cyanobacterium Calothrix. Using unialgal enrichments obtained from this cruise, we show that these Calothrix-like heterocystous cyanobionts (hetDA for ‘Trichodesmium-associated heterocystous diazotroph') fix nitrogen on a diurnal cycle (maximally in the middle of the light cycle with a detectable minimum in the dark). Gene sequencing of nifH from the enrichments revealed that this genus was likely not quantified using currently described quantitative PCR (qPCR) primers. Guided by the sequence from the isolate, new hetDA-specific primers were designed and subsequent qPCR of environmental samples detected this diazotroph from surface water to a depth of 150 m, reaching densities up to ∼9 × 103 l−1. Based on phylogenetic relatedness of nifH and 16S rRNA gene sequences, it is predicted that the distribution of this cyanobiont is not limited to subtropical North Pacific but likely reaches to the South Pacific and Atlantic Oceans. Therefore, this previously unrecognized cohabitation, if it reaches beyond the oligotrophic North Pacific, could potentially influence Trichodesmium-derived nitrogen fixation budgets in the world ocean. PMID:25343510

  11. MAPLE: reflected light from exoplanets with a 50-cm diameter stratospheric balloon telescope

    NASA Astrophysics Data System (ADS)

    Marois, Christian; Bradley, Colin; Pazder, John; Nash, Reston; Metchev, Stanimir; Grandmont, Frédéric; Maire, Anne-Lise; Belikov, Ruslan; Macintosh, Bruce; Currie, Thayne; Galicher, Raphaël.; Marchis, Franck; Mawet, Dimitri; Serabyn, Eugene; Steinbring, Eric

    2014-08-01

    Detecting light reflected from exoplanets by direct imaging is the next major milestone in the search for, and characterization of, an Earth twin. Due to the high-risk and cost associated with satellites and limitations imposed by the atmosphere for ground-based instruments, we propose a bottom-up approach to reach that ultimate goal with an endeavor named MAPLE. MAPLE first project is a stratospheric balloon experiment called MAPLE-50. MAPLE-50 consists of a 50 cm diameter off-axis telescope working in the near-UV. The advantages of the near-UV are a small inner working angle and an improved contrast for blue planets. Along with the sophisticated tracking system to mitigate balloon pointing errors, MAPLE-50 will have a deformable mirror, a vortex coronograph, and a self-coherent camera as a focal plane wavefront-sensor which employs an Electron Multiplying CCD (EMCCD) as the science detector. The EMCCD will allow photon counting at kHz rates, thereby closely tracking telescope and instrument-bench-induced aberrations as they evolve with time. In addition, the EMCCD will acquire the science data with almost no read noise penalty. To mitigate risk and lower costs, MAPLE-50 will at first have a single optical channel with a minimum of moving parts. The goal is to reach a few times 109 contrast in 25 h worth of flying time, allowing direct detection of Jovians around the nearest stars. Once the 50 cm infrastructure has been validated, the telescope diameter will then be increased to a 1.5 m diameter (MAPLE-150) to reach 1010 contrast and have the capability to image another Earth.

  12. A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean.

    PubMed

    Momper, Lily M; Reese, Brandi Kiel; Carvalho, Gustavo; Lee, Patrick; Webb, Eric A

    2015-03-17

    The cyanobacterial genus Trichodesmium is biogeochemically significant because of its dual role in nitrogen and carbon fixation in the oligotrophic ocean. Trichodesmium species form colonies that can be easily enriched from the water column and used for shipboard rate measurements to estimate their contribution to oceanic carbon and nitrogen budgets. During a July 2010 cruise near the Hawaiian Islands in the oligotrophic North Pacific Subtropical Gyre, a specific morphology of Trichodesmium puff-form colonies were examined under epifluorescent microscopy and found to harbor a colonial endobiont, morphologically identified as the heterocystous diazotrophic cyanobacterium Calothrix. Using unialgal enrichments obtained from this cruise, we show that these Calothrix-like heterocystous cyanobionts (hetDA for 'Trichodesmium-associated heterocystous diazotroph') fix nitrogen on a diurnal cycle (maximally in the middle of the light cycle with a detectable minimum in the dark). Gene sequencing of nifH from the enrichments revealed that this genus was likely not quantified using currently described quantitative PCR (qPCR) primers. Guided by the sequence from the isolate, new hetDA-specific primers were designed and subsequent qPCR of environmental samples detected this diazotroph from surface water to a depth of 150 m, reaching densities up to ∼ 9 × 10(3) l(-1). Based on phylogenetic relatedness of nifH and 16S rRNA gene sequences, it is predicted that the distribution of this cyanobiont is not limited to subtropical North Pacific but likely reaches to the South Pacific and Atlantic Oceans. Therefore, this previously unrecognized cohabitation, if it reaches beyond the oligotrophic North Pacific, could potentially influence Trichodesmium-derived nitrogen fixation budgets in the world ocean.

  13. A multidisciplinary approach to overreaching detection in endurance trained athletes.

    PubMed

    Le Meur, Yann; Hausswirth, Christophe; Natta, Françoise; Couturier, Antoine; Bignet, Frank; Vidal, Pierre Paul

    2013-02-01

    In sport, high training load required to reach peak performance pushes human adaptation to their limits. In that process, athletes may experience general fatigue, impaired performance, and may be identified as overreached (OR). When this state lasts for several months, an overtraining syndrome is diagnosed (OT). Until now, no variable per se can detect OR, a requirement to prevent the transition from OR to OT. It encouraged us to further investigate OR using a multivariate approach, including physiological, biomechanical, cognitive, and perceptive monitoring. Twenty-four highly trained triathletes were separated into an overload group and a normo-trained group (NT) during 3 wk of training. Given the decrement of their running performance, 11 triathletes were diagnosed as OR after this period. A discriminant analysis showed that the changes of eight parameters measured during a maximal incremental test could explain 98.2% of the OR state (lactatemia, heart rate, biomechanical parameters and effort perception). Variations in heart rate and lactatemia were the two most discriminating factors. When the multifactorial analysis was restricted to these variables, the classification score reached 89.5%. Catecholamines and creatine kinase concentrations at rest did not change significantly in both groups. Running pattern was preserved and cognitive performance decrement was observed only at exhaustion in OR subjects. This study showed that monitoring various variables is required to prevent the transition between NT and OR. It emphasized that an OR index, which combines heart rate and blood lactate concentration changes after a strenuous training period, could be helpful to routinely detect OR.

  14. Identification and temporal decrease of 137Cs and 134Cs in groundwater in Minami-Soma City following the accident at the Fukushima Dai-ichi nuclear power plant.

    PubMed

    Shizuma, Kiyoshi; Fujikawa, Yoko; Kurihara, Momo; Sakurai, Yushi

    2018-03-01

    The Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident on March 11, 2011, caused severe radioactive contamination in Fukushima Prefecture. In order to clarify the safety of drinking water, we have conducted radiocesium monitoring of public tap water and groundwater in Minami-Soma City, which is 10-40 km north of the nuclear power plant. The source of tap water for Minami-Soma City is groundwater, which is treated by rapid filtration before distribution in two of the three treatment plants. The tap water was collected from six stations during 2012-2016 and groundwater was collected from 11 stations with wells between 5 and 100 m deep during 2014-2016. Radiocesium contamination of groundwater has been considered unlikely in Japan because of the small vertical migration velocity of radiocesium in Japanese soil. However, radiocesium was detected in public tap water after 2012, and the maximum 137 Cs concentration of 292 mBq L -1 was observed in 2013. In all the well water, radiocesium was detected between 2014 and 2015, at concentrations similar to those observed in tap water in the same period. In tap water and groundwater, radiocesium was decreased to below the detection limit in 2016 except for four stations. Radiocesium concentration in shallow water reached a maximum between 2013 and 2015, 2-4 years after the FDNPP accident, and then decreased. The results are interpreted that dissolved 137 Cs migrated in the soil and reached aquifers of various depth. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Low-cost coherent receiver for long-reach optical access network using single-ended detection.

    PubMed

    Zhang, Xuebing; Li, Zhaohui; Li, Jianping; Yu, Changyuan; Lau, Alan Pak Tao; Lu, Chao

    2014-09-15

    A low-cost coherent receiver using two 2×3 optical hybrids and single-ended detection is proposed for long-reach optical access network. This structure can detect the two polarization components of polarization division multiplexing (PDM) signals. Polarization de-multiplexing and signal-to-signal beat interference (SSBI) cancellation are realized by using only three photodiodes. Simulation results for 40 Gb/s PDM-OFDM transmissions indicate that the low-cost coherent receiver has 3.2 dB optical signal-to-noise ratio difference compared with the theoretical value.

  16. Galactic punctuated equilibrium: how to undermine Carter's anthropic argument in astrobiology.

    PubMed

    Cirković, Milan M; Vukotić, Branislav; Dragićević, Ivana

    2009-06-01

    A new strategy by which to defeat Carter's "anthropic" argument against extraterrestrial life and intelligence is presented. Our approach is based on relaxing hidden uniformitarian assumptions and considering instead a dynamical succession of evolutionary regimes governed by both global (Galaxy-wide) and local (planet- or planetary system-limited) regulation mechanisms. Notably, our increased understanding of the nature of supernovae, gamma-ray bursts, and strong coupling between the Solar System and the Galaxy, and the theories of "punctuated equilibria" and "macroevolutionary regimes" are in full accordance with the regulation-mechanism picture. The application of this particular strategy highlights the limits of application of Carter's argument and indicates that, in the real universe, its applicability conditions are not satisfied. We conclude that drawing far-reaching conclusions about the scarcity of extraterrestrial intelligence and the prospects of our efforts to detect it on the basis of this argument is unwarranted.

  17. Strategy for determination of LOD and LOQ values--some basic aspects.

    PubMed

    Uhrovčík, Jozef

    2014-02-01

    The paper is devoted to the evaluation of limit of detection (LOD) and limit of quantification (LOQ) values in concentration domain by using 4 different approaches; namely 3σ and 10σ approaches, ULA2 approach, PBA approach and MDL approach. Brief theoretical analyses of all above mentioned approaches are given together with directions for their practical use. Calculations and correct calibration design are exemplified by using of electrothermal atomic absorption spectrometry for determination of lead in drinking water sample. These validation parameters reached 1.6 μg L(-1) (LOD) and 5.4 μg L(-1) (LOQ) by using 3σ and 10σ approaches. For obtaining relevant values of analyte concentration the influence of calibration design and measurement methodology were examined. The most preferred technique has proven to be a method of preconcentration of the analyte on the surface of the graphite cuvette (boost cycle). © 2013 Elsevier B.V. All rights reserved.

  18. X-ray analog pixel array detector for single synchrotron bunch time-resolved imaging.

    PubMed

    Koerner, Lucas J; Gruner, Sol M

    2011-03-01

    Dynamic X-ray studies can reach temporal resolutions limited by only the X-ray pulse duration if the detector is fast enough to segregate synchrotron pulses. An analog integrating pixel array detector with in-pixel storage and temporal resolution of around 150 ns, sufficient to isolate pulses, is presented. Analog integration minimizes count-rate limitations and in-pixel storage captures successive pulses. Fundamental tests of noise and linearity as well as high-speed laser measurements are shown. The detector resolved individual bunch trains at the Cornell High Energy Synchrotron Source at levels of up to 3.7 × 10(3) X-rays per pixel per train. When applied to turn-by-turn X-ray beam characterization, single-shot intensity measurements were made with a repeatability of 0.4% and horizontal oscillations of the positron cloud were detected.

  19. X-ray analog pixel array detector for single synchrotron bunch time-resolved imaging

    PubMed Central

    Koerner, Lucas J.; Gruner, Sol M.

    2011-01-01

    Dynamic X-ray studies can reach temporal resolutions limited by only the X-ray pulse duration if the detector is fast enough to segregate synchrotron pulses. An analog integrating pixel array detector with in-pixel storage and temporal resolution of around 150 ns, sufficient to isolate pulses, is presented. Analog integration minimizes count-rate limitations and in-pixel storage captures successive pulses. Fundamental tests of noise and linearity as well as high-speed laser measurements are shown. The detector resolved individual bunch trains at the Cornell High Energy Synchrotron Source at levels of up to 3.7 × 103 X-rays per pixel per train. When applied to turn-by-turn X-ray beam characterization, single-shot intensity measurements were made with a repeatability of 0.4% and horizontal oscillations of the positron cloud were detected. PMID:21335901

  20. Detection of circulating breast cancer cells using photoacoustic flow cytometry

    NASA Astrophysics Data System (ADS)

    Bhattacharyya, Kiran

    According to the American Cancer Society, more than 200,000 new cases of breast cancer are expected to be diagnosed this year. Moreover, about 40,000 women died from breast cancer last year alone. As breast cancer progresses in an individual, it can transform from a localized state to a metastatic one with multiple tumors distributed through the body, not necessarily contained within the breast. Metastasis is the spread of cancer through the body by circulating tumor cells (CTCs) which can be found in the blood and lymph of the diagnosed patient. Diagnosis of a metastatic state by the discovery of a secondary tumor can often come too late and hence, significantly reduce the patient's chance of survival. There is a current need for a CTC detection method which would diagnose metastasis before the secondary tumor occurs or reaches a size resolvable by current imaging systems. Since earlier detection would improve prognosis, this study proposes a method of labeling of breast cancer cells for detection with a photoacoustic flow cytometry system as a model for CTC detection in human blood. Gold nanoparticles and fluorescent polystyrene nanoparticles are proposed as contrast agents for T47D, the breast cancer cell line of choice. The labeling, photoacoustic detection limit, and sensitivity are first characterized and then applied to a study to show detection from human blood.

  1. An optimized microfabricated platform for the optical generation and detection of hyperpolarized 129Xe

    PubMed Central

    Kennedy, Daniel J.; Seltzer, Scott J.; Jiménez-Martínez, Ricardo; Ring, Hattie L.; Malecek, Nicolas S.; Knappe, Svenja; Donley, Elizabeth A.; Kitching, John; Bajaj, Vikram S.; Pines, Alexander

    2017-01-01

    Low thermal-equilibrium nuclear spin polarizations and the need for sophisticated instrumentation render conventional nuclear magnetic resonance (NMR) spectroscopy and imaging (MRI) incompatible with small-scale microfluidic devices. Hyperpolarized 129Xe gas has found use in the study of many materials but has required very large and expensive instrumentation. Recently a microfabricated device with modest instrumentation demonstrated all-optical hyperpolarization and detection of 129Xe gas. This device was limited by 129Xe polarizations less than 1%, 129Xe NMR signals smaller than 20 nT, and transport of hyperpolarized 129Xe over millimeter lengths. Higher polarizations, versatile detection schemes, and flow of 129Xe over larger distances are desirable for wider applications. Here we demonstrate an ultra-sensitive microfabricated platform that achieves 129Xe polarizations reaching 7%, NMR signals exceeding 1 μT, lifetimes up to 6 s, and simultaneous two-mode detection, consisting of a high-sensitivity in situ channel with signal-to-noise of 105 and a lower-sensitivity ex situ detection channel which may be useful in a wider variety of conditions. 129Xe is hyperpolarized and detected in locations more than 1 cm apart. Our versatile device is an optimal platform for microfluidic magnetic resonance in particular, but equally attractive for wider nuclear spin applications benefitting from ultra-sensitive detection, long coherences, and simple instrumentation. PMID:28266629

  2. Nano-LISA for in vitro diagnostic applications

    NASA Astrophysics Data System (ADS)

    Maswadi, Saher; Glickman, Randolph D.; Elliott, Rowe; Barsalou, Norman

    2011-03-01

    We previously reported the detection of bacterial antigen with immunoaffinity reactions using laser optoacoustic spectroscopy and antibody-coupled gold nanorods (Ab-NR) as a contrast agent specifically targeted to the antigen of interest. The Nano-LISA (Nanoparticle Linked Immunosorbent Assay) method has been adapted to detect three very common blood-borne viral infectious agents, i.e. human T-lymphotropic virus (HTLV), human immunodeficiency virus (HIV) and hepatitis-B (Hep-B). These agents were used in a model test panel to illustrate the performance of the Nano-LISA technique. A working laboratory prototype of a Nano-LISA microplate reader-sensor was assembled and tested against the panel containing specific antigens of each of the infectious viral agents. Optoacoustic (OA) responses generated by the samples were detected using the probe beam deflection technique, an all-optical, non-contact technique. A LabView graphical user interface was developed for control of the instrument and real-time display of the test results. The detection limit of Nano-LISA is at least 1 ng/ml of viral antigen, and can reach 10 pg/ml, depending on the binding affinity of the specific detection antibody used to synthesize the Ab-NR. The method has sufficient specificity, i.e. the detection reagents do not cross-react with noncomplementary antigens. Thus, the OA microplate reader, incorporating NanoLISA, has adequate detection sensitivity and specificity for use in clinical in vitro diagnostic testing.

  3. An optimized microfabricated platform for the optical generation and detection of hyperpolarized 129Xe

    DOE PAGES

    Kennedy, Daniel J.; Seltzer, Scott J.; Jiménez-Martínez, Ricardo; ...

    2017-03-07

    Low thermal-equilibrium nuclear spin polarizations and the need for sophisticated instrumentation render conventional nuclear magnetic resonance (NMR) spectroscopy and imaging (MRI) incompatible with small-scale microfluidic devices. Hyperpolarized 129Xe gas has found use in the study of many materials but has required very large and expensive instrumentation. Recently a microfabricated device with modest instrumentation demonstrated all-optical hyperpolarization and detection of 129Xe gas. This device was limited by 129Xe polarizations less than 1%, 129Xe NMR signals smaller than 20 nT, and transport of hyperpolarized 129Xe over millimeter lengths. Higher polarizations, versatile detection schemes, and flow of 129Xe over larger distances are desirablemore » for wider applications. Here we demonstrate an ultra-sensitive microfabricated platform that achieves 129Xe polarizations reaching 7%, NMR signals exceeding 1 μT, lifetimes up to 6 s, and simultaneous two-mode detection, consisting of a high-sensitivity in situ channel with signal-to-noise of 10 5 and a lower-sensitivity ex situ detection channel which may be useful in a wider variety of conditions. 129Xe is hyperpolarized and detected in locations more than 1 cm apart. Our versatile device is an optimal platform for microfluidic magnetic resonance in particular, but equally attractive for wider nuclear spin applications benefitting from ultra-sensitive detection, long coherences, and simple instrumentation.« less

  4. Electron Density and Temperature Measurements At Mercury Using Thermal Noise Spectroscopy

    NASA Astrophysics Data System (ADS)

    Moncuquet, M.; Bougeret, J.-L.; Hellinger, P.; Issautier, K.; Maksimovic, M.; Manning, R.; Meyer-Vernet, N.; Travnicek, P.; Zarka, P.

    With an innovative procedure, we have constructed a model of the de-biased orbital and magnitude distribution of Near Earth Objects (NEOs), up to absolute magnitude H=22. This model accounts for 4 main sources of Near Earth Objects in the asteroid belt and for extinct Jupiter Family Comets (JFCs). It fits well the orbital-magnitude distribution of the NEOs detected by the Spacewatch Survey, once the observational biases are properly taken into account. The model predicts the existence of 960 NEOs with absolute magnitude H<18 and semimajor axis a<7.8 AU. of these, 58 bodies should be Aten (NEOs with a<1 AU), 590 should be Apollo (NEOs with a>1 AU and perihelion distance q<1 AU) and 310 should be Amor (NEOs with 11km is 834, which, compared to the total number of NEOs with H<18 (963), shows that the usually assumed conversion H=18 <=> D=1km is slightly pessimistic, on average (the exact correspondence would be H=17.82). In a size limited sample, our model predicts that the de-biased ratio between dark and bright (albedo smaller or larger than 0.089) NEOs is 0.8 (I.E., 56% of the NEO with a < 7.4 AU have dark albedos). Moreover, combining our orbital distribution model with the new albedo distribution model, and assuming that the density of bright and dark bodies is 2.7 and 1.3 g/cm3, respectively, we estimate that the Earth should undergo a 1000 megatons collision every 64,000 years. Based on our model, we have computed the expected NEO distribution in the sky to- gether with their apparent magnitudes and rates of motion. This is the basis to simulate the efficiency of the various survey strategies. To understand the detection efficiency of various survey strategies, we have first simulated ``perfect surveys" as benchmarks. These are 100% efficient, all-sky, every night survey, subject only to the constraints of 1 detection above a specified air mass and when the Sun is below the horizon. We have computed that such a survey must have a limiting magnitude of about V=21 to reach 90% detection of NEOs with H<18 within ten years. Slightly more realistic surveys, limited by latitude, the galaxy, minimum rates of NEO motion, etc, require progres- sively fainter limiting magnitude to reach the 90% completion level. A survey with the sky-coverage of LINEAR could detect 90% of the NEOs with H<18 only if its limiting magnitude is 24 (the current 50% efficiency magnitude of LINEAR is around 18.5). Our simulations suggest that there may be little need for distributing survey telescopes in longitude and latitude as long as there is sufficient sky coverage from a telescope or network of telescopes which may be geographically close. Conversely, a space based survey, especially from a satellite orbit much interior to Earth, offers a tremendous advantage over their terrestrial planted brethren. For instance, a perfect survey based at Mercury with limiting magnitude V=18 would discover 90% of the NEOs with H<18 in less than 4 years. 2

  5. Standardization and performance evaluation of "modified" and "ultrasensitive" versions of the Abbott RealTime HIV-1 assay, adapted to quantify minimal residual viremia.

    PubMed

    Amendola, Alessandra; Bloisi, Maria; Marsella, Patrizia; Sabatini, Rosella; Bibbò, Angela; Angeletti, Claudio; Capobianchi, Maria Rosaria

    2011-09-01

    Numerous studies investigating clinical significance of HIV-1 minimal residual viremia (MRV) suggest potential utility of assays more sensitive than those routinely used to monitor viral suppression. However currently available methods, based on different technologies, show great variation in detection limit and input plasma volume, and generally suffer from lack of standardization. In order to establish new tools suitable for routine quantification of minimal residual viremia in patients under virological suppression, some modifications were introduced into standard procedure of the Abbott RealTime HIV-1 assay leading to a "modified" and an "ultrasensitive" protocols. The following modifications were introduced: calibration curve extended towards low HIV-1 RNA concentration; 4 fold increased sample volume by concentrating starting material; reduced volume of internal control; adoption of "open-mode" software for quantification. Analytical performances were evaluated using the HIV-1 RNA Working Reagent 1 for NAT assays (NIBSC). Both tests were applied to clinical samples from virologically suppressed patients. The "modified" and the "ultrasensitive" configurations of the assay reached a limit of detection of 18.8 (95% CI: 11.1-51.0 cp/mL) and 4.8 cp/mL (95% CI: 2.6-9.1 cp/mL), respectively, with high precision and accuracy. In clinical samples from virologically suppressed patients, "modified" and "ultrasensitive" protocols allowed to detect and quantify HIV RNA in 12.7% and 46.6%, respectively, of samples resulted "not-detectable", and in 70.0% and 69.5%, respectively, of samples "detected <40 cp/mL" in the standard assay. The "modified" and "ultrasensitive" assays are precise and accurate, and easily adoptable in routine diagnostic laboratories for measuring MRV. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Detection of E. coli O157:H7 from ground beef using Fourier transform infrared (FT-IR) spectroscopy and chemometrics.

    PubMed

    Davis, Reeta; Irudayaraj, Joseph; Reuhs, Bradley L; Mauer, Lisa J

    2010-08-01

    FT-IR spectroscopy methods for detection, differentiation, and quantification of E. coli O157:H7 strains separated from ground beef were developed. Filtration and immunomagnetic separation (IMS) were used to extract live and dead E. coli O157:H7 cells from contaminated ground beef prior to spectral acquisition. Spectra were analyzed using chemometric techniques in OPUS, TQ Analyst, and WinDAS software programs. Standard plate counts were used for development and validation of spectral analyses. The detection limit based on a selectivity value using the OPUS ident test was 10(5) CFU/g for both Filtration-FT-IR and IMS-FT-IR methods. Experiments using ground beef inoculated with fewer cells (10(1) to 10(2) CFU/g) reached the detection limit at 6 h incubation. Partial least squares (PLS) models with cross validation were used to establish relationships between plate counts and FT-IR spectra. Better PLS predictions were obtained for quantifying live E. coli O157:H7 strains (R(2)> or = 0.9955, RMSEE < or = 0.17, RPD > or = 14) and different ratios of live and dead E. coli O157:H7 cells (R(2)= 0.9945, RMSEE = 2.75, RPD = 13.43) from ground beef using Filtration-FT-IR than IMS-FT-IR methods. Discriminant analysis and canonical variate analysis (CVA) of the spectra differentiated various strains of E. coli O157:H7 from an apathogenic control strain. CVA also separated spectra of 100% dead cells separated from ground beef from spectra of 0.5% live cells in the presence of 99.5% dead cells of E. coli O157:H7. These combined separation and FT-IR methods could be useful for rapid detection and differentiation of pathogens in complex foods.

  7. Case history of the Seven Rivers Sand Waterflood, Crockett County, Texas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riley, E.A.; Bates, T.P.

    1965-04-22

    The Noelke Field is located approximately 6 1/2 miles SE of Iraan in Crockett County, Texas. The field covers some 2760 proven productive acres with an estimated 1300 acres being oil-productive and the remainder being high enough structurally to carry gas saturation. This report covers only the southern segment. The Noelke field produces from the Seven Rivers sand of the Permian System. The sand is found at depths ranging from 1006 to 1756 ft from the surface. Illustrations show field location, gas cap and oil segments, structure of the southern segment, isopachs, production history of the southern segment, and themore » injection pattern. Initial water injection was realized on Nov. 17, 1957, with all wells taking water readily at zero pressure. Initial flood response was detected in the first well in July 1958, or 8 months after initial injection. The response was positive and significant, reaching 75 bbl oil per day and no water in a month. Production rapidly increased during all of 1959 and reached a peak rate of 2580 bbl in Jan. 1960. Production declined mildly thereafter, and reached a level of 401 bbl during Dec. 1962, then gradually declined thereafter through 1964 to the economic limit. This shallow waterflood project proved highly successful.« less

  8. Semiautomatic Segmentation of Glioma on Mobile Devices.

    PubMed

    Wu, Ya-Ping; Lin, Yu-Song; Wu, Wei-Guo; Yang, Cong; Gu, Jian-Qin; Bai, Yan; Wang, Mei-Yun

    2017-01-01

    Brain tumor segmentation is the first and the most critical step in clinical applications of radiomics. However, segmenting brain images by radiologists is labor intense and prone to inter- and intraobserver variability. Stable and reproducible brain image segmentation algorithms are thus important for successful tumor detection in radiomics. In this paper, we propose a supervised brain image segmentation method, especially for magnetic resonance (MR) brain images with glioma. This paper uses hard edge multiplicative intrinsic component optimization to preprocess glioma medical image on the server side, and then, the doctors could supervise the segmentation process on mobile devices in their convenient time. Since the preprocessed images have the same brightness for the same tissue voxels, they have small data size (typically 1/10 of the original image size) and simple structure of 4 types of intensity value. This observation thus allows follow-up steps to be processed on mobile devices with low bandwidth and limited computing performance. Experiments conducted on 1935 brain slices from 129 patients show that more than 30% of the sample can reach 90% similarity; over 60% of the samples can reach 85% similarity, and more than 80% of the sample could reach 75% similarity. The comparisons with other segmentation methods also demonstrate both efficiency and stability of the proposed approach.

  9. Ion mobility spectrometry for food quality and safety.

    PubMed

    Vautz, W; Zimmermann, D; Hartmann, M; Baumbach, J I; Nolte, J; Jung, J

    2006-11-01

    Ion mobility spectrometry is known to be a fast and sensitive technique for the detection of trace substances, and it is increasingly in demand not only for protection against explosives and chemical warfare agents, but also for new applications in medical diagnosis or process control. Generally, a gas phase sample is ionized by help of ultraviolet light, ss-radiation or partial discharges. The ions move in a weak electrical field towards a detector. During their drift they collide with a drift gas flowing in the opposite direction and, therefore, are slowed down depending on their size, shape and charge. As a result, different ions reach the detector at different drift times, which are characteristic for the ions considered. The number of ions reaching the detector are a measure of the concentration of the analyte. The method enables the identification and quantification of analytes with high sensitivity (ng l(-1) range). The selectivity can even be increased - as necessary for the analyses of complex mixtures - using pre-separation techniques such as gas chromatography or multi-capillary columns. No pre-concentration of the sample is necessary. Those characteristics of the method are preserved even in air with up to a 100% relative humidity rate. The suitability of the method for application in the field of food quality and safety - including storage, process and quality control as well as the characterization of food stuffs - was investigated in recent years for a number of representative examples, which are summarized in the following, including new studies as well: (1) the detection of metabolites from bacteria for the identification and control of their growth; (2) process control in food production - beer fermentation being an example; (3) the detection of the metabolites of mould for process control during cheese production, for quality control of raw materials or for the control of storage conditions; (4) the quality control of packaging materials during the production of polymeric materials; and (5) the characterization of products - wine being an example. The challenges of such applications were operation in humid air, fast on-line analyses of complex mixtures, high sensitivity - detection limits have to be, for example, in the range of the odour limits - and, in some cases, the necessity of mobile instrumentation. It can be shown that ion mobility spectrometry is optimally capable of fulfilling those challenges for many applications.

  10. Robust high-contrast companion detection from interferometric observations. The CANDID algorithm and an application to six binary Cepheids

    NASA Astrophysics Data System (ADS)

    Gallenne, A.; Mérand, A.; Kervella, P.; Monnier, J. D.; Schaefer, G. H.; Baron, F.; Breitfelder, J.; Le Bouquin, J. B.; Roettenbacher, R. M.; Gieren, W.; Pietrzyński, G.; McAlister, H.; ten Brummelaar, T.; Sturmann, J.; Sturmann, L.; Turner, N.; Ridgway, S.; Kraus, S.

    2015-07-01

    Context. Long-baseline interferometry is an important technique to spatially resolve binary or multiple systems in close orbits. By combining several telescopes together and spectrally dispersing the light, it is possible to detect faint components around bright stars in a few hours of observations. Aims: We provide a rigorous and detailed method to search for high-contrast companions around stars, determine the detection level, and estimate the dynamic range from interferometric observations. Methods: We developed the code CANDID (Companion Analysis and Non-Detection in Interferometric Data), a set of Python tools that allows us to search systematically for point-source, high-contrast companions and estimate the detection limit using all interferometric observables, i.e., the squared visibilities, closure phases and bispectrum amplitudes. The search procedure is made on a N × N grid of fit, whose minimum needed resolution is estimated a posteriori. It includes a tool to estimate the detection level of the companion in the number of sigmas. The code CANDID also incorporates a robust method to set a 3σ detection limit on the flux ratio, which is based on an analytical injection of a fake companion at each point in the grid. Our injection method also allows us to analytically remove a detected component to 1) search for a second companion; and 2) set an unbiased detection limit. Results: We used CANDID to search for the companions around the binary Cepheids V1334 Cyg, AX Cir, RT Aur, AW Per, SU Cas, and T Vul. First, we showed that our previous discoveries of the components orbiting V1334 Cyg and AX Cir were detected at >25σ and >13σ, respectively. The astrometric positions and flux ratios provided by CANDID for these two stars are in good agreement with our previously published values. The companion around AW Per is detected at more than 15σ with a flux ratio of f = 1.22 ± 0.30%, and it is located at ρ = 32.16 ± 0.29 mas and PA = 67.1 ± 0.3°. We made a possible detection of the companion orbiting RT Aur with f = 0.22 ± 0.11%, and at ρ = 2.10 ± 0.23 mas and PA = -136 ± 6°. It was detected at 3.8σ using the closure phases only, and so more observations are needed to confirm the dectection. No companions were detected around SU Cas and T Vul. We also set the detection limit for possible undetected companions around these stars. We found that there is no companion with a spectral type earlier than B7V, A5V, F0V, B9V, A0V, and B9V orbiting the Cepheids V1334 Cyg, AX Cir, RT Aur, AW Per, SU Cas, and T Vul, respectively. This work also demonstrates the capabilities of the MIRC and PIONIER instruments, which can reach a dynamic range of 1:200, depending on the angular distance of the companion and the (u,v) plane coverage. In the future, we plan to work on improving the sensitivity limits for realistic data through better handling of the correlations. The current version of the code is available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/579/A68

  11. Silver nanoplate-decorated copper wire for the on-site microextraction and detection of perchlorate using a portable Raman spectrometer.

    PubMed

    Zhu, Sha; Zhang, Xiaoli; Cui, Jingcheng; Shi, Yu-E; Jiang, Xiaohong; Liu, Zhen; Zhan, Jinhua

    2015-04-21

    Perchlorate, which causes health concerns because of its effects on the thyroid function, is highly soluble and mobile in the environment. In this study, diethyldithiocarbamate (DDTC)-modified silver nanoplates were fabricated on a copper wire to perform the on-site microextraction and detection of perchlorate. This fiber could be inserted into water or soil to extract perchlorate through electrostatic interaction and then can be detected by a portable Raman spectrometer, owing to its surface-enhanced Raman (SERS) activity. A relatively stable vibrational mode (δ(HCH)(CH3), (CH2)) of DDTC at 1273 cm(-1) was used as an internal standard, which was negligibly influenced by the absorption of ClO4(-). The DDTC-modified Ag/Cu fiber showed high uniformity, good reusability and temporal stability under continuous laser radiation each with an RSD lower than 10%. The qualitative and quantitative detection of perchlorate were also realized. A log-log plot of the normalized SERS intensity against perchlorate concentration showed a good linear relationship. The fiber could be also directly inserted into the perchlorate-polluted soil, and the perchlorate could thereby be detected on site. The detection limit in soil reached 0.081 ppm, which was much lower than the EPA-published safety standard. The recovery of the detection was 105% and comparable with the ion chromatography. This hyphenated method of microextraction with direct SERS detection may find potential application for direct pollutant detection free from complex sample pretreatment.

  12. Time-varying land subsidence detected by radar altimetry: California, Taiwan and north China

    NASA Astrophysics Data System (ADS)

    Hwang, Cheinway; Yang, Yuande; Kao, Ricky; Han, Jiancheng; Shum, C. K.; Galloway, Devin L.; Sneed, Michelle; Hung, Wei-Chia; Cheng, Yung-Sheng; Li, Fei

    2016-06-01

    Contemporary applications of radar altimetry include sea-level rise, ocean circulation, marine gravity, and icesheet elevation change. Unlike InSAR and GNSS, which are widely used to map surface deformation, altimetry is neither reliant on highly temporally-correlated ground features nor as limited by the available spatial coverage, and can provide long-term temporal subsidence monitoring capability. Here we use multi-mission radar altimetry with an approximately 23 year data-span to quantify land subsidence in cropland areas. Subsidence rates from TOPEX/POSEIDON, JASON-1, ENVISAT, and JASON-2 during 1992-2015 show time-varying trends with respect to displacement over time in California’s San Joaquin Valley and central Taiwan, possibly related to changes in land use, climatic conditions (drought) and regulatory measures affecting groundwater use. Near Hanford, California, subsidence rates reach 18 cm yr-1 with a cumulative subsidence of 206 cm, which potentially could adversely affect operations of the planned California High-Speed Rail. The maximum subsidence rate in central Taiwan is 8 cm yr-1. Radar altimetry also reveals time-varying subsidence in the North China Plain consistent with the declines of groundwater storage and existing water infrastructure detected by the Gravity Recovery And Climate Experiment (GRACE) satellites, with rates reaching 20 cm yr-1 and cumulative subsidence as much as 155 cm.

  13. Time-varying land subsidence detected by radar altimetry: California, Taiwan and north China

    PubMed Central

    Hwang, Cheinway; Yang, Yuande; Kao, Ricky; Han, Jiancheng; Shum, C. K.; Galloway, Devin L.; Sneed, Michelle; Hung, Wei-Chia; Cheng, Yung-Sheng; Li, Fei

    2016-01-01

    Contemporary applications of radar altimetry include sea-level rise, ocean circulation, marine gravity, and icesheet elevation change. Unlike InSAR and GNSS, which are widely used to map surface deformation, altimetry is neither reliant on highly temporally-correlated ground features nor as limited by the available spatial coverage, and can provide long-term temporal subsidence monitoring capability. Here we use multi-mission radar altimetry with an approximately 23 year data-span to quantify land subsidence in cropland areas. Subsidence rates from TOPEX/POSEIDON, JASON-1, ENVISAT, and JASON-2 during 1992–2015 show time-varying trends with respect to displacement over time in California’s San Joaquin Valley and central Taiwan, possibly related to changes in land use, climatic conditions (drought) and regulatory measures affecting groundwater use. Near Hanford, California, subsidence rates reach 18 cm yr−1 with a cumulative subsidence of 206 cm, which potentially could adversely affect operations of the planned California High-Speed Rail. The maximum subsidence rate in central Taiwan is 8 cm yr−1. Radar altimetry also reveals time-varying subsidence in the North China Plain consistent with the declines of groundwater storage and existing water infrastructure detected by the Gravity Recovery And Climate Experiment (GRACE) satellites, with rates reaching 20 cm yr−1 and cumulative subsidence as much as 155 cm. PMID:27324935

  14. Review of CMOS Integrated Circuit Technologies for High-Speed Photo-Detection

    PubMed Central

    Jeong, Gyu-Seob

    2017-01-01

    The bandwidth requirement of wireline communications has increased exponentially because of the ever-increasing demand for data centers and high-performance computing systems. However, it becomes difficult to satisfy the requirement with legacy electrical links which suffer from frequency-dependent losses due to skin effects, dielectric losses, channel reflections, and crosstalk, resulting in a severe bandwidth limitation. In order to overcome this challenge, it is necessary to introduce optical communication technology, which has been mainly used for long-reach communications, such as long-haul networks and metropolitan area networks, to the medium- and short-reach communication systems. However, there still remain important issues to be resolved to facilitate the adoption of the optical technologies. The most critical challenges are the energy efficiency and the cost competitiveness as compared to the legacy copper-based electrical communications. One possible solution is silicon photonics which has long been investigated by a number of research groups. Despite inherent incompatibility of silicon with the photonic world, silicon photonics is promising and is the only solution that can leverage the mature complementary metal-oxide-semiconductor (CMOS) technologies. Silicon photonics can be utilized in not only wireline communications but also countless sensor applications. This paper introduces a brief review of silicon photonics first and subsequently describes the history, overview, and categorization of the CMOS IC technology for high-speed photo-detection without enumerating the complex circuital expressions and terminologies. PMID:28841154

  15. Study on room temperature gas-sensing performance of CuO film-decorated ordered porous ZnO composite by In2O3 sensitization

    PubMed Central

    Li, Tian-tian; Bao, Na; Geng, Ai-fang; Yang, Ying; Dong, Xiang-ting

    2018-01-01

    For the first time, ordered mesoporous ZnO nanoparticles have been synthesized by a template method. The electroplating after chemical plating method was creatively used to form copper film on the surface of the prepared ZnO, and then a CuO film-decorated ordered porous ZnO composite (CuO/ZnO) was obtained by a high-temperature oxidation method. In2O3 was loaded into the prepared CuO film–ZnO by an ultrasonic-assisted method to sensitize the room temperature gas-sensing performance of the prepared CuO/ZnO materials. The doped In2O3 could effectively improve the gas-sensing properties of the prepared materials to nitrogen oxides (NOx) at room temperature. The 1% In2O3 doped CuO/ZnO sample (1 wt% In2O3–CuO/ZnO) showed the best gas-sensing properties whose response to 100 ppm NOx reached 82%, and the detectable minimum concentration reached 1 ppm at room temperature. The prepared materials had a good selectivity, better response, very low detection limit, and high sensitivity to NOx gas at room temperature, which would have a great development space in the gas sensor field and a great research value. PMID:29515887

  16. Time-varying land subsidence detected by radar altimetry: California, Taiwan and north China.

    PubMed

    Hwang, Cheinway; Yang, Yuande; Kao, Ricky; Han, Jiancheng; Shum, C K; Galloway, Devin L; Sneed, Michelle; Hung, Wei-Chia; Cheng, Yung-Sheng; Li, Fei

    2016-06-21

    Contemporary applications of radar altimetry include sea-level rise, ocean circulation, marine gravity, and icesheet elevation change. Unlike InSAR and GNSS, which are widely used to map surface deformation, altimetry is neither reliant on highly temporally-correlated ground features nor as limited by the available spatial coverage, and can provide long-term temporal subsidence monitoring capability. Here we use multi-mission radar altimetry with an approximately 23 year data-span to quantify land subsidence in cropland areas. Subsidence rates from TOPEX/POSEIDON, JASON-1, ENVISAT, and JASON-2 during 1992-2015 show time-varying trends with respect to displacement over time in California's San Joaquin Valley and central Taiwan, possibly related to changes in land use, climatic conditions (drought) and regulatory measures affecting groundwater use. Near Hanford, California, subsidence rates reach 18 cm yr(-1) with a cumulative subsidence of 206 cm, which potentially could adversely affect operations of the planned California High-Speed Rail. The maximum subsidence rate in central Taiwan is 8 cm yr(-1). Radar altimetry also reveals time-varying subsidence in the North China Plain consistent with the declines of groundwater storage and existing water infrastructure detected by the Gravity Recovery And Climate Experiment (GRACE) satellites, with rates reaching 20 cm yr(-1) and cumulative subsidence as much as 155 cm.

  17. Review of CMOS Integrated Circuit Technologies for High-Speed Photo-Detection.

    PubMed

    Jeong, Gyu-Seob; Bae, Woorham; Jeong, Deog-Kyoon

    2017-08-25

    The bandwidth requirement of wireline communications has increased exponentially because of the ever-increasing demand for data centers and high-performance computing systems. However, it becomes difficult to satisfy the requirement with legacy electrical links which suffer from frequency-dependent losses due to skin effects, dielectric losses, channel reflections, and crosstalk, resulting in a severe bandwidth limitation. In order to overcome this challenge, it is necessary to introduce optical communication technology, which has been mainly used for long-reach communications, such as long-haul networks and metropolitan area networks, to the medium- and short-reach communication systems. However, there still remain important issues to be resolved to facilitate the adoption of the optical technologies. The most critical challenges are the energy efficiency and the cost competitiveness as compared to the legacy copper-based electrical communications. One possible solution is silicon photonics which has long been investigated by a number of research groups. Despite inherent incompatibility of silicon with the photonic world, silicon photonics is promising and is the only solution that can leverage the mature complementary metal-oxide-semiconductor (CMOS) technologies. Silicon photonics can be utilized in not only wireline communications but also countless sensor applications. This paper introduces a brief review of silicon photonics first and subsequently describes the history, overview, and categorization of the CMOS IC technology for high-speed photo-detection without enumerating the complex circuital expressions and terminologies.

  18. Time-varying land subsidence detected by radar altimetry: California, Taiwan and north China

    USGS Publications Warehouse

    Hwang, Cheinway; Yang, Yuande; Kao, Ricky; Han, Jiancheng; Shum, C.K.; Galloway, Devin L.; Sneed, Michelle; Hung, Wei-Chia; Cheng, Yung-Sheng; Li, Fei

    2016-01-01

    Contemporary applications of radar altimetry include sea-level rise, ocean circulation, marine gravity, and ice sheet elevation change. Unlike InSAR and GNSS, which are widely used to map surface deformation, altimetry is neither reliant on highly temporally-correlated ground features nor as limited by the available spatial coverage, and can provide long-term temporal subsidence monitoring capability. Here we use multi-mission radar altimetry with an approximately 23 year data-span to quantify land subsidence in cropland areas. Subsidence rates from TOPEX/POSEIDON, JASON-1, ENVISAT, and JASON-2 during 1992–2015 show time-varying trends with respect to displacement over time in California’s San Joaquin Valley and central Taiwan, possibly related to changes in land use, climatic conditions (drought) and regulatory measures affecting groundwater use. Near Hanford, California, subsidence rates reach 18 cm/yr with a cumulative subsidence of 206 cm, which potentially could adversely affect operations of the planned California High-Speed Rail. The maximum subsidence rate in central Taiwan is 8 cm/yr. Radar altimetry also reveals time-varying subsidence in the North China Plain consistent with the declines of groundwater storage and existing water infrastructure detected by the Gravity Recovery And Climate Experiment (GRACE) satellites, with rates reaching 20 cm/yr and cumulative subsidence as much as 155 cm.

  19. A Portable, Shock-Proof, Surface-Heated Droplet PCR System for Escherichia coli Detection

    PubMed Central

    Angus, Scott V.; Cho, Soohee; Harshman, Dustin K.; Song, Jae-Young; Yoon, Jeong-Yeol

    2015-01-01

    A novel polymerase chain reaction (PCR) device was developed that uses wire-guided droplet manipulation (WDM) to guide a droplet over three different heating chambers. After PCR amplification, end-point detection is achieved using a smartphone-based fluorescence microscope. The device was tested for identification of the 16S rRNA gene V3 hypervariable region from Escherichia coli genomic DNA. The lower limit of detection was 103 genome copies per sample. The device is portable with smartphone-based end-point detection and provides the assay results quickly (15 min for a 30-cycle amplification) and accurately. The system is also shock and vibration resistant, due to the multiple points of contact between the droplet and the thermocouple and the Teflon film on the heater surfaces. The thermocouple also provides realtime droplet temperature feedback to ensure it reaches the set temperature before moving to the next chamber/step in PCR. The device is equipped to use either silicone oil or coconut oil. Coconut oil provides additional portability and ease of transportation by eliminating spilling because its high melting temperature means it is solid at room temperature. PMID:26164008

  20. A novel and simple fluorescence probe for detecting main group magnesium ion in HeLa cells and Arabidopsis.

    PubMed

    Yu, Tingting; Sun, Ping; Hu, Yijie; Ji, Yinggang; Zhou, Hongping; Zhang, Baowei; Tian, Yupeng; Wu, Jieying

    2016-12-15

    A simple-molecule fluorescence probe L has been designed, synthesized and characterized, which shows high selectivity and sensitivity for the main group magnesium ion through fluorescence "turn-on" response in ethanol solution, and no interference from calcium ion in particular. Detection limit of probe L is 1.47×10(-6) M and the rapid response could reach about 15-20s. The recognition mechanism has been established by fluorescence spectra, (1)H NMR study. Moreover, probe L presents a great photostability, low toxicity and cellular permeability, then we have carried out fluorescent bio-imaging of the probe L for magnesium ions in HeLa cells, which showed that probe L could be utilized to detect the intracellular magnesium ion. Furthermore, it is successfully used as a magnesium ion developer in plant tissues, which shows that it not only can be well tracking the transport of magnesium ion but also make a corresponding fluorescence response to different concentrations magnesium ion. These results would make this probe a great potential application for detecting Mg(2+) in biological system. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Fluorescent CdSe QDs containing Bacillus licheniformis bioprobes for Copper (II) detection in water.

    PubMed

    Yan, Zheng-Yu; Du, Qing-Qing; Wan, Dong-Yu; Lv, Hang; Cao, Zhi-Ran; Wu, Sheng-Mei

    2017-12-01

    Quantum dots (QDs) are semiconductor nanoparticles (NPs) that offer valuable functionality for cellular labeling, drug delivery, solar cells and quantum computation. In this study, we reported that CdSe QDs could be bio-synthesized in Bacillus licheniformis. After optimization, the obtained CdSe QDs exhibited a uniform particle size of 3.71±0.04nm with a maximum fluorescence emission wavelength at 550nm and the synthetical positive ratio can reach up to 87%. Spectral properties, constitution, particle sizes and crystalline phases of the CdSe QDs were systematically and integrally investigated. The CdSe QD-containing Bacillus licheniformis cells were further used as whole fluorescent bio-probes to detect copper (II) (Cu 2+ ) in water, which demonstrated a low limit of detection (0.91μM). The assay also showed a good selectivity for Cu 2+ over other ions including Al 3+ , Cd 2+ , Mg 2+ , K + , Na + , NH 4 + , Zn 2+ , CH 3 COO + , Pb 2+ and I - . Our study suggests the fluorescent CdSe QDs-containing Bacillus licheniformis bio-probes as a promising approach for detection of Cu 2+ in complex solution environment. Copyright © 2017. Published by Elsevier Inc.

  2. Dispersion compensation of fiber optic communication system with direct detection using artificial neural networks (ANNs)

    NASA Astrophysics Data System (ADS)

    Maghrabi, Mahmoud M. T.; Kumar, Shiva; Bakr, Mohamed H.

    2018-02-01

    This work introduces a powerful digital nonlinear feed-forward equalizer (NFFE), exploiting multilayer artificial neural network (ANN). It mitigates impairments of optical communication systems arising due to the nonlinearity introduced by direct photo-detection. In a direct detection system, the detection process is nonlinear due to the fact that the photo-current is proportional to the absolute square of the electric field intensity. The proposed equalizer provides the most efficient computational cost with high equalization performance. Its performance is comparable to the benchmark compensation performance achieved by maximum-likelihood sequence estimator. The equalizer trains an ANN to act as a nonlinear filter whose impulse response removes the intersymbol interference (ISI) distortions of the optical channel. Owing to the proposed extensive training of the equalizer, it achieves the ultimate performance limit of any feed-forward equalizer (FFE). The performance and efficiency of the equalizer is investigated by applying it to various practical short-reach fiber optic communication system scenarios. These scenarios are extracted from practical metro/media access networks and data center applications. The obtained results show that the ANN-NFFE compensates for the received BER degradation and significantly increases the tolerance to the chromatic dispersion distortion.

  3. Antenna Effect on the Organic Spacer-Modified Eu-Doped Layered Gadolinium Hydroxide for the Detection of Vanadate Ions over a Wide pH Range.

    PubMed

    Jeong, Heejin; Lee, Byung-Il; Byeon, Song-Ho

    2016-05-04

    The excitation of the adsorbed vanadate group led to the red emission arising from the efficient energy transfer to Eu-doped layered gadolinium hydroxide (LGdH:Eu). This light-harvesting antenna effect allowed LGdH:Eu to detect selectively a vanadate in aqueous solution at different pHs. Because vanadate exists in various forms by extensive oligomerization and protonation reactions in aqueous solution depending on pH, it is important to detect a vanadate regardless of its form over a wide pH range. In particular, spacer molecules with long alkyl chains greatly facilitated access of a vanadate antenna into the interlayer surface of LGdH:Eu. The concomitant increase in adsorption capacity of LGdH:Eu achieved a strong antenna effect of vanadate on the red emission from Eu(3+). When a suspension containing LGdH:Eu nanosheets (1.0 g/L) was used, the vanadate concentration down to 1 × 10(-5) M could even be visually monitored, and the detection limit based on the (5)D0 → (7)F2 emission intensity could reach 4.5 × 10(-8) M.

  4. WATER MASERS IN THE ANDROMEDA GALAXY. I. A SURVEY FOR WATER MASERS, AMMONIA, AND HYDROGEN RECOMBINATION LINES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Darling, Jeremy; Gerard, Benjamin; Amiri, Nikta

    We report the results of a Green Bank Telescope survey for water masers, ammonia (1, 1) and (2, 2), and the H66 α recombination line toward 506 luminous compact 24 μ m emitting regions in the Andromeda Galaxy (M31). We include the 206 sources observed in the Darling water maser survey for completeness. The survey was sensitive enough to detect any maser useful for ∼10 μ as yr{sup 1} astrometry. No new water masers, ammonia lines, or H66 α recombination lines were detected individually or in spectral stacks reaching rms noise levels of ∼3 mJy and ∼0.2 mJy, respectively, inmore » 3.1–3.3 km s{sup 1} channels. The lack of detections in individual spectra and in the spectral stacks is consistent with Galactic extrapolations. Contrary to previous assertions, there do not seem to be any additional bright water masers to be found in M31. The strong variability of water masers may enable new maser detections in the future, but variability may also limit the astrometric utility of known (or future) masers because flaring masers must also fade.« less

  5. Synthesis of molecularly imprinted dye-silica nanocomposites with high selectivity and sensitivity: Fluorescent imprinted sensor for rapid and efficient detection of τ-fluvalinate in vodka.

    PubMed

    Wang, Yunyun; Wang, Jixiang; Cheng, Rujia; Sun, Lin; Dai, Xiaohui; Yan, Yongsheng

    2018-04-01

    An imprinted fluorescent sensor was fabricated based on SiO 2 nanoparticles encapsulated with a molecularly imprinted polymer containing allyl fluorescein. High fluorine cypermethirin as template molecules, methyl methacrylate as functional monomer, and allyl fluorescein as optical materials synthesized a core-shell fluorescent molecular imprinted sensor, which showed a high and rapid sensitivity and selectivity for the detection of τ-fluvalinate. The sensor presented appreciable sensitivity with a limit of 13.251 nM, rapid detection that reached to equilibrium within 3 min, great linear relationship in the relevant concentration range from 0 to 150 nM, and excellent selectivity over structural analogues. In addition, the fluorescent sensor demonstrated desirable regeneration ability (eight cycling operations). The molecularly imprinted polymers ensured specificity, while the fluorescent dyes provided the stabile sensitivity. Finally, an effective application of the sensor was implemented by the detection of τ-fluvalinate in real samples from vodka. The molecularly imprinted fluorescent sensor showed a promising potential in environmental monitoring and food safety. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Reagentless, Structure-Switching, Electrochemical Aptamer-Based Sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Macazo, Florika C.; Gutierrez, Brenda; Lottermoser, Justine; Liu, Juan; White, Ryan J.

    2016-06-01

    The development of structure-switching, electrochemical, aptamer-based sensors over the past ˜10 years has led to a variety of reagentless sensors capable of analytical detection in a range of sample matrices. The crux of this methodology is the coupling of target-induced conformation changes of a redox-labeled aptamer with electrochemical detection of the resulting altered charge transfer rate between the redox molecule and electrode surface. Using aptamer recognition expands the highly sensitive detection ability of electrochemistry to a range of previously inaccessible analytes. In this review, we focus on the methods of sensor fabrication and how sensor signaling is affected by fabrication parameters. We then discuss recent studies addressing the fundamentals of sensor signaling as well as quantitative characterization of the analytical performance of electrochemical aptamer-based sensors. Although the limits of detection of reported electrochemical aptamer-based sensors do not often reach that of gold-standard methods such as enzyme-linked immunosorbent assays, the operational convenience of the sensor platform enables exciting analytical applications that we address. Using illustrative examples, we highlight recent advances in the field that impact important areas of analytical chemistry. Finally, we discuss the challenges and prospects for this class of sensors.

  7. Chemical Sensors Based on IR Spectroscopy and Surface-Modified Waveguides

    NASA Technical Reports Server (NTRS)

    Lopez, Gabriel P.; Niemczyk, Thomas

    1999-01-01

    Sol-gel processing techniques have been used to apply thin porous films to the surfaces of planar infrared (IR) waveguides to produce widely useful chemical sensors. The thin- film coating serves to diminish the concentration of water and increase the concentration of the analyte in the region probed by the evanescent IR wave. These porous films are composed of silica, and therefore, conventional silica surface modification techniques can be used to give the surface a specific functional character. The sol-gel film was surface-modified to make the film highly hydrophobic. These sensors were shown to be capable of detecting non-polar organic analytes, such as benzonitrile, in aqueous solution with detection limits in the ppb range. Further, these porous sol-gel structures allow the analytes to diffuse into and out of the films rapidly, thus reaching equilibrium in less than ten seconds. These sensors are unique because of the fact that their operation is based on the measurement of an IR absorption spectrum. Thus, these sensors are able to identify the analytes as well as measure concentration with high sensitivity. These developments have been documented in previous reports and publications. Recently, we have also targeted detection of the polar organic molecules acetone and isopropanol in aqueous solution. Polar organics are widely used in industrial and chemical processes, hence it is of interest to monitor their presence in effluents or decontamination process flows. Although large improvements in detection limits were expected with non-polar organic molecules in aqueous solutions using very hydrophobic porous sol-gel films on silicon attenuated total reflectance (Si ATR) waveguides, it was not as clear what the detection enhancements might be for polar organic molecules. This report describes the use of modified sol-gel-coated Si ATR sensors for trace detection and quantitation of small polar organic molecules in aqueous solutions. The detection of both acetone and isopropanol molecules in aqueous solution has been previously reported for chalcogenide fiber optic sensors. The sol-gel film was produced using a mixture of ethyltriethoxysilane and tetraethoxysilane and the surface modification was carried out using trimethylchlorosilane. We have demonstrated that this film concentrates the target polar analytes from aqueous solution in the region probed by the evanescent wave to improve detection limits by as much as a factor of 450.

  8. Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets

    PubMed Central

    Hofmann, Natalie; Mwingira, Felista; Shekalaghe, Seif; Robinson, Leanne J.; Mueller, Ivo; Felger, Ingrid

    2015-01-01

    Background Planning and evaluating malaria control strategies relies on accurate definition of parasite prevalence in the population. A large proportion of asymptomatic parasite infections can only be identified by surveillance with molecular methods, yet these infections also contribute to onward transmission to mosquitoes. The sensitivity of molecular detection by PCR is limited by the abundance of the target sequence in a DNA sample; thus, detection becomes imperfect at low densities. We aimed to increase PCR diagnostic sensitivity by targeting multi-copy genomic sequences for reliable detection of low-density infections, and investigated the impact of these PCR assays on community prevalence data. Methods and Findings Two quantitative PCR (qPCR) assays were developed for ultra-sensitive detection of Plasmodium falciparum, targeting the high-copy telomere-associated repetitive element 2 (TARE-2, ∼250 copies/genome) and the var gene acidic terminal sequence (varATS, 59 copies/genome). Our assays reached a limit of detection of 0.03 to 0.15 parasites/μl blood and were 10× more sensitive than standard 18S rRNA qPCR. In a population cross-sectional study in Tanzania, 295/498 samples tested positive using ultra-sensitive assays. Light microscopy missed 169 infections (57%). 18S rRNA qPCR failed to identify 48 infections (16%), of which 40% carried gametocytes detected by pfs25 quantitative reverse-transcription PCR. To judge the suitability of the TARE-2 and varATS assays for high-throughput screens, their performance was tested on sample pools. Both ultra-sensitive assays correctly detected all pools containing one low-density P. falciparum–positive sample, which went undetected by 18S rRNA qPCR, among nine negatives. TARE-2 and varATS qPCRs improve estimates of prevalence rates, yet other infections might still remain undetected when absent in the limited blood volume sampled. Conclusions Measured malaria prevalence in communities is largely determined by the sensitivity of the diagnostic tool used. Even when applying standard molecular diagnostics, prevalence in our study population was underestimated by 8% compared to the new assays. Our findings highlight the need for highly sensitive tools such as TARE-2 and varATS qPCR in community surveillance and for monitoring interventions to better describe malaria epidemiology and inform malaria elimination efforts. PMID:25734259

  9. Stacking the Cosmic Web in fluorescent Ly α emission with MUSE

    NASA Astrophysics Data System (ADS)

    Gallego, Sofia G.; Cantalupo, Sebastiano; Lilly, Simon; Marino, Raffaella Anna; Pezzulli, Gabriele; Schaye, Joop; Wisotzki, Lutz; Bacon, Roland; Inami, Hanae; Akhlaghi, Mohammad; Tacchella, Sandro; Richard, Johan; Bouche, Nicolas F.; Steinmetz, Matthias; Carollo, Marcella

    2018-04-01

    Cosmological simulations suggest that most of the matter in the Universe is distributed along filaments connecting galaxies. Illuminated by the cosmic UV background (UVB), these structures are expected to glow in fluorescent Ly α emission with a surface brightness (SB) that is well below current limits for individual detections. Here, we perform a stacking analysis of the deepest MUSE/VLT data using three-dimensional regions (subcubes) with orientations determined by the position of neighbouring Ly α galaxies at 3 < z < 4. Our method increase the probability of detecting filamentary Ly α emission, provided that these structures are Lyman-limit systems (LLSs). By stacking 390 oriented subcubes we reach a 2σ sensitivity level of SB ≈ 0.44 × 10-20 erg s-1 cm-2 arcsec-2 in an aperture of 1 arcsec2 × 6.25 Å, three times below the expected fluorescent Ly α signal from the Haardt & Madau UVB at z ˜ 3.5. No detectable emission is found on intergalactic scales, implying that at least two thirds of our subcubes do not contain oriented LLSs. On the other hand, significant emission is detected in the circumgalactic medium (CGM) in the direction of the neighbours. The signal is stronger for galaxies with a larger number of neighbours and appears to be independent of any other galaxy properties. We estimate that preferentially oriented satellite galaxies cannot contribute significantly to this signal, suggesting instead that gas densities in the CGM are typically larger in the direction of neighbouring galaxies on cosmological scales.

  10. Doxycycline depletion and residues in eggs after oral administration to laying hens.

    PubMed

    Gajda, Anna; Posyniak, Andrzej

    2015-01-01

    The depletion of doxycycline (DC) residues in eggs was determined after oral drug administration by drinking water to laying hens. The antibiotic was supplied to birds for 5 consecutive days and the eggs were collected during medication and 18 days after withdrawal. DC residues were determined by LC-MS/MS. DC was isolated from eggs with a solution of 0.02 M of oxalic acid (pH 4), 0.1 M Na2EDTA and acetonitrile. The limit of detection (LOD) and limit of quantification (LOQ) of the method were 2 and 5 µg kg(-1), respectively. Analyses were performed on whole egg, egg white and yolk separately. DC was detectable 24 h after the beginning of administration. The concentration of antibiotic increased daily, resulting in the highest DC concentration in whole eggs at the first day of the withdrawal period. Thirteen days after withdrawal, the content of DC in whole eggs was below the LOQ of the method. However, some differences were found in the depletion curve of DC between egg white and yolk. Residues of DC in egg white were much higher during treatment and 1 day after withdrawal, but later the concentration in egg white decreased fairly rapidly and a higher DC content in egg yolk was observed. The depletion period was shorter for egg white than for yolk, and DC was detected in the egg white until 12 days after withdrawal and 2 days more in egg yolk than in white. DC reached a peak faster in egg white, but the residues were detectable for longer period in the yolk.

  11. HYDROGEN BALMER CONTINUUM IN SOLAR FLARES DETECTED BY THE INTERFACE REGION IMAGING SPECTROGRAPH (IRIS)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heinzel, P.; Kleint, L., E-mail: pheinzel@asu.cas.cz

    We present a novel observation of the white light flare (WLF) continuum, which was significantly enhanced during the X1 flare on 2014 March 29 (SOL2014-03-29T17:48). Data from the Interface Region Imaging Spectrograph (IRIS) in its near-UV channel show that at the peak of the continuum enhancement, the contrast at the quasi-continuum window above 2813 Å reached 100%-200% and can be even larger closer to Mg II lines. This is fully consistent with the hydrogen recombination Balmer-continuum emission, which follows an impulsive thermal and non-thermal ionization caused by the precipitation of electron beams through the chromosphere. However, a less probable photosphericmore » continuum enhancement cannot be excluded. The light curves of the Balmer continuum have an impulsive character with a gradual fading, similar to those detected recently in the optical region on the Solar Optical Telescope on board Hinode. This observation represents a first Balmer-continuum detection from space far beyond the Balmer limit (3646 Å), eliminating seeing effects known to complicate the WLF detection. Moreover, we use a spectral window so far unexplored for flare studies, which provides the potential to study the Balmer continuum, as well as many metallic lines appearing in emission during flares. Combined with future ground-based observations of the continuum near the Balmer limit, we will be able to disentangle various scenarios of the WLF origin. IRIS observations also provide a critical quantitative measure of the energy radiated in the Balmer continuum, which constrains various models of the energy transport and deposit during flares.« less

  12. Exploring cosmic origins with CORE: Extragalactic sources in cosmic microwave background maps

    NASA Astrophysics Data System (ADS)

    De Zotti, G.; González-Nuevo, J.; Lopez-Caniego, M.; Negrello, M.; Greenslade, J.; Hernández-Monteagudo, C.; Delabrouille, J.; Cai, Z.-Y.; Bonato, M.; Achúcarro, A.; Ade, P.; Allison, R.; Ashdown, M.; Ballardini, M.; Banday, A. J.; Banerji, R.; Bartlett, J. G.; Bartolo, N.; Basak, S.; Bersanelli, M.; Biesiada, M.; Bilicki, M.; Bonaldi, A.; Bonavera, L.; Borrill, J.; Bouchet, F.; Boulanger, F.; Brinckmann, T.; Bucher, M.; Burigana, C.; Buzzelli, A.; Calvo, M.; Carvalho, C. S.; Castellano, M. G.; Challinor, A.; Chluba, J.; Clements, D. L.; Clesse, S.; Colafrancesco, S.; Colantoni, I.; Coppolecchia, A.; Crook, M.; D'Alessandro, G.; de Bernardis, P.; de Gasperis, G.; Diego, J. M.; Di Valentino, E.; Errard, J.; Feeney, S. M.; Fernández-Cobos, R.; Ferraro, S.; Finelli, F.; Forastieri, F.; Galli, S.; Génova-Santos, R. T.; Gerbino, M.; Grandis, S.; Hagstotz, S.; Hanany, S.; Handley, W.; Hervias-Caimapo, C.; Hills, M.; Hivon, E.; Kiiveri, K.; Kisner, T.; Kitching, T.; Kunz, M.; Kurki-Suonio, H.; Lagache, G.; Lamagna, L.; Lasenby, A.; Lattanzi, M.; Le Brun, A.; Lesgourgues, J.; Lewis, A.; Liguori, M.; Lindholm, V.; Luzzi, G.; Maffei, B.; Mandolesi, N.; Martinez-Gonzalez, E.; Martins, C. J. A. P.; Masi, S.; Massardi, M.; Matarrese, S.; McCarthy, D.; Melchiorri, A.; Melin, J.-B.; Molinari, D.; Monfardini, A.; Natoli, P.; Notari, A.; Paiella, A.; Paoletti, D.; Partridge, R. B.; Patanchon, G.; Piat, M.; Pisano, G.; Polastri, L.; Polenta, G.; Pollo, A.; Poulin, V.; Quartin, M.; Remazeilles, M.; Roman, M.; Rossi, G.; Roukema, B. F.; Rubiño-Martín, J.-A.; Salvati, L.; Scott, D.; Serjeant, S.; Tartari, A.; Toffolatti, L.; Tomasi, M.; Trappe, N.; Triqueneaux, S.; Trombetti, T.; Tucci, M.; Tucker, C.; Väliviita, J.; van de Weygaert, R.; Van Tent, B.; Vennin, V.; Vielva, P.; Vittorio, N.; Young, K.; Zannoni, M.

    2018-04-01

    We discuss the potential of a next generation space-borne Cosmic Microwave Background (CMB) experiment for studies of extragalactic sources. Our analysis has particular bearing on the definition of the future space project, CORE, that has been submitted in response to ESA's call for a Medium-size mission opportunity as the successor of the Planck satellite. Even though the effective telescope size will be somewhat smaller than that of Planck, CORE will have a considerably better angular resolution at its highest frequencies, since, in contrast with Planck, it will be diffraction limited at all frequencies. The improved resolution implies a considerable decrease of the source confusion, i.e. substantially fainter detection limits. In particular, CORE will detect thousands of strongly lensed high-z galaxies distributed over the full sky. The extreme brightness of these galaxies will make it possible to study them, via follow-up observations, in extraordinary detail. Also, the CORE resolution matches the typical sizes of high-z galaxy proto-clusters much better than the Planck resolution, resulting in a much higher detection efficiency; these objects will be caught in an evolutionary phase beyond the reach of surveys in other wavebands. Furthermore, CORE will provide unique information on the evolution of the star formation in virialized groups and clusters of galaxies up to the highest possible redshifts. Finally, thanks to its very high sensitivity, CORE will detect the polarized emission of thousands of radio sources and, for the first time, of dusty galaxies, at mm and sub-mm wavelengths, respectively.

  13. Refractometric detection of liquids using tapered optical fiber and suspended core microstructured fiber: a comparison of methods.

    PubMed

    Martan, T; Nemecek, T; Komanec, M; Ahmad, R; Zvanovec, S

    2017-03-20

    Detecting explosive, flammable, or toxic industrial liquids reliably and accurately is a matter of civic responsibility that cannot be treated lightly. Tapered optical fibers (TOFs) and suspended core microstructured optical fibers (SC MOFs) were separately used as sensors of liquids without being compared to each other. We present a highly sensitive time-stable TOF sensor incorporated in the pipeline system for the in-line regime of measurement. This paper is furthermore focused on the comparison of this TOF and SC MOF of similar parameters for the detection of selected liquids. A validated method that incorporates TOF and SC MOF of small core (waist) diameter for refractometric detection is presented. The principle of detection is based on the overlap of an enhanced evanescent wave with a liquid analyte that either fills the cladding holes of the SC MOF or surrounds the waist area of the TOF. Optical power within the evanescent wave for both sensing structures and selected liquid analytes is analyzed. Measurement results concerning TOF and SC MOF are compared. Calculations to ascertain the limit of detection (LOD) for each sensor and the sensitivity (S) to refractive indices of liquid analytes in the range of 1.4269 to 1.4361 were performed at a wavelength of 1550 nm with the lowest refractive index step of 0.0007. Results affirming that S=600.96  dB/RIU and LOD=0.0733  RIU for the SC MOF and S=1143.2  dB/RIU and LOD of 0.0026 RIU for the TOF sensor were achieved, clearly illustrating that TOF-based sensors can reach close to two times greater sensitivity and 30 times higher limit of detection. This paper extends the comparison of the fiber sensors by discussing the potential applications.

  14. DEEP NEAR-IR OBSERVATIONS OF THE GLOBULAR CLUSTER M4: HUNTING FOR BROWN DWARFS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dieball, A.; Bedin, L. R.; Knigge, C.

    2016-01-20

    We present an analysis of deep Hubble Space Telescope (HST)/Wide Field Camera 3 near-IR (NIR) imaging data of the globular cluster (GC) M4. The best-photometry NIR color–magnitude diagram (CMD) clearly shows the main sequence extending toward the expected end of the hydrogen-burning limit and going beyond this point toward fainter sources. The white dwarf (WD) sequence can be identified. As such, this is the deepest NIR CMD of a GC to date. Archival HST optical data were used for proper-motion cleaning of the CMD and for distinguishing the WDs from brown dwarf (BD) candidates. Detection limits in the NIR aremore » around F110W ≈ 26.5 mag and F160W ≈ 27 mag, and in the optical around F775W ≈ 28 mag. Comparing our observed CMDs with theoretical models, we conclude that we have reached beyond the H-burning limit in our NIR CMD and are probably just above or around this limit in our optical–NIR CMDs. Thus, any faint NIR sources that have no optical counterpart are potential BD candidates, since the optical data are not deep enough to detect them. We visually inspected the positions of NIR sources that are fainter than the H-burning limit in F110W and for which the optical photometry did not return a counterpart. We found in total five sources for which we did not get an optical measurement. For four of these five sources, a faint optical counterpart could be visually identified, and an upper optical magnitude was estimated. Based on these upper optical magnitude limits, we conclude that one source is likely a WD, one source could be either a WD or BD candidate, and the remaining two sources agree with being BD candidates. No optical counterpart could be detected for just one source, which makes this source a good BD candidate. We conclude that we found in total four good BD candidates.« less

  15. Surface immuno-functionalisation for the capture and detection of Vibrio species in the marine environment: a new management tool for industrial facilities.

    PubMed

    Laczka, Olivier F; Labbate, Maurizio; Seymour, Justin R; Bourne, David G; Fielder, Stewart S; Doblin, Martina A

    2014-01-01

    Bacteria from the genus Vibrio are a common and environmentally important group of bacteria within coastal environments and include species pathogenic to aquaculture organisms. Their distribution and abundance are linked to specific environmental parameters, including temperature, salinity and nutrient enrichment. Accurate and efficient detection of Vibrios in environmental samples provides a potential important indicator of overall ecosystem health while also allowing rapid management responses for species pathogenic to humans or species implicated in disease of economically important aquacultured fish and invertebrates. In this study, we developed a surface immuno-functionalisation protocol, based on an avidin-biotin type covalent binding strategy, allowing specific sandwich-type detection of bacteria from the Vibrio genus. The assay was optimized on 12 diverse Vibrio strains, including species that have implications for aquaculture industries, reaching detection limits between 7×10(3) to 3×10(4) cells mL(-1). Current techniques for the detection of total Vibrios rely on laborious or inefficient analyses resulting in delayed management decisions. This work represents a novel approach for a rapid, accurate, sensitive and robust tool for quantifying Vibrios directly in industrial systems and in the environment, thereby facilitating rapid management responses.

  16. Ultrasensitive Detection of Drug-Resistant Pandemic 2009 (H1N1) Influenza A Virus by Rare-Variant-Sensitive High-Resolution Melting-Curve Analysis▿‡

    PubMed Central

    Chen, Neng; Pinsky, Benjamin A.; Lee, Betty P.; Lin, Min; Schrijver, Iris

    2011-01-01

    Oseltamivir (Tamiflu), an oral neuraminidase inhibitor, has been widely used to treat pandemic 2009 (H1N1) influenza A. Although a majority of 2009 (H1N1) influenza A virus remains oseltamivir susceptible, the threat of resistance due to the His275Tyr mutation is highlighted by the limitations of alternative therapies and the potential for rapid, global fixation of this mutation in the circulating influenza A virus population. In order to better understand the emergence of resistance, we developed a rare-variant-sensitive high-resolution melting-curve analysis method (RVS-HRM) that is able to detect the His275Tyr oseltamivir resistance mutation to 0.5% in a background of susceptible virus. We applied RVS-HRM to clinical specimens from patients who developed oseltamivir resistance and demonstrated the ultrasensitive detection of influenza A virus N1 neuraminidase quasispecies. Interestingly, we were unable to detect the oseltamivir resistance mutation in pretreatment samples, suggesting that resistant virus does not reach even this very low detection threshold until exposed to selective drug pressure. Thus, patients naive to oseltamivir are most likely to be susceptible when this drug is used as a first-line treatment modality. PMID:21543559

  17. Assembly of polythiophenes on responsive polymer microgels for the highly selective detection of ammonia gas

    DOE PAGES

    Chang, Aiping; Peng, Yahui; Li, Zezhou; ...

    2016-04-05

    For this study, a class of smart composite materials based on the assembly of conjugated polymers on responsive polymer microgels has been prepared. We have chosen poly(3-((2-(2-methoxyethoxy)ethoxy)methyl)-thiophene) as the model conjugated polymer and an ammonia-responsive microgel of phenoxazinium-functionalized poly(N-isopropylacrylamide-co-propargyl acrylate) as the model template. Under this design, the composite materials can combine the electrical conductivity of the conjugated polymers and the ammonia recognisability of the ammonia-responsive polymer microgels; the cooperation of these properties allows the reversible control of electrical conductivity by ammonia gas. Those composite materials can not only adapt to ammonia gas, but also convert changes in the concentrationmore » of ammonia into conductance, allowing the electrical detection of ammonia gas with high selectivity. This makes the composite materials different from the conductive polymer platforms reported previously, which may also respond to non-ammonia gases and the response induced by non-ammonia gases is close to that induced by ammonia gas. Using these composite materials as sensing materials for the electrical detection of ammonia gas, the detection limit can reach as low as 1.1 ppb. Finally, these features enable their use for the electrical detection of ammonia in breath.« less

  18. Assembly of polythiophenes on responsive polymer microgels for the highly selective detection of ammonia gas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Aiping; Peng, Yahui; Li, Zezhou

    For this study, a class of smart composite materials based on the assembly of conjugated polymers on responsive polymer microgels has been prepared. We have chosen poly(3-((2-(2-methoxyethoxy)ethoxy)methyl)-thiophene) as the model conjugated polymer and an ammonia-responsive microgel of phenoxazinium-functionalized poly(N-isopropylacrylamide-co-propargyl acrylate) as the model template. Under this design, the composite materials can combine the electrical conductivity of the conjugated polymers and the ammonia recognisability of the ammonia-responsive polymer microgels; the cooperation of these properties allows the reversible control of electrical conductivity by ammonia gas. Those composite materials can not only adapt to ammonia gas, but also convert changes in the concentrationmore » of ammonia into conductance, allowing the electrical detection of ammonia gas with high selectivity. This makes the composite materials different from the conductive polymer platforms reported previously, which may also respond to non-ammonia gases and the response induced by non-ammonia gases is close to that induced by ammonia gas. Using these composite materials as sensing materials for the electrical detection of ammonia gas, the detection limit can reach as low as 1.1 ppb. Finally, these features enable their use for the electrical detection of ammonia in breath.« less

  19. Radio morphing - towards a full parametrisation of the radio signal from air showers

    NASA Astrophysics Data System (ADS)

    Zilles, A.; Charrier, D.; Kotera, K.; Le Coz, S.; Martineau-Huynh, O.; Medina, C.; Niess, V.; Tueros, M.; de Vries, K.

    2017-12-01

    Over the last decades, radio detection of air showers has been established as a detection technique for ultra-high-energy cosmic-rays impinging on the Earth's atmosphere with energies far beyond LHC energies. Today’s second-generation of digital radio-detection experiments, as e.g. AERA or LOFAR, are becoming competitive in comparison to already standard techniques e.g. fluorescence light detection. Thanks to a detailed understanding of the physics of the radio emission in extensive air showers, simulations of the radio signal are already successfully tested and applied in the reconstruction of cosmic rays. However the limits of the computational power resources are easily reached when it comes to computing electric fields at the numerous positions requested by large or dense antenna arrays. In the case of mountainous areas as e.g. for the GRAND array, where 3D shower simulations are necessary, the problem arises with even stronger acuity. Therefore we developed a full parametrisation of the emitted radio signal on the basis of generic shower simulations which will reduce the simulation time by orders of magnitudes. In this talk we will present this concept after a short introduction to the concept of the radio detection of air-shower induced by cosmic rays.

  20. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens.

    PubMed

    Raja, B; Goux, H J; Marapadaga, A; Rajagopalan, S; Kourentzi, K; Willson, R C

    2017-08-01

    To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterococcus faecalis. All five RPAs required reaction times of under 12 min to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of nontarget bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78-100%) and a sensitivity of 89% (95% CI, 75-96%) for UTI detection. The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Rapid identification of the causative pathogens of UTIs can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture's 48-72-h turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens. © 2017 The Society for Applied Microbiology.

  1. High-Precision Displacement Sensing of Monolithic Piezoelectric Disk Resonators Using a Single-Electron Transistor

    NASA Astrophysics Data System (ADS)

    Li, J.; Santos, J. T.; Sillanpää, M. A.

    2018-02-01

    A single-electron transistor (SET) can be used as an extremely sensitive charge detector. Mechanical displacements can be converted into charge, and hence, SETs can become sensitive detectors of mechanical oscillations. For studying small-energy oscillations, an important approach to realize the mechanical resonators is to use piezoelectric materials. Besides coupling to traditional electric circuitry, the strain-generated piezoelectric charge allows for measuring ultrasmall oscillations via SET detection. Here, we explore the usage of SETs to detect the shear-mode oscillations of a 6-mm-diameter quartz disk resonator with a resonance frequency around 9 MHz. We measure the mechanical oscillations using either a conventional DC SET, or use the SET as a homodyne or heterodyne mixer, or finally, as a radio-frequency single-electron transistor (RF-SET). The RF-SET readout is shown to be the most sensitive method, allowing us to measure mechanical displacement amplitudes below 10^{-13} m. We conclude that a detection based on a SET offers a potential to reach the sensitivity at the quantum limit of the mechanical vibrations.

  2. A label-free impedimetric DNA sensing chip integrated with AC electroosmotic stirring.

    PubMed

    Wu, Ching-Chou; Yang, Dong-Jie

    2013-05-15

    AC electroosmosis (ACEO) flow and label-free electrochemical impedance spectroscopy are employed to increase the hybridization rate and specifically detect target DNA (tDNA) concentrations. A low-ionic-strength solution, 6.1μS/cm 1mM Tris (pH 9.3), was used to produce ACEO and proved the feasibility of hybridization. Adequate voltage parameters for the simultaneous ACEO driving and DNA hybridization in the 1mM Tris solution were 1.5 Vpp and 200Hz. Moreover, an electrode set with a 1:4 ring width-to-disk diameter ratio exhibited a larger ACEO velocity above the disk electrode surface to improve collecting efficiency. The ACEO-integrated DNA sensing chips could reach 90% saturation hybridization within 117s. The linear range and detection limit of the sensors was 10aM-10pM and 10aM, respectively. The label-free impedimetric DNA sensing chips with integrated ACEO stirring can perform rapid hybridization and highly-sensitive detections to specifically measure tDNA concentrations. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Measurement device for high-precision spectral transmittance of solar blind filter

    NASA Astrophysics Data System (ADS)

    Wang, Yan; Qian, Yunsheng; Lv, Yang; Feng, Cheng; Liu, Jian

    2017-02-01

    In order to measure spectral transmittance of solar-blind filter ranging from ultraviolet to visible light accurately, a high-precision filter transmittance measuring system based on the ultraviolet photomultiplier is developed. The calibration method is mainly used to measure transmittance in this system, which mainly consists of an ultraviolet photomultiplier as core of the system and a lock-in amplifier combined with an optical modulator as the aided measurement for the system. The ultraviolet photomultiplier can amplify the current signal through the filter and have the characteristics of low dark current and high luminance gain. The optical modulator and the lock-in amplifier can obtain the signal from the photomultiplier and inhibit dark noise and spurious signal effectively. Through these two parts, the low light passing through the filters can be detected and we can calculate the transmittance by the optical power detected. Based on the proposed system, the limit detection of the transmittance can reach 10-12, while the result of the conventional approach is merely 10-6. Therefore, the system can make an effective assessment of solar blind ultraviolet filters.

  4. Tracking of Mesenchymal Stem Cells with Fluorescence Endomicroscopy Imaging in Radiotherapy-Induced Lung Injury

    NASA Astrophysics Data System (ADS)

    Perez, Jessica R.; Ybarra, Norma; Chagnon, Frederic; Serban, Monica; Lee, Sangkyu; Seuntjens, Jan; Lesur, Olivier; El Naqa, Issam

    2017-01-01

    Mesenchymal stem cells (MSCs) have potential for reducing inflammation and promoting organ repair. However, limitations in available techniques to track them and assess this potential for lung repair have hindered their applicability. In this work, we proposed, implemented and evaluated the use of fluorescence endomicroscopy as a novel imaging tool to track MSCs in vivo. MSCs were fluorescently labeled and injected into a rat model of radiation-induced lung injury via endotracheal (ET) or intravascular (IV) administration. Our results show that MSCs were visible in the lungs with fluorescence endomicroscopy. Moreover, we developed an automatic cell counting algorithm to quantify the number of detected cells in each condition. We observed a significantly higher number of detected cells in ET injection compared to IV and a slight increase in the mean number of detected cells in irradiated lungs compared to control, although the latter did not reach statistical significance. Fluorescence endomicroscopy imaging is a powerful new minimally invasive and translatable tool that can be used to track and quantify MSCs in the lungs and help assess their potential in organ repair.

  5. High-Precision Displacement Sensing of Monolithic Piezoelectric Disk Resonators Using a Single-Electron Transistor

    NASA Astrophysics Data System (ADS)

    Li, J.; Santos, J. T.; Sillanpää, M. A.

    2018-06-01

    A single-electron transistor (SET) can be used as an extremely sensitive charge detector. Mechanical displacements can be converted into charge, and hence, SETs can become sensitive detectors of mechanical oscillations. For studying small-energy oscillations, an important approach to realize the mechanical resonators is to use piezoelectric materials. Besides coupling to traditional electric circuitry, the strain-generated piezoelectric charge allows for measuring ultrasmall oscillations via SET detection. Here, we explore the usage of SETs to detect the shear-mode oscillations of a 6-mm-diameter quartz disk resonator with a resonance frequency around 9 MHz. We measure the mechanical oscillations using either a conventional DC SET, or use the SET as a homodyne or heterodyne mixer, or finally, as a radio-frequency single-electron transistor (RF-SET). The RF-SET readout is shown to be the most sensitive method, allowing us to measure mechanical displacement amplitudes below 10^{-13} m. We conclude that a detection based on a SET offers a potential to reach the sensitivity at the quantum limit of the mechanical vibrations.

  6. Metal cation detection in positive ion mode electrospray ionization mass spectrometry using a tetracationic salt as a gas-phase ion-pairing agent: evaluation of the effect of chelating agents on detection sensitivity.

    PubMed

    Xu, Chengdong; Dodbiba, Edra; Padivitage, Nilusha L T; Breitbach, Zachary S; Armstrong, Daniel W

    2012-12-30

    The detection of metal cations continues to be essential in many scientific and industrial areas of interest. The most common electrospray ionization mass spectrometry (ESI-MS) approach involves chelating the metal ions and detecting the organometallic complex in the negative ion mode. However, it is well known that negative ion mode ESI-MS is generally less sensitive than the positive ion mode. To achieve greater sensitivity, it is necessary to examine the feasibility of detecting the chelated metal cations in positive ion mode ESI-MS. Since highly solvated native metal cations have relatively low ionization efficiency in ESI-MS, and can be difficult to detect in the positive ion mode, a tetracationic ion-pairing agent was added to form a complex with the negatively charged metal chelate. The use of the ion-pairing agent leads to the generation of an overall positively charged complex, which can be detected at higher m/z values in the positive ion mode by electrospray ionization linear quadrupole ion trap mass spectrometry. Thirteen chelating agents with diverse structures were evaluated in this study. The nature of the chelating agent played as important a role as was previously determined for cationic pairing agents. The detection limits of six metal cations reached sub-picogram levels and significant improvements were observed when compared to negative ion mode detection where the metal-chelates were monitored without adding the ion-pairing reagent (IPR). Also, selective reaction monitoring (SRM) analyses were performed on the ternary complexes, which improved detection limits by one to three orders of magnitude. With this method it was possible to analyze the metal cations in the positive ion mode ESI-MS with the advantage of speed, sensitivity and selectivity. The optimum solution pH for this type of analysis is 5-7. Tandem mass spectrometry (MS/MS) further increases the sensitivity. Speciation is straightforward making this a broadly useful approach for the analysis of metal ions. Copyright © 2012 John Wiley & Sons, Ltd.

  7. Determining the minimum ripening time of artisanal Minas cheese, a traditional Brazilian cheese

    PubMed Central

    Martins, José M.; Galinari, Éder; Pimentel-Filho, Natan J.; Ribeiro, José I.; Furtado, Mauro M.; Ferreira, Célia L.L.F.

    2015-01-01

    Physical, physicochemical, and microbiological changes were monitored in 256 samples of artisanal Minas cheese from eight producers from Serro region (Minas Gerais, Brazil) for 64 days of ripening to determine the minimum ripening time for the cheese to reach the safe microbiological limits established by Brazilian legislation. The cheeses were produced between dry season (April–September) and rainy season (October–March); 128 cheeses were ripened at room temperature (25 ± 4 °C), and 128 were ripened under refrigeration (8 ± 1 °C), as a control. No Listeria monocytogenes was found, but one cheese under refrigeration had Salmonella at first 15 days of ripening. However, after 22 days, the pathogen was not detected. Seventeen days was the minimum ripening time at room temperature to reduce at safe limits of total coliforms > 1000 cfu.g −1 ), Escherichia coli and Staphylococcus aureus (> 100 cfu.g −1 ) in both periods of manufacture. Otherwise under refrigeration, as expected, the minimum ripening time was longer, 33 days in the dry season and 63 days in the rainy season. To sum up, we suggest that the ripening of artisanal Minas cheese be done at room temperature, since this condition shortens the time needed to reach the microbiological quality that falls within the safety parameters required by Brazilian law, and at the same time maintain the appearance and flavor characteristics of this traditional cheese. PMID:26221111

  8. THE SPECTRAL EVOLUTION OF THE FIRST GALAXIES. I. JAMES WEBB SPACE TELESCOPE DETECTION LIMITS AND COLOR CRITERIA FOR POPULATION III GALAXIES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zackrisson, Erik; Rydberg, Claes-Erik; Oestlin, Goeran

    The James Webb Space Telescope (JWST) is expected to revolutionize our understanding of the high-redshift universe, and may be able to test the prediction that the first, chemically pristine (Population III) stars are formed with very high characteristic masses. Since isolated Population III stars are likely to be beyond the reach of JWST, small Population III galaxies may offer the best prospects of directly probing the properties of metal-free stars. Here, we present Yggdrasil, a new spectral synthesis code geared toward the first galaxies. Using this model, we explore the JWST imaging detection limits for Population III galaxies and investigatemore » to what extent such objects may be identified based on their JWST colors. We predict that JWST should be able to detect Population III galaxies with stellar population masses as low as {approx}10{sup 5} M{sub sun} at z {approx} 10 in ultra deep exposures. Over limited redshift intervals, it may also be possible to use color criteria to select Population III galaxy candidates for follow-up spectroscopy. The colors of young Population III galaxies dominated by direct starlight can be used to probe the stellar initial mass function (IMF), but this requires almost complete leakage of ionizing photons into the intergalactic medium. The colors of objects dominated by nebular emission show no corresponding IMF sensitivity. We also note that a clean selection of Population III galaxies at z {approx} 7-8 can be achieved by adding two JWST/MIRI filters to the JWST/NIRCam filter sets usually discussed in the context of JWST ultra deep fields.« less

  9. Search for Post-merger Gravitational Waves from the Remnant of the Binary Neutron Star Merger GW170817

    NASA Astrophysics Data System (ADS)

    Abbott, B. P.; Abbott, R.; Abbott, T. D.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Afrough, M.; Agarwal, B.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allen, G.; Allocca, A.; Altin, P. A.; Amato, A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Angelova, S. V.; Antier, S.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Atallah, D. V.; Aufmuth, P.; Aulbert, C.; AultONeal, K.; Austin, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Bae, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Banagiri, S.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barkett, K.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Bawaj, M.; Bayley, J. C.; Bazzan, M.; Bécsy, B.; Beer, C.; Bejger, M.; Belahcene, I.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Bernuzzi, S.; Bero, J. J.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Biscoveanu, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Bode, N.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonilla, E.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bossie, K.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderón Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Canizares, P.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Carney, M. F.; Casanueva Diaz, J.; Casentini, C.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Cerdá-Durán, P.; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chase, E.; Chassande-Mottin, E.; Chatterjee, D.; Cheeseboro, B. D.; Chen, H. Y.; Chen, X.; Chen, Y.; Cheng, H.-P.; Chia, H.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, A. K. W.; Chung, S.; Ciani, G.; Ciolfi, R.; Cirelli, C. E.; Cirone, A.; Clara, F.; Clark, J. A.; Clearwater, P.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P.-F.; Cohen, D.; Colla, A.; Collette, C. G.; Cominsky, L. R.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corban, P.; Corbitt, T. R.; Cordero-Carrión, I.; Corley, K. R.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J.-P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Dálya, G.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Da Silva Costa, C. F.; Dattilo, V.; Dave, I.; Davier, M.; Davis, D.; Daw, E. J.; Day, B.; De, S.; DeBra, D.; Degallaix, J.; De Laurentis, M.; Deléglise, S.; Del Pozzo, W.; Demos, N.; Denker, T.; Dent, T.; De Pietri, R.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; De Rossi, C.; DeSalvo, R.; de Varona, O.; Devenson, J.; Dhurandhar, S.; Díaz, M. C.; Dietrich, T.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Renzo, F.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Dovale Álvarez, M.; Downes, T. P.; Drago, M.; Dreissigacker, C.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dupej, P.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H.-B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Estevez, D.; Etienne, Z. B.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fee, C.; Fehrmann, H.; Feicht, J.; Fejer, M. M.; Fernandez-Galiana, A.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Finstad, D.; Fiori, I.; Fiorucci, D.; Fishbach, M.; Fisher, R. P.; Fitz-Axen, M.; Flaminio, R.; Fletcher, M.; Flynn, E.; Fong, H.; Font, J. A.; Forsyth, P. W. F.; Forsyth, S. S.; Fournier, J.-D.; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Ganija, M. R.; Gaonkar, S. G.; Garcia-Quiros, C.; Garufi, F.; Gateley, B.; Gaudio, S.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, D.; George, J.; Gergely, L.; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glover, L.; Goetz, E.; Goetz, R.; Gomes, S.; Goncharov, B.; González, G.; Gonzalez Castro, J. M.; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Gretarsson, E. M.; Groot, P.; Grote, H.; Grunewald, S.; Gruning, P.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Halim, O.; Hall, B. R.; Hall, E. D.; Hamilton, E. Z.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hannuksela, O. A.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Haster, C.-J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hinderer, T.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Horst, C.; Hough, J.; Houston, E. A.; Howell, E. J.; Hreibi, A.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Inta, R.; Intini, G.; Isa, H. N.; Isac, J.-M.; Isi, M.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jiménez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kamai, B.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Kastaun, W.; Katolik, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kawabe, K.; Kéfélian, F.; Keitel, D.; Kemball, A. J.; Kennedy, R.; Kent, C.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, K.; Kim, W.; Kim, W. S.; Kim, Y.-M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kinley-Hanlon, M.; Kirchhoff, R.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Knowles, T. D.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Krämer, C.; Kringel, V.; Krishnan, B.; Królak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kumar, S.; Kuo, L.; Kutynia, A.; Kwang, S.; Lackey, B. D.; Lai, K. H.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, H. W.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Linker, S. D.; Liu, J.; Lo, R. K. L.; Lockerbie, N. A.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lousto, C. O.; Lovelace, G.; Lück, H.; Lumaca, D.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macas, R.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magaña Hernandez, I.; Magaña-Sandoval, F.; Magaña Zertuche, L.; Magee, R. M.; Majorana, E.; Maksimovic, I.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markakis, C.; Markosyan, A. S.; Markowitz, A.; Maros, E.; Marquina, A.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R. M.; Martynov, D. V.; Mason, K.; Massera, E.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matas, A.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McCuller, L.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McNeill, L.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Mehmet, M.; Meidam, J.; Mejuto-Villa, E.; Melatos, A.; Mendell, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, B. B.; Miller, J.; Milovich-Goff, M. C.; Minazzoli, O.; Minenkov, Y.; Ming, J.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moffa, D.; Moggi, A.; Mogushi, K.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muñiz, E. A.; Muratore, M.; Murray, P. G.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Neilson, J.; Nelemans, G.; Nelson, T. J. N.; Nery, M.; Neunzert, A.; Nevin, L.; Newport, J. M.; Newton, G.; Ng, K. K. Y.; Nguyen, T. T.; Nichols, D.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; North, C.; Nuttall, L. K.; Oberling, J.; O'Dea, G. D.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Okada, M. A.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ormiston, R.; Ortega, L. F.; O'Shaughnessy, R.; Ossokine, S.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Page, M. A.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, Howard; Pan, Huang-Wei; Pang, B.; Pang, P. T. H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Parida, A.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patil, M.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Phukon, K. S.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pirello, M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Porter, E. K.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Pratten, G.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Pürrer, M.; Qi, H.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rajbhandari, B.; Rakhmanov, M.; Ramirez, K. E.; Ramos-Buades, A.; Rapagnani, P.; Raymond, V.; Razzano, M.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Ren, W.; Reyes, S. D.; Ricci, F.; Ricker, P. M.; Rieger, S.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romel, C. L.; Romie, J. H.; Rosińska, D.; Ross, M. P.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Rutins, G.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sanchez, L. E.; Sanchis-Gual, N.; Sandberg, V.; Sanders, J. R.; Sarin, N.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheel, M.; Scheuer, J.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schönbeck, A.; Schreiber, E.; Schuette, D.; Schulte, B. W.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Seidel, E.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Shaddock, D. A.; Shaffer, T. J.; Shah, A. A.; Shahriar, M. S.; Shaner, M. B.; Shao, L.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, L. P.; Singh, A.; Singhal, A.; Sintes, A. M.; Rana, J.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Smith, R. J. E.; Somala, S.; Son, E. J.; Sonnenberg, J. A.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Sowell, E.; Spencer, A. P.; Srivastava, A. K.; Staats, K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stevenson, S. P.; Stone, R.; Stops, D. J.; Strain, K. A.; Stratta, G.; Strigin, S. E.; Strunk, A.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Suresh, J.; Sutton, P. J.; Swinkels, B. L.; Szczepańczyk, M. J.; Tacca, M.; Tait, S. C.; Talbot, C.; Talukder, D.; Tanner, D. B.; Tápai, M.; Taracchini, A.; Tasson, J. D.; Taylor, J. A.; Taylor, R.; Tewari, S. V.; Theeg, T.; Thies, F.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tonelli, M.; Tornasi, Z.; Torres-Forné, A.; Torrie, C. I.; Töyrä, D.; Travasso, F.; Traylor, G.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tsang, K. W.; Tse, M.; Tso, R.; Tsukada, L.; Tsuna, D.; Tuyenbayev, D.; Ueno, K.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; Vasúth, M.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Viceré, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J.-Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walet, R.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, J. Z.; Wang, W. H.; Wang, Y. F.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessel, E. K.; Weßels, P.; Westerweck, J.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. D.; Whiting, B. F.; Whittle, C.; Wilken, D.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Wofford, J.; Wong, K. W. K.; Worden, J.; Wright, J. L.; Wu, D. S.; Wysocki, D. M.; Xiao, S.; Yamamoto, H.; Yancey, C. C.; Yang, L.; Yap, M. J.; Yazback, M.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrożny, A.; Zanolin, M.; Zelenova, T.; Zendri, J.-P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.-H.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zimmerman, A. B.; Zucker, M. E.; Zweizig, J.; (LIGO Scientific Collaboration; Virgo Collaboration

    2017-12-01

    The first observation of a binary neutron star (NS) coalescence by the Advanced LIGO and Advanced Virgo gravitational-wave (GW) detectors offers an unprecedented opportunity to study matter under the most extreme conditions. After such a merger, a compact remnant is left over whose nature depends primarily on the masses of the inspiraling objects and on the equation of state of nuclear matter. This could be either a black hole (BH) or an NS, with the latter being either long-lived or too massive for stability implying delayed collapse to a BH. Here, we present a search for GWs from the remnant of the binary NS merger GW170817 using data from Advanced LIGO and Advanced Virgo. We search for short- (≲1 s) and intermediate-duration (≲500 s) signals, which include GW emission from a hypermassive NS or supramassive NS, respectively. We find no signal from the post-merger remnant. Our derived strain upper limits are more than an order of magnitude larger than those predicted by most models. For short signals, our best upper limit on the root sum square of the GW strain emitted from 1-4 kHz is {h}{rss}50 % =2.1× {10}-22 {{Hz}}-1/2 at 50% detection efficiency. For intermediate-duration signals, our best upper limit at 50% detection efficiency is {h}{rss}50 % =8.4× {10}-22 {{Hz}}-1/2 for a millisecond magnetar model, and {h}{rss}50 % =5.9× {10}-22 {{Hz}}-1/2 for a bar-mode model. These results indicate that post-merger emission from a similar event may be detectable when advanced detectors reach design sensitivity or with next-generation detectors.

  10. Detection of self-paced reaching movement intention from EEG signals.

    PubMed

    Lew, Eileen; Chavarriaga, Ricardo; Silvoni, Stefano; Millán, José Del R

    2012-01-01

    Future neuroprosthetic devices, in particular upper limb, will require decoding and executing not only the user's intended movement type, but also when the user intends to execute the movement. This work investigates the potential use of brain signals recorded non-invasively for detecting the time before a self-paced reaching movement is initiated which could contribute to the design of practical upper limb neuroprosthetics. In particular, we show the detection of self-paced reaching movement intention in single trials using the readiness potential, an electroencephalography (EEG) slow cortical potential (SCP) computed in a narrow frequency range (0.1-1 Hz). Our experiments with 12 human volunteers, two of them stroke subjects, yield high detection rates prior to the movement onset and low detection rates during the non-movement intention period. With the proposed approach, movement intention was detected around 500 ms before actual onset, which clearly matches previous literature on readiness potentials. Interestingly, the result obtained with one of the stroke subjects is coherent with those achieved in healthy subjects, with single-trial performance of up to 92% for the paretic arm. These results suggest that, apart from contributing to our understanding of voluntary motor control for designing more advanced neuroprostheses, our work could also have a direct impact on advancing robot-assisted neurorehabilitation.

  11. Combined steam-ultrasound treatment of 2 seconds achieves significant high aerobic count and Enterobacteriaceae reduction on naturally contaminated food boxes, crates, conveyor belts, and meat knives.

    PubMed

    Musavian, Hanieh S; Butt, Tariq M; Larsen, Annette Baltzer; Krebs, Niels

    2015-02-01

    Food contact surfaces require rigorous sanitation procedures for decontamination, although these methods very often fail to efficiently clean and disinfect surfaces that are visibly contaminated with food residues and possible biofilms. In this study, the results of a short treatment (1 to 2 s) of combined steam (95°C) and ultrasound (SonoSteam) of industrial fish and meat transportation boxes and live-chicken transportation crates naturally contaminated with food and fecal residues were investigated. Aerobic counts of 5.0 to 6.0 log CFU/24 cm(2) and an Enterobacteriaceae spp. level of 2.0 CFU/24 cm(2) were found on the surfaces prior to the treatment. After 1 s of treatment, the aerobic counts were significantly (P < 0.0001) reduced, and within 2 s, reductions below the detection limit (<10 CFU) were reached. Enterobacteriaceae spp. were reduced to a level below the detection limit with only 1 s of treatment. Two seconds of steam-ultrasound treatment was also applied on two different types of plastic modular conveyor belts with hinge pins and one type of flat flexible rubber belt, all visibly contaminated with food residues. The aerobic counts of 3.0 to 5.0 CFU/50 cm(2) were significantly (P < 0.05) reduced, while Enterobacteriaceae spp. were reduced to a level below the detection limit. Industrial meat knives were contaminated with aerobic counts of 6.0 log CFU/5 cm(2) on the handle and 5.2 log CFU/14 cm(2) on the steel. The level of Enterobacteriaceae spp. contamination was approximately 2.5 log CFU on the handle and steel. Two seconds of steam-ultrasound treatment reduced the aerobic counts and Enterobacteriaceae spp. to levels below the detection limit on both handle and steel. This study shows that the steam-ultrasound treatment may be an effective replacement for disinfection processes and that it can be used for continuous disinfection at fast process lines. However, the treatment may not be able to replace efficient cleaning processes used to remove high loads of debris.

  12. Pollutant levels in discarded fish species by Spanish trawlers operating in the Great Sole Bank and the Atlantic coast of the Iberian Peninsula.

    PubMed

    Antelo, Luis T; Ordóñez-Del Pazo, Tatiana; Lopes, Carla; Franco-Uría, Amaya; Pérez-Martín, Ricardo I; Alonso, Antonio A

    2016-07-15

    Organic and inorganic pollutant levels were determined for the most discarded species from trawlers operating in Great Sole and Spanish coastal fishing grounds. Results for heavy metals indicated that Cd can reach values higher than legal limits for some species and tissues, while Hg and Pb concentrations are below established values. No significant variation was noticed with fishing grounds, but both season influences in the case of Pb and interspecies variation for Hg and Cd have been detected. Valorization recommendations could be therefore established according to the levels found in the different species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The Grism Lens-Amplified Survey from Space (GLASS). III. A Census of Lyα Emission at z ≳ 7 from HST Spectroscopy

    NASA Astrophysics Data System (ADS)

    Schmidt, K. B.; Treu, T.; Bradač, M.; Vulcani, B.; Huang, K.-H.; Hoag, A.; Maseda, M.; Guaita, L.; Pentericci, L.; Brammer, G. B.; Dijkstra, M.; Dressler, A.; Fontana, A.; Henry, A. L.; Jones, T. A.; Mason, C.; Trenti, M.; Wang, X.

    2016-02-01

    We present a census of Lyα emission at z≳ 7, utilizing deep near-infrared Hubble Space Telescope grism spectroscopy from the first six completed clusters of the Grism Lens-Amplified Survey from Space (GLASS). In 24/159 photometrically selected galaxies we detect emission lines consistent with Lyα in the GLASS spectra. Based on the distribution of signal-to-noise ratios and on simulations, we expect the completeness and the purity of the sample to be 40%-100% and 60%-90%, respectively. For the objects without detected emission lines we show that the observed (not corrected for lensing magnification) 1σ flux limits reach 5 × 10-18 erg s-1 cm-2 per position angle over the full wavelength range of GLASS (0.8-1.7 μm). Based on the conditional probability of Lyα emission measured from the ground at z˜ 7, we would have expected 12-18 Lyα emitters. This is consistent with the number of detections, within the uncertainties, confirming the drop in Lyα emission with respect to z˜ 6. Deeper follow-up spectroscopy, here exemplified by Keck spectroscopy, is necessary to improve our estimates of completeness and purity and to confirm individual candidates as true Lyα emitters. These candidates include a promising source at z = 8.1. The spatial extent of Lyα in a deep stack of the most convincing Lyα emitters with < z> = 7.2 is consistent with that of the rest-frame UV continuum. Extended Lyα emission, if present, has a surface brightness below our detection limit, consistent with the properties of lower-redshift comparison samples. From the stack we estimate upper limits on rest-frame UV emission line ratios and find {f}{{C}{{IV}}}/{f}{Lyα }≲ 0.32 and {f}{{C}{{III}}]}/{f}{Lyα }≲ 0.23, in good agreement with other values published in the literature.

  14. Field ion spectrometry: a new technology for cocaine and heroin detection

    NASA Astrophysics Data System (ADS)

    Carnahan, Byron L.; Day, Stephen; Kouznetsov, Viktor; Tarassov, Alexandre

    1997-02-01

    Field ion spectrometry, also known as transverse field compensation ion mobility spectrometry, is a new technique for trace gas analysis that can be applied to the detection of cocaine and heroin. Its principle is based on filtering ion species according to the functional dependence of their mobilities with electric field strength. Field ion spectrometry eliminates the gating electrodes needed in conventional IMS to pulse ions into the spectrometer; instead, ions are injected in to the spectrometer and reach the detector continuously, resulting in improved sensitivity. The technique enables analyses that are difficult with conventional constant field strength ion mobility spectrometers. We have shown that a filed ion spectrometer can selectively detect the vapors from cocaine and heroin emitted from both their base and hydrochloride forms. The estimated volumetric limits of detection are in the low pptv range, based on testing with standardized drug vapor generation systems. The spectrometer can detect cocaine base in the vapor phase, at concentrations well below its estimated 100 pptv vapor pressure equivalent at 20 degrees C. This paper describes the underlying principles of field ion spectrometry in relation to narcotic drug detection, and recent results obtained for cocaine and heroin. The work has been sponsored in part by the United States Advanced Research Projects Agency under contract DAAB10-95C-0004, for the DOD Counterdrug Technology Development Program.

  15. Plasmonic Enzyme-Linked Immunosorbent Assay Using Nanospherical Brushes as a Catalase Container for Colorimetric Detection of Ultralow Concentrations of Listeria monocytogenes.

    PubMed

    Chen, Rui; Huang, Xiaolin; Xu, Hengyi; Xiong, Yonghua; Li, Yanbin

    2015-12-30

    Plasmonic enzyme-linked immunosorbent assay (pELISA) based on catalase (CAT)-mediated gold nanoparticle growth exhibits ultrahigh sensitivity for detecting disease-related biomarkers using sandwich formats. However, the limit of detection (LOD) of this strategy for Listeria monocytogenes is only around 10(3) CFU/mL, which considerably exceeds the amount of L. monocytogenes commonly present in food products (<100 CFU/g). Herein, we report an improved pELISA method for detection of L. monocytogenes at ultralow concentrations with the sandwich formats using silica nanoparticles carrying poly(acrylic acid) brushes as a "CAT container" to increase enzyme loading for enhancing the detection signal. Under optimal conditions, the proposed pELISA exhibits good specificity and excellent sensitivity for L. monocytogenes with a LOD of 8 × 10(1) CFU/mL in 0.01 M phosphate-buffered saline, via a reaction that can be discriminated by the naked eye. The LOD obtained by this method was 2 and 5 orders of magnitude lower than that of conventional CAT-based pELISA and horseradish peroxidase (HRP)-based conventional ELISA, respectively. Coupled with large-volume immunomagnetic separation, the LOD for L. monocytogenes-spiked lettuce samples reached 8 × 10(1) CFU/g. The improved pELISA also exhibited a great potential in detecting a single cell of L. monocytogenes in 100 μL of solution.

  16. Mesoscale spatial variability of selected aquatic invertebrate community metrics from a minimally impaired stream segment

    USGS Publications Warehouse

    Gebler, J.B.

    2004-01-01

    The related topics of spatial variability of aquatic invertebrate community metrics, implications of spatial patterns of metric values to distributions of aquatic invertebrate communities, and ramifications of natural variability to the detection of human perturbations were investigated. Four metrics commonly used for stream assessment were computed for 9 stream reaches within a fairly homogeneous, minimally impaired stream segment of the San Pedro River, Arizona. Metric variability was assessed for differing sampling scenarios using simple permutation procedures. Spatial patterns of metric values suggest that aquatic invertebrate communities are patchily distributed on subsegment and segment scales, which causes metric variability. Wide ranges of metric values resulted in wide ranges of metric coefficients of variation (CVs) and minimum detectable differences (MDDs), and both CVs and MDDs often increased as sample size (number of reaches) increased, suggesting that any particular set of sampling reaches could yield misleading estimates of population parameters and effects that can be detected. Mean metric variabilities were substantial, with the result that only fairly large differences in metrics would be declared significant at ?? = 0.05 and ?? = 0.20. The number of reaches required to obtain MDDs of 10% and 20% varied with significance level and power, and differed for different metrics, but were generally large, ranging into tens and hundreds of reaches. Study results suggest that metric values from one or a small number of stream reach(es) may not be adequate to represent a stream segment, depending on effect sizes of interest, and that larger sample sizes are necessary to obtain reasonable estimates of metrics and sample statistics. For bioassessment to progress, spatial variability may need to be investigated in many systems and should be considered when designing studies and interpreting data.

  17. International non-governmental organizations' provision of community-based tuberculosis care for hard-to-reach populations in Myanmar, 2013-2014.

    PubMed

    Soe, Kyaw Thu; Saw, Saw; van Griensven, Johan; Zhou, Shuisen; Win, Le; Chinnakali, Palanivel; Shah, Safieh; Mon, Myo Myo; Aung, Si Thu

    2017-03-24

    National tuberculosis (TB) programs increasingly engage with international non-governmental organizations (INGOs), especially to provide TB care in complex settings where community involvement might be required. In Myanmar, however, there is limited data on how such INGO community-based programs are organized and how effective they are. In this study, we describe four INGO strategies for providing community-based TB care to hard-to-reach populations in Myanmar, and assess their contribution to TB case detection. We conducted a descriptive study using program data from four INGOs and the National TB Program (NTP) in 2013-2014. For each INGO, we extracted information on its approach and key activities, the number of presumptive TB cases referred and undergoing TB testing, and the number of patients diagnosed with TB and their treatment outcomes. The contribution of INGOs to TB diagnosis in their selected townships was calculated as the proportion of INGO-diagnosed new TB cases out of the total NTP-diagnosed new TB cases in the same townships. All four INGOs implemented community-based TB care in challenging contexts, targeting migrants, post-conflict areas, the urban poor, and other vulnerable populations. Two recruited community volunteers via existing community health volunteers or health structures, one via existing community leaderships, and one directly involved TB infected/affected individuals. Two INGOs compensated volunteers via performance-based financing, and two provided financial and in-kind initiatives. All relied on NTP laboratories for diagnosis and TB drugs, but provided direct observation treatment support and treatment follow-up. A total of 21 995 presumptive TB cases were referred for TB diagnosis, with 7 383 (34%) new TB cases diagnosed and almost all (98%) successfully treated. The four INGOs contributed to the detection of, on average, 36% (7 383/20 663) of the total new TB cases in their respective townships (range: 15-52%). Community-based TB care supported by INGOs successfully achieved TB case detection in hard-to-reach and vulnerable populations. This is vital to achieving the World Health Organization End TB Strategy targets. Strategies to ensure sustainability of the programs should be explored, including the need for longer-term commitment of INGOs.

  18. Utilizing an Innovative Evaluation Model To Assess Impacts of Training Adult Educators on Reaching Limited Resource Audiences.

    ERIC Educational Resources Information Center

    Safrit, R. Dale; And Others

    An interagency conference, Reading Families and Youth Who Have Limited Resources, was held in September 1992. Over a 2-day period, 186 adult educators and human service professionals participated in 27 different workshops. An innovative evaluation model was developed to assess the impacts of conference participation on reaching audiences who have…

  19. Automatic small target detection in synthetic infrared images

    NASA Astrophysics Data System (ADS)

    Yardımcı, Ozan; Ulusoy, Ä.°lkay

    2017-05-01

    Automatic detection of targets from far distances is a very challenging problem. Background clutter and small target size are the main difficulties which should be solved while reaching a high detection performance as well as a low computational load. The pre-processing, detection and post-processing approaches are very effective on the final results. In this study, first of all, various methods in the literature were evaluated separately for each of these stages using the simulated test scenarios. Then, a full system of detection was constructed among available solutions which resulted in the best performance in terms of detection. However, although a precision rate as 100% was reached, the recall values stayed low around 25-45%. Finally, a post-processing method was proposed which increased the recall value while keeping the precision at 100%. The proposed post-processing method, which is based on local operations, increased the recall value to 65-95% in all test scenarios.

  20. Medicine authentication technology as a counterfeit medicine-detection tool: a Delphi method study to establish expert opinion on manual medicine authentication technology in secondary care.

    PubMed

    Naughton, Bernard; Roberts, Lindsey; Dopson, Sue; Brindley, David; Chapman, Stephen

    2017-05-06

    This study aims to establish expert opinion and potential improvements for the Falsified Medicines Directive mandated medicines authentication technology. A two-round Delphi method study using an online questionnaire. Large National Health Service (NHS) foundation trust teaching hospital. Secondary care pharmacists and accredited checking technicians. Seven-point rating scale answers which reached a consensus of 70-80% with a standard deviation (SD) of <1.0. Likert scale questions which reached a consensus of 70-80%, a SD of <1.0 and classified as important according to study criteria. Consensus expert opinion has described database cross-checking technology as quick and user friendly and suggested the inclusion of an audio signal to further support the detection of counterfeit medicines in secondary care (70% consensus, 0.9 SD); other important consensus with a SD of <1.0 included reviewing the colour and information in warning pop up screens to ensure they were not mistaken for the 'already dispensed here' pop up, encouraging the dispenser/checker to act on the warnings and making it mandatory to complete an 'action taken' documentation process to improve the quarantine of potentially counterfeit, expired or recalled medicines. This paper informs key opinion leaders and decision makers as to the positives and negatives of medicines authentication technology from an operator's perspective and suggests the adjustments which may be required to improve operator compliance and the detection of counterfeit medicines in the secondary care sector. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  1. A 3-year survey of Italian honey bee-collected pollen reveals widespread contamination by agricultural pesticides.

    PubMed

    Tosi, Simone; Costa, Cecilia; Vesco, Umberto; Quaglia, Giancarlo; Guido, Giovanni

    2018-02-15

    Honey bee (Apis mellifera L.) health is compromised by complex interactions between multiple stressors, among which pesticides play a major role. To better understand the extent of honey bee colonies' exposure to pesticides in time and space, we conducted a survey by collecting corbicular pollen from returning honey bee foragers in 53 Italian apiaries during the active beekeeping season of 3 subsequent years (2012-2014). Of 554 pollen samples analysed for pesticide residues, 62% contained at least one pesticide. The overall rate of multiresidual samples (38%) was higher than the rate of single pesticide samples (24%), reaching a maximum of 7 pesticides per sample (1%). Over 3years, 18 different pesticides were detected (10 fungicides and 8 insecticides) out of 66 analysed. Pesticide concentrations reached the level of concern for bee health (Hazard Quotient (HQ) higher than 1000) at least once in 13% of the apiaries and exceeded the thresholds of safety for human dietary intake (Acute Reference Dose (ARfD), the Acceptable Daily Intake (ADI), and the Maximum Residue Limit (MRL)) in 39% of the analysis. The pesticide which was most frequently detected was the insecticide chlorpyrifos (30% of the samples overall, exceeding ARfD, ADI, or MRL in 99% of the positive ones), followed by the fungicides mandipropamid (19%), metalaxyl (16%), spiroxamine (15%), and the neonicotinoid insecticide imidacloprid (12%). Imidacloprid had also the highest HQ level (5054, with 12% of its positive samples with HQ higher than 1000). This 3year survey provides further insights on the contamination caused by agricultural pesticide use on honey bee colonies. Bee-collected pollen is shown to be a valuable tool for environmental monitoring, and for the detection of illegal uses of pesticides. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Specific characterization of non-steroidal selective androgen peceptor modulators using supercritical fluid chromatography coupled to ion-mobility mass spectrometry: application to the detection of enobosarm in bovine urine.

    PubMed

    Beucher, Laure; Dervilly-Pinel, Gaud; Cesbron, Nora; Penot, Mylène; Gicquiau, Audrey; Monteau, Fabrice; Le Bizec, Bruno

    2017-02-01

    Currently under development for therapeutic purposes in human medicine, non-steroidal selective androgen receptor modulators (non-steroidal SARMs) are also known to impact growth associated pathways. As such, they present a potential for abuse in sports and food-producing animals as interesting alternative anabolic substances. Forbidden since 2008 by the World Anti-Doping Agency (WADA) these compounds are however easily available and could be (mis)used in livestock production as growth promoters. To prevent such practices, dedicated analytical strategies have to be developed for specific and sensitive detection of these compounds in biological matrices. Using an innovative analytical platform constituted of supercritical fluid chromatography coupled to ion mobility-mass spectrometry, the present study enabled efficient separation and identification in urine of 4 of these drugs (andarine, bicalutamide, hydroxyflutamide, and enobosarm) in accordance with European Union criteria (Commission Decision 2002/657/EC). Besides providing information about compounds structure and behaviour in gas phase, such a coupling enabled reaching low limits of detection (LOD < 0.05 ng.mL -1 for andarine and limits of detection < 0.005 ng.mL -1 for the three others) in urine with good repeatability (CV < 21 %). The workflow has been applied to quantitative determination of enobosarm elimination in urine of treated bovine (200 mg, oral). Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Sample preparation for arsenic speciation analysis in baby food by generation of substituted arsines with atomic absorption spectrometry detection.

    PubMed

    Huber, Charles S; Vale, Maria Goreti R; Dessuy, Morgana B; Svoboda, Milan; Musil, Stanislav; Dědina, Jiři

    2017-12-01

    A slurry sampling procedure for arsenic speciation analysis in baby food by arsane generation, cryogenic trapping and detection with atomic absorption spectrometry is presented. Several procedures were tested for slurry preparation, including different reagents (HNO 3 , HCl and tetramethylammonium hydroxide - TMAH) and their concentrations, water bath heating and ultrasound-assisted agitation. The best results for inorganic arsenic (iAs) and dimethylarsinate (DMA) were reached when using 3molL -1 HCl under heating and ultrasound-assisted agitation. The developed method was applied for the analysis of five porridge powder and six baby meal samples. The trueness of the method was checked with a certified reference material (CRM) of total arsenic (tAs), iAs and DMA in rice (ERM-BC211). Arsenic recoveries (mass balance) for all samples and CRM were performed by the determination of the tAs by inductively coupled plasma mass spectrometry (ICP-MS) after microwave-assisted digestion and its comparison against the sum of the results from the speciation analysis. The relative limits of detection were 0.44, 0.24 and 0.16µgkg -1 for iAs, methylarsonate and DMA, respectively. The concentrations of the most toxic arsenic species (iAs) in the analyzed baby food samples ranged between 4.2 and 99µgkg -1 which were below the limits of 300, 200 and 100µgkg -1 set by the Brazilian, Chinese and European legislation, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. [Detection of occupational hazards in a large shipbuilding factory].

    PubMed

    Du, Weijia; Wang, Zhi; Zhang, Hai; Zhou, Liping; Huang, Minzhi; Liu, Yimin

    2014-03-01

    To provide evidence for the prevention and treatment of occupational diseases by the analysis of existing major occupational hazards and health conditions of workers in a large shipbuilding factory. Field investigation of occupational conditions was conducted to examine the existence of occupational hazards from 2009 to 2012 in a large shipbuilding factory, and then the results of physical examination among its workers were analyzed. Other than the metal dust (total dust), the levels of other dusts and manganese dioxide were beyond the national standard to various degrees, and through a sampling point detection, it was found that the levels of manganese dioxide exceeded the standard by 42.8%. The maximum time-weighted average concentration in individuals was 27.927 mg/m(3), much higher than the national standard limit. For harmful gas detection in individuals, xylene was 38.4%above the standard level (the highest concentration reached 1447.7 mg/m(3)); moreover, both toluene and ethylbenzene exceeded the national standard at different levels. Among the noise-exposed workers, 71%worked in the environment where the daily noise was above the limit of the national standard (85 dB). Physical examinations in 2010 and 2012 showed that the abnormal rate of audiometry in workers was higher than 15%. Dust (total dust), manganese dioxide, benzene, and noise are the main occupational hazards among the workers in the large shipbuilding factory, and strict protection and control for these hazards should be implemented for the workers in the factory.

  5. Characterisation and optimisation of the new Prompt Gamma-ray Activation Analysis (PGAA) facility at FRM II

    NASA Astrophysics Data System (ADS)

    Canella, Lea; Kudějová, Petra; Schulze, Ralf; Türler, Andreas; Jolie, Jan

    2011-04-01

    At the research reactor Forschungs-Neutronenquelle Heinz Maier-Leibnitz (FRM II) a new Prompt Gamma-ray Activation Analysis (PGAA) facility was installed. The instrument was originally built and operating at the spallation source at the Paul Scherrer Institute in Switzerland. After a careful re-design in 2004-2006, the new PGAA instrument was ready for operation at FRM II. In this paper the main characteristics and the current operation conditions of the facility are described. The neutron flux at the sample position can reach up 6.07×1010 [cm-2 s-1], thus the optimisation of some parameters, e.g. the beam background, was necessary in order to achieve a satisfactory analytical sensitivity for routine measurements. Once the optimal conditions were reached, detection limits and sensitivities for some elements, like for example H, B, C, Si, or Pb, were calculated and compared with other PGAA facilities. A standard reference material was also measured in order to show the reliability of the analysis under different conditions at this instrument.

  6. Occurrence of Organic Contaminants in Lower Reaches of River Ganges, India

    NASA Astrophysics Data System (ADS)

    Dutta Gupta, S.; Bhattacharya, A.; Mukherjee, A.; Bhattacharya, J.

    2016-12-01

    The Gangetic plain of eastern India has been long known as the "bread basket" of the Indian subcontinent. However, indiscriminate use of pesticides in the agricultural fields is to increase crop production. These resulted to increased vulnerability of pesticide pollution of the hydrological systems of the area, potentially exposing to significant human health consequences. Our present study delineate pesticides occurrence in lower Ganges in West Bengal. The major organic contaminants regularly detected in the studied reaches of the Ganges belong to wide range of herbicides and insecticides, which especially include organochlorides and organophosphates such as Aldrin, Alachlor, Lindane, Malathion, Chlorpyrifos and Methyl parathion. Results show Alachlor and Malathion were the most abundant organic contaminant in the river. Among the other pesticides, one of the most venomous substances, Malathion has been noticed from the last year insecticide screening study. The mean concentration of river water Malathion was found to be 5 times higher than the maximum concentration limit (MCL). Presence of Malathion or its derivative Malaoxon in river water is suspected to be caused by agricultural run-off and it showed a good correlation with river water chlorine concentrations.

  7. Hallmarks in prostate cancer imaging with Ga68-PSMA-11-PET/CT with reference to detection limits and quantitative properties.

    PubMed

    Sanchez-Crespo, Alejandro; Jussing, Emma; Björklund, Ann-Charlotte; Pokrovskaja Tamm, Katja

    2018-04-04

    Gallium-68-labeled prostate-specific antigen positron emission tomography/computed tomography imaging (Ga68-PSMA-11-PET/CT) has emerged as a potential gold standard for prostate cancer (PCa) diagnosis. However, the imaging limitations of this technique at the early state of PCa recurrence/metastatic spread are still not well characterized. The aim of this study was to determine the quantitative properties and the fundamental imaging limits of Ga68-PSMA-11-PET/CT in localizing small PCa cell deposits. The human PCa LNCaP cells (PSMA expressing) were grown and collected as single cell suspension or as 3D-spheroids at different cell numbers and incubated with Ga68-PSMA-11. Thereafter, human HCT116 cells (PSMA negative) were added to a total cell number of 2 × 10 5 cells per tube. The tubes were then pelleted and the supernatant aspirated. A whole-body PET/CT scanner with a clinical routine protocol was used for imaging the pellets inside of a cylindrical water phantom with increasing amounts of background activity. The actual activity bound to the cells was also measured in an automatic gamma counter. Imaging detection limits and activity recovery coefficients as a function of LNCaP cell number were obtained. The effect of Ga68-PSMA-11 mass concentration on cell binding was also investigated in samples of LnCaP cells incubated with increasing concentrations of radioligand. A total of 1 × 10 4 LNCaP cells mixed in a pellet of 2 × 10 5 cells were required to reach a 50% detection probability with Ga68-PSMA-11-PET/CT without background. With a background level of 1 kBq/ml, between 4 × 10 5 and 1 × 10 6 cells are required. The radioligand equilibrium dissociation constant was 27.05 nM, indicating high binding affinity. Hence, the specific activity of the radioligand has a profound effect on image quantification. Ga68-PSMA-11-PET detects a small number of LNCaP cells even when they are mixed in a population of non-PSMA expressing cells and in the presence of background. The obtained image detection limits and characteristic quantification properties of Ga68-PSMA-11-PET/CT are essential hallmarks for the individualization of patient management. The use of the standardized uptake value for Ga68-PSMA-11-PET/CT image quantification should be precluded.

  8. Channel morphology and bed-sediment characteristics before and after riparian vegetation clearing in the Cottonwood Ranch, Platte River, Nebraska, water years 2001-2004

    USGS Publications Warehouse

    Kinzel, Paul J.; Nelson, Jonathan M.; Heckman, Ashley K.

    2006-01-01

    Riparian areas along a reach of Platte River passing through Nebraska Public Power District's Cottonwood Ranch Property were modified during 2002 to 2004 to enhance in-channel habitats for endangered and threatened avian species. A component of this alteration involved the removal of riparian vegetation from riverbanks and islands to provide roosting habitat for the endangered whooping crane and to provide nesting and foraging habitat for the endangered least tern and threatened piping plover. It was hypothesized that the removal of riparian vegetation could have the effect of stimulating channel widening in this reach by increasing the potential of these surfaces to erode under natural fluvial action. It also was hypothesized that as a direct or indirect consequence of the alterations, a local increase in sediment supply also might occur, potentially resulting in geomorphic change downstream and possibly initiating negative third-party effects. The cumulative effects of the management activities on the channel morphology and sediment transport in this reach were monitored during water years 2001-2004 by measuring transect elevation profiles and bed-sediment-size gradations upstream, within, and downstream from the managed area before and after the development activities. An analysis of variance (ANOVA) was performed to determine if the geomorphic variables measured before and after the development activities were significantly different. Although statistically significant differences were detected in some of the variables, increases in mean bed elevation did not occur in a greater percentage of the monitoring sections measured downstream compared to upstream from the management activities. This result suggests that the management activities did not have a substantial effect on the downstream river channel morphology and sediment transport. However, it is important to place these short-term and site-specific results in the context that river flows following the management activities were at historical low rates, and therefore the potential to affect and the opportunity to detect possible geomorphic change within and downstream from the managed reach were limited.

  9. Project Reach 1988-89. OREA Report.

    ERIC Educational Resources Information Center

    Berney, Tomi D.; Lista, Carlos A.

    Project Reach, serving 390 students of limited English proficiency at William H. Taft high school in New York, was fully implemented in 1988-89. Project Reach endeavored to help students develop their English and native language skills and make academic progress through bilingual content area courses. During the school year, participating students…

  10. Periphyton response to increased light and salmon carcass introduction in northern California streams

    USGS Publications Warehouse

    Ambrose, H.E.; Wilzbach, M.A.; Cummins, K.W.

    2004-01-01

    Periphyton response to riparian canopy opening and salmon carcass addition in coastal streams of northern California was evaluated in a manipulative field experiment. The experiment followed a split-plot design, with streams as whole plots and two 100-m reaches in each of 6 streams as subplots. At the subplot level, riparian hardwoods were removed from one reach in each stream. At the whole-plot level, carcasses were added to both open- and closed-canopy reaches of 3 of the streams. Thus, treatments consisted of reaches with open or closed canopies, in the presence and absence of carcasses. Nutrient limitation of the periphyton was assessed in 2 streams (1 with carcasses and 1 without carcasses) using nutrient-diffusing clay saucers (N-enriched, P-enriched, N+P-enriched, or unenriched control) incubated in open- and closed-canopy reaches in the streams. Canopy and carcass treatments did not affect gross primary productivity or periphyton biomass on natural substrates. The periphyton assemblage consisted primarily of diatoms in all reaches on all dates. N amendment of agar in nutrient-diffusing, clay saucers and canopy removal increased biofilm ash-free dry mass on the saucers, but carcass introduction did not. Failure of periphyton to respond to carcass addition may have reflected overriding light limitation, inadequate within-stream retention of carcass nutrients, and/or limitations of the study design.

  11. Searches for Gravitational Waves from Known Pulsars with Science Run 5 LIGO Data

    NASA Astrophysics Data System (ADS)

    Abbott, B. P.; Abbott, R.; Acernese, F.; Adhikari, R.; Ajith, P.; Allen, B.; Allen, G.; Alshourbagy, M.; Amin, R. S.; Anderson, S. B.; Anderson, W. G.; Antonucci, F.; Aoudia, S.; Arain, M. A.; Araya, M.; Armandula, H.; Armor, P.; Arun, K. G.; Aso, Y.; Aston, S.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P.; Ballardin, G.; Ballmer, S.; Barker, C.; Barker, D.; Barone, F.; Barr, B.; Barriga, P.; Barsotti, L.; Barsuglia, M.; Barton, M. A.; Bartos, I.; Bassiri, R.; Bastarrika, M.; Bauer, Th. S.; Behnke, B.; Beker, M.; Benacquista, M.; Betzwieser, J.; Beyersdorf, P. T.; Bigotta, S.; Bilenko, I. A.; Billingsley, G.; Birindelli, S.; Biswas, R.; Bizouard, M. A.; Black, E.; Blackburn, J. K.; Blackburn, L.; Blair, D.; Bland, B.; Boccara, C.; Bodiya, T. P.; Bogue, L.; Bondu, F.; Bonelli, L.; Bork, R.; Boschi, V.; Bose, S.; Bosi, L.; Braccini, S.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Brau, J. E.; Bridges, D. O.; Brillet, A.; Brinkmann, M.; Brisson, V.; Van Den Broeck, C.; Brooks, A. F.; Brown, D. A.; Brummit, A.; Brunet, G.; Budzyński, R.; Bulik, T.; Bullington, A.; Bulten, H. J.; Buonanno, A.; Burmeister, O.; Buskulic, D.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Calloni, E.; Camp, J. B.; Campagna, E.; Cannizzo, J.; Cannon, K. C.; Canuel, B.; Cao, J.; Carbognani, F.; Cardenas, L.; Caride, S.; Castaldi, G.; Caudill, S.; Cavaglià, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C.; Cesarini, E.; Chalermsongsak, T.; Chalkley, E.; Charlton, P.; Chassande-Mottin, E.; Chatterji, S.; Chelkowski, S.; Chen, Y.; Chincarini, A.; Christensen, N.; Chung, C. T. Y.; Clark, D.; Clark, J.; Clayton, J. H.; Cleva, F.; Coccia, E.; Cokelaer, T.; Colacino, C. N.; Colas, J.; Colla, A.; Colombini, M.; Conte, R.; Cook, D.; Corbitt, T. R. C.; Corda, C.; Cornish, N.; Corsi, A.; Coulon, J.-P.; Coward, D.; Coyne, D. C.; Creighton, J. D. E.; Creighton, T. D.; Cruise, A. M.; Culter, R. M.; Cumming, A.; Cunningham, L.; Cuoco, E.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dari, A.; Dattilo, V.; Daudert, B.; Davier, M.; Davies, G.; Daw, E. J.; Day, R.; De Rosa, R.; DeBra, D.; Degallaix, J.; del Prete, M.; Dergachev, V.; Desai, S.; DeSalvo, R.; Dhurandhar, S.; Di Fiore, L.; Di Lieto, A.; Emilio, M. Di Paolo; Di Virgilio, A.; Díaz, M.; Dietz, A.; Donovan, F.; Dooley, K. L.; Doomes, E. E.; Drago, M.; Drever, R. W. P.; Dueck, J.; Duke, I.; Dumas, J.-C.; Dwyer, J. G.; Echols, C.; Edgar, M.; Effler, A.; Ehrens, P.; Espinoza, E.; Etzel, T.; Evans, M.; Evans, T.; Fafone, V.; Fairhurst, S.; Faltas, Y.; Fan, Y.; Fazi, D.; Fehrmann, H.; Ferrante, I.; Fidecaro, F.; Finn, L. S.; Fiori, I.; Flaminio, R.; Flasch, K.; Foley, S.; Forrest, C.; Fotopoulos, N.; Fournier, J.-D.; Franc, J.; Franzen, A.; Frasca, S.; Frasconi, F.; Frede, M.; Frei, M.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T.; Fritschel, P.; Frolov, V. V.; Fyffe, M.; Galdi, V.; Gammaitoni, L.; Garofoli, J. A.; Garufi, F.; Gemme, G.; Genin, E.; Gennai, A.; Gholami, I.; Giaime, J. A.; Giampanis, S.; Giardina, K. D.; Giazotto, A.; Goda, K.; Goetz, E.; Goggin, L. M.; González, G.; Gorodetsky, M. L.; Goßler, S.; Gouaty, R.; Granata, M.; Granata, V.; Grant, A.; Gras, S.; Gray, C.; Gray, M.; Greenhalgh, R. J. S.; Gretarsson, A. M.; Greverie, C.; Grimaldi, F.; Grosso, R.; Grote, H.; Grunewald, S.; Guenther, M.; Guidi, G.; Gustafson, E. K.; Gustafson, R.; Hage, B.; Hallam, J. M.; Hammer, D.; Hammond, G. D.; Hanna, C.; Hanson, J.; Harms, J.; Harry, G. M.; Harry, I. W.; Harstad, E. D.; Haughian, K.; Hayama, K.; Heefner, J.; Heitmann, H.; Hello, P.; Heng, I. S.; Heptonstall, A.; Hewitson, M.; Hild, S.; Hirose, E.; Hoak, D.; Hodge, K. A.; Holt, K.; Hosken, D. J.; Hough, J.; Hoyland, D.; Huet, D.; Hughey, B.; Huttner, S. H.; Ingram, D. R.; Isogai, T.; Ito, M.; Ivanov, A.; Jaranowski, P.; Johnson, B.; Johnson, W. W.; Jones, D. I.; Jones, G.; Jones, R.; Sancho de la Jordana, L.; Ju, L.; Kalmus, P.; Kalogera, V.; Kandhasamy, S.; Kanner, J.; Kasprzyk, D.; Katsavounidis, E.; Kawabe, K.; Kawamura, S.; Kawazoe, F.; Kells, W.; Keppel, D. G.; Khalaidovski, A.; Khalili, F. Y.; Khan, R.; Khazanov, E.; King, P.; Kissel, J. S.; Klimenko, S.; Kokeyama, K.; Kondrashov, V.; Kopparapu, R.; Koranda, S.; Kowalska, I.; Kozak, D.; Krishnan, B.; Królak, A.; Kumar, R.; Kwee, P.; La Penna, P.; Lam, P. K.; Landry, M.; Lantz, B.; Lazzarini, A.; Lei, H.; Lei, M.; Leindecker, N.; Leonor, I.; Leroy, N.; Letendre, N.; Li, C.; Lin, H.; Lindquist, P. E.; Littenberg, T. B.; Lockerbie, N. A.; Lodhia, D.; Longo, M.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lu, P.; Lubiński, M.; Lucianetti, A.; Lück, H.; Machenschalk, B.; MacInnis, M.; Mackowski, J.-M.; Mageswaran, M.; Mailand, K.; Majorana, E.; Man, N.; Mandel, I.; Mandic, V.; Mantovani, M.; Marchesoni, F.; Marion, F.; Márka, S.; Márka, Z.; Markosyan, A.; Markowitz, J.; Maros, E.; Marque, J.; Martelli, F.; Martin, I. W.; Martin, R. M.; Marx, J. N.; Mason, K.; Masserot, A.; Matichard, F.; Matone, L.; Matzner, R. A.; Mavalvala, N.; McCarthy, R.; McClelland, D. E.; McGuire, S. C.; McHugh, M.; McIntyre, G.; McKechan, D. J. A.; McKenzie, K.; Mehmet, M.; Melatos, A.; Melissinos, A. C.; Mendell, G.; Menéndez, D. F.; Menzinger, F.; Mercer, R. A.; Meshkov, S.; Messenger, C.; Meyer, M. S.; Michel, C.; Milano, L.; Miller, J.; Minelli, J.; Minenkov, Y.; Mino, Y.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Miyakawa, O.; Moe, B.; Mohan, M.; Mohanty, S. D.; Mohapatra, S. R. P.; Moreau, J.; Moreno, G.; Morgado, N.; Morgia, A.; Morioka, T.; Mors, K.; Mosca, S.; Moscatelli, V.; Mossavi, K.; Mours, B.; MowLowry, C.; Mueller, G.; Muhammad, D.; zur Mühlen, H.; Mukherjee, S.; Mukhopadhyay, H.; Mullavey, A.; Müller-Ebhardt, H.; Munch, J.; Murray, P. G.; Myers, E.; Myers, J.; Nash, T.; Nelson, J.; Neri, I.; Newton, G.; Nishizawa, A.; Nocera, F.; Numata, K.; Ochsner, E.; O'Dell, J.; Ogin, G. H.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pagliaroli, G.; Palomba, C.; Pan, Y.; Pankow, C.; Paoletti, F.; Papa, M. A.; Parameshwaraiah, V.; Pardi, S.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patel, P.; Pedraza, M.; Penn, S.; Perreca, A.; Persichetti, G.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pietka, M.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Pletsch, H. J.; Plissi, M. V.; Poggiani, R.; Postiglione, F.; Prato, M.; Principe, M.; Prix, R.; Prodi, G. A.; Prokhorov, L.; Puncken, O.; Punturo, M.; Puppo, P.; Quetschke, V.; Raab, F. J.; Rabaste, O.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raics, Z.; Rainer, N.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Re, V.; Reed, C. M.; Reed, T.; Regimbau, T.; Rehbein, H.; Reid, S.; Reitze, D. H.; Ricci, F.; Riesen, R.; Riles, K.; Rivera, B.; Roberts, P.; Robertson, N. A.; Robinet, F.; Robinson, C.; Robinson, E. L.; Rocchi, A.; Roddy, S.; Rolland, L.; Rollins, J.; Romano, J. D.; Romano, R.; Romie, J. H.; Rosińska, D.; Röver, C.; Rowan, S.; Rüdiger, A.; Ruggi, P.; Russell, P.; Ryan, K.; Sakata, S.; Salemi, F.; Sandberg, V.; Sannibale, V.; Santamaría, L.; Saraf, S.; Sarin, P.; Sassolas, B.; Sathyaprakash, B. S.; Sato, S.; Satterthwaite, M.; Saulson, P. R.; Savage, R.; Savov, P.; Scanlan, M.; Schilling, R.; Schnabel, R.; Schofield, R.; Schulz, B.; Schutz, B. F.; Schwinberg, P.; Scott, J.; Scott, S. M.; Searle, A. C.; Sears, B.; Seifert, F.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sergeev, A.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sibley, A.; Siemens, X.; Sigg, D.; Sinha, S.; Sintes, A. M.; Slagmolen, B. J. J.; Slutsky, J.; van der Sluys, M. V.; Smith, J. R.; Smith, M. R.; Smith, N. D.; Somiya, K.; Sorazu, B.; Stein, A.; Stein, L. C.; Steplewski, S.; Stochino, A.; Stone, R.; Strain, K. A.; Strigin, S.; Stroeer, A.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, K.-X.; Sung, M.; Sutton, P. J.; Swinkels, B.; Szokoly, G. P.; Talukder, D.; Tang, L.; Tanner, D. B.; Tarabrin, S. P.; Taylor, J. R.; Taylor, R.; Terenzi, R.; Thacker, J.; Thorne, K. A.; Thorne, K. S.; Thüring, A.; Tokmakov, K. V.; Toncelli, A.; Tonelli, M.; Torres, C.; Torrie, C.; Tournefier, E.; Travasso, F.; Traylor, G.; Trias, M.; Trummer, J.; Ugolini, D.; Ulmen, J.; Urbanek, K.; Vahlbruch, H.; Vajente, G.; Vallisneri, M.; van den Brand, J. F. J.; van der Putten, S.; Vass, S.; Vaulin, R.; Vavoulidis, M.; Vecchio, A.; Vedovato, G.; van Veggel, A. A.; Veitch, J.; Veitch, P.; Veltkamp, C.; Verkindt, D.; Vetrano, F.; Viceré, A.; Villar, A.; Vinet, J.-Y.; Vocca, H.; Vorvick, C.; Vyachanin, S. P.; Waldman, S. J.; Wallace, L.; Ward, R. L.; Was, M.; Weidner, A.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wen, S.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; Whiting, B. F.; Wilkinson, C.; Willems, P. A.; Williams, H. R.; Williams, L.; Willke, B.; Wilmut, I.; Winkelmann, L.; Winkler, W.; Wipf, C. C.; Wiseman, A. G.; Woan, G.; Wooley, R.; Worden, J.; Wu, W.; Yakushin, I.; Yamamoto, H.; Yan, Z.; Yoshida, S.; Yvert, M.; Zanolin, M.; Zhang, J.; Zhang, L.; Zhao, C.; Zotov, N.; Zucker, M. E.; Zweizig, J.; Bégin, S.; Corongiu, A.; D'Amico, N.; Freire, P. C. C.; Hessels, J. W. T.; Hobbs, G. B.; Kramer, M.; Lyne, A. G.; Manchester, R. N.; Marshall, F. E.; Middleditch, J.; Possenti, A.; Ransom, S. M.; Stairs, I. H.; Stappers, B.; LIGO Scientific Collaboration; Virgo Collaboration

    2010-04-01

    We present a search for gravitational waves from 116 known millisecond and young pulsars using data from the fifth science run of the LIGO detectors. For this search, ephemerides overlapping the run period were obtained for all pulsars using radio and X-ray observations. We demonstrate an updated search method that allows for small uncertainties in the pulsar phase parameters to be included in the search. We report no signal detection from any of the targets and therefore interpret our results as upper limits on the gravitational wave signal strength. The most interesting limits are those for young pulsars. We present updated limits on gravitational radiation from the Crab pulsar, where the measured limit is now a factor of 7 below the spin-down limit. This limits the power radiated via gravitational waves to be less than ~2% of the available spin-down power. For the X-ray pulsar J0537 - 6910 we reach the spin-down limit under the assumption that any gravitational wave signal from it stays phase locked to the X-ray pulses over timing glitches, and for pulsars J1913+1011 and J1952+3252 we are only a factor of a few above the spin-down limit. Of the recycled millisecond pulsars, several of the measured upper limits are only about an order of magnitude above their spin-down limits. For these our best (lowest) upper limit on gravitational wave amplitude is 2.3 × 10-26 for J1603 - 7202 and our best (lowest) limit on the inferred pulsar ellipticity is 7.0 × 10-8 for J2124 - 3358.

  12. Improvement of highly sensitive lidar with a thumb-sized sensor-head built using an optical fiber preamplifier

    NASA Astrophysics Data System (ADS)

    Inoue, Daisuke; Ichikawa, Tadashi; Matsubara, Hiroyuki; Mao, Xueon; Maeda, Mitsutoshi; Nagashima, Chie; Kagami, Manabu

    2012-06-01

    We have developed a LIDAR system with a sensor head which, although it includes a scanning mechanism, is less than 20 cc in size. The system is not only small, but is also highly sensitive. Our LIDAR system is based on time-of-flight measurements, and incorporates an optical fiber. The main feature of our system is the utilization of optical amplifiers for both the transmitter and the receiver, and the optical amplifiers enable us to exceed the detection limit set by thermal noise. In conventional LIDAR systems the detection limit is determined by the thermal noise, because the avalanche photo-diodes (APD) and trans-impedance amplifiers (TIA) that they use detect the received signals directly. In the case of our LIDAR system, the received signal is amplified by an optical fiber amplifier before reaching the photo diode and the TIA. Therefore, our LIDAR system boosts the signal level before the weak incoming signal is depleted by thermal noise. There are conditions under which the noise figure for the combination of an optical fiber amplifier and a photo diode is superior to the noise figure for an avalanche photo diode. We optimized the gains of the optical fiber amplifier and the TIA in our LIDAR system such that it would be capable of detecting a single photon. As a result, the detection limit of our system is determined by shot noise. We have previously demonstrated optical pre-amplified LIDAR with a perfect co-axial optical system[1]. For this we used a variable optical attenuator to remove internal reflection from the transmission and receiving lenses. However, the optical attenuator had an insertion loss of 6dB which reduced the sensitivity of the LIDAR. We re-designed the optical system such that it was semi-co-axial and removed the variable optical attenuator. As a result, we succeeded in scanning up to a range of 80 m. This small and highly sensitive measurement technology shows great potential for use in LIDAR.

  13. Extravascular transport in normal and tumor tissues.

    PubMed

    Jain, R K; Gerlowski, L E

    1986-01-01

    The transport characteristics of the normal and tumor tissue extravascular space provide the basis for the determination of the optimal dosage and schedule regimes of various pharmacological agents in detection and treatment of cancer. In order for the drug to reach the cellular space where most therapeutic action takes place, several transport steps must first occur: (1) tissue perfusion; (2) permeation across the capillary wall; (3) transport through interstitial space; and (4) transport across the cell membrane. Any of these steps including intracellular events such as metabolism can be the rate-limiting step to uptake of the drug, and these rate-limiting steps may be different in normal and tumor tissues. This review examines these transport limitations, first from an experimental point of view and then from a modeling point of view. Various types of experimental tumor models which have been used in animals to represent human tumors are discussed. Then, mathematical models of extravascular transport are discussed from the prespective of two approaches: compartmental and distributed. Compartmental models lump one or more sections of a tissue or body into a "compartment" to describe the time course of disposition of a substance. These models contain "effective" parameters which represent the entire compartment. Distributed models consider the structural and morphological aspects of the tissue to determine the transport properties of that tissue. These distributed models describe both the temporal and spatial distribution of a substance in tissues. Each of these modeling techniques is described in detail with applications for cancer detection and treatment in mind.

  14. Zero-phonon-line emission of single molecules for applications in quantum information processing

    NASA Astrophysics Data System (ADS)

    Kiraz, Alper; Ehrl, M.; Mustecaplioglu, O. E.; Hellerer, T.; Brauchle, C.; Zumbusch, A.

    2005-07-01

    A single photon source which generates transform limited single photons is highly desirable for applications in quantum optics. Transform limited emission guarantees the indistinguishability of the emitted single photons. This, in turn brings groundbreaking applications in linear optics quantum information processing within an experimental reach. Recently, self-assembled InAs quantum dots and trapped atoms have successfully been demonstrated as such sources for highly indistinguishable single photons. Here, we demonstrate that nearly transform limited zero-phonon-line (ZPL) emission from single molecules can be obtained by using vibronic excitation. Furthermore we report the results of coincidence detection experiments at the output of a Michelson-type interferometer. These experiments reveal Hong-Ou-Mandel correlations as a proof of the indistinguishability of the single photons emitted consecutively from a single molecule. Therefore, single molecules constitute an attractive alternative to single InAs quantum dots and trapped atoms for applications in linear optics quantum information processing. Experiments were performed with a home-built confocal microscope keeping the sample in a superfluid liquid Helium bath at 1.4K. We investigated terrylenediimide (TDI) molecules highly diluted in hexadecane (Shpol'skii matrix). A continuous wave single mode dye laser was used for excitation of vibronic transitions of individual molecules. From the integral fluorescence, the ZPL of single molecules was selected with a spectrally narrow interference filter. The ZPL emission was then sent to a scanning Fabry-Perot interferometer for linewidth measurements or a Michelson-type interferometer for coincidence detection.

  15. Beyond the Great Wall: gold of the silk roads and the first empire of the steppes.

    PubMed

    Radtke, Martin; Reiche, Ina; Reinholz, Uwe; Riesemeier, Heinrich; Guerra, Maria F

    2013-02-05

    Fingerprinting ancient gold work requires the use of nondestructive techniques with high spatial resolution (down to 25 μm) and good detection limits (micrograms per gram level). In this work experimental setups and protocols for synchrotron radiation induced X-ray fluorescence (SRXRF) at the BAMline of the Berlin electron storage ring company for synchrotron radiation (BESSY) in Berlin for the measurement of characteristic trace elements of gold are compared considering the difficulties, shown in previous works, connected to the quantification of Pt. The best experimental conditions and calculation methods were achieved by using an excitation energy of 11.58 keV, a silicon drift chamber detector (SDD) detector, and pure element reference standards. A detection limit of 3 μg/g has been reached. This newly developed method was successfully applied to provenancing the Xiongnu gold from the Gol Mod necropolis, excavated under the aegis of the United Nations Educational, Scientific and Cultural Organization (UNESCO). The composition of the base alloys and the presence of Pt and Sn showed that, contrary to what is expected, the gold foils from the first powerful empire of the steppes along the Great Wall were produced with alluvial gold from local placer deposits located in Zaamar, Boroo, and in the Selenga River.

  16. Probing Reionization at z≥7 with HST's Near-Infrared Grisms

    NASA Astrophysics Data System (ADS)

    Borello Schmidt, Kasper

    2015-08-01

    The epoch of reionization, i.e. the transition of the IGM from neutral to fully ionized, is essential for our understanding of the evolution of the Universe and the formation of the first stars and galaxies. The first results at z≤ 7 suggest that the reionization happened in a patchy, rather than smooth, fashion. It is still unclear whether galaxies at z≥7 prefer a patchy reionization scenario as well. The Grism Lens-Amplified Survey from Space (GLASS) has obtained spectra of ten thousands of objects in and behind 10 massive galaxy clusters, including the six Hubble Frontier Fields. Coaming the Hubble grism spectroscopy from GLASS results in 100s of spectra of z≥7 galaxy candidates. Taking advantage of the lensing magnification from the foreground clusters, the GLASS spectra reaches unprecedented depths in the near-infrared with flux limits below 10-18 erg/s/cm2. This has resulted in several Lyα detections at z˜7, tight limits on the emission line fluxes for non-detections, and the equivalent width distribution of Lyα in the very earlier Universe. Taking advantage of the extensive spectroscopic samples of z≥7 galaxies from GLASS, I will show how these samples can give us and unprecedented view of the cosmic reionization at z≥7.

  17. Delineation of spatial-temporal patterns of groundwater/surface-water interaction along a river reach (Aa River, Belgium) with transient thermal modeling

    NASA Astrophysics Data System (ADS)

    Anibas, Christian; Tolche, Abebe Debele; Ghysels, Gert; Nossent, Jiri; Schneidewind, Uwe; Huysmans, Marijke; Batelaan, Okke

    2018-05-01

    Among the advances made in analytical and numerical analysis methods to quantify groundwater/surface-water interaction, one methodology that stands out is the use of heat as an environmental tracer. A large data set of river and riverbed temperature profiles from the Aa River in Belgium has been used to examine the spatial-temporal variations of groundwater/surface-water interaction. Exchange fluxes were calculated with the numerical heat-transport code STRIVE. The code was applied in transient mode to overcome previous limitations of steady-state analysis, and allowed for the calculation of model quality. In autumn and winter the mean exchange fluxes reached -90 mm d-1, while in spring and early summer fluxes were -42 mm d-1. Predominantly gaining conditions occurred along the river reach; however, in a few areas the direction of flow changed in time. The river banks showed elevated fluxes up to a factor of 3 compared to the center of the river. Higher fluxes were detected in the upstream section of the reach. Due to the influence of exchange fluxes along the river banks, larger temporal variations were found in the downstream section. The exchange fluxes at the river banks seemed more driven by variable local exchange flows, while the center of the river was dominated by deep and steady regional groundwater flows. These spatial and temporal differences in groundwater/surface-water exchange show the importance of long-term investigations on the driving forces of hyporheic processes across different scales.

  18. Focal plane wavefront sensor achromatization: The multireference self-coherent camera

    NASA Astrophysics Data System (ADS)

    Delorme, J. R.; Galicher, R.; Baudoz, P.; Rousset, G.; Mazoyer, J.; Dupuis, O.

    2016-04-01

    Context. High contrast imaging and spectroscopy provide unique constraints for exoplanet formation models as well as for planetary atmosphere models. But this can be challenging because of the planet-to-star small angular separation (<1 arcsec) and high flux ratio (>105). Recently, optimized instruments like VLT/SPHERE and Gemini/GPI were installed on 8m-class telescopes. These will probe young gazeous exoplanets at large separations (≳1 au) but, because of uncalibrated phase and amplitude aberrations that induce speckles in the coronagraphic images, they are not able to detect older and fainter planets. Aims: There are always aberrations that are slowly evolving in time. They create quasi-static speckles that cannot be calibrated a posteriori with sufficient accuracy. An active correction of these speckles is thus needed to reach very high contrast levels (>106-107). This requires a focal plane wavefront sensor. Our team proposed a self coherent camera, the performance of which was demonstrated in the laboratory. As for all focal plane wavefront sensors, these are sensitive to chromatism and we propose an upgrade that mitigates the chromatism effects. Methods: First, we recall the principle of the self-coherent camera and we explain its limitations in polychromatic light. Then, we present and numerically study two upgrades to mitigate chromatism effects: the optical path difference method and the multireference self-coherent camera. Finally, we present laboratory tests of the latter solution. Results: We demonstrate in the laboratory that the multireference self-coherent camera can be used as a focal plane wavefront sensor in polychromatic light using an 80 nm bandwidth at 640 nm (bandwidth of 12.5%). We reach a performance that is close to the chromatic limitations of our bench: 1σ contrast of 4.5 × 10-8 between 5 and 17 λ0/D. Conclusions: The performance of the MRSCC is promising for future high-contrast imaging instruments that aim to actively minimize the speckle intensity so as to detect and spectrally characterize faint old or light gaseous planets.

  19. Hygroscopic salts and the potential for life on Mars.

    PubMed

    Davila, Alfonso F; Duport, Luis Gago; Melchiorri, Riccardo; Jänchen, Jochen; Valea, Sergio; de Los Rios, Asunción; Fairén, Alberto G; Möhlmann, Diedrich; McKay, Christopher P; Ascaso, Carmen; Wierzchos, Jacek

    2010-01-01

    Hygroscopic salts have been detected in soils in the northern latitudes of Mars, and widespread chloride-bearing evaporitic deposits have been detected in the southern highlands. The deliquescence of hygroscopic minerals such as chloride salts could provide a local and transient source of liquid water that would be available for microorganisms on the surface. This is known to occur in the Atacama Desert, where massive halite evaporites have become a habitat for photosynthetic and heterotrophic microorganisms that take advantage of the deliquescence of the salt at certain relative humidity (RH) levels. We modeled the climate conditions (RH and temperature) in a region on Mars with chloride-bearing evaporites, and modeled the evolution of the water activity (a(w)) of the deliquescence solutions of three possible chloride salts (sodium chloride, calcium chloride, and magnesium chloride) as a function of temperature. We also studied the water absorption properties of the same salts as a function of RH. Our climate model results show that the RH in the region with chloride-bearing deposits on Mars often reaches the deliquescence points of all three salts, and the temperature reaches levels above their eutectic points seasonally, in the course of a martian year. The a(w) of the deliquescence solutions increases with decreasing temperature due mainly to the precipitation of unstable phases, which removes ions from the solution. The deliquescence of sodium chloride results in transient solutions with a(w) compatible with growth of terrestrial microorganisms down to 252 K, whereas for calcium chloride and magnesium chloride it results in solutions with a(w) below the known limits for growth at all temperatures. However, taking the limits of a(w) used to define special regions on Mars, the deliquescence of calcium chloride deposits would allow for the propagation of terrestrial microorganisms at temperatures between 265 and 253 K, and for metabolic activity (no growth) at temperatures between 253 and 233 K.

  20. Commercial-scale demonstration of the Liquid Phase Methanol (LPMEOH{trademark}) process. Technical progress report number 11, January 1--March 31, 1997

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1997-06-11

    During this quarter, the third draft of the Topical Report on Process Economics Studies was issued for review. A recommendation to continue with design verification testing on the coproduction of methanol and dimethyl ether (DME) was made. A liquid phase dimethyl ether (LPDME) catalyst system with reasonable long-term activity and stability is being developed, and a decision to proceed with a proof-of-concept test run at the LaPorte Alternative Fuels Development Unit (AFDU) is pending the release of a memo from Air Products on the catalyst targets and corresponding economics for a commercially successful LPDME catalyst. The off-site product-use test planmore » is to be updated in June of 1997. During this quarter, Air Products and Acurex Environmental Corporation continued developing the listing of product-use test participants who are involved in fuel cell, transportation, and stationary power plant applications. Start-up activities (Task 3.1) began during the reporting period, and coal-derived synthesis gas (syngas) was introduced to the demonstration unit. The recycle compressor was tested successfully on syngas at line pressure of 700 psig, and the reactor loop reached 220 C for carbonyl burnout. Iron carbonyl in the balanced gas feed remained below the 10 ppbv detection limit for all samples but one. Within the reactor loop, iron carbonyl levels peaked out near 200 ppbv after about 40 hours on-stream, before decreasing to between 10--20 ppbv at 160 hours on -stream. Nickel carbonyl measurements reached a peak of about 60 ppbv, and decreased at all sampling locations to below the 10 ppbv detection limit by 70 hours on-stream. Catalyst activation of the nine 2,250 lb batches required for the initial catalyst charge began and concluded. All batches met or slightly exceeded the theoretical maximum uptake of 2.82 SCF of reducing gas/lb catalyst.« less

  1. THROUGH THE LOOKING GLASS: HST SPECTROSCOPY OF FAINT GALAXIES LENSED BY THE FRONTIER FIELDS CLUSTER MACSJ0717.5+3745

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmidt, K. B.; Treu, T.; Wang, X.

    The Grism Lens-Amplified Survey from Space (GLASS) is a Hubble Space Telescope (HST) Large Program, which will obtain 140 orbits of grism spectroscopy of the core and infall regions of 10 galaxy clusters, selected to be among the very best cosmic telescopes. Extensive HST imaging is available from many sources including the CLASH and Frontier Fields programs. We introduce the survey by analyzing spectra of faint multiply-imaged galaxies and z ≳ 6 galaxy candidates obtained from the first 7 orbits out of 14 targeting the core of the Frontier Fields cluster MACSJ0717.5+3745. Using the G102 and G141 grisms to covermore » the wavelength range 0.8-1.7 μm, we confirm four strongly lensed systems by detecting emission lines in each of the images. For the 9 z ≳ 6 galaxy candidates clear from contamination, we do not detect any emission lines down to a 7 orbit 1σ noise level of ∼5 × 10{sup –18} erg s{sup –1} cm{sup –2}. Taking lensing magnification into account, our flux sensitivity reaches ∼0.2-5 × 10{sup –18} erg s{sup –1}cm{sup –2}. These limits over an uninterrupted wavelength range rule out the possibility that the high-z galaxy candidates are instead strong line emitters at lower redshift. These results show that by means of careful modeling of the background—and with the assistance of lensing magnification—interesting flux limits can be reached for large numbers of objects, avoiding pre-selection and the wavelength restrictions inherent to ground-based multi-slit spectroscopy. These observations confirm the power of slitless HST spectroscopy even in fields as crowded as a cluster core.« less

  2. Your Legal Guide to Consumer Credit, with a Special Section on Bankruptcy. You and the Law Series.

    ERIC Educational Resources Information Center

    American Bar Association, Chicago, IL. Public Education Div.

    This booklet was published to help people better understand how to use it, how to determine if they are reaching or have reached their credit-debt limit, and what to do if they have exceeded that limit. It also explains federal rules, regulations, and laws pertaining to consumer installment credit that are designed to protect the consumer.…

  3. Effectiveness of a Time-Limited Incentive on Participation by Hard-to-Reach Respondents in a Panel Study

    ERIC Educational Resources Information Center

    Fomby, Paula; Sastry, Narayan; McGonagle, Katherine A.

    2017-01-01

    We describe an experiment to provide a time-limited incentive among a random sample of 594 hard-to-reach respondents, 200 of whom were offered the incentive to complete all survey components of a study during a three-week winter holiday period. Sample members were primary caregivers of children included in the 2014 Child Development Supplement to…

  4. Quantum thermodynamics with local control

    NASA Astrophysics Data System (ADS)

    Lekscha, J.; Wilming, H.; Eisert, J.; Gallego, R.

    2018-02-01

    We investigate the limitations that emerge in thermodynamic tasks as a result of having local control only over the components of a thermal machine. These limitations are particularly relevant for devices composed of interacting many-body systems. Specifically, we study protocols of work extraction that employ a many-body system as a working medium whose evolution can be driven by tuning the on-site Hamiltonian terms. This provides a restricted set of thermodynamic operations, giving rise to alternative bounds for the performance of engines. Our findings show that those limitations in control render it, in general, impossible to reach Carnot efficiency; in its extreme ramification it can even forbid to reach a finite efficiency or finite work per particle. We focus on the one-dimensional Ising model in the thermodynamic limit as a case study. We show that in the limit of strong interactions the ferromagnetic case becomes useless for work extraction, while the antiferromagnetic case improves its performance with the strength of the couplings, reaching Carnot in the limit of arbitrary strong interactions. Our results provide a promising connection between the study of quantum control and thermodynamics and introduce a more realistic set of physical operations well suited to capture current experimental scenarios.

  5. A novel electrochemical sensor for detecting hyperin with a nanocomposite of ZrO2-SDS-SWCNTs as decoration.

    PubMed

    Li, Shuo; Lei, Sheng; Yu, Qian; Zou, Lina; Ye, Baoxian

    2018-08-01

    A novel high-sensitive electrochemical sensor with glassy carbon electrode (GCE) as support for hyperin determination is successfully designed and constructed, and the well-shaped nano-meter modified material is synthesized via a one-step and facile route. Functionalized with surfactant sodium dodecyl sulfate (SDS), Single-Walled Carbon Nanotubes (SWCNTs) are synchronously grafted with ZrO 2 nanoparticles to develop into the as-prepared nano-composite (ZrO 2 -SDS-SWCNTs). Compared to the previous reports related with hyperin detection, the linear range gets wider and detection limit (LOD) becomes lower with the aid of this novel nano-composite modified glassy carbon electrode (ZrO 2 -SDS-SWCNTs/GCE). The crystalline phases and functionalization of the preparation process has been investigated by X-ray diffraction (XRD) and Fourier transform infrared (FT-IR) instrument analysis, respectively, and the micro-morphology of related modified materials is also visibly characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). In addition, electrochemical properties of the modified materials are comparably explored by means of impedance spectroscopy (EIS) and cyclic voltammograms (CV). According to the established calibration curve under optimized condition, the peak current (Differential pulse voltammetry (DPV) signal) keeps a linear relationship with hyperin concentration in the ranges of 1.0 × 10 -9 - 3.0 × 10 -7 mol L -1 , meanwhile detection limit reaches as low as 5 × 10 -10 mol L -1 (S/N = 3). As for practical applications, the proposed sensor has also worked well on sensitive hyperin determination in real species Abelmoschus manihot. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Electrosynthesis and characterization of nanostructured polyquinone for use in detection and quantification of naturally occurring dsDNA.

    PubMed

    Hernández, Loreto A; Del Valle, María A; Armijo, Francisco

    2016-05-15

    The detection of naturally occurring desoxyribonucleic acid (DNA) has become a subject of study by the projections that would generate to be able to sense the genetic material for the detection of future diseases. Bearing this in mind, to provide new measuring strategies, in the current work the preparation of a low-cost electrode, modified with poly(1-amino-9,10-anthraquinone) nanowires using a SiO2 template, is carried out; the assembly is next modified by covalently attaching ssDNA strands. It must be noted that all this is accomplished by using solely electrochemical techniques, according to methodology developed for this purpose. SEM images of the modified surface show high order and homogeneity in the distribution of modified nanowires over the electrode surface. In turn, after the hybridization with its complementary strand, the voltammetric responses enable corroborating the linear relationship between hybridization at different DNA concentrations and normalized current response, obtaining a limit of detection (LOD) 5.7·10(-12)gL(-1) and limit of quantification (LOQ) 1.9·10(-11)gL(-1). The working dynamic range is between 1.4·10(-7) and 8.5·10(-9)gL(-1) with a correlation coefficient 0.9998. The successful obtaining of the modified electrode allows concluding that the high order reached by the nanostructures, guides the subsequent single strand of DNA (ssDNA) covalent attachment, which after hybridization with its complementary strand brings about a considerable current increase. This result allows foreseeing a guaranteed breakthrough with regard to the use of the biosensor in real samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Functionalization of indium-tin-oxide electrodes by laser-nanostructured gold thin films for biosensing applications

    NASA Astrophysics Data System (ADS)

    Grochowska, Katarzyna; Siuzdak, Katarzyna; Karczewski, Jakub; Śliwiński, Gerard

    2015-12-01

    The production and properties of the indium-tin-oxide (ITO) electrodes functionalized by Au nanoparticle (NP) arrays of a relatively large area formed by pulsed laser nanostructuring of thin gold films are reported and discussed. The SEM inspection of modified electrodes reveals the presence of the nearly spherical and disc-shaped particles of dimensions in the range of 40-120 nm. The NP-array geometry can be controlled by selection of the laser processing conditions. It is shown that particle size and packing density of the array are important factors which determine the electrode performance. In the case of NP-modified electrodes the peak current corresponding to the glucose direct oxidation process shows rise with increasing glucose concentration markedly higher comparing to the reference Au disc electrode. The detection limit reaches 12 μM and linear response of the sensor is observed from 0.1 to 47 mM that covers the normal physiological range of the blood sugar detection.

  8. Statement of The American Society of Human Genetics on cystic fibrosis carrier screening

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The identification in 1989 of the cystic fibrosis (CF) gene and its most common mutation immediately raised the possibility of CF carrier detection by DNA analysis. The American Society of Human Genetics (ASHG) issued a statement recommending that CF carrier testing should be made available to individuals with a family history of CF. It was also stated that screening of individuals or couples in the general population should not be offered until the rate of CF carrier detection improves. An additional prerequisite emphasized the need for the establishment of effective educational and counseling programs consistent with previous widely accepted principles.more » An NIH workshop reached similar conclusions. ASHG recommendations are that screening be limited to individuals with a family history of CF, testing should be accompanied by education and counseling, screening should be voluntary and confidential with appropriate laboratory quality controls, and efforts should be expanded to educate health care providers and the public.« less

  9. Further research on iodine speciation in seawater by capillary zone electrophoresis with isotachophoresis preconcentration.

    PubMed

    Huang, Zhuo; Ito, Kazuaki; Hirokawa, Takeshi

    2004-11-05

    A novel, simple and highly sensitive CE method was developed to determine total iodine (TI) in seawater. The method is based on the on-capillary reduction of iodine species to iodide by a reductant, introduced into the capillary before sample injection, the preconcentration of iodide using isotachophoresis, followed by its UV detection. Under optimized conditions for reduction and CE separation, the limit of detection for TI (S/N = 3) reached 0.4 microg L(-1) (226 nm). The repeatability of migration time and peak area, expressed by relative standard deviation, was 0.46 and 1.45%, respectively (n = 19). The correlation factor was 0.9991 (n = 10) for the concentration range of 12-115 microg I L(-1). The CE results obtained for the real seawater analysis agreed with the data of ion chromatography. To determine the genuine TI by the proposed method, organic iodinated compounds in the sample were treated with H202 and irradiation with UV light before analysis.

  10. Development of a FI-HG-ICP-OES solid phase preconcentration system for inorganic selenium speciation in Argentinean beverages.

    PubMed

    Escudero, Luis A; Pacheco, Pablo H; Gasquez, José A; Salonia, José A

    2015-02-15

    A preconcentration system has been developed to determine inorganic selenium species. Selenium was retained by a column filled with polyvinyl chloride (PVC) with lanthanum hydroxide co-precipitation. Speciation was achieved by selective photoreduction previous Se preconcentration. The retention pH was optimized at 10.0. Two multivariate calibrations and a central composite design were employed for optimization of the system. Sample, reagents and acid flow rates are significant variables affecting the system. Employing HG-ICP-OES as detection, the optimized system reached a detection limit of 0.03μg/L, and an enhancement factor of 14875 (25 for preconcentration system, 595 for hydride generation). To verify the method' accuracy, two certified reference materials, BCR® 414 Plankton & IRMM-804 Rice Flour, were analysed. The system was applied to inorganic selenium speciation in several Argentinean beverages to estimate their selenium contribution to diet. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Production and characterization of monoclonal antibodies against ochratoxin B.

    PubMed

    Heussner, Alexandra H; Moeller, Ines; Day, Billy W; Dietrich, Daniel R; O'Brien, Evelyn

    2007-05-01

    Monoclonal antibodies against ochratoxin B (OTB) were generated by immunizing Balb/c mice with OTB conjugated to keyhole limpet hemocyanin (KLH) via carbodiimide reactions with CHMC and EDAC. A stable hybridoma cell line 2F1.E10 was produced by fusion of murine splenocytes and myeloma cells. The obtained antibodies were characterized using an indirect competitive ELISA. The detection limit was calculated (27+/-2 nM OTB) and 50% binding inhibition was reached at 500 nM free OTB. A low cross-reactivity to ochratoxin A (OTA) of 3.3% and no cross-reactivities to either coumarin or DL-phenylalanine were observed, suggesting a highly specific OTB antibody. The antibody type was identified as IgG class 1 with the light chain being of the kappa configuration. These antibodies can be used in an indirect competitive ELISA to detect OTB in the nanomolar to micromolar concentration range and may be useful for the analysis of contaminated food items.

  12. A laboratory demonstration of the capability to image an Earth-like extrasolar planet.

    PubMed

    Trauger, John T; Traub, Wesley A

    2007-04-12

    The detection and characterization of an Earth-like planet orbiting a nearby star requires a telescope with an extraordinarily large contrast at small angular separations. At visible wavelengths, an Earth-like planet would be 1 x 10(-10) times fainter than the star at angular separations of typically 0.1 arcsecond or less. There are several proposed space telescope systems that could, in principle, achieve this. Here we report a laboratory experiment that reaches these limits. We have suppressed the diffracted and scattered light near a star-like source to a level of 6 x 10(-10) times the peak intensity in individual coronagraph images. In a series of such images, together with simple image processing, we have effectively reduced this to a residual noise level of about 0.1 x 10(-10). This demonstrates that a coronagraphic telescope in space could detect and spectroscopically characterize nearby exoplanetary systems, with the sensitivity to image an 'Earth-twin' orbiting a nearby star.

  13. Prenatal diagnosis in a cystic fibrosis family: a combined molecular strategy for a precise diagnosis.

    PubMed

    Chávez-Saldaña, Margarita; García-Cavazos, Ricardo; Vigueras, Rosa María; Orozco, Lorena

    2011-01-01

    The high genetic heterogeneity in populations with a wide spectrum of mutations in the CF transmembrane conductance regulator gene (CFTR), makes the detection of mutations a very hard and difficult task, thereby limiting the accurate diagnosis of the disease, mainly in patients with uncharacterized mutations. Molecular strategies, like targeted identification of the most frequent CFTR mutations in Mexican population combined with linkage analysis using markers, is very useful for carrier detection and for prenatal diagnosis in affected families with CF. In this paper we show that the combination of methodologies was a crucial alternative to reach a precise prenatal CF diagnosis. We documented CF diagnosis in a 14th-week fetus combining the screening of the most common mutations in Mexican population with linkage analysis of two extragenic polymorphisms (XV2C/TaqI and KM19/PstI). We determined that the fetus inherited the PG542X mutation from its mother and an unknown mutation from its father through the chromosomal phases analysis.

  14. Simple diazonium chemistry to develop specific gene sensing platforms.

    PubMed

    Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E

    2014-02-27

    A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Sensitive Precise p H Measurement with Large-Area Graphene Field-Effect Transistors at the Quantum-Capacitance Limit

    NASA Astrophysics Data System (ADS)

    Fakih, Ibrahim; Mahvash, Farzaneh; Siaj, Mohamed; Szkopek, Thomas

    2017-10-01

    A challenge for p H sensing is decreasing the minimum measurable p H per unit bandwidth in an economical fashion. Minimizing noise to reach the inherent limit imposed by charge fluctuation remains an obstacle. We demonstrate here graphene-based ion-sensing field-effect transistors that saturate the physical limit of sensitivity, defined here as the change in electrical response with respect to p H , and achieve a precision limited by charge-fluctuation noise at the sensing layer. We present a model outlining the necessity for maximizing the device carrier mobility, active sensing area, and capacitive coupling in order to minimize noise. We encapsulate large-area graphene with an ultrathin layer of parylene, a hydrophobic polymer, and deposit an ultrathin, stoichiometric p H -sensing layer of either aluminum oxide or tantalum pentoxide. With these structures, we achieve gate capacitances ˜0.6 μ F /cm2 , approaching the quantum-capacitance limit inherent to graphene, along with a near-Nernstian p H response of ˜55 ±2 mV /p H . We observe field-effect mobilities as high as 7000 cm2 V-1 s-1 with minimal hysteresis as a result of the parylene encapsulation. A detection limit of 0.1 m p H in a 60-Hz electrical bandwidth is observed in optimized graphene transistors.

  16. From Supercomputer Modeling to Highest Mass Resolution in FT-ICR.

    PubMed

    N Nikolaev, Evgene; N Vladimirov, Gleb; Jertz, Roland; Baykut, Gökhan

    2013-01-01

    Understanding of behavior of ion ensembles inside FT-ICR cell based on the computer simulation of ion motion gives rise to the new ideas of cell designs. The recently introduced novel FT-ICR cell based on a Penning ion trap with specially shaped excitation and detection electrodes prevents distortion of ion cyclotron motion phases (normally caused by non-ideal electric trapping fields) by averaging the trapping DC electric field during the ion motion in the ICR cell. Detection times of 5 min resulting in resolving power close to 40,000,000 have been reached for reserpine at m/z 609 at a magnetic field of only 7 Tesla. Fine structures of resolved 13Cn isotopic cluster groups could be measured for molecular masses up to 5.7 kDa (insulin) with resolving power of 4,000,000 at 7 Tesla. Based on resolved fine structure patterns atomic compositions can be directly determined using a new developed algorithm for fine structure processing. Mass spectra of proteins and multimers of proteins reaching masses up to 186 kDa (enolase tetramer) could be measured with isotopic resolution. For instance, at 7 Tesla resolving power of 800,000 was achieved for enolase dimer (96 kDa) and 500,000 for molecular masses above 100 kDa. Experimental data indicate that there is practically no limit for the resolving power of this ICR cell except by collisional damping in the ultrahigh vacuum chamber.

  17. Imaging of myocardial infarction in dogs and humans using monoclonal antibodies specific for human myosin heavy chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leger, J.; Chevalier, J.; Larue, C.

    1991-08-01

    The use of three different monoclonal antibodies specific for human ventricular myosin heavy chains in the visualization of the location and extent of necrosis in dogs with experimental acute myocardial infarction and in humans is described. Using a classic immunohistochemical method or ex vivo analysis of heart slices in dogs with acute myocardial infarction subjected to intravenous injection of unlabeled antimyosin antibodies or antimyosin antibodies labeled with indium-111, it was observed that all antibody fragments specifically reached the targeted necrotic zone less than 2 h after antibody injection and remained bound for up to 24 h. In a limited butmore » significant number of cases (5 of the 12 humans and 11 of 43 dogs), it was possible to image the necrotic zone in vivo as early as 2 to 4 h after antibody injection. In other cases, individual blood clearance variations retarded or even prevented in vivo necrosis detection. Higher antimyosin fixation values were obtained in the necrotic zones in dogs with a rapid blood clearance relative to that of the other dogs. It is concluded that antimyosin antibodies always reached necrotic areas within 2 h. If blood clearance was rapid, in vivo imaging of the necrotic area was possible 2 to 6 h after necrosis, even in humans. In some cases, however, uncontrolled individual variations in the timing required for sufficient blood clearance hampered this rapid in vivo detection of myocardial necrosis.« less

  18. School Furniture Dimensions: Standing and Reaching.

    ERIC Educational Resources Information Center

    Department of Education and Science, London (England).

    Performance of school children in regard to their standing and reach postures are described with dimensions given on the limits of their performance only. The facts of task performances are presented for the following tasks--(1) seeing into a shelf, (2) reaching into a shelf, (3) drawing on a vertical surface, (4) sitting or standing while…

  19. Satellite-based remote sensing of running water habitats at large riverscape scales: Tools to analyze habitat heterogeneity for river ecosystem management

    NASA Astrophysics Data System (ADS)

    Hugue, F.; Lapointe, M.; Eaton, B. C.; Lepoutre, A.

    2016-01-01

    We illustrate an approach to quantify patterns in hydraulic habitat composition and local heterogeneity applicable at low cost over very large river extents, with selectable reach window scales. Ongoing developments in remote sensing and geographical information science massively improve efficiencies in analyzing earth surface features. With the development of new satellite sensors and drone platforms and with the lowered cost of high resolution multispectral imagery, fluvial geomorphology is experiencing a revolution in mapping streams at high resolution. Exploiting the power of aerial or satellite imagery is particularly useful in a riverscape research framework (Fausch et al., 2002), where high resolution sampling of fluvial features and very large coverage extents are needed. This study presents a satellite remote sensing method that requires very limited field calibration data to estimate over various scales ranging from 1 m to many tens or river kilometers (i) spatial composition metrics for key hydraulic mesohabitat types and (ii) reach-scale wetted habitat heterogeneity indices such as the hydromorphological index of diversity (HMID). When the purpose is hydraulic habitat characterization applied over long river networks, the proposed method (although less accurate) is much less computationally expensive and less data demanding than two dimensional computational fluid dynamics (CFD). Here, we illustrate the tools based on a Worldview 2 satellite image of the Kiamika River, near Mont Laurier, Quebec, Canada, specifically over a 17-km river reach below the Kiamika dam. In the first step, a high resolution water depth (D) map is produced from a spectral band ratio (calculated from the multispectral image), calibrated with limited field measurements. Next, based only on known river discharge and estimated cross section depths at time of image capture, empirical-based pseudo-2D hydraulic rules are used to rapidly generate a two-dimensional map of flow velocity (V) over the 17-km Kiamika reach. The joint distribution of D and V variables over wetted zones then is used to reveal structural patterns in hydraulic habitat availability at patch, reach, and segment scales. Here we analyze 156 bivariate (D, V) density function plots estimated over moving reach windows along the satellite scene extent to extract 14 physical habitat metrics (such as river width, mean and modal depths and velocity, variances and covariance in D and V over 1-m pixels, HMID, entropy). A principal component analysis on the set of metrics is then used to cluster river reaches in regard to similarity in their hydraulic habitat composition and heterogeneity. Applications of this approach can include (i) specific fish habitat detection at riverscape scales (e.g., large areas of riffle spawning beds, deeper pools) for regional management, (ii) studying how river habitat heterogeneity is correlated to fish distribution and (iii) guidance for site location for restoration of key habitats or for post regulation monitoring of representative reaches of various types.

  20. KS-Detect – Validation of Solar Thermal PCR for the Diagnosis of Kaposi’s Sarcoma Using Pseudo-Biopsy Samples

    PubMed Central

    Snodgrass, Ryan; Gardner, Andrea; Jiang, Li; Fu, Cheng; Cesarman, Ethel; Erickson, David

    2016-01-01

    Resource-limited settings present unique engineering challenges for medical diagnostics. Diagnosis is often needed for those unable to reach central healthcare systems, making portability and independence from traditional energy infrastructure essential device parameters. In 2014, our group presented a microfluidic device that performed a solar-powered variant of the polymerase chain reaction, which we called solar thermal PCR. In this work, we expand on our previous effort by presenting an integrated, portable, solar thermal PCR system targeted towards the diagnosis of Kaposi’s sarcoma. We call this system KS-Detect, and we now report the system’s performance as a diagnostic tool using pseudo-biopsy samples made from varying concentrations of human lymphoma cell lines positive for the KS herpesvirus (KSHV). KS-Detect achieved 83% sensitivity and 70% specificity at high (≥10%) KSHV+ cell concentrations when diagnosing pseudo-biopsy samples by smartphone image. Using histology, we confirm that our prepared pseudo-biopsies contain similar KSHV+ cell concentrations as human biopsies positive for KS. Through our testing of samples derived from human cell lines, we validate KS-Detect as a viable, portable KS diagnostic tool, and we identify critical engineering considerations for future solar-thermal PCR devices. PMID:26799834

  1. Directional templates for real-time detection of coronal axis rotated faces

    NASA Astrophysics Data System (ADS)

    Perez, Claudio A.; Estevez, Pablo A.; Garate, Patricio

    2004-10-01

    Real-time face and iris detection on video images has gained renewed attention because of multiple possible applications in studying eye function, drowsiness detection, virtual keyboard interfaces, face recognition, video processing and multimedia retrieval. In this paper, a study is presented on using directional templates in the detection of faces rotated in the coronal axis. The templates are built by extracting the directional image information from the regions of the eyes, nose and mouth. The face position is determined by computing a line integral using the templates over the face directional image. The line integral reaches a maximum when it coincides with the face position. It is shown an improvement in localization selectivity by the increased value in the line integral computed with the directional template. Besides, improvements in the line integral value for face size and face rotation angle was also found through the computation of the line integral using the directional template. Based on these results the new templates should improve selectivity and hence provide the means to restrict computations to a fewer number of templates and restrict the region of search during the face and eye tracking procedure. The proposed method is real time, completely non invasive and was applied with no background limitation and normal illumination conditions in an indoor environment.

  2. Chromatic biosensor for detection of phosphinothricin acetyltransferase by use of polydiacetylene vesicles encapsulated within automatically generated immunohydrogel beads.

    PubMed

    Jung, Sung-Ho; Jang, Huisoo; Lim, Min-Cheol; Kim, Jae-Hwan; Shin, Kong-Sik; Kim, Sun Min; Kim, Hae-Yeong; Kim, Young-Rok; Jeon, Tae-Joon

    2015-02-17

    We developed a simple and sensitive colorimetric biosensor in the form of microparticles by using polydiacetylene (PDA) vesicles encapsulated within a hydrogel matrix for the detection of phosphinothricin acetyltransferase (PAT) protein, which is one of the most important marker proteins in genetically modified (GM) crops. Although PDA is commonly used as a sensing material due to its unique colorimetric properties, existing PDA biosensors are ineffective due to their low sensitivity as well as their lack of robustness. To overcome these disadvantages, we devised immunohydrogel beads made of anti-PAT-conjugated PDA vesicles embedded at high density within a poly(ethylene glycol) diacrylate (PEG-DA) hydrogel matrix. In addition, the construction of immunohydrogel beads was automated by use of a microfluidic device. In the immunoreaction, the sensitivity of antibody-conjugated PDA vesicles was significantly amplified, as monitored by the unaided eye. The limit of detection for target molecules reached as low as 20 nM, which is sufficiently low enough to detect target materials in GM organisms. Collectively, the results show that immunohydrogel beads constitute a promising colorimetric sensing platform for onsite testing in a number of fields, such as the food and medical industries, as well as warfare situations.

  3. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

  4. A simple method to produce 2D and 3D microfluidic paper-based analytical devices for clinical analysis.

    PubMed

    de Oliveira, Ricardo A G; Camargo, Fiamma; Pesquero, Naira C; Faria, Ronaldo Censi

    2017-03-08

    This paper describes the fabrication of 2D and 3D microfluidic paper-based analytical devices (μPADs) for monitoring glucose, total protein, and nitrite in blood serum and artificial urine. A new method of cutting and sealing filter paper to construct μPADs was demonstrated. Using an inexpensive home cutter printer soft cellulose-based filter paper was easily and precisely cut to produce pattern hydrophilic microchannels. 2D and 3D μPADs were designed with three detection zones each for the colorimetric detection of the analytes. A small volume of samples was added to the μPADs, which was photographed after 15 min using a digital camera. Both μPADs presented an excellent analytical performance for all analytes. The 2D device was applied in artificial urine samples and reached limits of detection (LODs) of 0.54 mM, 5.19 μM, and 2.34 μM for glucose, protein, and nitrite, respectively. The corresponding LODs of the 3D device applied for detecting the same analytes in artificial blood serum were 0.44 mM, 1.26 μM, and 4.35 μM. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. [Computed tomography with computer-assisted detection of pulmonary nodules in dogs and cats].

    PubMed

    Niesterok, C; Piesnack, S; Köhler, C; Ludewig, E; Alef, M; Kiefer, I

    2015-01-01

    The aim of this study was to assess the potential benefit of computer-assisted detection (CAD) of pulmonary nodules in veterinary medicine. Therefore, the CAD rate was compared to the detection rates of two individual examiners in terms of its sensitivity and false-positive findings. We included 51 dogs and 16 cats with pulmonary nodules previously diagnosed by computed tomography. First, the number of nodules ≥ 3 mm was recorded for each patient by two independent examiners. Subsequently, each examiner used the CAD software for automated nodule detection. With the knowledge of the CAD results, a final consensus decision on the number of nodules was achieved. The software used was a commercially available CAD program. The sensitivity of examiner 1 was 89.2%, while that of examiner 2 reached 87.4%. CAD had a sensitivity of 69.4%. With CAD, the sensitivity of examiner 1 increased to 94.7% and that of examiner 2 to 90.8%. The CAD-system, which we used in our study, had a moderate sensitivity of 69.4%. Despite its severe limitations, with a high level of false-positive and false-negative results, CAD increased the examiners' sensitivity. Therefore, its supportive role in diagnostics appears to be evident.

  6. Astrometric Research of Asteroidal Satellites

    NASA Astrophysics Data System (ADS)

    Kikwaya, J.-B.; Thuillot, W.; Rocher, P.; Vieira Martins, R.; Arlot, J.-E.; Angeli, Cl.

    2002-09-01

    Several observational methods have been applied in order to detect asteroidal satellites. Some of them were rather successful, such as the stellar occultations and mutual eclipse methods. Recently other techniques such as the space imaging, the adaptive optics and the radar imaging inferred a great improvement in the search for these objects. However several limitations appear in the type of data that each of them allow us to access. We propose to apply an astrometric method in order as well to detect new asteroidal satellites as to get complementary data of some already detected objects (mainly their orbital period). This method is founded on the search of the reflex effect of the primary object due to the orbital motion of a possible satellite. Such an astrometric signature, already searched by Monet & Monet (1998), may reach several tens of MAS. Only a spectral analysis could then detect this signal under good conditions of signal/noise ratio and thanks to high quality astrometric measurements and coverage by different sites of observation. We have applied such a method for several asteroids. A preliminary result is obtained thanks to 377 CCD observations of 146 Lucina made at the Haute-Provence Observatory in South of France. A periodical signal appears in this analysis, leading to data compatible with a first detection of a probable satellite made previously (Arlot et al. 1985) by the occultation method.

  7. Concise and Efficient Fluorescent Probe via an Intromolecular Charge Transfer for the Chemical Warfare Agent Mimic Diethylchlorophosphate Vapor Detection.

    PubMed

    Yao, Junjun; Fu, Yanyan; Xu, Wei; Fan, Tianchi; Gao, Yixun; He, Qingguo; Zhu, Defeng; Cao, Huimin; Cheng, Jiangong

    2016-02-16

    Sarin, used as chemical warfare agents (CWAs) for terrorist attacks, can induce a number of virulent effects. Therefore, countermeasures which could realize robust and convenient detection of sarin are in exigent need. A concise charge-transfer colorimetric and fluorescent probe (4-(6-(tert-butyl)pyridine-2-yl)-N,N-diphenylaniline, TBPY-TPA) that could be capable of real-time and on-site monitoring of DCP vapor was reported in this contribution. Upon contact with DCP, the emission band red-shifted from 410 to 522 nm upon exposure to DCP vapor. And the quenching rate of TBPY-TPA reached up to 98% within 25 s. Chemical substances such as acetic acid (HAc), dimethyl methylphosphonate (DMMP), pinacolyl methylphosphonate (PAMP), and triethyl phosphate (TEP) do not interfere with the detection. A detection limit for DCP down to 2.6 ppb level is remarkably achieved which is below the Immediately Dangerous to Life or Health concentration. NMR data suggested that a transformation of the pyridine group into pyridinium salt via a cascade reaction is responsible for the sensing process which induced the dramatic fluorescent red shift. All of these data suggest TBPY-TPA is a promising fluorescent sensor for a rapid, simple, and low-cost method for DCP detection, which could be easy to prepare as a portable chemosensor kit for its practical application in real-time and on-site monitoring.

  8. Trace vapor detection of hydrogen peroxide: An effective approach to identification of improvised explosive devices

    NASA Astrophysics Data System (ADS)

    Xu, Miao

    Vapor detection has been proven as one of the practical, noninvasive methods suitable for explosives detection among current explosive detection technologies. Optical methods (especially colorimetric and fluorescence spectral methods) are low in cost, provide simple instrumentation alignment, while still maintaining high sensitivity and selectivity, these factors combined facilitate broad field applications. Trace vapor detection of hydrogen peroxide (H2O2) represents an effective approach to noninvasive detection of peroxide-based explosives, though development of such a sensor system with high reliability and sufficient sensitivity (reactivity) still remains challenging. Three vapor sensor systems for H2O2 were proposed and developed in this study, which exploited specific chemical reaction towards H2O2 to ensure the selectivity, and materials surface engineering to afford efficient air sampling. The combination of these features enables expedient, cost effective, reliable detection of peroxide explosives. First, an expedient colorimetric sensor for H2O2 vapor was developed, which utilized the specific interaction between Ti(oxo) and H2O2 to offer a yellow color development. The Ti(oxo) salt can be blended into a cellulose microfibril network to produce tunable interface that can react with H2O2. The vapor detection limit can reach 400 ppb. To further improve the detection sensitivity, a naphthalimide based fluorescence turn-on sensor was designed and developed. The sensor mechanism was based on H2O2-mediated oxidation of a boronate fluorophore, which is nonfluorescent in ICT band, but becomes strongly fluorescent upon conversion into the phenol state. The detection limit of this sensory material was improved to be below 10 ppb. However, some technical factors such as sensor concentration, local environment, and excitation intensity were found difficult to control to make the sensor system sufficiently reproducible. To solve the problem, we developed a ratiometric fluorescence sensor, which allows for dual-band emission monitoring and thus enhances the detection reliability. Moreover, the significant spectral overlap between the fluorescence of the pristine sensor and the absorption of the reacted state enables effective Foster Resonance Energy Transfer (FRET). This FRET process can significantly enhance the fluorescence sensing efficiency in comparison to the normal single-band sensor system, for which the sensing efficiency is solely determined by the stoichiometric conversion of sensor molecules.

  9. Handheld analyzer with on-chip molecularly-imprinted biosensors for electrical detection of propofol in plasma samples.

    PubMed

    Hong, Chien-Chong; Lin, Chih-Chung; Hong, Chian-Lang; Lin, Zi-Xiang; Chung, Meng-Hua; Hsieh, Pei-Wen

    2016-12-15

    This paper proposes a novel handheld analyzer with disposable lab-on-a-chip technology for the electrical detection of the anesthetic propofol in human plasma samples for clinical diagnoses. The developed on-chip biosensors are based on the conduction of molecularly imprinted polymers (MIPs) that employ label-free electrical detection techniques. Propofol in total intravenous anesthesia is widely used with a target-controlled infusion system. At present, the methods employed for detecting blood propofol concentrations in hospitals comprise high-performance liquid chromatography and ion mobility spectrometry. These conventional instruments are bulky, expensive, and difficult to access. In this study, we developed a novel plastic microfluidic biochip with an on-chip anesthetic biosensor that was characterized for the rapid detection of propofol concentrations. The experimental results revealed that the response time of the developed propofol biosensors was 25s. The specific binding of an MIP to a nonimprinted polymer (NIP) reached up to 560%. Moreover, the detection limit of the biosensors was 0.1μg/mL, with a linear detection range of 0.1-30μg/mL. The proposed disposable microfluidic biochip with an on-chip anesthetic biosensor using MIPs exhibited excellent performance in the separation and sensing of propofol molecules in the human plasma samples. Compared with large-scale conventional instruments, the developed microfluidic biochips with on-chip MIP biosensors present the advantages of a compact size, high selectivity, low cost, rapid response, and single-step detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Induction-detection electron spin resonance with spin sensitivity of a few tens of spins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artzi, Yaron; Twig, Ygal; Blank, Aharon

    2015-02-23

    Electron spin resonance (ESR) is a spectroscopic method that addresses electrons in paramagnetic materials directly through their spin properties. ESR has many applications, ranging from semiconductor characterization to structural biology and even quantum computing. Although it is very powerful and informative, ESR traditionally suffers from low sensitivity, requiring many millions of spins to get a measureable signal with commercial systems using the Faraday induction-detection principle. In view of this disadvantage, significant efforts were made recently to develop alternative detection schemes based, for example, on force, optical, or electrical detection of spins, all of which can reach single electron spin sensitivity.more » This sensitivity, however, comes at the price of limited applicability and usefulness with regard to real scientific and technological issues facing modern ESR which are currently dealt with conventional induction-detection ESR on a daily basis. Here, we present the most sensitive experimental induction-detection ESR setup and results ever recorded that can detect the signal from just a few tens of spins. They were achieved thanks to the development of an ultra-miniature micrometer-sized microwave resonator that was operated at ∼34 GHz at cryogenic temperatures in conjunction with a unique cryogenically cooled low noise amplifier. The test sample used was isotopically enriched phosphorus-doped silicon, which is of significant relevance to spin-based quantum computing. The sensitivity was experimentally verified with the aid of a unique high-resolution ESR imaging approach. These results represent a paradigm shift with respect to the capabilities and possible applications of induction-detection-based ESR spectroscopy and imaging.« less

  11. Consequences of Spin-Orbit Coupling at the Single Hole Level: Spin-Flip Tunneling and the Anisotropic g Factor

    NASA Astrophysics Data System (ADS)

    Bogan, A.; Studenikin, S. A.; Korkusinski, M.; Aers, G. C.; Gaudreau, L.; Zawadzki, P.; Sachrajda, A. S.; Tracy, L. A.; Reno, J. L.; Hargett, T. W.

    2017-04-01

    Hole transport experiments were performed on a gated double quantum dot device defined in a p -GaAs /AlGaAs heterostructure with a single hole occupancy in each dot. The charging diagram of the device was mapped out using charge detection confirming that the single hole limit is reached. In that limit, a detailed study of the two-hole spin system was performed using high bias magnetotransport spectroscopy. In contrast to electron systems, the hole spin was found not to be conserved during interdot resonant tunneling. This allows one to fully map out the two-hole energy spectrum as a function of the magnitude and the direction of the external magnetic field. The heavy-hole g factor was extracted and shown to be strongly anisotropic, with a value of 1.45 for a perpendicular field and close to zero for an in-plane field as required for hybridizing schemes between spin and photonic quantum platforms.

  12. [Comparison of the acrylamide level in microwaved popcorn with that of ordinarily heated one].

    PubMed

    Sun, Shiyu; Xia, Yongmei; Liu, Xuefeng; Hu, Xueyi

    2007-03-01

    To establish a method of examining acrylamide in cooked popcorn. Solid phase extraction/gas chromatography (SPE/GC) was established with N, N-dimethyl acrylamide as internal standard. The detection limit and the quantification limit were estimated at 3 microg/L and 10 microg/L, respectively, and the linear correlation coefficient was 0.9969. Seven commercial popcorn samples with different flavors were collected and tested in this paper. The RSD of acrylamide level of caramel sweet popcorn microwaved was 1.95 % (n = 6). When the commercial popcorns of caramel sweet and cream salted were microwaved (A and D) or conventional heated (A' and D'), the acrylamide levels reached [Am]A = 1017 microg/kg, [Am]D = 146.5 microg/kg, [Am]A, = 2206 microg/kg and [Am]D = 970.1 microg/kg, respectively. The microwaved popcorns tested are safer in general because the acrylamide level of them except that with high simple sugar content is obviously lower than that of ordinarily heated one.

  13. Performance updates of HAWK-I and preparation for the commissioning of the system GRAAL+HAWK-I

    NASA Astrophysics Data System (ADS)

    Hibon, Pascale; Paufique, Jerome; Kuntschner, Harald; Dobrzycka, Danuta; Le Louarn, Miska; Valenti, Elena; Neeser, Mark; Pompei, Emanuela; Arsenault, Robin; Siebenmorgen, Ralf; Madec, Pierre-Yves; Petr-Gotzens, Monika; La Fuente, Carlos; Urrutia, Josefina; Valenzuela, Javier; Castillo, Roberto; Baksai, Pedro; Garcia Dabo, Cesar Enrique; Jost, Andreas; Argomedo, Javier; Kolb, Johann; Kiekebusch, Mario; Hubin, Norbert; Duhoux, Philippe; Conzelmann, Ralf Dieter; Donaldson, Robert; Tordo, Sebastien; Huber, Stefan

    2016-08-01

    The High Acuity Wide field K-band Imager (HAWK-I) instrument is a cryogenic wide field imager operating in the wavelength range 0.9 to 2.5 microns. It has been in operations since 2007 on the UT4 at the Very Large Telescope Observatory in seeing-limited mode. In 2017-2018, GRound Layer Adaptive optics Assisted by Lasers module (GRAAL) will be in operation and the system GRAAL+HAWK-I will be commissioned. It will allow: deeper exposures for nearly point-source objects, or shorter exposure times for reaching the same magnitude, and/or deeper detection limiting magnitude. With GRAAL, HAWK-I will operate more than 80% of the time with an equivalent K-band seeing of 0.55" (instead of 0.7" without GRAAL). GRAAL is already installed and the operations without adaptive optics were commissioned in 2015. We discuss here the latest updates on performance from HAWK-I without Adaptive Optics (AO) and the preparation for the commissioning of the system GRAAL+HAWK-I.

  14. Consequences of Spin-Orbit Coupling at the Single Hole Level: Spin-Flip Tunneling and the Anisotropic g Factor.

    PubMed

    Bogan, A; Studenikin, S A; Korkusinski, M; Aers, G C; Gaudreau, L; Zawadzki, P; Sachrajda, A S; Tracy, L A; Reno, J L; Hargett, T W

    2017-04-21

    Hole transport experiments were performed on a gated double quantum dot device defined in a p-GaAs/AlGaAs heterostructure with a single hole occupancy in each dot. The charging diagram of the device was mapped out using charge detection confirming that the single hole limit is reached. In that limit, a detailed study of the two-hole spin system was performed using high bias magnetotransport spectroscopy. In contrast to electron systems, the hole spin was found not to be conserved during interdot resonant tunneling. This allows one to fully map out the two-hole energy spectrum as a function of the magnitude and the direction of the external magnetic field. The heavy-hole g factor was extracted and shown to be strongly anisotropic, with a value of 1.45 for a perpendicular field and close to zero for an in-plane field as required for hybridizing schemes between spin and photonic quantum platforms.

  15. Prompt optical emission from gamma-ray bursts

    NASA Astrophysics Data System (ADS)

    Kehoe, Robert; Akerlof, Karl; Balsano, Richard; Barthelmy, Scott; Bloch, Jeff; Butterworth, Paul; Casperson, Don; Cline, Tom; Fletcher, Sandra; Frontera, Fillippo; Gisler, Galen; Heise, John; Hills, Jack; Hurley, Kevin; Lee, Brian; Marshall, Stuart; McKay, Tim; Pawl, Andrew; Piro, Luigi; Priedhorsky, Bill; Szymanski, John; Wren, Jim

    The Robotic Optical Transient Search Experiment (ROTSE) seeks to measure contemporaneous and early afterglow optical emission from gamma-ray bursts (GRBs). The ROTSE-I telescope array has been fully automated and responding to burst alerts from the GRB Coordinates Network since March 1998, taking prompt optical data for 30 bursts in its first year. We will briefly review observations of GRB990123 which revealed the first detection of an optical burst occurring during the gamma-ray emission, reaching 9th magnitude at its peak. In addition, we present here preliminary optical results for seven other gamma-ray bursts. No other optical counterparts were seen in this analysis, and the best limiting senisitivities are mV > 13.0 at 14.7 seconds after the gamma-ray rise, and mmV > 16.4 at 62 minutes. These are the most stringent limits obtained for GRB optical counterpart brightness in the first hour after the burst. This analysis suggests that there is not a strong correlation between optical flux and gamma-ray emission.

  16. Consequences of spin-orbit coupling at the single hole level: Spin-flip tunneling and the anisotropic g factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bogan, A.; Studenikin, Sergei A.; Korkusinski, M.

    Hole transport experiments were performed on a gated double quantum dot device defined in a p-GaAs/AlGaAs heterostructure with a single hole occupancy in each dot. The charging diagram of the device was mapped out using charge detection confirming that the single hole limit is reached. In that limit, a detailed study of the two-hole spin system was performed using high bias magnetotransport spectroscopy. In contrast to electron systems, the hole spin was found not to be conserved during interdot resonant tunneling. This allows one to fully map out the two-hole energy spectrum as a function of the magnitude and themore » direction of the external magnetic field. As a result, the heavy-hole g factor was extracted and shown to be strongly anisotropic, with a value of 1.45 for a perpendicular field and close to zero for an in-plane field as required for hybridizing schemes between spin and photonic quantum platforms.« less

  17. Genetic modification of hematopoietic stem cells as a therapy for HIV/AIDS.

    PubMed

    Younan, Patrick; Kowalski, John; Kiem, Hans-Peter

    2013-11-28

    The combination of genetic modification and hematopoietic stem cell (HSC) transplantation may provide the necessary means to develop an alternative treatment option to conventional antiretroviral therapy. As HSCs give rise to all hematopoietic cell types susceptible to HIV infection, modification of HSCs is an ideal strategy for the development of infection-resistant immune cell populations. Although promising results have been obtained in multiple animal models, additional evidence is needed to convincingly demonstrate the feasibility of this approach as a treatment of HIV-1 infected patients. Here, we review the potential of HSC transplantation and the recently identified limitations of this approach. Using the Berlin Patient as a model for a functional cure, we contrast the confines of autologous versus allogeneic transplantation. Finally, we suggest that although autologous, gene-modified HSC-transplantation may significantly reduce plasma viremia, reaching the lower detection limits currently obtainable through daily HAART will remain a challenging endeavor that will require innovative combinatorial therapies.

  18. Genetic Modification of Hematopoietic Stem Cells as a Therapy for HIV/AIDS

    PubMed Central

    Younan, Patrick; Kowalski, John; Kiem, Hans-Peter

    2013-01-01

    The combination of genetic modification and hematopoietic stem cell (HSC) transplantation may provide the necessary means to develop an alternative treatment option to conventional antiretroviral therapy. As HSCs give rise to all hematopoietic cell types susceptible to HIV infection, modification of HSCs is an ideal strategy for the development of infection-resistant immune cell populations. Although promising results have been obtained in multiple animal models, additional evidence is needed to convincingly demonstrate the feasibility of this approach as a treatment of HIV-1 infected patients. Here, we review the potential of HSC transplantation and the recently identified limitations of this approach. Using the Berlin Patient as a model for a functional cure, we contrast the confines of autologous versus allogeneic transplantation. Finally, we suggest that although autologous, gene-modified HSC-transplantation may significantly reduce plasma viremia, reaching the lower detection limits currently obtainable through daily HAART will remain a challenging endeavor that will require innovative combinatorial therapies. PMID:24287598

  19. Consequences of spin-orbit coupling at the single hole level: Spin-flip tunneling and the anisotropic g factor

    DOE PAGES

    Bogan, A.; Studenikin, Sergei A.; Korkusinski, M.; ...

    2017-04-20

    Hole transport experiments were performed on a gated double quantum dot device defined in a p-GaAs/AlGaAs heterostructure with a single hole occupancy in each dot. The charging diagram of the device was mapped out using charge detection confirming that the single hole limit is reached. In that limit, a detailed study of the two-hole spin system was performed using high bias magnetotransport spectroscopy. In contrast to electron systems, the hole spin was found not to be conserved during interdot resonant tunneling. This allows one to fully map out the two-hole energy spectrum as a function of the magnitude and themore » direction of the external magnetic field. As a result, the heavy-hole g factor was extracted and shown to be strongly anisotropic, with a value of 1.45 for a perpendicular field and close to zero for an in-plane field as required for hybridizing schemes between spin and photonic quantum platforms.« less

  20. The next generation of LASIK patients.

    PubMed

    Freeman, J Christopher; Chuck, Roy S

    2009-07-01

    With baby boomers aging, and despite a growing global population, there is a decreasing number of potential laser vision correction patients. Some believe that the worldwide economic downturn of these times will limit the number of potential patients as well. This article highlights looking to an alternative segment of the population to identify potential laser vision correction patients and the limitations of reaching this group. The group known as generation Y contains a large number of individuals who may be candidates for laser vision correction. Traditional marketing efforts present challenges in reaching this particular population segment. Many individuals in this group are already patients of eye doctors for contact lenses and glasses and can be reached by these eye doctors to address candidacy and education of laser vision correction. Generation Y represents a large population segment that contains technology-embracing individuals who, although hard to reach with traditional marketing efforts, may be reached by fellow eye doctors already managing these patients. There are many in this age group who would be good laser vision correction candidates.

  1. In situ surface-enhanced Raman scattering monitoring of reduction of 4-nitrothiophenol on bifunctional metallic nanostructure

    NASA Astrophysics Data System (ADS)

    Du, Pan; Zhang, Xin; Yin, Hongjun; Zhao, Yongmei; Liu, Luo; Wu, Zhenglong; Xu, Haijun

    2018-03-01

    Bifunctional Au/Ag nanoparticle-decorated silicon nanowire arrays (Au/Ag@SiNWAs) were prepared using a facile wet chemical method. This surface-enhanced Raman scattering (SERS) substrate not only showed excellent reutilization capabilities by the simple NaBH4 washing, but also could reach a detection limit for drop-dried rhodamine 6G molecules as low as 10-16 M. More importantly, this substrate could be used to monitor the in situ reduction of 4-nitrothiophenol by NaBH4 using SERS spectroscopy. Our findings demonstrate that the bifunctional substrate can serve as a powerful system for the real-time in situ SERS monitoring of catalytic reactions, which should be beneficial for new catalyst exploration.

  2. Fate of 14C-terpolymer (methylmethacrylate-14C, 2-hydroxyethylmethacrylate, butylacrylate) nanoparticles after peroral administration to rats.

    PubMed

    Kukan, M; Bezek, S; Koprda, V; Labský, J; Kálal, J; Bauerová, K; Trnovec, T

    1989-05-01

    The fate of 14C-terpolymer (methylmethacrylate-14C, 2-hydroxyethylmethacrylate, butylacrylate) nanoparticles was studied in male Wistar rats after peroral administration. These nanoparticles may reach systemic circulation as evidenced by the plasma 14C level, excretion of the label in the urine, as well as organ label deposition. It was found that at least 2% of the dose of 14C was absorbed from the gastrointestinal tract. As expected, the radioactive nanoparticles were excreted predominantly via the feces. The amount of the label in the gastrointestinal tract, liver, and carcasses fell below the limit of detection on day seven after administration. However in the spleen and lung some slight radioactivity persisted after 7 d of experiment.

  3. 33 CFR 84.17 - Horizontal sectors.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... intensities. The intensities shall decrease to reach practical cut-off between 1 and 3 degrees outside the... intensity may decrease by 50 percent up to the prescribed limits; it shall decrease steadily to reach...

  4. Collider detection of dark matter electromagnetic anapole moments

    NASA Astrophysics Data System (ADS)

    Alves, Alexandre; Santos, A. C. O.; Sinha, Kuver

    2018-03-01

    Dark matter that interacts with the Standard Model by exchanging photons through higher multipole interactions occurs in a wide range of both strongly and weakly coupled hidden sector models. We study the collider detection prospects of these candidates, with a focus on Majorana dark matter that couples through the anapole moment. The study is conducted at the effective field theory level with the mono-Z signature incorporating varying levels of systematic uncertainties at the high-luminosity LHC. The projected collider reach on the anapole moment is then compared to the reach coming from direct detection experiments like LZ. Finally, the analysis is applied to a weakly coupled completion with leptophilic dark matter.

  5. Automated and sensitive method for the determination of formoterol in human plasma by high-performance liquid chromatography and electrochemical detection.

    PubMed

    Campestrini, J; Lecaillon, J B; Godbillon, J

    1997-12-19

    An automated high-performance liquid chromatography (HPLC) method for the determination of formoterol in human plasma with improved sensitivity has been developed and validated. Formoterol and CGP 47086, the internal standard, were extracted from plasma (1 ml) using a cation-exchange solid-phase extraction (SPE) cartridge. The compounds were eluted with pH 6 buffer solution-methanol (70:30, v/v) and the eluate was further diluted with water. An aliquot of the extract solution was injected and analyzed by HPLC. The extraction, dilution, injection and chromatographic analysis were combined and automated using the automate (ASPEC) system. The chromatographic separations were achieved on a 5 microm, Hypersil ODS analytical column (200 mm x 3 mm I.D.), using (pH 6 phosphate buffer, 0.035 M + 20 mg/l EDTA)-MeOH-CH3CN (70:25:5, v/v/v) as the mobile phase at a flow-rate of 0.4 ml/min. The analytes were detected with electrochemical detection at an operating potential of +0.63 V. Intra-day accuracy and precision were assessed from the relative recoveries of calibration/quality control plasma samples in the concentration range of 7.14 to 238 pmol/l of formoterol base. The accuracy over the entire concentration range varied from 81 to 105%, and the precision (C.V.) ranged from 3 to 14%. Inter-day accuracy and precision were assessed in the concentration range of 11.9 to 238 pmol/l of formoterol base in plasma. The accuracy over the entire concentration range varied from 98 to 109%, and precision ranged from 8 to 19%. At the limit of quantitation (LOQ) of 11.9 pmol/l for inter-day measurements, the recovery value was 109% and C.V. was 19%. As shown from intra-day accuracy and precision results, favorable conditions (a newly used column, a newly washed detector cell and moderate residual cell current level) allowed us to reach a LOQ of 7.14 pmol/l of formoterol base (3 pg/ml of formoterol fumarate dihydrate). Improvement of the limit of detection by a factor of about 10 was reached as compared to the previously described methods. The method has been applied for quantifying formoterol in plasma after 120 microg drug inhalation to volunteers. Formoterol was still measurable at 24 h post-dosing in most subjects and a slow elimination of formoterol from plasma beyond 6-8 h after inhalation was demonstrated for the first time thanks to the sensitivity of the method.

  6. Development of a multianalyte method based on micro-matrix-solid-phase dispersion for the analysis of fragrance allergens and preservatives in personal care products.

    PubMed

    Celeiro, Maria; Guerra, Eugenia; Lamas, J Pablo; Lores, Marta; Garcia-Jares, Carmen; Llompart, Maria

    2014-05-30

    An effective, simple and low cost sample preparation method based on matrix solid-phase dispersion (MSPD) followed by gas chromatography-mass spectrometry (GC-MS) or gas chromatography-triple quadrupole-mass spectrometry (GC-MS/MS) has been developed for the rapid simultaneous determination of 38 cosmetic ingredients, 25 fragrance allergens and 13 preservatives. All target substances are frequently used in cosmetics and personal care products and they are subjected to use restrictions or labeling requirements according to the EU Cosmetic Directive. The extraction procedure was optimized on real non-spiked rinse-off and leave-on cosmetic products by means of experimental designs. The final miniaturized process required the use of only 0.1g of sample and 1 mL of organic solvent, obtaining a final extract ready for analysis. The micro-MSPD method was validated showing satisfactory performance by GC-MS and GC-MS/MS analysis. The use of GC coupled to triple quadrupole mass detection allowed to reach very low detection limits (low ng g(-1)) improving, at the same time, method selectivity. In an attempt to improve the chromatographic analysis of preservatives, the inclusion of a derivatization step was also assessed. The proposed method was applied to a broad range of cosmetics and personal care products (shampoos, body milk, moisturizing milk, toothpaste, hand creams, gloss lipstick, sunblock, deodorants and liquid soaps among others), demonstrating the extended use of these substances. The concentration levels were ranging from the sub parts per million to the parts per mill. The number of target fragrance allergens per samples was quite high (up to 16). Several fragrances (linalool, farnesol, hexylcinnamal, and benzyl benzoate) have been detected at levels >0.1% (1,000 μg g(-1)). As regards preservatives, phenoxyethanol was the most frequently found additive reaching quite high concentration (>1,500 μg g(-1)) in five cosmetic products. BHT was detected in eight samples, in two of them (a baby care product and a lipstick) at high concentrations (>1,000 μg g(-1)). Methyl paraben was also found at high levels (>1,700 μg g(-1)) in three leave-on samples. Finally, triclosan was found at the maximum concentration limit (0.3%) laid down by the European regulation in two deodorant samples, and the total paraben concentration was close to the maximum concentration permitted (0.8%) in one leave-on sample (body milk). Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Lameness Detection in Dairy Cows: Part 2. Use of Sensors to Automatically Register Changes in Locomotion or Behavior.

    PubMed

    Van Nuffel, Annelies; Zwertvaegher, Ingrid; Van Weyenberg, Stephanie; Pastell, Matti; Thorup, Vivi M; Bahr, Claudia; Sonck, Bart; Saeys, Wouter

    2015-08-28

    Despite the research on opportunities to automatically measure lameness in cattle, lameness detection systems are not widely available commercially and are only used on a few dairy farms. However, farmers need to be aware of the lame cows in their herds in order treat them properly and in a timely fashion. Many papers have focused on the automated measurement of gait or behavioral cow characteristics related to lameness. In order for such automated measurements to be used in a detection system, algorithms to distinguish between non-lame and mildly or severely lame cows need to be developed and validated. Few studies have reached this latter stage of the development process. Also, comparison between the different approaches is impeded by the wide range of practical settings used to measure the gait or behavioral characteristic (e.g., measurements during normal farming routine or during experiments; cows guided or walking at their own speed) and by the different definitions of lame cows. In the majority of the publications, mildly lame cows are included in the non-lame cow group, which limits the possibility of also detecting early lameness cases. In this review, studies that used sensor technology to measure changes in gait or behavior of cows related to lameness are discussed together with practical considerations when conducting lameness research. In addition, other prerequisites for any lameness detection system on farms (e.g., need for early detection, real-time measurements) are discussed.

  8. Detection of lead in brass by laser-induced breakdown spectroscopy combined with laser-induced fluorescence

    NASA Astrophysics Data System (ADS)

    Goueguel, Christian; Laville, Stéphane; Loudyi, Hakim; Chaker, Mohamed; Sabsabi, Mohamad; Vidal, François

    2008-06-01

    Laser-Induced Breakdown Spectroscopy (LIBS) technique combined with Laser-Induced Fluorescence (LIF) is known to be a high sensitivity and high selectivity analytical technique. Although sub-ppm limits of detection (LoD) have already been demonstrated, there is still a constant and urgent need to reach lower LoDs. Here, we report results obtained for the detection of lead trace in brass samples. The plasma was produced by a Q-switched Nd:YAG laser at 1064 nm and then re-excited by a nanosecond optical parametric oscillator (OPO) laser tuned at 283.31 nm. Emission from Pb atoms was then observed at 405.78 nm. The experiments were performed in air at atmospheric pressure. We found out that the optimal conditions were obtained for an ablation fluence of 2-3 J/cm2 and inter-pulse delay of 8-10 μs. Also, excitation energy of about 200 μJ was required to maximize the Pb(I) 405.78 nm emission. Using the LIBS-LIFS technique, the LoD was estimated to be about 180 ppb over 100 laser shots, which corresponds to an improvement of about two orders of magnitude with that obtained using conventional LIBS.

  9. Performance of a fire detector based on a compact laser spectroscopic carbon monoxide sensor.

    PubMed

    Hangauer, A; Chen, J; Strzoda, R; Fleischer, M; Amann, M-C

    2014-06-02

    In this paper we show the suitability of a miniaturized tunable diode laser spectroscopy (TDLS)-based carbon-monoxide (CO) sensor for fire detection applications. The sensor utilizes a vertical-cavity surface-emitting laser (VCSEL) and inherent calibration scheme with reference gas filled in the photodetector housing. The fire-detection experiments are carried out under realistic conditions as described in the European standard EN54. The CO generation of all class C fires (according to EN54) could be well resolved. The cross-sensitivity to other substances was found to be very low: the maximum CO false response from cigarette smoke, hairspray and general aerosols reaches a low value of a few μL/L and only if the substance is directly applied into the sensor gas inlet. Therefore this sensor overcomes the disadvantage of high false alarm rate given by smoke detectors and is also in small size which is suitable for household and industrial applications. Hence, the VCSEL-based TDLS sensor is shown to have sufficient performance for fire-detection. It has advantages such as capability for fail-safe operation and, low cross-sensitivities as compared to existing point fire detector technology which is presently limited by these factors.

  10. Enantiomeric separation of fluoxetine and norfluoxetine in plasma and serum samples with high detection sensitivity capillary electrophoresis.

    PubMed

    Desiderio, C; Rudaz, S; Raggi, M A; Fanali, S

    1999-11-01

    A capillary electrophoresis method was optimized for the stereoselective analysis of the antidepressant drug fluoxetine and its main demethylated metabolite norfluoxetine using a cyclodextrin-modified sodium phosphate buffer at pH 2.5. The combination of a neutral and a negatively charged cyclodextrin, dimethylated-beta- and phosphated-gamma-respectively, provided the baseline enantiomeric separation of the two compounds. The very low concentrations of chiral selectors employed together with the use of a high sensitivity detection cell of special design (zeta-shaped) in a diode array UV detector allowed us to reach a limit of detection of 0.005 and 0.01 microg/mL for fluoxetine and norfluoxetine, respectively. Analysis of fluoxetine and norfluoxetine standard mixtures showed a reproducibility of migration times and peak area and linearity in the concentration range of 0.1-2.0 microg/mL. The optimized method was applied to the analysis of clinical serum and plasma samples of patients under depression therapy. In all the analyzed samples the enantiomeric forms of fluoxetine and norfluoxetine were easily identified. The fluoxetine and metabolite enantiomeric ratio confirmed the stereoselectivity of the metabolic process of the fluoxetine drug in accordance with the literature data.

  11. Molecular imprinted polymer-coated optical fiber sensor for the identification of low molecular weight molecules.

    PubMed

    Lépinay, Sandrine; Ianoul, Anatoli; Albert, Jacques

    2014-10-01

    A biomimetic optical probe for detecting low molecular weight molecules (maltol, 3-hydroxy-2-methyl-4H-pyran-4-one, molecular weight of 126.11 g/mol), was designed, fabricated, and characterized. The sensor couples a molecular imprinted polymer (MIP) and the Bragg grating refractometry technology into an optical fiber. The probe is fabricated first by inscribing tilted grating planes in the core of the fiber, and then by photopolymerization to immobilize a maltol imprinted MIP on the fiber cladding surface over the Bragg grating. The sensor response to the presence of maltol in different media is obtained by spectral interrogation of the fiber transmission signal. The results showed that the limit of detection of the sensor reached 1 ng/mL in pure water with a sensitivity of 6.3 × 10(8)pm/M. The selectivity of the sensor against other compounds and its reusability were also studied experimentally. Finally, the unambiguous detection of concentrations as little as 10nM of maltol in complex media (real food samples) by the MIP-coated tilted fiber Bragg grating sensor was demonstrated. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. A facile one-pot preparation of Co3O4/g-C3N4 heterojunctions with excellent electrocatalytic activity for the detection of environmental phenolic hormones

    NASA Astrophysics Data System (ADS)

    Sun, Yanjuan; Jiang, Jizhou; Liu, Yi; Wu, Shengli; Zou, Jing

    2018-02-01

    The Co3O4/g-C3N4 heterojunctions were prepared by a facile one-pot thermal decomposition technique. Compared with g-C3N4, it was found that Co3O4/g-C3N4 heterojunctions possessed a higher Brunner-Emmet-Teller (BET) surface area, which was beneficial to the diffusion of aim molecules on the electrode surfaces. And the optimal Co3O4/g-C3N4 heterojunctions exhibited a narrower band gap and a higher donor density, resulting in an excellent electrocatalytic activity for environmental phenolic hormones. Moreover, the Co3O4/g-C3N4 heterojunctions were used for the electrochemical sensing of environmental phenolic hormones such as bisphenol A, pentachlorophenol, p-nitrophenol and octylphenol. All detection ranges reached three orders of magnitude, showing a lower limit of detection of 10-9 mol L-1. So, sensitivity and accurate determination of environmental phenolic hormones in real water samples may use this Co3O4/g-C3N4 heterojunctions modified electrode.

  13. Changes in Muscle Activation after Reach Training with Gravity Compensation in Chronic Stroke Patients

    ERIC Educational Resources Information Center

    Prange, Gerdienke B.; Krabben, Thijs; Renzenbrink, Gerbert J.; Ijzerman, Maarten J.; Hermens, Hermie J.; Jannink, Michiel J. A.

    2012-01-01

    The objective of this study is to examine the effect of gravity compensation training on reaching and underlying changes in muscle activation. In this clinical trial, eight chronic stroke patients with limited arm function received 18 sessions (30 min) of gravity-compensated reach training (during 6 weeks) in combination with a rehabilitation…

  14. 33 CFR 162.105 - Missouri River; administration and navigation.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... on the river. (b) Navigation. During critical flood stages on any particular limited reach of the... District Commander in charge of the locality shall have the authority to declare the reach of the river...

  15. From reaching to reach-to-grasp: the arm posture difference and its implications on human motion control strategy.

    PubMed

    Li, Zhi; Milutinović, Dejan; Rosen, Jacob

    2017-05-01

    Reach-to-grasp arm postures differ from those in pure reaching because they are affected by grasp position/orientation, rather than simple transport to a position during a reaching motion. This paper investigates this difference via an analysis of experimental  data collected on reaching and reach-to-grasp motions. A seven-degree-of-freedom (DOFs) kinematic arm model with the swivel angle is used for the motion analysis. Compared to a widely used anatomical arm model, this model distinguishes clearly the four grasping-relevant DOFs (GR-DOFs) that are affected by positions and orientations of the objects to be grasped. These four GR-DOFs include the swivel angle that measures the elbow rotation about the shoulder-wrist axis, and three wrist joint angles. For each GR-DOF, we quantify position vs orientation task-relevance bias that measures how much the DOF is affected by the grasping position vs orientation. The swivel angle and forearm supination have similar bias, and the analysis of their motion suggests two hypotheses regarding the synergistic coordination of the macro- and micro-structures of the human arm (1) DOFs with similar task-relevance are synergistically coordinated; and (2) such synergy breaks when a task-relevant DOF is close to its joint limit without necessarily reaching the limit. This study provides a motion analysis method to reduce the control complexity for reach-to-grasp tasks, and suggests using dynamic coupling to coordinate the hand and arm of upper-limb exoskeletons.

  16. Low Z total reflection X-ray fluorescence analysis — challenges and answers

    NASA Astrophysics Data System (ADS)

    Streli, C.; Kregsamer, P.; Wobrauschek, P.; Gatterbauer, H.; Pianetta, P.; Pahlke, S.; Fabry, L.; Palmetshofer, L.; Schmeling, M.

    1999-10-01

    Low Z elements, like C, O, ... Al are difficult to measure, due to the lack of suitable low-energy photons for efficient excitation using standard X-ray tubes, as well as difficult to detect with an energy dispersive detector, if the entrance window is not thin enough. Special excitation sources and special energy dispersive detectors are required to increase the sensitivity and to increase the detected fluorescence signal and so to improve the detection limits. Synchrotron radiation, due to its features like high intensity and wide spectral range covering also the low-energy region, is the ideal source for TXRF, especially of low-Z elements. Experiments at a specific beamline (BL 3-4) at SSRL, Stanford, designed for the exclusive use of low-energy photons has been used as an excitation source. Detection limits <100 fg for Al, Mg and Na have been achieved using quasimonochromatic radiation of 1.7 keV. A Ge(HP) detector with an ultra-thin NORWAR entrance window is used. One application is the determination of low-Z surface contamination on Si-wafers. Sodium, as well as Al, are elements of interest for the semiconductor industry, both influencing the yield of ICs negatively. A detection capacity of 10 10 atoms/cm 2 is required which can be reached using synchrotron radiation as excitation source. Another promising application is the determination of low-Z atoms implanted in Si wafers. Sodium, Mg and Al were implanted in Si-wafers at various depths. From measuring the dependence of the fluorescence signal on the glancing angle, characteristic shapes corresponding to the depth profile and the relevant implantation depth are found. Calculations are compared with measurements. Finally, aerosols sampled on polycarbonate plates in a Battelle impactor were analyzed with LZ-TXRF using multilayer monochromatized Cr-Kα radiation from a 1300-W fine-focus tube for excitation. Results are presented.

  17. A new kind of highly sensitive competitive lateral flow immunoassay displaying direct analyte-signal dependence. Application to the determination of the mycotoxin deoxynivalenol.

    PubMed

    Urusov, Alexandr E; Gubaidullina, Miliausha K; Petrakova, Alina V; Zherdev, Anatoly V; Dzantiev, Boris B

    2017-12-06

    A new kind of competitive immunochromatographic assay is presented. It is based on the use of a test strip loaded with (a) labeled specific antibodies, (b) a hapten-protein conjugate at the control zone, and (c) antibodies interacting with the specific antibodies in the analytical zone. In the case where a sample does not contain the target antigen (hapten), all labeled antibodies remain in the control zone because of the selected ratio of reactants. The analytical zone remains colorless because the labeled antibodies do not reach it. If an antigen is present in the sample, it interferes with the binding of the specific antibodies in the control zone and knocks them out. Some of these antibodies pass the control zone to form a colored line in the analytical zone. The intensity of the color is directly proportional to the amount of the target antigen in the sample. The assay has an attractive feature in that an appearance in coloration is more easily detected visually than a decoloration. Moreover, the onset of coloration is detectable at a lower concentration than a decoloration. The new detection scheme was applied to the determination of the mycotoxin deoxynivalenol. The visual limit of detection is 2 ng·mL -1 in corn extracts (35 ng per gram of sample). With the same reagents, this is lower by a factor of 60 than the established test strip. The assay takes only 15 min. This new kind of assay has wide potential applications for numerous low molecular weight analytes. Graphical abstract Competitive immunochromatography with direct analyte-signal dependence is proposed. It provides a 60-fold decrease of the detection limit for mycotoxin deoxynivalenol. The analyte-antibody-label complexes move along the immobilized antigen (control zone) and bind with anti-species antibodies (test zone).

  18. Remote laser spectroscopy of oil and gas deposits

    NASA Astrophysics Data System (ADS)

    Zhevlakov, A. P.; Bespalov, V. G.; Elizarov, V. V.; Grishkanich, A. S.; Kascheev, S. V.; Makarov, E. A.; Bogoslovsky, S. A.; Il'inskiy, A. A.

    2014-06-01

    We developed a Raman lidar with ultraspectral resolution for automatic airborne monitoring of pipeline leaks and for oil and gas exploration. Test flights indicate that a sensitivity of 6 ppm for methane and 2 ppm for hydrogen sulfide has been reached for leakage detection. The lidar is based on the CARS method with a Ti:Sapphire pump laser and a frequencydoubled YLF:Nd probe beam whose frequency is displaced by a BBO crystal. In ground-based experiments, a detection level of 3 to 10 molecules has been reached.

  19. How big can a black hole grow?

    NASA Astrophysics Data System (ADS)

    King, Andrew

    2016-02-01

    I show that there is a physical limit to the mass of a black hole, above which it cannot grow through luminous accretion of gas, and so cannot appear as a quasar or active galactic nucleus (AGN). The limit is Mmax ≃ 5 × 1010 M⊙ for typical parameters, but can reach Mmax ≃ 2.7 × 1011 M⊙ in extreme cases (e.g. maximal prograde spin). The largest black hole masses so far found are close to but below the limit. The Eddington luminosity ≃6.5 × 1048 erg s-1 corresponding to Mmax is remarkably close to the largest AGN bolometric luminosity so far observed. The mass and luminosity limits both rely on a reasonable but currently untestable hypothesis about AGN disc formation, so future observations of extreme supermassive black hole masses can therefore probe fundamental disc physics. Black holes can in principle grow their masses above Mmax by non-luminous means such as mergers with other holes, but cannot become luminous accretors again. They might nevertheless be detectable in other ways, for example through gravitational lensing. I show further that black holes with masses ˜Mmax can probably grow above the values specified by the black-hole-host-galaxy scaling relations, in agreement with observation.

  20. Josephson junction microwave amplifier in self-organized noise compression mode

    PubMed Central

    Lähteenmäki, Pasi; Vesterinen, Visa; Hassel, Juha; Seppä, Heikki; Hakonen, Pertti

    2012-01-01

    The fundamental noise limit of a phase-preserving amplifier at frequency is the standard quantum limit . In the microwave range, the best candidates have been amplifiers based on superconducting quantum interference devices (reaching the noise temperature at 700 MHz), and non-degenerate parametric amplifiers (reaching noise levels close to the quantum limit at 8 GHz). We introduce a new type of an amplifier based on the negative resistance of a selectively damped Josephson junction. Noise performance of our amplifier is limited by mixing of quantum noise from Josephson oscillation regime down to the signal frequency. Measurements yield nearly quantum-limited operation, at 2.8 GHz, owing to self-organization of the working point. Simulations describe the characteristics of our device well and indicate potential for wide bandwidth operation. PMID:22355788

  1. Glyphosate analysis using sensors and electromigration separation techniques as alternatives to gas or liquid chromatography.

    PubMed

    Gauglitz, Günter; Wimmer, Benedikt; Melzer, Tanja; Huhn, Carolin

    2018-01-01

    Since its introduction in 1974, the herbicide glyphosate has experienced a tremendous increase in use, with about one million tons used annually today. This review focuses on sensors and electromigration separation techniques as alternatives to chromatographic methods for the analysis of glyphosate and its metabolite aminomethyl phosphonic acid. Even with the large number of studies published, glyphosate analysis remains challenging. With its polar and depending on pH even ionic functional groups lacking a chromophore, it is difficult to analyze with chromatographic techniques. Its analysis is mostly achieved after derivatization. Its purification from food and environmental samples inevitably results incoextraction of ionic matrix components, with a further impact on analysis derivatization. Its purification from food and environmental samples inevitably results in coextraction of ionic matrix components, with a further impact on analysis and also derivatization reactions. Its ability to form chelates with metal cations is another obstacle for precise quantification. Lastly, the low limits of detection required by legislation have to be met. These challenges preclude glyphosate from being analyzed together with many other pesticides in common multiresidue (chromatographic) methods. For better monitoring of glyphosate in environmental and food samples, further fast and robust methods are required. In this review, analytical methods are summarized and discussed from the perspective of biosensors and various formats of electromigration separation techniques, including modes such as capillary electrophoresis and micellar electrokinetic chromatography, combined with various detection techniques. These methods are critically discussed with regard to matrix tolerance, limits of detection reached, and selectivity.

  2. Perspectives on Emerging/Novel Computing Paradigms and Future Aerospace Workforce Environments

    NASA Technical Reports Server (NTRS)

    Noor, Ahmed K.

    2003-01-01

    The accelerating pace of the computing technology development shows no signs of abating. Computing power reaching 100 Tflop/s is likely to be reached by 2004 and Pflop/s (10(exp 15) Flop/s) by 2007. The fundamental physical limits of computation, including information storage limits, communication limits and computation rate limits will likely be reached by the middle of the present millennium. To overcome these limits, novel technologies and new computing paradigms will be developed. An attempt is made in this overview to put the diverse activities related to new computing-paradigms in perspective and to set the stage for the succeeding presentations. The presentation is divided into five parts. In the first part, a brief historical account is given of development of computer and networking technologies. The second part provides brief overviews of the three emerging computing paradigms grid, ubiquitous and autonomic computing. The third part lists future computing alternatives and the characteristics of future computing environment. The fourth part describes future aerospace workforce research, learning and design environments. The fifth part lists the objectives of the workshop and some of the sources of information on future computing paradigms.

  3. Rapid detection of Bacillus anthracis using monoclonal antibody functionalized QCM sensor.

    PubMed

    Hao, Rongzhang; Wang, Dianbing; Zhang, Xian'en; Zuo, Guomin; Wei, Hongping; Yang, Ruifu; Zhang, Zhiping; Cheng, Zhenxing; Guo, Yongchao; Cui, Zongqiang; Zhou, Yafeng

    2009-01-01

    Since the anthrax spore bioterrorism attacks in America in 2001, the early detection of Bacillus anthracis spores and vegetative cells has gained significant interest. At present, many polyclonal antibody-based quartz crystal microbalance (QCM) sensors have been developed to detect B. anthracis simulates. To achieve a simultaneous rapid detection of B. anthracis spores and vegetative cells, this paper presents a biosensor that utilizes an anti-B. anthracis monoclonal antibody designated to 8G3 (mAb 8G3, IgG) functionalized QCM sensor. Having compared four kinds of antibody immobilizations on Au surface, an optimized mAb 8G3 was immobilized onto the Au electrode with protein A on a mixed self-assembled monolayer (SAM) of 11-mercaptoundecanoic acid (11-MUA) and 6-mercaptohexan-1-ol (6-MHO) as adhesive layer. The detection of B. anthracis was investigated under three conditions: dip-and-dry, static addition and flow through procedure. The results indicated that the sensor yielded a distinct response to B. anthracis spores or vegetative cells but had no significant response to Bacillus thuringiensis species. The functionalized sensor recognized B. anthracis spores and vegetative cells specifically from its homophylic ones, and the limit of detection (LOD) reached 10(3)CFU or spores/ml of B. anthracis in less than 30 min. Cyclic voltammogram (CV) and scanning electronic microscopy (SEM) were performed to characterize the surface of the sensor in variable steps during the modification and after the detection. The mAb functionalized QCM biosensor will be helpful in the fabrication of a similar biosensor that may be available in anti-bioterrorism in the future.

  4. SISGR: Room Temperature Single-Molecule Detection and Imaging by Stimulated Emission Microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Xiaoliang Sunney

    Single-molecule spectroscopy has made considerable impact on many disciplines including chemistry, physics, and biology. To date, most single-molecule spectroscopy work is accomplished by detecting fluorescence. On the other hand, many naturally occurring chromophores, such as retinal, hemoglobin and cytochromes, do not have detectable fluorescence. There is an emerging need for single-molecule spectroscopy techniques that do not require fluorescence. In the last proposal period, we have successfully demonstrated stimulated emission microscopy, single molecule absorption, and stimulated Raman microscopy based on a high-frequency modulation transfer technique. These first-of-a- kind new spectroscopy/microscopy methods tremendously improved our ability to observe molecules that fluorescence weakly,more » even to the limit of single molecule detection for absorption measurement. All of these methods employ two laser beams: one (pump beam) excites a single molecule to a real or virtual excited state, and the other (probe beam) monitors the absorption/emission property of the single. We extract the intensity change of the probe beam with high sensitivity by implementing a high-frequency phase-sensitive detection scheme, which offers orders of magnitude improvement in detection sensitivity over direct absorption/emission measurement. However, single molecule detection based on fluorescence or absorption is fundamentally limited due to their broad spectral response. It is important to explore other avenues in single molecule detection and imaging which provides higher molecular specificity for studying a wide variety of heterogeneous chemical and biological systems. This proposal aimed to achieve single-molecule detection sensitivity with near resonance stimulated Raman scattering (SRS) microscopy. SRS microscopy was developed in our lab as a powerful technique for imaging heterogeneous samples based on their intrinsic vibrational contrasts, which provides much higher molecular specificity than absorption and fluorescence. Current sensitivity limit of SRS microscopy has not yet reached single molecule detection. We proposed to capitalize on our state-of-the-art SRS microscopy and develop near-resonance enhanced SRS for single molecule detection of carotenoids and heme proteins. The specific aims we pursued are: (1) building the next SRS generation microscope that utilizes near resonance enhancement to allow detection and imaging of single molecules with undetectable fluorescence, such as -carotene. (2) using near-resonance SRS as a contrast mechanism to study dye-sensitize semiconductor interface, elucidating the heterogeneous electron ejection kinetics with high spatial and temporal resolution. (3) studying the binding and unbinding of oxygen in single hemoglobin molecules in order to gain molecular level understanding of the long-standing issue of cooperativity. The new methods developed in the fund period of this grant have advanced the detection sensitivity in many aspects. Near-resonance SRS improved the signal by using shorter wavelengths for SRS microscopy. Frequency modulation and multi-color SRS target the reduction of background to improve the chemical specificity of SRS while maintaining the high imaging speed. Time-domain coherent Raman scattering microscopy targets to reduce the noise floor of coherent Raman microscopy. These methods have already demonstrated first-of-a-kind new applications in biology and medical research. However, we are still one order of magnitude away from single molecule limit. It is important to continue to improve the laser specification and develop new imaging methods to finally achieve label-free single molecule microscopy.« less

  5. 50 CFR 622.191 - Commercial trip limits.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    .... During a limited commercial fishing season, as specified in § 622.183(b)(5), and until the commercial ACL... limitations regarding red snapper after the commercial ACL is reached. (b) [Reserved] [78 FR 22952, Apr. 17...

  6. 50 CFR 622.191 - Commercial trip limits.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    .... During a limited commercial fishing season, as specified in § 622.183(b)(5), and until the commercial ACL... limitations regarding red snapper after the commercial ACL is reached. (b) [Reserved] [78 FR 22952, Apr. 17...

  7. Basin Visual Estimation Technique (BVET) and Representative Reach Approaches to Wadeable Stream Surveys: Methodological Limitations and Future Directions

    Treesearch

    Lance R. Williams; Melvin L. Warren; Susan B. Adams; Joseph L. Arvai; Christopher M. Taylor

    2004-01-01

    Basin Visual Estimation Techniques (BVET) are used to estimate abundance for fish populations in small streams. With BVET, independent samples are drawn from natural habitat units in the stream rather than sampling "representative reaches." This sampling protocol provides an alternative to traditional reach-level surveys, which are criticized for their lack...

  8. 50 CFR 622.193 - Annual catch limits (ACLs), annual catch targets (ACTs), and accountability measures (AMs).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., as estimated by the SRD, reach or are projected to reach the commercial ACL (commercial quota... commercial ACL (commercial quota) specified in § 622.190(a)(2)(iii), the AA will file a notification with the... of the fishing year. After the commercial ACL for the longline component is reached or projected to...

  9. 50 CFR 622.193 - Annual catch limits (ACLs), annual catch targets (ACTs), and accountability measures (AMs).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., as estimated by the SRD, reach or are projected to reach the commercial ACL (commercial quota... commercial ACL (commercial quota) specified in § 622.190(a)(2)(iii), the AA will file a notification with the... of the fishing year. After the commercial ACL for the longline component is reached or projected to...

  10. Discerning trends in multiplex immunoassay technology with potential for resource-limited settings.

    PubMed

    Gordon, Julian; Michel, Gerd

    2012-04-01

    In the search for more powerful tools for diagnoses of endemic diseases in resource-limited settings, we have been analyzing technologies with potential applicability. Increasingly, the process focuses on readily accessible bodily fluids combined with increasingly powerful multiplex capabilities to unambiguously diagnose a condition without resorting to reliance on a sophisticated reference laboratory. Although these technological advances may well have important implications for the sensitive and specific detection of disease, to date their clinical utility has not been demonstrated, especially in resource-limited settings. Furthermore, many emerging technological developments are in fields of physics or engineering, which are not readily available to or intelligible to clinicians or clinical laboratory scientists. This review provides a look at technology trends that could have applicability to high-sensitivity multiplexed immunoassays in resource-limited settings. Various technologies are explained and assessed according to potential for reaching relevant limits of cost, sensitivity, and multiplex capability. Frequently, such work is reported in technical journals not normally read by clinical scientists, and the authors make enthusiastic claims for the potential of their technology while ignoring potential pitfalls. Thus it is important to draw attention to technical hurdles that authors may not be publicizing. Immunochromatographic assays, optical methods including those involving waveguides, electrochemical methods, magnetorestrictive methods, and field-effect transistor methods based on nanotubes, nanowires, and nanoribbons reveal possibilities as next-generation technologies.

  11. Automated Propulsion Data Screening demonstration system

    NASA Technical Reports Server (NTRS)

    Hoyt, W. Andes; Choate, Timothy D.; Whitehead, Bruce A.

    1995-01-01

    A fully-instrumented firing of a propulsion system typically generates a very large quantity of data. In the case of the Space Shuttle Main Engine (SSME), data analysis from ground tests and flights is currently a labor-intensive process. Human experts spend a great deal of time examining the large volume of sensor data generated by each engine firing. These experts look for any anomalies in the data which might indicate engine conditions warranting further investigation. The contract effort was to develop a 'first-cut' screening system for application to SSME engine firings that would identify the relatively small volume of data which is unusual or anomalous in some way. With such a system, limited and expensive human resources could focus on this small volume of unusual data for thorough analysis. The overall project objective was to develop a fully operational Automated Propulsion Data Screening (APDS) system with the capability of detecting significant trends and anomalies in transient and steady-state data. However, the effort limited screening of transient data to ground test data for throttle-down cases typical of the 3-g acceleration, and for engine throttling required to reach the maximum dynamic pressure limits imposed on the Space Shuttle. This APDS is based on neural networks designed to detect anomalies in propulsion system data that are not part of the data used for neural network training. The delivered system allows engineers to build their own screening sets for application to completed or planned firings of the SSME. ERC developers also built some generic screening sets that NASA engineers could apply immediately to their data analysis efforts.

  12. Probing Reionization at z >~ 7 with HST's Near-Infrared Grisms

    NASA Astrophysics Data System (ADS)

    Schmidt, Kasper B.

    The epoch of reionization, i.e. the phase transition of the inter-galactic medium from neutral to fully ionized, is essential for our understanding of the evolution of the Universe and the formation of the first stars and galaxies. The Grism Lens-Amplified Survey from Space (GLASS) has obtained spectra of ten thousands of objects in and behind 10 massive galaxy clusters, including the six Hubble Frontier Fields. The grism spectroscopy from GLASS results in hundreds of spectra of z >~ 7 galaxy candidates. Taking advantage of the lensing magnification from the foreground clusters, the GLASS spectra reaches unprecedented depths in the near-infrared with observed flux limits of ~ 5 × 10-18erg/s/cm2 before correcting for the lens magnification. This has resulted in several Lyα detections at z ~ 7 and tight limits on the emission line fluxes for non-detections. From an ensemble of different photometric selections, we have assembled more than 150 z >~ 7 galaxy candidates from six of the ten GLASS clusters. Among these more than 20 objects show emission lines consistent with being Lyα at z >~ 7. The spatial extent of Lyα estimated from a stack of the most promising Lyα emitters at = 7.2 is consistent with the spatial extent of the UV continuum emission. From the stack we obtain upper limits on the emission line ratios between prominent rest-frame UV emission lines, finding that f CIV/f Lyα <~ 0.32 and f CIII]/f Lyα <~ 0.23 in good agreement with values published in the literature.

  13. Understanding public responses to chemical, biological, radiological and nuclear incidents--driving factors, emerging themes and research gaps.

    PubMed

    Krieger, Kristian; Amlôt, Richard; Rogers, M Brooke

    2014-11-01

    This paper discusses the management of public responses to incidents involving chemical, biological, radiological and nuclear materials (CBRN). Given the extraordinary technical and operational challenges of a response to a CBRN release including, but not limited to, hazard detection and identification, casualty decontamination and multi-agency co-ordination, it is not surprising that public psychological and behavioural responses to such incidents have received limited attention by scholars and practitioners alike. As a result, a lack of understanding about the role of the public in effective emergency response constitutes a major gap in research and practice. This limitation must be addressed as a CBRN release has the potential to have wide-reaching psychological and behavioural impacts which, in turn, impact upon public morbidity and mortality rates. This paper addresses a number of key issues: why public responses matter; how responses have been conceptualised by practitioners; what factors have been identified as influencing public responses to a CBRN release and similar extreme events, and what further analysis is needed in order to generate a better understanding of public responses to inform the management of public responses to a CBRN release. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Fast and accurate detection of spread source in large complex networks.

    PubMed

    Paluch, Robert; Lu, Xiaoyan; Suchecki, Krzysztof; Szymański, Bolesław K; Hołyst, Janusz A

    2018-02-06

    Spread over complex networks is a ubiquitous process with increasingly wide applications. Locating spread sources is often important, e.g. finding the patient one in epidemics, or source of rumor spreading in social network. Pinto, Thiran and Vetterli introduced an algorithm (PTVA) to solve the important case of this problem in which a limited set of nodes act as observers and report times at which the spread reached them. PTVA uses all observers to find a solution. Here we propose a new approach in which observers with low quality information (i.e. with large spread encounter times) are ignored and potential sources are selected based on the likelihood gradient from high quality observers. The original complexity of PTVA is O(N α ), where α ∈ (3,4) depends on the network topology and number of observers (N denotes the number of nodes in the network). Our Gradient Maximum Likelihood Algorithm (GMLA) reduces this complexity to O (N 2 log (N)). Extensive numerical tests performed on synthetic networks and real Gnutella network with limitation that id's of spreaders are unknown to observers demonstrate that for scale-free networks with such limitation GMLA yields higher quality localization results than PTVA does.

  15. Perspectives on the application of nanotechnology in photodynamic therapy for the treatment of melanoma.

    PubMed

    Monge-Fuentes, Victoria; Muehlmann, Luis Alexandre; de Azevedo, Ricardo Bentes

    2014-01-01

    Malignant melanoma is the most aggressive form of skin cancer and has been traditionally considered difficult to treat. The worldwide incidence of melanoma has been increasing faster than any other type of cancer. Early detection, surgery, and adjuvant therapy enable improved outcomes; nonetheless, the prognosis of metastatic melanoma remains poor. Several therapies have been investigated for the treatment of melanoma; however, current treatment options for patients with metastatic disease are limited and non-curative in the majority of cases. Photodynamic therapy (PDT) has been proposed as a promising minimally invasive therapeutic procedure that employs three essential elements to induce cell death: a photosensitizer, light of a specific wavelength, and molecular oxygen. However, classical PDT has shown some drawbacks that limit its clinical application. In view of this, the use of nanotechnology has been considered since it provides many tools that can be applied to PDT to circumvent these limitations and bring new perspectives for the application of this therapy for different types of diseases. On that ground, this review focuses on the potential use of developing nanotechnologies able to bring significant benefits for anticancer PDT, aiming to reach higher efficacy and safety for patients with malignant melanoma.

  16. Perspectives on the application of nanotechnology in photodynamic therapy for the treatment of melanoma

    PubMed Central

    Monge-Fuentes, Victoria; Muehlmann, Luis Alexandre; de Azevedo, Ricardo Bentes

    2014-01-01

    Malignant melanoma is the most aggressive form of skin cancer and has been traditionally considered difficult to treat. The worldwide incidence of melanoma has been increasing faster than any other type of cancer. Early detection, surgery, and adjuvant therapy enable improved outcomes; nonetheless, the prognosis of metastatic melanoma remains poor. Several therapies have been investigated for the treatment of melanoma; however, current treatment options for patients with metastatic disease are limited and non-curative in the majority of cases. Photodynamic therapy (PDT) has been proposed as a promising minimally invasive therapeutic procedure that employs three essential elements to induce cell death: a photosensitizer, light of a specific wavelength, and molecular oxygen. However, classical PDT has shown some drawbacks that limit its clinical application. In view of this, the use of nanotechnology has been considered since it provides many tools that can be applied to PDT to circumvent these limitations and bring new perspectives for the application of this therapy for different types of diseases. On that ground, this review focuses on the potential use of developing nanotechnologies able to bring significant benefits for anticancer PDT, aiming to reach higher efficacy and safety for patients with malignant melanoma. PMID:25317253

  17. Optimization of the solvent-based dissolution method to sample volatile organic compound vapors for compound-specific isotope analysis.

    PubMed

    Bouchard, Daniel; Wanner, Philipp; Luo, Hong; McLoughlin, Patrick W; Henderson, James K; Pirkle, Robert J; Hunkeler, Daniel

    2017-10-20

    The methodology of the solvent-based dissolution method used to sample gas phase volatile organic compounds (VOC) for compound-specific isotope analysis (CSIA) was optimized to lower the method detection limits for TCE and benzene. The sampling methodology previously evaluated by [1] consists in pulling the air through a solvent to dissolve and accumulate the gaseous VOC. After the sampling process, the solvent can then be treated similarly as groundwater samples to perform routine CSIA by diluting an aliquot of the solvent into water to reach the required concentration of the targeted contaminant. Among solvents tested, tetraethylene glycol dimethyl ether (TGDE) showed the best aptitude for the method. TGDE has a great affinity with TCE and benzene, hence efficiently dissolving the compounds during their transition through the solvent. The method detection limit for TCE (5±1μg/m 3 ) and benzene (1.7±0.5μg/m 3 ) is lower when using TGDE compared to methanol, which was previously used (385μg/m 3 for TCE and 130μg/m 3 for benzene) [2]. The method detection limit refers to the minimal gas phase concentration in ambient air required to load sufficient VOC mass into TGDE to perform δ 13 C analysis. Due to a different analytical procedure, the method detection limit associated with δ 37 Cl analysis was found to be 156±6μg/m 3 for TCE. Furthermore, the experimental results validated the relationship between the gas phase TCE and the progressive accumulation of dissolved TCE in the solvent during the sampling process. Accordingly, based on the air-solvent partitioning coefficient, the sampling methodology (e.g. sampling rate, sampling duration, amount of solvent) and the final TCE concentration in the solvent, the concentration of TCE in the gas phase prevailing during the sampling event can be determined. Moreover, the possibility to analyse for TCE concentration in the solvent after sampling (or other targeted VOCs) allows the field deployment of the sampling method without the need to determine the initial gas phase TCE concentration. The simplified field deployment approach of the solvent-based dissolution method combined with the conventional analytical procedure used for groundwater samples substantially facilitates the application of CSIA to gas phase studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The Herschel Virgo Cluster Survey. XIII. Dust in early-type galaxies

    NASA Astrophysics Data System (ADS)

    di Serego Alighieri, S.; Bianchi, S.; Pappalardo, C.; Zibetti, S.; Auld, R.; Baes, M.; Bendo, G.; Corbelli, E.; Davies, J. I.; Davis, T.; De Looze, I.; Fritz, J.; Gavazzi, G.; Giovanardi, C.; Grossi, M.; Hunt, L. K.; Magrini, L.; Pierini, D.; Xilouris, E. M.

    2013-04-01

    Aims: We study the dust content of a large optical input sample of 910 early-type galaxies (ETG) in the Virgo cluster, also extending to the dwarf ETG, and examine the results in relation to those on the other cold ISM components. Methods: We have searched for far-infrared emission in all galaxies in the input sample using the 250 μm image of the Herschel Virgo Cluster Survey (HeViCS). This image covers a large fraction of the cluster with an area of ~55 square degrees. For the detected ETG we measured fluxes in five bands from 100 to 500 μm, and estimated the dust mass and temperature with modified black-body fits. Results: Dust is detected above the completeness limit of 25.4 mJy at 250 μm in 46 ETG, 43 of which are in the optically complete part of the input sample. In addition, dust is present at fainter levels in another six ETG. We detect dust in the four ETG with synchrotron emission, including M 87. Dust appears to be much more concentrated than stars and more luminous ETG have higher dust temperatures. Considering only the optically complete input sample and correcting for the contamination by background galaxies, dust detection rates down to the 25.4 mJy limit are 17% for ellipticals, about 40% for lenticulars (S0 + S0a), and around 3% for dwarf ETG. Dust mass does not correlate clearly with stellar mass and is often much greater than expected for a passive galaxy in a closed-box model. The dust-to-stars mass ratio anticorrelates with galaxy luminosity, and for some dwarf ETG reaches values as high as for dusty late-type galaxies. In the Virgo cluster slow rotators appear more likely to contain dust than fast ones. Comparing the dust results with those on Hi there are only eight ETG detected both in dust and in Hi in the HeViCS area; 39 have dust but only an upper limit on Hi, and eight have Hi but only an upper limit on dust. The locations of these galaxies in the cluster are different, with the dusty ETG concentrated in the densest regions, while the Hi rich ETG are at the periphery. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA.Table A.1 is available in electronic form at http://www.aanda.org

  19. Comparing efficiency of American Fisheries Society standard snorkeling techniques to environmental DNA sampling techniques

    USGS Publications Warehouse

    Ulibarri, Roy M.; Bonar, Scott A.; Rees, Christopher B.; Amberg, Jon J.; Ladell, Bridget; Jackson, Craig

    2017-01-01

    Analysis of environmental DNA (eDNA) is an emerging technique used to detect aquatic species through water sampling and the extraction of biological material for amplification. Our study compared the efficacy of eDNA methodology to American Fisheries Society (AFS) standard snorkeling surveys with regard to detecting the presence of rare fish species. Knowing which method is more efficient at detecting target species will help managers to determine the best way to sample when both traditional sampling methods and eDNA sampling are available. Our study site included three Navajo Nation streams that contained Navajo Nation Genetic Subunit Bluehead Suckers Catostomus discobolus and Zuni Bluehead Suckers C. discobolus yarrowi. We first divided the entire wetted area of streams into consecutive 100-m reaches and then systematically selected 10 reaches/stream for snorkel and eDNA surveys. Surface water samples were taken in 10-m sections within each 100-m reach, while fish presence was noted via snorkeling in each 10-m section. Quantitative PCR was run on each individual water sample in quadruplicate to test for the presence or absence of the target species. With eDNA sampling techniques, we were able to positively detect both species in two out of the three streams. Snorkeling resulted in positive detection of both species in all three streams. In streams where the target species were detected with eDNA sampling, snorkeling detected fish at 11–29 sites/stream, whereas eDNA detected fish at 3–12 sites/stream. Our results suggest that AFS standard snorkeling is more effective than eDNA for detecting target fish species. To improve our eDNA procedures, the amount of water collected and tested should be increased. Additionally, filtering water on-site may improve eDNA techniques for detecting fish. Future research should focus on standardization of eDNA sampling to provide a widely operational sampling tool.

  20. Pulsar Timing Array Based Search for Supermassive Black Hole Binaries in the Square Kilometer Array Era

    NASA Astrophysics Data System (ADS)

    Wang, Yan; Mohanty, Soumya D.

    2017-04-01

    The advent of next generation radio telescope facilities, such as the Square Kilometer Array (SKA), will usher in an era where a pulsar timing array (PTA) based search for gravitational waves (GWs) will be able to use hundreds of well timed millisecond pulsars rather than the few dozens in existing PTAs. A realistic assessment of the performance of such an extremely large PTA must take into account the data analysis challenge posed by an exponential increase in the parameter space volume due to the large number of so-called pulsar phase parameters. We address this problem and present such an assessment for isolated supermassive black hole binary (SMBHB) searches using a SKA era PTA containing 1 03 pulsars. We find that an all-sky search will be able to confidently detect nonevolving sources with a redshifted chirp mass of 1 010 M⊙ out to a redshift of about 28 (corresponding to a rest-frame chirp mass of 3.4 ×1 08 M⊙). We discuss the important implications that the large distance reach of a SKA era PTA has on GW observations from optically identified SMBHB candidates. If no SMBHB detections occur, a highly unlikely scenario in the light of our results, the sky-averaged upper limit on strain amplitude will be improved by about 3 orders of magnitude over existing limits.

  1. A portable, stable and precise laser differential refractometer

    NASA Astrophysics Data System (ADS)

    Gong, Xiangjun; Ngai, To; Wu, Chi

    2013-11-01

    In this work, we present a portable laser differential refractometer with real-time detection and high precision based on the Snell's law and a 2f-2f optical design. The 2f-2f configuration solves a traditional position drifting problem of the laser beam and enhances the signal stability, where a small pinhole is illuminated by the laser light and imaged to the detector by lens placed in the middle between the detector and the pinhole. However, it also leads to a larger dimension of the instrument, limiting its applications and its sensitivity that is proportional to the optical path. Therefore, for a portable device on the basis of the 2f-2f design, a combination of a mirror and a lens was developed to minimize the optical path without affecting the 2f-2f design. Our simple and compact design reaches a resolution of 10-6 refractive index units (RIU). Moreover, the dimension of such a modified differential refractometer is significantly reduced to be portable. Owing to its real-time detection speed and high precision, this newly developed refractometer is particularly attractive when it is used as an independent and ultra-sensitive detector in many research and industrial applications wherein there is a time-dependent concentration change, e.g., the concentration determination, quality control, and study of kinetic processes in solution, including adsorption, sedimentation, and dissolution, to name few but not limited.

  2. Effective Enrichment and Detection of Trace Polycyclic Aromatic Hydrocarbons in Food Samples based on Magnetic Covalent Organic Framework Hybrid Microspheres.

    PubMed

    Li, Ning; Wu, Di; Hu, Na; Fan, Guangsen; Li, Xiuting; Sun, Jing; Chen, Xuefeng; Suo, Yourui; Li, Guoliang; Wu, Yongning

    2018-04-04

    The present study reported a facile, sensitive, and efficient method for enrichment and determination of trace polycyclic aromatic hydrocarbons (PAHs) in food samples by employing new core-shell nanostructure magnetic covalent organic framework hybrid microspheres (Fe 3 O 4 @COF-(TpBD)) as the sorbent followed by HPLC-DAD. Under mild synthetic conditions, the Fe 3 O 4 @COF-(TpBD) were prepared with the retention of colloidal nanosize, larger specific surface area, higher porosity, uniform morphology, and supermagnetism. The as-prepared materials showed an excellent adsorption ability for PAHs, and the enrichment efficiency of the Fe 3 O 4 @COF-(TpBD) could reach 99.95%. The obtained materials also had fast adsorption kinetics and realized adsorption equilibrium within 12 min. The eluent was further analyzed by HPLC-DAD, and good linearity was observed in the range of 1-100 ng/mL with the linear correlation being above 0.9990. The limits of detection (S/N = 3) and limits of quantitation (S/N = 10) for 15 PAHs were in the range of 0.83-11.7 ng/L and 2.76-39.0 ng/L, respectively. For the application, the obtained materials were employed for the enrichment of trace PAHs in food samples and exhibited superior enrichment capacity and excellent applicability.

  3. ScintSim1: A new Monte Carlo simulation code for transport of optical photons in 2D arrays of scintillation detectors

    PubMed Central

    Mosleh-Shirazi, Mohammad Amin; Zarrini-Monfared, Zinat; Karbasi, Sareh; Zamani, Ali

    2014-01-01

    Two-dimensional (2D) arrays of thick segmented scintillators are of interest as X-ray detectors for both 2D and 3D image-guided radiotherapy (IGRT). Their detection process involves ionizing radiation energy deposition followed by production and transport of optical photons. Only a very limited number of optical Monte Carlo simulation models exist, which has limited the number of modeling studies that have considered both stages of the detection process. We present ScintSim1, an in-house optical Monte Carlo simulation code for 2D arrays of scintillation crystals, developed in the MATLAB programming environment. The code was rewritten and revised based on an existing program for single-element detectors, with the additional capability to model 2D arrays of elements with configurable dimensions, material, etc., The code generates and follows each optical photon history through the detector element (and, in case of cross-talk, the surrounding ones) until it reaches a configurable receptor, or is attenuated. The new model was verified by testing against relevant theoretically known behaviors or quantities and the results of a validated single-element model. For both sets of comparisons, the discrepancies in the calculated quantities were all <1%. The results validate the accuracy of the new code, which is a useful tool in scintillation detector optimization. PMID:24600168

  4. ScintSim1: A new Monte Carlo simulation code for transport of optical photons in 2D arrays of scintillation detectors.

    PubMed

    Mosleh-Shirazi, Mohammad Amin; Zarrini-Monfared, Zinat; Karbasi, Sareh; Zamani, Ali

    2014-01-01

    Two-dimensional (2D) arrays of thick segmented scintillators are of interest as X-ray detectors for both 2D and 3D image-guided radiotherapy (IGRT). Their detection process involves ionizing radiation energy deposition followed by production and transport of optical photons. Only a very limited number of optical Monte Carlo simulation models exist, which has limited the number of modeling studies that have considered both stages of the detection process. We present ScintSim1, an in-house optical Monte Carlo simulation code for 2D arrays of scintillation crystals, developed in the MATLAB programming environment. The code was rewritten and revised based on an existing program for single-element detectors, with the additional capability to model 2D arrays of elements with configurable dimensions, material, etc., The code generates and follows each optical photon history through the detector element (and, in case of cross-talk, the surrounding ones) until it reaches a configurable receptor, or is attenuated. The new model was verified by testing against relevant theoretically known behaviors or quantities and the results of a validated single-element model. For both sets of comparisons, the discrepancies in the calculated quantities were all <1%. The results validate the accuracy of the new code, which is a useful tool in scintillation detector optimization.

  5. Pulsar Timing Array Based Search for Supermassive Black Hole Binaries in the Square Kilometer Array Era.

    PubMed

    Wang, Yan; Mohanty, Soumya D

    2017-04-14

    The advent of next generation radio telescope facilities, such as the Square Kilometer Array (SKA), will usher in an era where a pulsar timing array (PTA) based search for gravitational waves (GWs) will be able to use hundreds of well timed millisecond pulsars rather than the few dozens in existing PTAs. A realistic assessment of the performance of such an extremely large PTA must take into account the data analysis challenge posed by an exponential increase in the parameter space volume due to the large number of so-called pulsar phase parameters. We address this problem and present such an assessment for isolated supermassive black hole binary (SMBHB) searches using a SKA era PTA containing 10^{3} pulsars. We find that an all-sky search will be able to confidently detect nonevolving sources with a redshifted chirp mass of 10^{10}  M_{⊙} out to a redshift of about 28 (corresponding to a rest-frame chirp mass of 3.4×10^{8}  M_{⊙}). We discuss the important implications that the large distance reach of a SKA era PTA has on GW observations from optically identified SMBHB candidates. If no SMBHB detections occur, a highly unlikely scenario in the light of our results, the sky-averaged upper limit on strain amplitude will be improved by about 3 orders of magnitude over existing limits.

  6. Super-Sensitive and Robust Biosensors from Supported Polymer Bilayers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paxton, Walter F.

    2015-09-01

    Biological organisms are potentially the most sensitive and selective biological detection systems known, yet we are currently severely limited in our ability to exploit biological interactions in sensory devices, due in part to the limited stability of biological systems and derived materials. This proposal addresses an important aspect of integrating biological sensory materials in a solid state device. If successful, such technology could enable entirely new classes of robust biosensors that could be miniaturized and deployed in the field. The critical aims of the proposed work were 1) the calibration of a more versatile approach to measuring pH, 2) themore » use of this method to monitor pH changes caused by the light-induced pumping of protons across vesicles with bacteriorhodopsin integrated into the membranes (either polymer or lipid); 3) the preparation of bilayer assemblies on platinum surfaces; 4) the enhanced detection of lightinduced pH changes driven by bR-loaded supported bilayers. I have developed a methodology that may enable that at interfaces and developed a methodology to characterize the functionality of bilayer membranes with reconstituted membrane proteins. The integrity of the supported bilayer films however must be optimized prior to the full realization of the work originally envisioned in the original proposal. Nevertheless, the work performed on this project and the encouraging results it has produced has demonstrated that these goals are challenging yet within reach.« less

  7. A potential vector of domoic acid: the swimming crab Polybius henslowii Leach (Decapoda-brachyura).

    PubMed

    Costa, Pedro R; Rodrigues, Susana M; Botelho, Maria J; Sampayo, Maria Antónia de M

    2003-08-01

    The swimming crab Polybius henslowii may play an important role in the movement of the amnesic shellfish toxin, domoic acid (DA), through the marine food chain. High DA concentrations have been determined in crab samples harvested along the Portuguese coast during the summer of 2002, reaching a level of 323.1 microg DA/g crab tissue. Toxin distribution in the different crab organs showed levels as high as 571.6 microg DA/g in the visceral tissues. Levels of toxin 4-12 times lower were detected in the remaining tissues. This crab might be a prominent vector of the toxin to higher trophic levels, including fishes, sea birds and even humans. In Portugal P. henslowii is commercialised during the summer in some local markets. DA concentrations were found close to the legal limit of 20 microg/g in samples purchased at Figueira da Foz market. The crabs are boiled prior to reaching the consumers. The cooking process was evaluated. Determination of toxin losses during the cooking process showed a toxin reduction higher than 50%. DA was determined by HPLC-UV and confirmed by spectra acquired with diode-array detector.

  8. Bodily action penetrates affective perception

    PubMed Central

    Rigutti, Sara; Gerbino, Walter

    2016-01-01

    Fantoni & Gerbino (2014) showed that subtle postural shifts associated with reaching can have a strong hedonic impact and affect how actors experience facial expressions of emotion. Using a novel Motor Action Mood Induction Procedure (MAMIP), they found consistent congruency effects in participants who performed a facial emotion identification task after a sequence of visually-guided reaches: a face perceived as neutral in a baseline condition appeared slightly happy after comfortable actions and slightly angry after uncomfortable actions. However, skeptics about the penetrability of perception (Zeimbekis & Raftopoulos, 2015) would consider such evidence insufficient to demonstrate that observer’s internal states induced by action comfort/discomfort affect perception in a top-down fashion. The action-modulated mood might have produced a back-end memory effect capable of affecting post-perceptual and decision processing, but not front-end perception. Here, we present evidence that performing a facial emotion detection (not identification) task after MAMIP exhibits systematic mood-congruent sensitivity changes, rather than response bias changes attributable to cognitive set shifts; i.e., we show that observer’s internal states induced by bodily action can modulate affective perception. The detection threshold for happiness was lower after fifty comfortable than uncomfortable reaches; while the detection threshold for anger was lower after fifty uncomfortable than comfortable reaches. Action valence induced an overall sensitivity improvement in detecting subtle variations of congruent facial expressions (happiness after positive comfortable actions, anger after negative uncomfortable actions), in the absence of significant response bias shifts. Notably, both comfortable and uncomfortable reaches impact sensitivity in an approximately symmetric way relative to a baseline inaction condition. All of these constitute compelling evidence of a genuine top-down effect on perception: specifically, facial expressions of emotion are penetrable by action-induced mood. Affective priming by action valence is a candidate mechanism for the influence of observer’s internal states on properties experienced as phenomenally objective and yet loaded with meaning. PMID:26893964

  9. The Giant Radio Array for Neutrino Detection

    NASA Astrophysics Data System (ADS)

    Martineau-Huynh, Olivier; Bustamante, Mauricio; Carvalho, Washington; Charrier, Didier; De Jong, Sijbrand; de Vries, Krijn D.; Fang, Ke; Feng, Zhaoyang; Finley, Chad; Gou, Quanbu; Gu, Junhua; Hu, Hongbo; Kotera, Kumiko; Le Coz, Sandra; Medina, Clementina; Murase, Kohta; Niess, Valentin; Oikonomou, Foteini; Timmermans, Charles; Wang, Zhen; Wu, Xiangping; Zhang, Yi

    2017-03-01

    The Giant Radio Array for Neutrino Detection (GRAND) is a planned array of 2·105 radio antennas deployed over 200 000 km2 in a mountainous site. It aims primarly at detecting high-energy neutrinos via the observation of extensive air showers induced by the decay in the atmosphere of taus produced by the interaction of cosmic neutrinos under the Earth surface. GRAND aims at reaching a neutrino sensitivity of 5 · 10-11 E-2 GeV-1 cm-2 s-1 sr-1 above 3 · 1016 eV. This ensures the detection of cosmogenic neutrinos in the most pessimistic source models, and 50 events per year are expected for the standard models. The instrument will also detect UHECRs and possibly FRBs. Here we show how our preliminary design should enable us to reach our sensitivity goals, and discuss the steps to be taken to achieve GRAND, while the compelling science case for GRAND is discussed in more details in [1].

  10. Conducting Anonymous, Incentivized, Online Surveys With Sexual and Gender Minority Adolescents: Lessons Learned From a National Polyvictimization Study.

    PubMed

    Sterzing, Paul R; Gartner, Rachel E; McGeough, Briana L

    2018-03-01

    Sexual and gender minority adolescents represent an understudied and hard-to-reach population who experience higher rates of mental and behavioral health problems in comparison to their cisgender, heterosexual peers. Online surveys and the proliferation of Internet-connected devices among adolescents offer an exciting opportunity for researchers to begin addressing research gaps and past methodological limitations with these hard-to-reach populations. The purpose of this article is to provide guidance to researchers who are designing and implementing anonymous, incentivized, online surveys by examining the following critical domains-(a) recruitment and engagement: means of leveraging social media and videos to recruit and engage a more nationally representative sample; (b) safety and protection: strategies for administering informed consent and protecting participant anonymity and well-being; and (c) data integrity: mechanisms to detect dishonest and repeat responders. To facilitate discussion of these aims, concrete examples are used from SpeakOut-a 3-year, national study funded by the National Institute of Justice that utilized an anonymous, incentivized, online survey with a large sample of sexual and gender minority adolescents ( N = 1,177) to identify the prevalence, incidence, and correlates of polyvictimization. The article concludes with lessons learned from this national study and recommendations for technological innovations and future research that will strengthen the utility of anonymous, incentivized, online surveys to study sexual and gender minority adolescents and other hard-to-reach populations.

  11. 77 FR 74389 - Fisheries of the Caribbean, Gulf of Mexico, and South Atlantic; 2012 Commercial Accountability...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-14

    ... projected to reach the commercial annual catch limit (ACL) on December 19, 2012. Therefore, NMFS closes the.... Background The commercial ACL for wahoo is 64,147 lb (29,097 kg), round weight, as specified in 50 CFR 622.49... sector for wahoo when the commercial ACL for wahoo has been reached, or is projected to be reached, by...

  12. An integrated fluorescence detection system in poly(dimethylsiloxane) for microfluidic applications.

    PubMed

    Chabinyc, M L; Chiu, D T; McDonald, J C; Stroock, A D; Christian, J F; Karger, A M; Whitesides, G M

    2001-09-15

    This paper describes a prototype of an integrated fluorescence detection system that uses a microavalanche photodiode (microAPD) as the photodetector for microfluidic devices fabricated in poly(dimethylsiloxane) (PDMS). The prototype device consisted of a reusable detection system and a disposable microfluidic system that was fabricated using rapid prototyping. The first step of the procedure was the fabrication of microfluidic channels in PDMS and the encapsulation of a multimode optical fiber (100-microm core diameter) in the PDMS; the tip of the fiber was placed next to the side wall of one of the channels. The optical fiber was used to couple light into the microchannel for the excitation of fluorescent analytes. The photodetector, a prototype solid-state microAPD array, was embedded in a thick slab (1 cm) of PDMS. A thin (80 microm) colored polycarbonate filter was placed on the top of the embedded microAPD to absorb scattered excitation light before it reached the detector. The microAPD was placed below the microchannel and orthogonal to the axis of the optical fiber. The close proximity (approximately 200 microm) of the microAPD to the microchannel made it unnecessary to incorporate transfer optics; the pixel size of the microAPD (30 microm) matched the dimensions of the channels (50 microm). A blue light-emitting diode was used for fluorescence excitation. The microAPD was operated in Geiger mode to detect the fluorescence. The detection limit of the prototype (approximately 25 nM) was determined by finding the minimum detectable concentration of a solution of fluorescein. The device was used to detect the separation of a mixture of proteins and small molecules by capillary electrophoresis; the separation illustrated the suitability of this integrated fluorescence detection system for bioanalytical applications.

  13. Highly labeled methylene blue-ds DNA silica nanoparticles for signal enhancement of immunoassays: application to the sensitive detection of bacteria in human platelet concentrates.

    PubMed

    Bonnet, Romaric; Farre, Carole; Valera, Lionel; Vossier, Ludivine; Léon, Fanny; Dagland, Typhaine; Pouzet, Agnès; Jaffrézic-Renault, Nicole; Fareh, Jeannette; Fournier-Wirth, Chantal; Chaix, Carole

    2018-05-15

    A nanoparticle-based electrochemical sandwich immunoassay was developed for bacteria detection in platelet concentrates. For the assay, magnetic beads were functionalized with antibodies to allow the specific capture of bacteria from the complex matrix, and innovative methylene blue-DNA/nanoparticle assemblies provided the electrochemical response for amplified detection. This nanoparticular system was designed as a temperature-sensitive nano-tool for electrochemical detection. First, oligonucleotide-functionalized nanoparticles were obtained by direct synthesis of the DNA strands on the nanoparticle surface using an automated oligonucleotide synthesizer. Densely packed DNA coverage was thus obtained. Then, DNA duplexes were constructed on the NP surface with a complementary strand bearing a 3 methylene blue tag. This strategy ultimately produced highly functionalized nanoparticles with electrochemical markers. These assemblies enabled amplification of the electrochemical signal, resulting in a very good sensitivity. A proof-of-concept was carried out for E. coli detection in human platelet concentrates. Bacterial contamination of this complex biological matrix is the highest residual infectious risk in blood transfusion. The development of a rapid assay that could reach 10-102 CFU mL-1 sensitivity is a great challenge. The nanoparticle-based electrochemical sandwich immunoassay carried out on a boron doped diamond electrode proved to be sensitive for E. coli detection in human platelets. Two antibody pairs were used to develop either a generic assay against certain Gram negative strains or a specific assay for E. coli. The methylene blue-DNA/nanoparticles amplify sensitivity ×1000 compared with the assay run without NPs for electrochemical detection. A limit of detection of 10 CFU mL-1 in a biological matrix was achieved for E. coli using the highly specific antibody pair.

  14. Nondestructive Detection of the Internalquality of Apple Using X-Ray and Machine Vision

    NASA Astrophysics Data System (ADS)

    Yang, Fuzeng; Yang, Liangliang; Yang, Qing; Kang, Likui

    The internal quality of apple is impossible to be detected by eyes in the procedure of sorting, which could reduce the apple’s quality reaching market. This paper illustrates an instrument using X-ray and machine vision. The following steps were introduced to process the X-ray image in order to determine the mould core apple. Firstly, lifting wavelet transform was used to get a low frequency image and three high frequency images. Secondly, we enhanced the low frequency image through image’s histogram equalization. Then, the edge of each apple's image was detected using canny operator. Finally, a threshold was set to clarify mould core and normal apple according to the different length of the apple core’s diameter. The experimental results show that this method could on-line detect the mould core apple with less time consuming, less than 0.03 seconds per apple, and the accuracy could reach 92%.

  15. U.S. EPA’S GUIDELINES FOR WATER REUSE

    EPA Science Inventory

    In August 2004, the U.S. Environmental Protection Agency and the U.S. Agency for International Development published “Guidelines for Water Reuse”, updating their 1992 guidelines document. Because communities around the world are reaching, or have reached, the limits o...

  16. Exercise in the Heat is Limited by a Critical Internal Temperature

    DTIC Science & Technology

    2000-08-01

    various strains of antelope (20), the cheetah (21), dogs (24), and humans (6, 12, 14, 15). There is evidence that limitations in endurance performance in...On receipt, all rats were main- tained on a calorically restricted diet , receiving 60–63% of the diet consumed by rats fed ad libitum, as determined by...occurred when Thyp reached 42.0–42.9°C in exercising goats. Furthermore, cheetahs cease running when their core temperature reaches 40.5°C (21

  17. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    PubMed

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Ultra-sensitive suspended atomically thin-layered black phosphorus mercury sensors.

    PubMed

    Li, Peng; Zhang, Dongzhi; Jiang, Chuanxing; Zong, Xiaoqi; Cao, Yuhua

    2017-12-15

    The extraordinary properties of black phosphorus (BP) make it a promising candidate for next-generation transistor chemical sensors. However, BP films reported so far are supported on substrate, and substrate scattering drastically deteriorates its electrical properties. Consequentially, the potential sensing capability of intrinsic BP is highly underestimated and its sensing mechanism is masked. Additionally, the optimum sensing regime of BP remains unexplored. This article is the first demonstration of suspended BP sensor operated in subthreshold regime. BP exhibited significant enhancement of sensitivity for ultra-low-concentration mercury detection in the absence of substrate, and the sensitivity reached maximum in subthreshold regime. Without substrate scattering, the suspended BP device demonstrated 10 times lower 1/f noise which contributed to better signal-to-noise ratio. Therefore, rapid label-free trace detection of Hg 2+ was achieved with detection limit of 0.01 ppb, lower than the world health organization (WHO) tolerance level (1 ppb). The time constant for ion detection extracted was 3s. Additionally, experimental results revealed that good stability, repeatability, and selectivity were achieved. BP sensors also demonstrated the ability of detecting mercury ions in environment water samples. The underling sensing mechanism of intrinsic BP was ascribed to the carrier density variation resulted from surface charge gating effect, so suspended BP in subthreshold regime with optimum gating effect demonstrated the best sensitivity. Our results show the prominent advantages of intrinsic BP as a sensing material. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Clinical whole-genome sequencing from routine formalin-fixed, paraffin-embedded specimens: pilot study for the 100,000 Genomes Project.

    PubMed

    Robbe, Pauline; Popitsch, Niko; Knight, Samantha J L; Antoniou, Pavlos; Becq, Jennifer; He, Miao; Kanapin, Alexander; Samsonova, Anastasia; Vavoulis, Dimitrios V; Ross, Mark T; Kingsbury, Zoya; Cabes, Maite; Ramos, Sara D C; Page, Suzanne; Dreau, Helene; Ridout, Kate; Jones, Louise J; Tuff-Lacey, Alice; Henderson, Shirley; Mason, Joanne; Buffa, Francesca M; Verrill, Clare; Maldonado-Perez, David; Roxanis, Ioannis; Collantes, Elena; Browning, Lisa; Dhar, Sunanda; Damato, Stephen; Davies, Susan; Caulfield, Mark; Bentley, David R; Taylor, Jenny C; Turnbull, Clare; Schuh, Anna

    2018-02-01

    PurposeFresh-frozen (FF) tissue is the optimal source of DNA for whole-genome sequencing (WGS) of cancer patients. However, it is not always available, limiting the widespread application of WGS in clinical practice. We explored the viability of using formalin-fixed, paraffin-embedded (FFPE) tissues, available routinely for cancer patients, as a source of DNA for clinical WGS.MethodsWe conducted a prospective study using DNAs from matched FF, FFPE, and peripheral blood germ-line specimens collected from 52 cancer patients (156 samples) following routine diagnostic protocols. We compared somatic variants detected in FFPE and matching FF samples.ResultsWe found the single-nucleotide variant agreement reached 71% across the genome and somatic copy-number alterations (CNAs) detection from FFPE samples was suboptimal (0.44 median correlation with FF) due to nonuniform coverage. CNA detection was improved significantly with lower reverse crosslinking temperature in FFPE DNA extraction (80 °C or 65 °C depending on the methods). Our final data showed somatic variant detection from FFPE for clinical decision making is possible. We detected 98% of clinically actionable variants (including 30/31 CNAs).ConclusionWe present the first prospective WGS study of cancer patients using FFPE specimens collected in a routine clinical environment proving WGS can be applied in the clinic.GENETICS in MEDICINE advance online publication, 1 February 2018; doi:10.1038/gim.2017.241.

  20. Building materials. VOC emissions, diffusion behaviour and implications from their use.

    PubMed

    Katsoyiannis, Athanasios; Leva, Paolo; Barrero-Moreno, Josefa; Kotzias, Dimitrios

    2012-10-01

    Five cement- and five lime-based building materials were examined in an environmental chamber for their emissions of Volatile Organic Compounds (VOCs). Typical VOCs were below detection limits, whereas not routinely analysed VOCs, like neopentyl glycol (NPG), dominated the cement-based products emissions, where, after 72 h, it was found to occur, in levels as high as 1400 μg m(-3), accounting for up to 93% of total VOCs. The concentrations of NPG were not considerably changed between the 24 and 72 h of sampling. The permeability of building materials was assessed through experiments with a dual environmental chamber; it was shown that building materials facilitate the diffusion of chemicals through their pores, reaching equilibrium relatively fast (6 h). Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Current Saturation Avoidance with Real-Time Control using DPCS

    NASA Astrophysics Data System (ADS)

    Ferrara, M.; Hutchinson, I.; Wolfe, S.; Stillerman, J.; Fredian, T.

    2008-11-01

    Tokamak ohmic-transformer and equilibrium-field coils need to be able to operate near their maximum current capabilities. However if they reach their upper limit during high-performance discharges or in the presence of a strong off-normal event, shape control is compromised, and instability, even plasma disruptions can result. On Alcator C-Mod we designed and tested an anti-saturation routine which detects the impending saturation of OH and EF currents and interpolates to a neighboring safe equilibrium in real-time. The routine was implemented with a multi-processor, multi-time-scale control scheme, which is based on a master process and multiple asynchronous slave processes. The scheme is general and can be used for any computationally-intensive algorithm. USDoE award DE- FC02-99ER545512.

  2. Microfabricated polymer injector for direct mass spectrometry coupling.

    PubMed

    Gobry, Véronique; van Oostrum, Jan; Martinelli, Marco; Rohner, Tatiana C; Reymond, Frédéric; Rossier, Joël S; Girault, Hubert H

    2002-04-01

    This paper demonstrates the coupling of a plasma etched polymer microfluidic system with an electrospray mass spectrometer by generation of a nanospray. Taking advantage of the microtechnology processes and polymer properties, high volume production with good reproducibility of hydrophobic interfaces could be obtained. The nanospray was directly produced from the outlet of the plastic microfabricated chip positioned in front of the capillary entrance of the mass spectrometer. No chemical background due to the polymer has been observed under standard nanospray conditions. The performances of the spray as well as its efficiency have been demonstrated by flow measurements, stability establishment and tandem mass spectrometry experiment on angiotensin II. The spray was actuated without additional flow in methanol: water:acetic acid (50:49:1%) solution. A 40 fmol/microL detection limit could be reached.

  3. NEWSdm: Nuclear Emulsions for WIMP Search with directional measurement

    NASA Astrophysics Data System (ADS)

    Di Crescenzo, A.

    2017-12-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). The measurement of the direction of WIMP-induced nuclear recoils is a challenging strategy to extend dark matter searches beyond the neutrino floor and provide an unambiguous signature of the detection of Galactic dark matter. Current directional experiments are based on the use of gas TPC whose sensitivity is strongly limited by the small achievable detector mass. We present an innovative directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching a position resolution of the order of 10 nm.

  4. Effects of magnetic field and pressure in magnetoelastic stress reconfigurable thin film resonators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Staruch, M.; Bussmann, K.; Finkel, P.

    2015-07-20

    Free-standing CoFe thin-film doubly clamped stress reconfigurable resonators were investigated as a function of magnetic field and pressure. A large uniaxial anisotropy resulting from residual uniaxial tensile stress, as revealed from magnetic hysteresis loops, leads to an easy magnetization axis aligned along the length of the beams. The quality factor of the driven resonator beams under vacuum is increased by 30 times, leading to an enhanced signal-to-noise ratio and a predicted reduction in the intrinsic magnetic noise by a factor of 6, potentially reaching as low as ∼25 pT/√Hz at 1 Torr. Stress reconfigurable sensors operating under vacuum could thus furthermore » improve the limit of detection and advance development of magnetic field sensing technology.« less

  5. Door detection in images based on learning by components

    NASA Astrophysics Data System (ADS)

    Cicirelli, Grazia; D'Orazio, Tiziana; Ancona, Nicola

    2001-10-01

    In this paper we present a vision-based technique for detecting targets of the environment which has to be reached by an autonomous mobile robot during its navigational task. The targets the robot has to reach are the doors of our office building. Color and shape information are used as identifying features for detecting principal components of the door. In fact in images the door can appear of different dimensions depending on the attitude of the robot with respect to the door, therefore detection of the door is performed by detecting its most significant components in the image. Positive and negative examples, in form of image patterns, are manually selected from real images for training two neural classifiers in order to recognize the single components. Each classifier has been realized by a feed-forward neural network with one hidden layer and sigmoid activation function. Moreover for selecting negative examples, relevant for the problem at hand, a bootstrap technique has been used during the training process. Finally the detecting system has been applied to several test real images for evaluating its performance.

  6. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    NASA Astrophysics Data System (ADS)

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  7. Macromolecular Systems with MSA-Capped CdTe and CdTe/ZnS Core/Shell Quantum Dots as Superselective and Ultrasensitive Optical Sensors for Picric Acid Explosive.

    PubMed

    Dutta, Priyanka; Saikia, Dilip; Adhikary, Nirab Chandra; Sarma, Neelotpal Sen

    2015-11-11

    This work reports the development of highly fluorescent materials for the selective and efficient detection of picric acid explosive in the nanomolar range by fluorescence quenching phenomenon. Poly(vinyl alcohol) grafted polyaniline (PPA) and its nanocomposites with 2-mercaptosuccinic acid (MSA)-capped CdTe quantum dots (PPA-Q) and with MSA-capped CdTe/ZnS core/shell quantum dots (PPA-CSQ) are synthesized in a single step free radical polymerization reaction. The thermal stability and photo stability of the polymer increases in the order of PPA < PPA-Q < PPA-CSQ. The polymers show remarkably high selectivity and efficient sensitivity toward picric acid, and the quenching efficiency for PPA-CSQ reaches up to 99%. The detection limits of PPA, PPA-Q, and PPA-CSQ for picric acid are found to be 23, 1.6, and 0.65 nM, respectively, which are remarkably low. The mechanism operating in the quenching phenomenon is proposed to be a combination of a strong inner filter effect and ground state electrostatic interaction between the polymers and picric acid. A portable and cost-effective electronic device for the visual detection of picric acid by the sensory system is successfully fabricated. The device is further employed for quantitative detection of picric acid in real water samples.

  8. A scalable engineering approach to improve performance of a miniaturized optical detection system for in vitro point-of-care testing

    NASA Astrophysics Data System (ADS)

    Robbins, Hannah; Hu, Sijung; Liu, Changqing

    2015-03-01

    The demand for rapid screening technologies, to be used outside of a traditional healthcare setting, has been vastly expanding. This is requiring a new engineering platform for faster and cost effective techniques to be easily adopted through forward-thinking manufacturing procedures, i.e., advanced miniaturisation and heterogeneous integration of high performance microfluidics based point-of-care testing (POCT) systems. Although there has been a considerable amount of research into POCT systems, there exist tremendous challenges and bottlenecks in the design and manufacturing in order to reach a clinical acceptability of sensitivity and selectivity, as well as smart microsystems for healthcare. The project aims to research how to enable scalable production of such complex systems through 1) advanced miniaturisation of a physical layout and opto-electronic component allocation through an optimal design; and 2) heterogeneous integration of multiplexed fluorescence detection (MFD) for in vitro POCT. Verification is being arranged through experimental testing with a series of dilutions of commonly used fluorescence dye, i.e. Cy5. Iterative procedures will be engaged until satisfaction of the detection limit, of Cy5 dye, 1.209x10-10 M. The research creates a new avenue of rapid screening POCT manufacturing solutions with a particular view on high performance and multifunctional detection systems not only in POCT, but also life sciences and environmental applications.

  9. NO2 trace measurements by optical-feedback cavity-enhanced absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Ventrillard-Courtillot, I.; Foldes, T.; Romanini, D.

    2009-04-01

    In order to reach the sub-ppb NO2 detection level required for environmental applications in remote areas, we are developing a spectrometer that exploits a technique that we introduced several years ago, named Optical-Feedback Cavity-Enhanced Absorption Spectroscopy (OF-CEAS) [1]. It allows very sensitive and selective measurements, together with the realization of compact and robust set-ups as was subsequently demonstrated during measurements campaigns in harsh environments [2,3]. OF-CEAS benefits from the optical feedback (OF) to efficiently inject a cw-laser in a high finesse cavity (typically F >10 000). Absorption spectra are acquired on a small spectral region (~1 cm-1) that enables selective and quantitative measurements at a fast acquisition rate (~10 Hz) with a detection limit of several 10-10 cm-1 as reported in this paper. Spectra are obtained with high spectral resolution (~150 MHz) and are self calibrated by cavity rind-down measurements regularly performed (typically every second). Therefore, OF-CEAS appears very attractive for NO2 trace detection. This work is performed in the blue spectral region where NO2 has intense electronic transitions. Our setup involves a commercial extended cavity diode laser (ECDL) working at room temperature around 411nm. A first setup was developed [4] to demonstrate that OF sensitivity of ECDL is fully consistent with this technique, initially introduced with distributed feedback diode lasers in the near infrared region. In this paper we will report on a new set-up developed for in-situ measurements with proper mechanical, acoustic and thermal insulation. Additionally, new data processing was implemented allowing real time concentration measurements. It is based on a reference spectra recorded under controlled conditions by OF-CEAS and used later to fit the observed spectra. We will present measurements performed with calibrated NO2 reference samples demonstrating a good linearity of the apparatus. The minimum detectable absorption loss is estimated by considering the standard deviation of the spectra. We achieved better than 2x10-10 cm-1 for a single spectrum recorded in less than 100ms at 100mbar. This limit constitutes an improved of more than one order of magnitude as compare to the previous measurements reported in [4]. It leads to a detection limit of 3x108 molecules/cm3, corresponding to about 150pptv at 100mbar. At atmospheric pressure the same measurement would yield a detection limit of 15pptv assuming we can maintain the same level of sensitivity. But currently, works are under development to transfer the low minimum detectable absorption limit, already obtained for one spectrum, to a set of real time measurements. These are now limited by amplitude fluctuations of a few ppb from one spectrum to another one. [1] J. Morville, S. Kassi, M. Chenevier, and D. Romanini, Appl. Phys. B, 80, 1027 (2005). [2] D. Romanini, M. Chenevrier, S. Kassi, M. Schmidt, C. Valant, M. Ramonet, J. Lopez, and H.-J. Jost, Appl. Phys. B, 83, 659 (2006). [2] E.R.T. Kerstel, R.Q. Iannone, M. Chenevrier, S. Kassi, H.-J. Jost and D. Romanini, Appl. Phys. B, 84, 343 (2006). [4] I. Courtillot, J. Morville, V. Motto-Ros, and D. Romanini, Appl. Phys. B, 85, 407 (2006).

  10. Cumulative sum analysis score and phacoemulsification competency learning curve.

    PubMed

    Vedana, Gustavo; Cardoso, Filipe G; Marcon, Alexandre S; Araújo, Licio E K; Zanon, Matheus; Birriel, Daniella C; Watte, Guilherme; Jun, Albert S

    2017-01-01

    To use the cumulative sum analysis score (CUSUM) to construct objectively the learning curve of phacoemulsification competency. Three second-year residents and an experienced consultant were monitored for a series of 70 phacoemulsification cases each and had their series analysed by CUSUM regarding posterior capsule rupture (PCR) and best-corrected visual acuity. The acceptable rate for PCR was <5% (lower limit h) and the unacceptable rate was >10% (upper limit h). The acceptable rate for best-corrected visual acuity worse than 20/40 was <10% (lower limit h) and the unacceptable rate was >20% (upper limit h). The area between lower limit h and upper limit h is called the decision interval. There was no statistically significant difference in the mean age, sex or cataract grades between groups. The first trainee achieved PCR CUSUM competency at his 22 nd case. His best-corrected visual acuity CUSUM was in the decision interval from his third case and stayed there until the end, never reaching competency. The second trainee achieved PCR CUSUM competency at his 39 th case. He could reach best-corrected visual acuity CUSUM competency at his 22 nd case. The third trainee achieved PCR CUSUM competency at his 41 st case. He reached best-corrected visual acuity CUSUM competency at his 14 th case. The learning curve of competency in phacoemulsification is constructed by CUSUM and in average took 38 cases for each trainee to achieve it.

  11. Discovery of Fast X-ray Oscillations During the 1998 Giant Flare from SGR 1900+14

    NASA Technical Reports Server (NTRS)

    Strohmayer, T.; Watts, A.

    2005-01-01

    We report the discovery of complex high frequency variability during the August 27, 1998 giant flare from SGR 1900+14 using the Rossi X-ray Timing Explorer (RXTE). We detect an approx. equals 84 Hz oscillation (QPO) during a 1 s interval beginning approximately 1 min after the initial hard spike. The amplitude is energy dependent, reaching a maximum of 26% (rms) for photons above 30 keV, and is not detected below 11 keV, with a 90% confidence upper limit of 14% (rms). Remarkably, additional QPOs are detected in the average power spectrum of data segments centered on the rotational phase at which the 84 Hz signal was detected. Two signals, at 53.5 and 155.1 Hz, are strongly detected, while a third feature at 28 Hz is found with lower significance. These QPOs are not detected at other rotational phases. The phenomenology seen in the SGR 1900+14 flare is similar to that of QPOs recently reported by Israel et al. (2005) from the December 27, 2004 flare from SGR 1806-20, suggesting they may have a common origin, perhaps torsional vibrations of the neutron star crust. Indeed, an association of the four frequencies (in increasing order) found in SGR 1900+14 with l = 2, 4, 7, and 13 toroidal modes appears plausible. We discuss our findings in the context of this model and show that if the stars have similar masses then the magnetic field in SGR 1806-20 must be about twice as large as in SGR 1900+14, broadly consistent with estimates from pulse timing.

  12. Validation of PCR methods for quantitation of genetically modified plants in food.

    PubMed

    Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P

    2001-01-01

    For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.

  13. Time variability of Io's volcanic activity from near-IR adaptive optics observations on 100 nights in 2013-2015

    NASA Astrophysics Data System (ADS)

    de Kleer, Katherine; de Pater, Imke

    2016-12-01

    Jupiter's moon Io is a dynamic target, exhibiting extreme and time-variable volcanic activity powered by tidal forcing from Jupiter. We have conducted a campaign of high-cadence observations of Io with the goal of characterizing its volcanic activity. Between Aug 2013 and the end of 2015, we imaged Io on 100 nights in the near-infrared with adaptive optics on the Keck and Gemini N telescopes, which resolve emission from individual volcanic hot spots. During our program, we made over 400 detections of 48 distinct hot spots, some of which were detected 30+ times. We use these observations to derive a timeline of global volcanic activity on Io, which exhibits wide variability from month to month. The timelines of thermal activity at individual volcanic centers have geophysical implications, and will permit future characterization by others. We evaluate hot spot detection limits and give a simple parameterization of the minimum detectable intensity as a function of emission angle, which can be applied to other analyses. We detected three outburst eruptions in August 2013, but no other outburst-scale events were observed in the subsequent ∼90 observations. Either the cluster of events in August 2013 was a rare occurrence, or there is a mechanism causing large events to occur closely-spaced in time. We also detected large eruptions (though not of outburst scale) within days of one another at Kurdalagon Patera and Sethlaus/Gabija Paterae in 2015. As was also seen in the Galileo dataset, the hot spots we detected can be separated into two categories based on their thermal emission: those that are persistently active for 1 year or more at moderate intensity, and those that are only briefly active, are time-variable, and often reach large intensities. A small number of hot spots in the latter category appear and subside in a matter of days, reaching particularly high intensities; although these are not bright enough to qualify as outbursts, their thermal signatures follow the same pattern, suggesting that a similar mechanism may be responsible for these events though at a smaller scale. Two eruptions seen at Kurdalagon Patera in January and April 2015 occurred simultaneously with a brightening of the neutral cloud and plasma torus which are sourced from Io's atmosphere. A plume at Kurdalagon Patera, such as was seen by New Horizons in 2007, could have been responsible for the influx of material that caused these brightenings.

  14. U.S. EPA’S GUIDELINES FOR WATER REUSE

    EPA Science Inventory

    In August 2004, the U.S. Environmental Protection Agency and the U.S. Agency for International Development published “Guidelines for Water Reuse”, updating their 1992 guidelines document. Because communities around the world are reaching, or have reached, the limits of available...

  15. 40 CFR Appendix B to Part 136 - Definition and Procedure for the Determination of the Method Detection Limit-Revision 1.11

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... calculated method detection limit. To insure that the estimate of the method detection limit is a good...) where: MDL = the method detection limit t(n-1,1- α=.99) = the students' t value appropriate for a 99... Determination of the Method Detection Limit-Revision 1.11 B Appendix B to Part 136 Protection of Environment...

  16. Measurement of plasma densities by dual frequency multichannel boxcar THz time domain spectroscopy

    NASA Astrophysics Data System (ADS)

    Meier, St. M.; Tsankov, Ts V.; Luggenhölscher, D.; Czarnetzki, U.

    2017-06-01

    In this paper we show the development and the application of the terahertz time domain spectroscopy (THz TDS) diagnostic technique for the determination of plasma densities in low-pressure discharges. A commercially available system was modified to reach a better signal-to-noise ratio. For that the THz emitter and the detection method were changed and a fast lock-in amplifier was used to reach 38 MHz lock-in frequency. These modifications in a combination with the novel method of dual frequency multichannel boxcar embedded as a feature in the lock-in amplifier allowed us to make also time-resolved measurements. The temporal resolution can potentially go down to 100 ps and is limited only by the spectral range that needs to be recovered for the measurement of low electron densities. Further, the cause of artefacts found in all THz TDS based systems, but not understood until now, is identified and explained. As an application the electron densities in inductively coupled plasmas sustained in a magnetic multi-cusp chamber are determined. Results from steady-state discharges in noble gases (He, Ne, Ar, Kr, Xe) and time-resolved measurements in pulsed discharges in Ar and Ne are presented. The technique is benchmarked against microwave interferometry with good agreement in the applicability range of both techniques. The THz TDS performs reliably also in much denser plasmas where standard microwave interferometry fails. The lower limit for the technique is at a line-integrated electron density of 1012 cm-2, corresponding to about 1011 cm-3 for typical plasma dimensions.

  17. Methylxanthine Content in Commonly Consumed Foods in Spain and Determination of Its Intake during Consumption

    PubMed Central

    2017-01-01

    Methylxanthines present psychostimulant effects. These compounds have low toxicity and their consumption at moderate levels presents some beneficial health effects, whereas some significant risk appears at high levels. Samples of common types of methylxanthine-containing beverages and foods consumed in Spain were analyzed to determine their content. Caffeine was the methylxanthine that was most found in the samples investigated. Instant coffees gave the highest caffeine percentage (18–44 mg·g−1). Green and scented teas were found to have a caffeine dry-weight content (8–26 mg·g−1) equivalent to ground coffees (13–23 mg·g−1), but black and pu-erh teas (18–30 mg·g−1) had a higher caffeine content. The evaluation of the most conventional methods for preparing espresso coffees showed that an espresso contains between 88–116 mg of caffeine. In the case of tea beverages, the amount of caffeine present was 2–3 times smaller than in espresso coffees. Energy drinks showed a similar caffeine content (80–106 mg) as espresso coffees. Chocolates had the lowest caffeine content. It has been found that none of the foods evaluated reach the recommended daily intake limit of 400 mg of caffeine with a single dose. This limit can be reached with 4–5 doses in the case of coffees and energy drinks. In the case of chocolates, the methylxanthine compound detected at large levels was theobromine, with amounts ranging from 4 to 10 mg·g−1 for dark chocolates. PMID:29207513

  18. Material limitations on the detection limit in refractometry.

    PubMed

    Skafte-Pedersen, Peder; Nunes, Pedro S; Xiao, Sanshui; Mortensen, Niels Asger

    2009-01-01

    We discuss the detection limit for refractometric sensors relying on high-Q optical cavities and show that the ultimate classical detection limit is given by min {Δn} ≳ η, with n + iη being the complex refractive index of the material under refractometric investigation. Taking finite Q factors and filling fractions into account, the detection limit declines. As an example we discuss the fundamental limits of silicon-based high-Q resonators, such as photonic crystal resonators, for sensing in a bio-liquid environment, such as a water buffer. In the transparency window (λ ≳ 1100 nm) of silicon the detection limit becomes almost independent on the filling fraction, while in the visible, the detection limit depends strongly on the filling fraction because the silicon absorbs strongly.

  19. Axion searches with microwave filters: the RADES project

    NASA Astrophysics Data System (ADS)

    Álvarez Melcón, Alejandro; Arguedas Cuendis, Sergio; Cogollos, Cristian; Díaz-Morcillo, Alejandro; Döbrich, Babette; Gallego, Juan Daniel; Gimeno, Benito; Irastorza, Igor G.; José Lozano-Guerrero, Antonio; Malbrunot, Chloé; Navarro, Pablo; Peña Garay, Carlos; Redondo, Javier; Vafeiadis, Theodoros; Wuensch, Walter

    2018-05-01

    We propose, design and construct a variant of the conventional axion haloscope concept that could be competitive in the search for dark matter axions of masses in the decade 10–100 μeV. Theses masses are located somewhat above the mass range in which existing experiments have reached sensitivity to benchmark QCD axion models. Our haloscope consists of an array of small microwave cavities connected by rectangular irises, in an arrangement commonly used in radio-frequency filters. The size of the unit cavity determines the main resonant frequency, while the possibility to connect a large number of cavities allows to reach large detection volumes. We develop the theoretical framework of the detection concept, and present design prescriptions to optimize detection capabilities. We describe the design and realization of a first small-scale prototype of this concept, called Relic Axion Detector Exploratory Setup (RADES). It consists of a copper-coated stainless steel five-cavities microwave filter with the detecting mode operating at around 8.4 GHz. This structure has been electromagnetically characterized at 2 K and 298 K, and it is now placed in ultra-high vacuum in one of the twin-bores of the 9 T CAST dipole magnet at CERN. We describe the data acquisition system developed for relic axion detection, and present preliminary results of the electromagnetic properties of the microwave filter, which show the potential of filters to reach QCD axion window sensitivity at X-band frequencies.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, Michael J.; Williamson, Kevin S.

    We investigated differences in the statistical power to assign parentage between an artificially propagated and wild salmon population. The propagated fish were derived from the wild population, and are used to supplement its abundance. Levels of genetic variation were similar between the propagated and wild groups at 11 microsatellite loci, and exclusion probabilities were >0.999999 for both groups. The ability to unambiguously identify a pair of parents for each sampled progeny was much lower than expected, however. Simulations demonstrated that the proportion of cases the most likely pair of parents were the true parents was lower for propagated parents thanmore » for wild parents. There was a clear relationship between parentage assignment ability and the degree of linkage disequilibrium, the estimated effective number of breeders that produced the parents, and the size of the largest family within the potential parents. If a stringent threshold for parentage assignment was used, estimates of relative fitness were biased downward for the propagated fish. The bias appeared to be largely eliminated by either fractionally assigning progeny among parents in proportion to their likelihood of parentage, or by assigning progeny to the most likely set of parents without using a statistical threshold. We used a DNA-based parentage analysis to measure the relative reproductive success of hatchery- and natural-origin spring Chinook salmon in the natural environment. Both male and female hatchery-origin fish produced far fewer juvenile progeny per parent when spawning naturally than did natural origin fish. Differences in age structure, spawning location, weight and run timing were responsible for some of the difference in fitness. Male size and age had a large influence on fitness, with larger and older males producing more offspring than smaller or younger individuals. Female size had a significant effect on fitness, but the effect was much smaller than the effect of size on male fitness. For both sexes, run time had a smaller but still significant effect on fitness, with earlier returning fish favored. Spawning location within the river had a significant effect on fitness for both males and females, and for females explained most of the reduced fitness observed for hatchery fish in this population. While differences have been reported in the relative reproductive success of hatchery and naturally produced salmonids Oncorhynchus spp., factors explaining the differences are often confounded. We examined the spawning site habitat and redd structure variables of hatchery and naturally produced spring Chinook salmon O. tshawytscha of known size that spawned in two tributaries of the Wenatchee River. We controlled for variability in spawning habitat by limiting our analysis to redds found within four selected reaches. No difference in the instantaneous spawner density or location of the redd in the stream channel was detected between reaches. Within each reach, no difference in the fork length or weight of hatchery and naturally produced fish was detected. While most variables differed between reaches, we found no difference in redd characteristics within a reach between hatchery and naturally produced females. Correlation analysis of fish size and redd characteristics found several weak but significant relationships suggesting larger fish contract larger redds in deeper water. Spawner density was inversely related to several redd structure variables suggesting redd size may decrease as spawner density increases. Results should be considered preliminary until samples size and statistical power goals are reached in future years. Trends in relative reproductive success of hatchery and naturally produced spring Chinook salmon Oncorhynchus tshawytscha in the Wenatchee Basins suggest females that spawn in the upper reaches of the tributaries produced a great number of offspring compared to females that spawn in the lower reaches of the tributaries. To better understand this trend, redd microhabitat data was collected from spring Chinook salmon that spawned in the Chiwawa River and Nason Creek, the primary spawning tributaries in the Wenatchee Basin. The objective of the study was to examine the influence of habitat and spawner density on spawning site and redd structure characteristics. We analyzed 27 variables of redd microhabitat data collected from the upper and lower most reaches of each study stream. In both streams, we found redds in the upper most reaches to be significantly larger (length and width) and deeper (bowl depth). Spawner density was significantly greater in the lower Chiwawa River compared to the upper reach. No difference in spawner density was detected between reaches in Nason Creek (P = 0.54). Data should be considered preliminary until sample size goals are achieved.« less

Top