Sample records for detection method includes

  1. Methods, systems and devices for detecting and locating ferromagnetic objects

    DOEpatents

    Roybal, Lyle Gene [Idaho Falls, ID; Kotter, Dale Kent [Shelley, ID; Rohrbaugh, David Thomas [Idaho Falls, ID; Spencer, David Frazer [Idaho Falls, ID

    2010-01-26

    Methods for detecting and locating ferromagnetic objects in a security screening system. One method includes a step of acquiring magnetic data that includes magnetic field gradients detected during a period of time. Another step includes representing the magnetic data as a function of the period of time. Another step includes converting the magnetic data to being represented as a function of frequency. Another method includes a step of sensing a magnetic field for a period of time. Another step includes detecting a gradient within the magnetic field during the period of time. Another step includes identifying a peak value of the gradient detected during the period of time. Another step includes identifying a portion of time within the period of time that represents when the peak value occurs. Another step includes configuring the portion of time over the period of time to represent a ratio.

  2. Quantitative detection of pathogens in centrifugal microfluidic disks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

    A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

  3. Methods for the selective detection of alkyne-presenting molecules and related compositions and systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valdez, Carlos A.; Vu, Alexander K.

    Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.

  4. False alarm recognition in hyperspectral gas plume identification

    DOEpatents

    Conger, James L [San Ramon, CA; Lawson, Janice K [Tracy, CA; Aimonetti, William D [Livermore, CA

    2011-03-29

    According to one embodiment, a method for analyzing hyperspectral data includes collecting first hyperspectral data of a scene using a hyperspectral imager during a no-gas period and analyzing the first hyperspectral data using one or more gas plume detection logics. The gas plume detection logic is executed using a low detection threshold, and detects each occurrence of an observed hyperspectral signature. The method also includes generating a histogram for all occurrences of each observed hyperspectral signature which is detected using the gas plume detection logic, and determining a probability of false alarm (PFA) for all occurrences of each observed hyperspectral signature based on the histogram. Possibly at some other time, the method includes collecting second hyperspectral data, and analyzing the second hyperspectral data using the one or more gas plume detection logics and the PFA to determine if any gas is present. Other systems and methods are also included.

  5. Localized surface plasmon resonance mercury detection system and methods

    DOEpatents

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  6. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  7. Methods, systems and devices for detecting threatening objects and for classifying magnetic data

    DOEpatents

    Kotter, Dale K [Shelley, ID; Roybal, Lyle G [Idaho Falls, ID; Rohrbaugh, David T [Idaho Falls, ID; Spencer, David F [Idaho Falls, ID

    2012-01-24

    A method for detecting threatening objects in a security screening system. The method includes a step of classifying unique features of magnetic data as representing a threatening object. Another step includes acquiring magnetic data. Another step includes determining if the acquired magnetic data comprises a unique feature.

  8. Military applications and examples of near-surface seismic surface wave methods (Invited)

    NASA Astrophysics Data System (ADS)

    sloan, S.; Stevens, R.

    2013-12-01

    Although not always widely known or publicized, the military uses a variety of geophysical methods for a wide range of applications--some that are already common practice in the industry while others are truly novel. Some of those applications include unexploded ordnance detection, general site characterization, anomaly detection, countering improvised explosive devices (IEDs), and security monitoring, to name a few. Techniques used may include, but are not limited to, ground penetrating radar, seismic, electrical, gravity, and electromagnetic methods. Seismic methods employed include surface wave analysis, refraction tomography, and high-resolution reflection methods. Although the military employs geophysical methods, that does not necessarily mean that those methods enable or support combat operations--often times they are being used for humanitarian applications within the military's area of operations to support local populations. The work presented here will focus on the applied use of seismic surface wave methods, including multichannel analysis of surface waves (MASW) and backscattered surface waves, often in conjunction with other methods such as refraction tomography or body-wave diffraction analysis. Multiple field examples will be shown, including explosives testing, tunnel detection, pre-construction site characterization, and cavity detection.

  9. Sample detection and analysis techniques for electrophoretic separation

    NASA Technical Reports Server (NTRS)

    Falb, R. D.; Hughes, K. E.; Powell, T. R.

    1975-01-01

    Methods for detecting and analyzing biological agents suitable for space flight operations were studied primarily by literature searches which were conducted of cell separation techniques. Detection methods discussed include: photometrometric, electric, radiometric, micrometry, ultrasonic, microscopic, and photographic. A bibliography, and a directory of vendors are included along with an index of commercial hardware.

  10. Method of enhancing radiation response of radiation detection materials

    DOEpatents

    Miller, Steven D.

    1997-01-01

    The present invention is a method of increasing radiation response of a radiation detection material for a given radiation signal by first pressurizing the radiation detection material. Pressurization may be accomplished by any means including mechanical and/or hydraulic. In this application, the term "pressure" includes fluid pressure and/or mechanical stress.

  11. Method and Pd/V2 O5 device for H2 detection

    DOEpatents

    Liu, Ping [San Diego, CA; Tracy, C Edwin [Golden, CO; Pitts, J Roland [Lakewood, CO; Smith, II, R. Davis; Lee, Se-Hee [Lakewood, CO

    2011-12-27

    Methods and Pd/V.sub.2O.sub.5 devices for hydrogen detection are disclosed. An exemplary method of preparing an improved sensor for chemochromic detection of hydrogen gas over a wide response range exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas. The method may include providing a substrate. The method may also include depositing a V.sub.20.sub.5 layer that functions as a H.sub.2 insertion host in a Pd/V.sub.20.sub.5 hydrogen sensor to be formed on said substrate. The method may also include depositing a Pd layer onto said V.sub.20.sub.5 layer; said Pd layer functioning as an optical modulator.

  12. Method of Detecting Coliform Bacteria and Escherichia Coli Bacteria from Reflected Light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert (Inventor)

    2013-01-01

    The present invention relates to a method of detecting coliform bacteria in water from reflected light and a method of detecting Eschericha Coli bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  13. Seismic data fusion anomaly detection

    NASA Astrophysics Data System (ADS)

    Harrity, Kyle; Blasch, Erik; Alford, Mark; Ezekiel, Soundararajan; Ferris, David

    2014-06-01

    Detecting anomalies in non-stationary signals has valuable applications in many fields including medicine and meteorology. These include uses such as identifying possible heart conditions from an Electrocardiography (ECG) signals or predicting earthquakes via seismographic data. Over the many choices of anomaly detection algorithms, it is important to compare possible methods. In this paper, we examine and compare two approaches to anomaly detection and see how data fusion methods may improve performance. The first approach involves using an artificial neural network (ANN) to detect anomalies in a wavelet de-noised signal. The other method uses a perspective neural network (PNN) to analyze an arbitrary number of "perspectives" or transformations of the observed signal for anomalies. Possible perspectives may include wavelet de-noising, Fourier transform, peak-filtering, etc.. In order to evaluate these techniques via signal fusion metrics, we must apply signal preprocessing techniques such as de-noising methods to the original signal and then use a neural network to find anomalies in the generated signal. From this secondary result it is possible to use data fusion techniques that can be evaluated via existing data fusion metrics for single and multiple perspectives. The result will show which anomaly detection method, according to the metrics, is better suited overall for anomaly detection applications. The method used in this study could be applied to compare other signal processing algorithms.

  14. Systems and Methods for Automated Water Detection Using Visible Sensors

    NASA Technical Reports Server (NTRS)

    Rankin, Arturo L. (Inventor); Matthies, Larry H. (Inventor); Bellutta, Paolo (Inventor)

    2016-01-01

    Systems and methods are disclosed that include automated machine vision that can utilize images of scenes captured by a 3D imaging system configured to image light within the visible light spectrum to detect water. One embodiment includes autonomously detecting water bodies within a scene including capturing at least one 3D image of a scene using a sensor system configured to detect visible light and to measure distance from points within the scene to the sensor system, and detecting water within the scene using a processor configured to detect regions within each of the at least one 3D images that possess at least one characteristic indicative of the presence of water.

  15. Cancer Detection and Diagnosis Methods - Annual Plan

    Cancer.gov

    Early cancer detection is a proven life-saving strategy. Learn about the research opportunities NCI supports, including liquid biopsies and other less-invasive methods, for detecting early cancers and precancerous growths.

  16. Systems and methods for detecting a failure event in a field programmable gate array

    NASA Technical Reports Server (NTRS)

    Ng, Tak-Kwong (Inventor); Herath, Jeffrey A. (Inventor)

    2009-01-01

    An embodiment generally relates to a method of self-detecting an error in a field programmable gate array (FPGA). The method includes writing a signature value into a signature memory in the FPGA and determining a conclusion of a configuration refresh operation in the FPGA. The method also includes reading an outcome value from the signature memory.

  17. [A cloud detection algorithm for MODIS images combining Kmeans clustering and multi-spectral threshold method].

    PubMed

    Wang, Wei; Song, Wei-Guo; Liu, Shi-Xing; Zhang, Yong-Ming; Zheng, Hong-Yang; Tian, Wei

    2011-04-01

    An improved method for detecting cloud combining Kmeans clustering and the multi-spectral threshold approach is described. On the basis of landmark spectrum analysis, MODIS data is categorized into two major types initially by Kmeans method. The first class includes clouds, smoke and snow, and the second class includes vegetation, water and land. Then a multi-spectral threshold detection is applied to eliminate interference such as smoke and snow for the first class. The method is tested with MODIS data at different time under different underlying surface conditions. By visual method to test the performance of the algorithm, it was found that the algorithm can effectively detect smaller area of cloud pixels and exclude the interference of underlying surface, which provides a good foundation for the next fire detection approach.

  18. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.

  19. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-07-21

    A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.

  20. Toxin Detection by Surface Plasmon Resonance

    PubMed Central

    Hodnik, Vesna; Anderluh, Gregor

    2009-01-01

    Significant efforts have been invested in the past years for the development of analytical methods for fast toxin detection in food and water. Immunochemical methods like ELISA, spectroscopy and chromatography are the most used in toxin detection. Different methods have been linked, e.g. liquid chromatography and mass spectrometry (LC-MS), in order to detect as low concentrations as possible. Surface plasmon resonance (SPR) is one of the new biophysical methods which enables rapid toxin detection. Moreover, this method was already included in portable sensors for on-site determinations. In this paper we describe some of the most common methods for toxin detection, with an emphasis on SPR. PMID:22573957

  1. Heap/stack guard pages using a wakeup unit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gooding, Thomas M; Satterfield, David L; Steinmacher-Burow, Burkhard

    A method and system for providing a memory access check on a processor including the steps of detecting accesses to a memory device including level-1 cache using a wakeup unit. The method includes invalidating level-1 cache ranges corresponding to a guard page, and configuring a plurality of wakeup address compare (WAC) registers to allow access to selected WAC registers. The method selects one of the plurality of WAC registers, and sets up a WAC register related to the guard page. The method configures the wakeup unit to interrupt on access of the selected WAC register. The method detects access ofmore » the memory device using the wakeup unit when a guard page is violated. The method generates an interrupt to the core using the wakeup unit, and determines the source of the interrupt. The method detects the activated WAC registers assigned to the violated guard page, and initiates a response.« less

  2. Method of Detecting Coliform Bacteria from Reflected Light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert K. (Inventor)

    2014-01-01

    The present invention relates to a method of detecting coliform bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  3. Detection, Isolation, and Identification of Vibrio cholerae from the Environment

    PubMed Central

    Huq, Anwar; Haley, Bradd J.; Taviani, Elisa; Chen, Arlene; Hasan, Nur A.; Colwell, Rita R.

    2012-01-01

    Recent molecular advances in microbiology have greatly improved the detection of bacterial pathogens in the environment. Improvement and a downward trend in the cost of molecular detection methods have contributed to increased frequency of detection of pathogenic microorganisms where traditional culture-based detection methods have failed. Culture methods also have been greatly improved and the confluence of the two suites of methods provides a powerful tool for detection, isolation, and characterization of pathogens. While molecular detection provides data on the presence and type of pathogens, culturing methods allow a researcher to preserve the organism of interest for “–omics” studies, such as genomic, metabolomic, secretomic, and transcriptomic analysis, which are rapidly becoming more affordable. This has yielded a clearer understanding of the ecology and epidemiology of microorganisms that cause disease. Specifically, important advances have been made over the past several years on isolation, detection, and identification of Vibrio cholerae, the causative agent of cholera in humans. In this unit, we present commonly accepted methods for isolation, detection, and characterization of V. cholerae, providing more extensive knowledge of the ecology and epidemiology of this organism. This unit has been fully revised and updated from the earlier unit (Huq, Grim et al. 2006) with the latest knowledge and additional information not previously included. We have also taken into account of cost of reagents and equipment that may be prohibitive for many researchers and have, therefore, included protocols for all laboratories, including those with limited resources, likely to be located in regions of cholera endemicity. PMID:22875567

  4. Systems and methods for detecting an image of an object by use of an X-ray beam having a polychromatic distribution

    DOEpatents

    Parham, Christopher; Zhong, Zhong; Pisano, Etta; Connor, Dean; Chapman, Leroy D.

    2010-06-22

    Systems and methods for detecting an image of an object using an X-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include detecting an image of an object. The method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a single monochromator crystal in a predetermined position to directly intercept the first X-ray beam such that a second X-ray beam having a predetermined energy level is produced. Further, an object can be positioned in the path of the second X-ray beam for transmission of the second X-ray beam through the object and emission from the object as a transmitted X-ray beam. The transmitted X-ray beam can be directed at an angle of incidence upon a crystal analyzer. Further, an image of the object can be detected from a beam diffracted from the analyzer crystal.

  5. Comparison of methods for the detection of coliphages in recreational water at two California, United States beaches.

    PubMed

    Rodríguez, Roberto A; Love, David C; Stewart, Jill R; Tajuba, Julianne; Knee, Jacqueline; Dickerson, Jerold W; Webster, Laura F; Sobsey, Mark D

    2012-04-01

    Methods for detection of two fecal indicator viruses, F+ and somatic coliphages, were evaluated for application to recreational marine water. Marine water samples were collected during the summer of 2007 in Southern California, United States from transects along Avalon Beach (n=186 samples) and Doheny Beach (n=101 samples). Coliphage detection methods included EPA method 1601 - two-step enrichment (ENR), EPA method 1602 - single agar layer (SAL), and variations of ENR. Variations included comparison of two incubation times (overnight and 5-h incubation) and two final detection steps (lysis zone assay and a rapid latex agglutination assay). A greater number of samples were positive for somatic and F+ coliphages by ENR than by SAL (p<0.01). The standard ENR with overnight incubation and detection by lysis zone assay was the most sensitive method for the detection of F+ and somatic coliphages from marine water, although the method takes up to three days to obtain results. A rapid 5-h enrichment version of ENR also performed well, with more positive samples than SAL, and could be performed in roughly 24h. Latex agglutination-based detection methods require the least amount of time to perform, although the sensitivity was less than lysis zone-based detection methods. Rapid culture-based enrichment of coliphages in marine water may be possible by further optimizing culture-based methods for saline water conditions to generate higher viral titers than currently available, as well as increasing the sensitivity of latex agglutination detection methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Fundamentals, achievements and challenges in the electrochemical sensing of pathogens.

    PubMed

    Monzó, Javier; Insua, Ignacio; Fernandez-Trillo, Francisco; Rodriguez, Paramaconi

    2015-11-07

    Electrochemical sensors are powerful tools widely used in industrial, environmental and medical applications. The versatility of electrochemical methods allows for the investigation of chemical composition in real time and in situ. Electrochemical detection of specific biological molecules is a powerful means for detecting disease-related markers. In the last 10 years, highly-sensitive and specific methods have been developed to detect waterborne and foodborne pathogens. In this review, we classify the different electrochemical techniques used for the qualitative and quantitative detection of pathogens. The robustness of electrochemical methods allows for accurate detection even in heterogeneous and impure samples. We present a fundamental description of the three major electrochemical sensing methods used in the detection of pathogens and the advantages and disadvantages of each of these methods. In each section, we highlight recent breakthroughs, including the utilisation of microfluidics, immunomagnetic separation and multiplexing for the detection of multiple pathogens in a single device. We also include recent studies describing new strategies for the design of future immunosensing systems and protocols. The high sensitivity and selectivity, together with the portability and the cost-effectiveness of the instrumentation, enhances the demand for further development in the electrochemical detection of microbes.

  7. Detection of Test Collusion via Kullback-Leibler Divergence

    ERIC Educational Resources Information Center

    Belov, Dmitry I.

    2013-01-01

    The development of statistical methods for detecting test collusion is a new research direction in the area of test security. Test collusion may be described as large-scale sharing of test materials, including answers to test items. Current methods of detecting test collusion are based on statistics also used in answer-copying detection.…

  8. Methods for detecting, quantifying, and adjusting for dissemination bias in meta-analysis are described.

    PubMed

    Mueller, Katharina Felicitas; Meerpohl, Joerg J; Briel, Matthias; Antes, Gerd; von Elm, Erik; Lang, Britta; Motschall, Edith; Schwarzer, Guido; Bassler, Dirk

    2016-12-01

    To systematically review methodological articles which focus on nonpublication of studies and to describe methods of detecting and/or quantifying and/or adjusting for dissemination in meta-analyses. To evaluate whether the methods have been applied to an empirical data set for which one can be reasonably confident that all studies conducted have been included. We systematically searched Medline, the Cochrane Library, and Web of Science, for methodological articles that describe at least one method of detecting and/or quantifying and/or adjusting for dissemination bias in meta-analyses. The literature search retrieved 2,224 records, of which we finally included 150 full-text articles. A great variety of methods to detect, quantify, or adjust for dissemination bias were described. Methods included graphical methods mainly based on funnel plot approaches, statistical methods, such as regression tests, selection models, sensitivity analyses, and a great number of more recent statistical approaches. Only few methods have been validated in empirical evaluations using unpublished studies obtained from regulators (Food and Drug Administration, European Medicines Agency). We present an overview of existing methods to detect, quantify, or adjust for dissemination bias. It remains difficult to advise which method should be used as they are all limited and their validity has rarely been assessed. Therefore, a thorough literature search remains crucial in systematic reviews, and further steps to increase the availability of all research results need to be taken. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Systems and methods of detecting force and stress using tetrapod nanocrystal

    DOEpatents

    Choi, Charina L.; Koski, Kristie J.; Sivasankar, Sanjeevi; Alivisatos, A. Paul

    2013-08-20

    Systems and methods of detecting force on the nanoscale including methods for detecting force using a tetrapod nanocrystal by exposing the tetrapod nanocrystal to light, which produces a luminescent response by the tetrapod nanocrystal. The method continues with detecting a difference in the luminescent response by the tetrapod nanocrystal relative to a base luminescent response that indicates a force between a first and second medium or stresses or strains experienced within a material. Such systems and methods find use with biological systems to measure forces in biological events or interactions.

  10. Method and apparatus for detecting phycocyanin-pigmented algae and bacteria from reflected light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert (Inventor)

    2013-01-01

    The present invention relates to a method of detecting phycocyanin algae or bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  11. Method and apparatus for detecting phycocyanin-pigmented algae and bacteria from reflected light

    NASA Technical Reports Server (NTRS)

    Vincent, Robert (Inventor)

    2006-01-01

    The present invention relates to a method of detecting phycocyanin algae or bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

  12. Systems and methods for data quality control and cleansing

    DOEpatents

    Wenzel, Michael; Boettcher, Andrew; Drees, Kirk; Kummer, James

    2016-05-31

    A method for detecting and cleansing suspect building automation system data is shown and described. The method includes using processing electronics to automatically determine which of a plurality of error detectors and which of a plurality of data cleansers to use with building automation system data. The method further includes using processing electronics to automatically detect errors in the data and cleanse the data using a subset of the error detectors and a subset of the cleansers.

  13. Laser-based standoff detection of explosives: a critical review.

    PubMed

    Wallin, Sara; Pettersson, Anna; Ostmark, Henric; Hobro, Alison

    2009-09-01

    A review of standoff detection technologies for explosives has been made. The review is focused on trace detection methods (methods aiming to detect traces from handling explosives or the vapours surrounding an explosive charge due to the vapour pressure of the explosive) rather than bulk detection methods (methods aiming to detect the bulk explosive charge). The requirements for standoff detection technologies are discussed. The technologies discussed are mostly laser-based trace detection technologies, such as laser-induced-breakdown spectroscopy, Raman spectroscopy, laser-induced-fluorescence spectroscopy and IR spectroscopy but the bulk detection technologies millimetre wave imaging and terahertz spectroscopy are also discussed as a complement to the laser-based methods. The review includes novel techniques, not yet tested in realistic environments, more mature technologies which have been tested outdoors in realistic environments as well as the most mature millimetre wave imaging technique.

  14. Imaging indicator for ESD safety testing.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whinnery, LeRoy L.,; Nissen, April; Keifer, Patrick N.

    2013-05-01

    This report describes the development of a new detection method for electrostatic discharge (ESD) testing of explosives, using a single-lens reflex (SLR) digital camera and a 200-mm macro lens. This method has demonstrated several distinct advantages to other current ESD detection methods, including the creation of a permanent record, an enlarged image for real-time viewing as well as extended periods of review, and ability to combine with most other Go/No-Go sensors. This report includes details of the method, including camera settings and position, and results with wellcharacterized explosives PETN and RDX, and two ESD-sensitive aluminum powders.

  15. Systems and methods for neutron detection using scintillator nano-materials

    DOEpatents

    Letant, Sonia Edith; Wang, Tzu-Fang

    2016-03-08

    In one embodiment, a neutron detector includes a three dimensional matrix, having nanocomposite materials and a substantially transparent film material for suspending the nanocomposite materials, a detector coupled to the three dimensional matrix adapted for detecting a change in the nanocomposite materials, and an analyzer coupled to the detector adapted for analyzing the change detected by the detector. In another embodiment, a method for detecting neutrons includes receiving radiation from a source, converting neutrons in the radiation into alpha particles using converter material, converting the alpha particles into photons using quantum dot emitters, detecting the photons, and analyzing the photons to determine neutrons in the radiation.

  16. A novel, colorimetric method for biogenic amine detection based on arylalkylamine N-acetyltransferase.

    PubMed

    Leng, Pei-Qiang; Zhao, Feng-Lan; Yin, Bin-Cheng; Ye, Bang-Ce

    2015-05-21

    We developed a novel colorimetric method for rapid detection of biogenic amines based on arylalkylamine N-acetyltransferase (aaNAT). The proposed method offers distinct advantages including simple handling, high speed, low cost, good sensitivity and selectivity.

  17. EVALUATION OF AN ALTERNATIVE IMS DISSOCIATION PROCEDURE FOR USE WITH METHOD 1622: DETECTION OF CRYPTOSPORIDIUM IN WATER

    EPA Science Inventory

    U.S. EPA Method 1623 is used to detect and quantify Cruptosporidum spp. oocysts in ater. The protocol consists of filtration, immunomagnetic separation (IMS), staining with a fluorescent antibody, and microscopic analysis. Microscopic analysis includes detection by fluorescent ...

  18. Methods, media, and systems for detecting attack on a digital processing device

    DOEpatents

    Stolfo, Salvatore J.; Li, Wei-Jen; Keromylis, Angelos D.; Androulaki, Elli

    2014-07-22

    Methods, media, and systems for detecting attack are provided. In some embodiments, the methods include: comparing at least part of a document to a static detection model; determining whether attacking code is included in the document based on the comparison of the document to the static detection model; executing at least part of the document; determining whether attacking code is included in the document based on the execution of the at least part of the document; and if attacking code is determined to be included in the document based on at least one of the comparison of the document to the static detection model and the execution of the at least part of the document, reporting the presence of an attack. In some embodiments, the methods include: selecting a data segment in at least one portion of an electronic document; determining whether the arbitrarily selected data segment can be altered without causing the electronic document to result in an error when processed by a corresponding program; in response to determining that the arbitrarily selected data segment can be altered, arbitrarily altering the data segment in the at least one portion of the electronic document to produce an altered electronic document; and determining whether the corresponding program produces an error state when the altered electronic document is processed by the corresponding program.

  19. Methods, media, and systems for detecting attack on a digital processing device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stolfo, Salvatore J.; Li, Wei-Jen; Keromytis, Angelos D.

    Methods, media, and systems for detecting attack are provided. In some embodiments, the methods include: comparing at least part of a document to a static detection model; determining whether attacking code is included in the document based on the comparison of the document to the static detection model; executing at least part of the document; determining whether attacking code is included in the document based on the execution of the at least part of the document; and if attacking code is determined to be included in the document based on at least one of the comparison of the document tomore » the static detection model and the execution of the at least part of the document, reporting the presence of an attack. In some embodiments, the methods include: selecting a data segment in at least one portion of an electronic document; determining whether the arbitrarily selected data segment can be altered without causing the electronic document to result in an error when processed by a corresponding program; in response to determining that the arbitrarily selected data segment can be altered, arbitrarily altering the data segment in the at least one portion of the electronic document to produce an altered electronic document; and determining whether the corresponding program produces an error state when the altered electronic document is processed by the corresponding program.« less

  20. Rapid identification of salmonella serotypes with stereo and hyperspectral microscope imaging Methods

    USDA-ARS?s Scientific Manuscript database

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  1. Rapid Identification of Salmonella Serotypes with Stereo and Hyperspectral Microscope Imaging Methods

    USDA-ARS?s Scientific Manuscript database

    The hyperspectral microscope imaging (HMI) method can reduce detection time within 8 hours including incubation process. The early and rapid detection with this method in conjunction with the high throughput capabilities makes HMI method a prime candidate for implementation for the food industry. Th...

  2. In-situ trainable intrusion detection system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symons, Christopher T.; Beaver, Justin M.; Gillen, Rob

    A computer implemented method detects intrusions using a computer by analyzing network traffic. The method includes a semi-supervised learning module connected to a network node. The learning module uses labeled and unlabeled data to train a semi-supervised machine learning sensor. The method records events that include a feature set made up of unauthorized intrusions and benign computer requests. The method identifies at least some of the benign computer requests that occur during the recording of the events while treating the remainder of the data as unlabeled. The method trains the semi-supervised learning module at the network node in-situ, such thatmore » the semi-supervised learning modules may identify malicious traffic without relying on specific rules, signatures, or anomaly detection.« less

  3. Chemical detection system and related methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caffrey, Augustine J.; Chichester, David L.; Egger, Ann E.

    2017-06-27

    A chemical detection system includes a frame, an emitter coupled to the frame, and a detector coupled to the frame proximate the emitter. The system also includes a shielding system coupled to the frame and positioned at least partially between the emitter and the detector, wherein the frame positions a sensing surface of the detector in a direction substantially parallel to a plane extending along a front portion of the frame. A method of analyzing composition of a suspect object includes directing neutrons at the object, detecting gamma rays emitted from the object, and communicating spectrometer information regarding the gammamore » rays. The method also includes presenting a GUI to a user with a dynamic status of an ongoing neutron spectroscopy process. The dynamic status includes a present confidence for a plurality of compounds being present in the suspect object responsive to changes in the spectrometer information during the ongoing process.« less

  4. Multiview road sign detection via self-adaptive color model and shape context matching

    NASA Astrophysics Data System (ADS)

    Liu, Chunsheng; Chang, Faliang; Liu, Chengyun

    2016-09-01

    The multiview appearance of road signs in uncontrolled environments has made the detection of road signs a challenging problem in computer vision. We propose a road sign detection method to detect multiview road signs. This method is based on several algorithms, including the classical cascaded detector, the self-adaptive weighted Gaussian color model (SW-Gaussian model), and a shape context matching method. The classical cascaded detector is used to detect the frontal road signs in video sequences and obtain the parameters for the SW-Gaussian model. The proposed SW-Gaussian model combines the two-dimensional Gaussian model and the normalized red channel together, which can largely enhance the contrast between the red signs and background. The proposed shape context matching method can match shapes with big noise, which is utilized to detect road signs in different directions. The experimental results show that compared with previous detection methods, the proposed multiview detection method can reach higher detection rate in detecting signs with different directions.

  5. Micro Ring Grating Spectrometer with Adjustable Aperture

    NASA Technical Reports Server (NTRS)

    Park, Yeonjoon (Inventor); King, Glen C. (Inventor); Elliott, James R. (Inventor); Choi, Sang H. (Inventor)

    2012-01-01

    A spectrometer includes a micro-ring grating device having coaxially-aligned ring gratings for diffracting incident light onto a target focal point, a detection device for detecting light intensity, one or more actuators, and an adjustable aperture device defining a circular aperture. The aperture circumscribes a target focal point, and directs a light to the detection device. The aperture device is selectively adjustable using the actuators to select a portion of a frequency band for transmission to the detection device. A method of detecting intensity of a selected band of incident light includes directing incident light onto coaxially-aligned ring gratings of a micro-ring grating device, and diffracting the selected band onto a target focal point using the ring gratings. The method includes using an actuator to adjust an aperture device and pass a selected portion of the frequency band to a detection device for measuring the intensity of the selected portion.

  6. Rapid detection and identification of energetic materials with surface enhanced raman spectrometry (SERS)

    DOEpatents

    Han, Thomas Yong-Jin; Valdez, Carlos A; Olson, Tammy Y; Kim, Sung Ho; Satcher, Jr., Joe H

    2015-04-21

    In one embodiment, a system includes a plurality of metal nanoparticles functionalized with a plurality of organic molecules tethered thereto, wherein the plurality of organic molecules preferentially interact with one or more analytes when placed in proximity therewith. According to another embodiment, a method for detecting analytes includes contacting a fluid having one or more analytes of interest therein with a plurality of metal nanoparticles, each metal nanoparticle having a plurality of organic molecules tethered thereto, and detecting Raman scattering from an analyte of interest from the fluid, the analyte interacting with one or more of the plurality of organic molecules. In another embodiment, a method includes chemically modifying a plurality of cyclodextrin molecules at a primary hydroxyl moiety to create a chemical handle, and tethering the plurality of cyclodextrin molecules to a metal nanoparticle using the chemical handle. Other systems and methods for detecting analytes are also described.

  7. Surface defect detection in tiling Industries using digital image processing methods: analysis and evaluation.

    PubMed

    Karimi, Mohammad H; Asemani, Davud

    2014-05-01

    Ceramic and tile industries should indispensably include a grading stage to quantify the quality of products. Actually, human control systems are often used for grading purposes. An automatic grading system is essential to enhance the quality control and marketing of the products. Since there generally exist six different types of defects originating from various stages of tile manufacturing lines with distinct textures and morphologies, many image processing techniques have been proposed for defect detection. In this paper, a survey has been made on the pattern recognition and image processing algorithms which have been used to detect surface defects. Each method appears to be limited for detecting some subgroup of defects. The detection techniques may be divided into three main groups: statistical pattern recognition, feature vector extraction and texture/image classification. The methods such as wavelet transform, filtering, morphology and contourlet transform are more effective for pre-processing tasks. Others including statistical methods, neural networks and model-based algorithms can be applied to extract the surface defects. Although, statistical methods are often appropriate for identification of large defects such as Spots, but techniques such as wavelet processing provide an acceptable response for detection of small defects such as Pinhole. A thorough survey is made in this paper on the existing algorithms in each subgroup. Also, the evaluation parameters are discussed including supervised and unsupervised parameters. Using various performance parameters, different defect detection algorithms are compared and evaluated. Copyright © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

  8. Charge gradient microscopy

    DOEpatents

    Roelofs, Andreas; Hong, Seungbum

    2018-02-06

    A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.

  9. Detection of genetically modified organisms in foods by DNA amplification techniques.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

    2004-01-01

    In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

  10. Analysis of digital communication signals and extraction of parameters

    NASA Astrophysics Data System (ADS)

    Al-Jowder, Anwar

    1994-12-01

    The signal classification performance of four types of electronics support measure (ESM) communications detection systems is compared from the standpoint of the unintended receiver (interceptor). Typical digital communication signals considered include binary phase shift keying (BPSK), quadrature phase shift keying (QPSK), frequency shift keying (FSK), and on-off keying (OOK). The analysis emphasizes the use of available signal processing software. Detection methods compared include broadband energy detection, FFT-based narrowband energy detection, and two correlation methods which employ the fast Fourier transform (FFT). The correlation methods utilize modified time-frequency distributions, where one of these is based on the Wigner-Ville distribution (WVD). Gaussian white noise is added to the signal to simulate various signal-to-noise ratios (SNR's).

  11. Highly Sensitive GMO Detection Using Real-Time PCR with a Large Amount of DNA Template: Single-Laboratory Validation.

    PubMed

    Mano, Junichi; Hatano, Shuko; Nagatomi, Yasuaki; Futo, Satoshi; Takabatake, Reona; Kitta, Kazumi

    2018-03-01

    Current genetically modified organism (GMO) detection methods allow for sensitive detection. However, a further increase in sensitivity will enable more efficient testing for large grain samples and reliable testing for processed foods. In this study, we investigated real-time PCR-based GMO detection methods using a large amount of DNA template. We selected target sequences that are commonly introduced into many kinds of GM crops, i.e., 35S promoter and nopaline synthase (NOS) terminator. This makes the newly developed method applicable to a wide range of GMOs, including some unauthorized ones. The estimated LOD of the new method was 0.005% of GM maize events; to the best of our knowledge, this method is the most sensitive among the GM maize detection methods for which the LOD was evaluated in terms of GMO content. A 10-fold increase in the DNA amount as compared with the amount used under common testing conditions gave an approximately 10-fold reduction in the LOD without PCR inhibition. Our method is applicable to various analytical samples, including processed foods. The use of other primers and fluorescence probes would permit highly sensitive detection of various recombinant DNA sequences besides the 35S promoter and NOS terminator.

  12. Radiation sensitive devices and systems for detection of radioactive materials and related methods

    DOEpatents

    Kotter, Dale K

    2014-12-02

    Radiation sensitive devices include a substrate comprising a radiation sensitive material and a plurality of resonance elements coupled to the substrate. Each resonance element is configured to resonate responsive to non-ionizing incident radiation. Systems for detecting radiation from a special nuclear material include a radiation sensitive device and a sensor located remotely from the radiation sensitive device and configured to measure an output signal from the radiation sensitive device. In such systems, the radiation sensitive device includes a radiation sensitive material and a plurality of resonance elements positioned on the radiation sensitive material. Methods for detecting a presence of a special nuclear material include positioning a radiation sensitive device in a location where special nuclear materials are to be detected and remotely interrogating the radiation sensitive device with a sensor.

  13. System and method for detecting components of a mixture including tooth elements for alignment

    DOEpatents

    Sommer, Gregory Jon; Schaff, Ulrich Y.

    2016-11-22

    Examples are described including assay platforms having tooth elements. An impinging element may sequentially engage tooth elements on the assay platform to sequentially align corresponding detection regions with a detection unit. In this manner, multiple measurements may be made of detection regions on the assay platform without necessarily requiring the starting and stopping of a motor.

  14. Inflight Microbial Monitoring - An Alternative Method to Culture Based Detection Currently Used on the International Space Station

    NASA Technical Reports Server (NTRS)

    Khodadad, Christina L.; Birmele, Michele N.; Hummerick, Mary E.; Roman, Monsi; Smith, David J.

    2015-01-01

    Microorganisms including potential human pathogens have been detected on the International Space Station (ISS). The potential to introduce new microorganisms occurs with every exchange of crew or addition of equipment or supplies. Current microbial monitoring methods require enrichment of microorganisms and a 48-hour incubation time resulting in an increase in microbial load, detecting a limited number of unidentified microorganisms. An expedient, low-cost, in-flight method of microbial detection, identification, and enumeration is warranted.

  15. Ricin detection: tracking active toxin.

    PubMed

    Bozza, William P; Tolleson, William H; Rivera Rosado, Leslie A; Zhang, Baolin

    2015-01-01

    Ricin is a plant toxin with high bioterrorism potential due to its natural abundance and potency in inducing cell death. Early detection of the active toxin is essential for developing appropriate countermeasures. Here we review concepts for designing ricin detection methods, including mechanism of action of the toxin, advantages and disadvantages of current detection assays, and perspectives on the future development of rapid and reliable methods for detecting ricin in environmental samples. Published by Elsevier Inc.

  16. Method and Apparatus for Reading Two Dimensional Identification Symbols Using Radar Techniques

    NASA Technical Reports Server (NTRS)

    Schramm, Harry F., Jr. (Inventor); Roxby, Donald L. (Inventor)

    2003-01-01

    A method and apparatus are provided for sensing two-dimensional identification marks provided on a substrate or embedded within a substrate below a surface of the substrate. Micropower impulse radar is used to transmit a high risetime, short duration pulse to a focussed radar target area of the substrate having the two dimensional identification marks. The method further includes the steps of listening for radar echoes returned from the identification marks during a short listening period window occurring a predetermined time after transmission of the radar pulse. If radar echoes are detected, an image processing step is carried out. If no radar echoes are detected, the method further includes sequentially transmitting further high risetime, short duration pulses, and listening for radar echoes from each of said further pulses after different elapsed times for each of the further pulses until radar echoes are detected. When radar echoes are detected, data based on the detected echoes is processed to produce an image of the identification marks.

  17. Acoustic detection and monitoring for transportation infrastructure security.

    DOT National Transportation Integrated Search

    2009-09-01

    Acoustical methods have been extensively used to locate, identify, and track objects underwater. Some of these applications include detecting and tracking submarines, marine mammal detection and identification, detection of mines and ship wrecks and ...

  18. Assessment of Hyporheic Zone, Flood-Plain, Soil-Gas, Soil, and Surface-Water Contamination at the McCoys Creek Chemical Training Area, Fort Gordon, Georgia, 2009-2010

    USGS Publications Warehouse

    Guimaraes, Wladmir B.; Falls, W. Fred; Caldwell, Andral W.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

    2011-01-01

    The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, Georgia, assessed the hyporheic zone, flood plain, soil gas, soil, and surface water for contaminants at the McCoys Creek Chemical Training Area (MCTA) at Fort Gordon, from October 2009 to September 2010. The assessment included the detection of organic contaminants in the hyporheic zone, flood plain, soil gas, and surface water. In addition, the organic contaminant assessment included the analysis of organic compounds classified as explosives and chemical agents in selected areas. Inorganic contaminants were assessed in soil and surface-water samples. The assessment was conducted to provide environmental contamination data to the U.S. Army at Fort Gordon pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. Ten passive samplers were deployed in the hyporheic zone and flood plain, and total petroleum hydrocarbons (TPH) and octane were detected above the method detection level in every sampler. Other organic compounds detected above the method detection level in the hyporheic zone and flood-plain samplers were trichloroethylene, and cis- and trans- 1, 2-dichloroethylene. One trip blank detected TPH below the method detection level but above the nondetection level. The concentrations of TPH in the samplers were many times greater than the concentrations detected in the blank; therefore, all other TPH concentrations detected are considered to represent environmental conditions. Seventy-one soil-gas samplers were deployed in a grid pattern across the MCTA. Three trip blanks and three method blanks were used and not deployed, and TPH was detected above the method detection level in two trip blanks and one method blank. Detection of TPH was observed at all 71 samplers, but because TPH was detected in the trip and method blanks, TPH was censored and, therefore, only 7 of the 71 samplers were reported as detecting TPH. In addition, benzene, toluene, ethylbenzene, and total xylene were detected above the method detection level in 22 samplers. Other compounds detected above the method detection level included naphthalene, octane, undecane, tridecane, 1,2,4-trimethylbenzene, trichloroethylene, perchloroethylene, chloroform, and 1,4-dichlorobenzene. Subsequent to the soil-gas survey, five locations with elevated contaminant mass were selected and a passive sampler was deployed at those locations to detect the presence of organic compounds classified as explosives or chemical agents. No explosives or chemical agents were detected above the method detection level, but some compounds were detected below the method detection level but above the nondetection level. Dimethyl disulfide, benzothiazole, chloroacetophenones, and para-chlorophenyl methyl sulfide were all detected below the method detection level but above the nondetection level. The compounds 2,4-dinitrotoluene, and para-chlorophenyl methyl sulfone were detected in samplers but also were detected in trip blanks and are not considered as present in the MCTA. The same five locations that were selected for sampling of explosives and chemical agents were selected for soil sampling. Metal concentrations in composite soil samples collected at five locations from land surface to a depth of 6 inches did not exceed the U.S. Environmental Protection Agency Regional Screening Levels for Industrial Soil. Concentrations in some compounds were higher than the South Carolina Department of Health and Environmental Control background levels for nearby South Carolina, including aluminum, arsenic, barium, beryllium, chromium, copper, iron, lead, manganese, nickel, and potassium. A surface-water sample was collected from McCoys Creek and analyzed for volatile organic compounds, semivolatile organic compounds, and inorganic compounds (metals). No volatile organic compounds and (or) semivolatile organic compounds were detected at levels above the maximum contaminant level of the U.S. Environmental Protection Agency (USEPA) National Primary Drinking Water Standard, and no inorganic compounds exceeded the maximum contaminant level of the USEPA National Primary Drinking Water Standard or the Georgia In-Stream Water-Quality Standard. Iron was the only inorganic compound detected in the surface-water sample (578 micrograms per liter) that exceeded the USEPA National Secondary Drinking Water Standard of 300 micrograms per liter.

  19. Bioluminescent bioreporter integrated circuit detection methods

    DOEpatents

    Simpson, Michael L.; Paulus, Michael J.; Sayler, Gary S.; Applegate, Bruce M.; Ripp, Steven A.

    2005-06-14

    Disclosed are monolithic bioelectronic devices comprising a bioreporter and an OASIC. These bioluminescent bioreporter integrated circuit are useful in detecting substances such as pollutants, explosives, and heavy-metals residing in inhospitable areas such as groundwater, industrial process vessels, and battlefields. Also disclosed are methods and apparatus for detection of particular analytes, including ammonia and estrogen compounds.

  20. Systems and Methods for Automated Vessel Navigation Using Sea State Prediction

    NASA Technical Reports Server (NTRS)

    Huntsberger, Terrance L. (Inventor); Howard, Andrew B. (Inventor); Reinhart, Rene Felix (Inventor); Aghazarian, Hrand (Inventor); Rankin, Arturo (Inventor)

    2017-01-01

    Systems and methods for sea state prediction and autonomous navigation in accordance with embodiments of the invention are disclosed. One embodiment of the invention includes a method of predicting a future sea state including generating a sequence of at least two 3D images of a sea surface using at least two image sensors, detecting peaks and troughs in the 3D images using a processor, identifying at least one wavefront in each 3D image based upon the detected peaks and troughs using the processor, characterizing at least one propagating wave based upon the propagation of wavefronts detected in the sequence of 3D images using the processor, and predicting a future sea state using at least one propagating wave characterizing the propagation of wavefronts in the sequence of 3D images using the processor. Another embodiment includes a method of autonomous vessel navigation based upon a predicted sea state and target location.

  1. Systems and Methods for Automated Vessel Navigation Using Sea State Prediction

    NASA Technical Reports Server (NTRS)

    Aghazarian, Hrand (Inventor); Reinhart, Rene Felix (Inventor); Huntsberger, Terrance L. (Inventor); Rankin, Arturo (Inventor); Howard, Andrew B. (Inventor)

    2015-01-01

    Systems and methods for sea state prediction and autonomous navigation in accordance with embodiments of the invention are disclosed. One embodiment of the invention includes a method of predicting a future sea state including generating a sequence of at least two 3D images of a sea surface using at least two image sensors, detecting peaks and troughs in the 3D images using a processor, identifying at least one wavefront in each 3D image based upon the detected peaks and troughs using the processor, characterizing at least one propagating wave based upon the propagation of wavefronts detected in the sequence of 3D images using the processor, and predicting a future sea state using at least one propagating wave characterizing the propagation of wavefronts in the sequence of 3D images using the processor. Another embodiment includes a method of autonomous vessel navigation based upon a predicted sea state and target location.

  2. Method and apparatus for operating a powertrain system upon detecting a stuck-closed clutch

    DOEpatents

    Hansen, R. Anthony

    2014-02-18

    A powertrain system includes a multi-mode transmission having a plurality of torque machines. A method for controlling the powertrain system includes identifying all presently applied clutches including commanded applied clutches and the stuck-closed clutch upon detecting one of the torque-transfer clutches is in a stuck-closed condition. A closed-loop control system is employed to control operation of the multi-mode transmission accounting for all the presently applied clutches.

  3. Integrated Fluorescence

    NASA Technical Reports Server (NTRS)

    Tuma, Margaret (Inventor); Gruhlke, Russell W. (Inventor)

    1998-01-01

    A detection method is integrated with a filtering method and an enhancement method to create a fluorescence sensor that can be miniaturized. The fluorescence sensor comprises a thin film geometry including a waveguide layer, a metal film layer and sensor layer. The thin film geometry of the fluorescence sensor allows the detection of fluorescent radiation over a narrow wavelength interval. This enables wavelength discrimination and eliminates the detection of unwanted light from unknown or spurious sources.

  4. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

    PubMed Central

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

  5. Scoping review of response shift methods: current reporting practices and recommendations.

    PubMed

    Sajobi, Tolulope T; Brahmbatt, Ronak; Lix, Lisa M; Zumbo, Bruno D; Sawatzky, Richard

    2018-05-01

    Response shift (RS) has been defined as a change in the meaning of an individual's self-evaluation of his/her health status and quality of life. Several statistical model- and design-based methods have been developed to test for RS in longitudinal data. We reviewed the uptake of these methods in patient-reported outcomes (PRO) literature. CINHAHL, EMBASE, Medline, ProQuest, PsycINFO, and Web of Science were searched to identify English-language articles about RS published until 2016. Data on year and country of publication, PRO measure adopted, RS detection method, type of RS detected, and testing of underlying model assumptions were extracted from the included articles. Of the 1032 articles identified, 101 (9.8%) articles were included in the study. While 54.5 of the articles reported on the Then-test, 30.7% of the articles reported on Oort's or Schmitt's structural equation modeling (SEM) procedure. Newer RS detection methods, such as relative importance analysis and random forest regression, have been used less frequently. Less than 25% reported on testing the assumptions underlying the adopted RS detection method(s). Despite rapid methodological advancements in RS research, this review highlights the need for further research about RS detection methods for complex longitudinal data and standardized reporting guidelines.

  6. Smart materials: strain sensing and stress determination by means of nanotube sensing systems, composites, and devices

    NASA Technical Reports Server (NTRS)

    Kim, Jong Dae (Inventor); Nagarajaiah, Satish (Inventor); Barrera, Enrique V. (Inventor); Dharap, Prasad (Inventor); Zhiling, Li (Inventor)

    2010-01-01

    The present invention is directed toward devices comprising carbon nanotubes that are capable of detecting displacement, impact, stress, and/or strain in materials, methods of making such devices, methods for sensing/detecting/monitoring displacement, impact, stress, and/or strain via carbon nanotubes, and various applications for such methods and devices. The devices and methods of the present invention all rely on mechanically-induced electronic perturbations within the carbon nanotubes to detect and quantify such stress/strain. Such detection and quantification can rely on techniques which include, but are not limited to, electrical conductivity/conductance and/or resistivity/resistance detection/measurements, thermal conductivity detection/measurements, electroluminescence detection/measurements, photoluminescence detection/measurements, and combinations thereof. All such techniques rely on an understanding of how such properties change in response to mechanical stress and/or strain.

  7. Method and apparatus for continuous fluid leak monitoring and detection in analytical instruments and instrument systems

    DOEpatents

    Weitz, Karl K [Pasco, WA; Moore, Ronald J [West Richland, WA

    2010-07-13

    A method and device are disclosed that provide for detection of fluid leaks in analytical instruments and instrument systems. The leak detection device includes a collection tube, a fluid absorbing material, and a circuit that electrically couples to an indicator device. When assembled, the leak detection device detects and monitors for fluid leaks, providing a preselected response in conjunction with the indicator device when contacted by a fluid.

  8. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1997-01-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

  9. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1997-04-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

  10. Structural Damage Detection Using Changes in Natural Frequencies: Theory and Applications

    NASA Astrophysics Data System (ADS)

    He, K.; Zhu, W. D.

    2011-07-01

    A vibration-based method that uses changes in natural frequencies of a structure to detect damage has advantages over conventional nondestructive tests in detecting various types of damage, including loosening of bolted joints, using minimum measurement data. Two major challenges associated with applications of the vibration-based damage detection method to engineering structures are addressed: accurate modeling of structures and the development of a robust inverse algorithm to detect damage, which are defined as the forward and inverse problems, respectively. To resolve the forward problem, new physics-based finite element modeling techniques are developed for fillets in thin-walled beams and for bolted joints, so that complex structures can be accurately modeled with a reasonable model size. To resolve the inverse problem, a logistical function transformation is introduced to convert the constrained optimization problem to an unconstrained one, and a robust iterative algorithm using a trust-region method, called the Levenberg-Marquardt method, is developed to accurately detect the locations and extent of damage. The new methodology can ensure global convergence of the iterative algorithm in solving under-determined system equations and deal with damage detection problems with relatively large modeling error and measurement noise. The vibration-based damage detection method is applied to various structures including lightning masts, a space frame structure and one of its components, and a pipeline. The exact locations and extent of damage can be detected in the numerical simulation where there is no modeling error and measurement noise. The locations and extent of damage can be successfully detected in experimental damage detection.

  11. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  12. Apparatus and method for rapid separation and detection of hydrocarbon fractions in a fluid stream

    DOEpatents

    Sluder, Charles S.; Storey, John M.; Lewis, Sr., Samuel A.

    2013-01-22

    An apparatus and method for rapid fractionation of hydrocarbon phases in a sample fluid stream are disclosed. Examples of the disclosed apparatus and method include an assembly of elements in fluid communication with one another including one or more valves and at least one sorbent chamber for removing certain classifications of hydrocarbons and detecting the remaining fractions using a detector. The respective ratios of hydrocarbons are determined by comparison with a non separated fluid stream.

  13. Electro-active sensor, method for constructing the same; apparatus and circuitry for detection of electro-active species

    NASA Technical Reports Server (NTRS)

    Buehler, Martin (Inventor)

    2009-01-01

    An electro-active sensor includes a nonconductive platform with a first electrode set attached with a first side of a nonconductive platform. The first electrode set serves as an electrochemical cell that may be utilized to detect electro-active species in solution. A plurality of electrode sets and a variety of additional electrochemical cells and sensors may be attached with the nonconductive platform. The present invention also includes a method for constructing the aforementioned electro-active sensor. Additionally, an apparatus for detection and observation is disclosed, where the apparatus includes a sealable chamber for insertion of a portion of an electro-active sensor. The apparatus allows for monitoring and detection activities. Allowing for control of attached cells and sensors, a dual-mode circuitry is also disclosed. The dual-mode circuitry includes a switch, allowing the circuitry to be switched from a potentiostat to a galvanostat mode.

  14. Dynamic baseline detection method for power data network service

    NASA Astrophysics Data System (ADS)

    Chen, Wei

    2017-08-01

    This paper proposes a dynamic baseline Traffic detection Method which is based on the historical traffic data for the Power data network. The method uses Cisco's NetFlow acquisition tool to collect the original historical traffic data from network element at fixed intervals. This method uses three dimensions information including the communication port, time, traffic (number of bytes or number of packets) t. By filtering, removing the deviation value, calculating the dynamic baseline value, comparing the actual value with the baseline value, the method can detect whether the current network traffic is abnormal.

  15. Detection of Toxoplasma gondii oocysts in water: proposition of a strategy and evaluation in Champagne-Ardenne Region, France.

    PubMed

    Aubert, D; Villena, I

    2009-03-01

    Water is a vehicle for disseminating human and veterinary toxoplasmosis due to oocyst contamination. Several outbreaks of toxoplasmosis throughout the world have been related to contaminated drinking water. We have developed a method for the detection of Toxoplasma gondii oocysts in water and we propose a strategy for the detection of multiple waterborne parasites, including Cryptosporidium spp. and Giardia. Water samples were filtered to recover Toxoplasma oocysts and, after the detection of Cryptosporidium oocysts and Giardia cysts by immunofluorescence, as recommended by French norm procedure NF T 90-455, the samples were purified on a sucrose density gradient. Detection of Toxoplasma was based on PCR amplification and mouse inoculation to determine the presence and infectivity of recovered oocysts. After experimental seeding assays, we determined that the PCR assay was more sensitive than the bioassay. This strategy was then applied to 482 environmental water samples collected since 2001. We detected Toxoplasma DNA in 37 environmental samples (7.7%), including public drinking water; however, none of them were positive by bioassay. This strategy efficiently detects Toxoplasma oocysts in water and may be suitable as a public health sentinel method. Alternative methods can be used in conjunction with this one to determine the infectivity of parasites that were detected by molecular methods.

  16. Applications of 3D-EDGE Detection for ALS Point Cloud

    NASA Astrophysics Data System (ADS)

    Ni, H.; Lin, X. G.; Zhang, J. X.

    2017-09-01

    Edge detection has been one of the major issues in the field of remote sensing and photogrammetry. With the fast development of sensor technology of laser scanning system, dense point clouds have become increasingly common. Precious 3D-edges are able to be detected from these point clouds and a great deal of edge or feature line extraction methods have been proposed. Among these methods, an easy-to-use 3D-edge detection method, AGPN (Analyzing Geometric Properties of Neighborhoods), has been proposed. The AGPN method detects edges based on the analysis of geometric properties of a query point's neighbourhood. The AGPN method detects two kinds of 3D-edges, including boundary elements and fold edges, and it has many applications. This paper presents three applications of AGPN, i.e., 3D line segment extraction, ground points filtering, and ground breakline extraction. Experiments show that the utilization of AGPN method gives a straightforward solution to these applications.

  17. A simple, rapid, cost-effective and sensitive method for detection of Salmonella in environmental and pecan samples.

    PubMed

    Dobhal, S; Zhang, G; Rohla, C; Smith, M W; Ma, L M

    2014-10-01

    PCR is widely used in the routine detection of foodborne human pathogens; however, challenges remain in overcoming PCR inhibitors present in some sample matrices. The objective of this study was to develop a simple, sensitive, cost-effective and rapid method for processing large numbers of environmental and pecan samples for Salmonella detection. This study was also aimed at validation of a new protocol for the detection of Salmonella from in-shell pecans. Different DNA template preparation methods, including direct boiling, prespin, multiple washing and commercial DNA extraction kits, were evaluated with pure cultures of Salmonella Typhimurium and with enriched soil, cattle feces and in-shell pecan each spiked individually with Salmonella Typhimurium. PCR detection of Salmonella was conducted using invA and 16S rRNA gene (internal amplification control) specific primers. The effect of amplification facilitators, including bovine serum albumin (BSA), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) and gelatin on PCR sensitivity, was also evaluated. Conducting a prespin of sample matrices in combination with the addition of 0·4% (w/v) BSA and 1% (w/v) PVP in PCR mix was the simplest, most rapid, cost-effective and sensitive method for PCR detection of Salmonella, with up to 40 CFU Salmonella per reaction detectable in the presence of over 10(9 ) CFU ml(-1) of background micro-organisms from enriched feces soil or pecan samples. The developed method is rapid, cost-effective and sensitive for detection of Salmonella from different matrices. This study provides a method with broad applicability for PCR detection of Salmonella in complex sample matrices. This method has a potential for its application in different research arenas and diagnostic laboratories. © 2014 The Society for Applied Microbiology.

  18. Uncooled infrared photon detector and multicolor infrared detection using microoptomechanical sensors

    DOEpatents

    Datskos, Panagiotis G.; Rajic, Solobodan; Datskou, Irene C.

    1999-01-01

    Systems and methods for infrared detection are described. An optomechanical photon detector includes a semiconductor material and is based on measurement of a photoinduced lattice strain. A multicolor infrared sensor includes a stack of frequency specific optomechanical detectors. The stack can include one, or more, of the optomechanical photon detectors that function based on the measurement of photoinduced lattice strain. The systems and methods provide advantages in that rapid, sensitive multicolor infrared imaging can be performed without the need for a cooling subsystem.

  19. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOEpatents

    West, Phillip B [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID; Wright, Jerry P [Idaho Falls, ID

    2012-05-29

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  20. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOEpatents

    West, Phillip B [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID; Wright, Jerry P [Idaho Falls, ID

    2011-09-27

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  1. Detection of urban expansion in an urban-rural landscape with multitemporal QuickBird images

    PubMed Central

    Lu, Dengsheng; Hetrick, Scott; Moran, Emilio; Li, Guiying

    2011-01-01

    Accurately detecting urban expansion with remote sensing techniques is a challenge due to the complexity of urban landscapes. This paper explored methods for detecting urban expansion with multitemporal QuickBird images in Lucas do Rio Verde, Mato Grosso, Brazil. Different techniques, including image differencing, principal component analysis (PCA), and comparison of classified impervious surface images with the matched filtering method, were used to examine urbanization detection. An impervious surface image classified with the hybrid method was used to modify the urbanization detection results. As a comparison, the original multispectral image and segmentation-based mean-spectral images were used during the detection of urbanization. This research indicates that the comparison of classified impervious surface images with matched filtering method provides the best change detection performance, followed by the image differencing method based on segmentation-based mean spectral images. The PCA is not a good method for urban change detection in this study. Shadows and high spectral variation within the impervious surfaces represent major challenges to the detection of urban expansion when high spatial resolution images are used. PMID:21799706

  2. Development of a Novel Loop-Mediated Isothermal Amplification (LAMP) Assay for the Detection of Rickettsia spp.

    PubMed

    Hanaoka, Nozomu; Matsutani, Minenosuke; Satoh, Masaaki; Ogawa, Motohiko; Shirai, Mutsunori; Ando, Shuji

    2017-01-24

    We developed a novel loop-mediated isothermal amplification (LAMP) method to detect Rickettsia spp., including Rickettsia prowazekii and R. typhi. Species-specific LAMP primers were developed for orthologous genes conserved among Rickettsia spp. The selected modified primers could detect all the Rickettsia spp. tested. The LAMP method was successfully used to detect 100 DNA copies of Rickettsia spp. within approximately 60 min at 63℃. Therefore, this method may be an excellent tool for the early diagnosis of rickettsiosis in a laboratory or in the field.

  3. Minimal Residual Disease Assessment in Lymphoma: Methods and Applications.

    PubMed

    Herrera, Alex F; Armand, Philippe

    2017-12-01

    Standard methods for disease response assessment in patients with lymphoma, including positron emission tomography and computed tomography scans, are imperfect. In other hematologic malignancies, particularly leukemias, the ability to detect minimal residual disease (MRD) is increasingly influencing treatment paradigms. However, in many subtypes of lymphoma, the application of MRD assessment techniques, like flow cytometry or polymerase chain reaction-based methods, has been challenging because of the absence of readily detected circulating disease or canonic chromosomal translocations. Newer MRD detection methods that use next-generation sequencing have yielded promising results in a number of lymphoma subtypes, fueling the hope that MRD detection may soon be applicable in clinical practice for most patients with lymphoma. MRD assessment can provide real-time information about tumor burden and response to therapy, noninvasive genomic profiling, and monitoring of clonal dynamics, allowing for many possible applications that could significantly affect the care of patients with lymphoma. Further validation of MRD assessment methods, including the incorporation of MRD assessment into clinical trials in patients with lymphoma, will be critical to determine how best to deploy MRD testing in routine practice and whether MRD assessment can ultimately bring us closer to the goal of personalized lymphoma care. In this review article, we describe the methods available for detecting MRD in patients with lymphoma and their relative advantages and disadvantages. We discuss preliminary results supporting the potential applications for MRD testing in the care of patients with lymphoma and strategies for including MRD assessment in lymphoma clinical trials.

  4. Spectral analysis method for detecting an element

    DOEpatents

    Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Reber, Edward L [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID

    2008-02-12

    A method for detecting an element is described and which includes the steps of providing a gamma-ray spectrum which has a region of interest which corresponds with a small amount of an element to be detected; providing nonparametric assumptions about a shape of the gamma-ray spectrum in the region of interest, and which would indicate the presence of the element to be detected; and applying a statistical test to the shape of the gamma-ray spectrum based upon the nonparametric assumptions to detect the small amount of the element to be detected.

  5. Psychophysical Models for Signal Detection with Time Varying Uncertainty. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Gai, E.

    1975-01-01

    Psychophysical models for the behavior of the human operator in detection tasks which include change in detectability, correlation between observations and deferred decisions are developed. Classical Signal Detection Theory (SDT) is discussed and its emphasis on the sensory processes is contrasted to decision strategies. The analysis of decision strategies utilizes detection tasks with time varying signal strength. The classical theory is modified to include such tasks and several optimal decision strategies are explored. Two methods of classifying strategies are suggested. The first method is similar to the analysis of ROC curves, while the second is based on the relation between the criterion level (CL) and the detectability. Experiments to verify the analysis of tasks with changes of signal strength are designed. The results show that subjects are aware of changes in detectability and tend to use strategies that involve changes in the CL's.

  6. Position detectors, methods of detecting position, and methods of providing positional detectors

    DOEpatents

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  7. Failure detection of liquid cooled electronics in sealed packages. [in airborne information management system

    NASA Technical Reports Server (NTRS)

    Hoadley, A. W.; Porter, A. J.

    1991-01-01

    The theory and experimental verification of a method of detecting fluid-mass loss, expansion-chamber pressure loss, or excessive vapor build-up in NASA's Airborne Information Management System (AIMS) are presented. The primary purpose of this leak-detection method is to detect the fluid-mass loss before the volume of vapor on the liquid side causes a temperature-critical part to be out of the liquid. The method detects the initial leak after the first 2.5 pct of the liquid mass has been lost, and it can be used for detecting subsequent situations including the leaking of air into the liquid chamber and the subsequent vapor build-up.

  8. Salient object detection method based on multiple semantic features

    NASA Astrophysics Data System (ADS)

    Wang, Chunyang; Yu, Chunyan; Song, Meiping; Wang, Yulei

    2018-04-01

    The existing salient object detection model can only detect the approximate location of salient object, or highlight the background, to resolve the above problem, a salient object detection method was proposed based on image semantic features. First of all, three novel salient features were presented in this paper, including object edge density feature (EF), object semantic feature based on the convex hull (CF) and object lightness contrast feature (LF). Secondly, the multiple salient features were trained with random detection windows. Thirdly, Naive Bayesian model was used for combine these features for salient detection. The results on public datasets showed that our method performed well, the location of salient object can be fixed and the salient object can be accurately detected and marked by the specific window.

  9. System and method for detecting a faulty object in a system

    DOEpatents

    Gunnels, John A.; Gustavson, Fred Gehrung; Engle, Robert Daniel

    2010-12-14

    A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the n-dimensional architecture which would result in identifying a faulty object in the system.

  10. System and method for detecting a faulty object in a system

    DOEpatents

    Gunnels, John A [Brewster, NY; Gustavson, Fred Gehrung [Briarcliff Manor, NY; Engle, Robert Daniel [St. Louis, MO

    2009-03-17

    A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the n-dimensional architecture which would result in identifying a faulty object in the system.

  11. Automatic adventitious respiratory sound analysis: A systematic review.

    PubMed

    Pramono, Renard Xaviero Adhi; Bowyer, Stuart; Rodriguez-Villegas, Esther

    2017-01-01

    Automatic detection or classification of adventitious sounds is useful to assist physicians in diagnosing or monitoring diseases such as asthma, Chronic Obstructive Pulmonary Disease (COPD), and pneumonia. While computerised respiratory sound analysis, specifically for the detection or classification of adventitious sounds, has recently been the focus of an increasing number of studies, a standardised approach and comparison has not been well established. To provide a review of existing algorithms for the detection or classification of adventitious respiratory sounds. This systematic review provides a complete summary of methods used in the literature to give a baseline for future works. A systematic review of English articles published between 1938 and 2016, searched using the Scopus (1938-2016) and IEEExplore (1984-2016) databases. Additional articles were further obtained by references listed in the articles found. Search terms included adventitious sound detection, adventitious sound classification, abnormal respiratory sound detection, abnormal respiratory sound classification, wheeze detection, wheeze classification, crackle detection, crackle classification, rhonchi detection, rhonchi classification, stridor detection, stridor classification, pleural rub detection, pleural rub classification, squawk detection, and squawk classification. Only articles were included that focused on adventitious sound detection or classification, based on respiratory sounds, with performance reported and sufficient information provided to be approximately repeated. Investigators extracted data about the adventitious sound type analysed, approach and level of analysis, instrumentation or data source, location of sensor, amount of data obtained, data management, features, methods, and performance achieved. A total of 77 reports from the literature were included in this review. 55 (71.43%) of the studies focused on wheeze, 40 (51.95%) on crackle, 9 (11.69%) on stridor, 9 (11.69%) on rhonchi, and 18 (23.38%) on other sounds such as pleural rub, squawk, as well as the pathology. Instrumentation used to collect data included microphones, stethoscopes, and accelerometers. Several references obtained data from online repositories or book audio CD companions. Detection or classification methods used varied from empirically determined thresholds to more complex machine learning techniques. Performance reported in the surveyed works were converted to accuracy measures for data synthesis. Direct comparison of the performance of surveyed works cannot be performed as the input data used by each was different. A standard validation method has not been established, resulting in different works using different methods and performance measure definitions. A review of the literature was performed to summarise different analysis approaches, features, and methods used for the analysis. The performance of recent studies showed a high agreement with conventional non-automatic identification. This suggests that automated adventitious sound detection or classification is a promising solution to overcome the limitations of conventional auscultation and to assist in the monitoring of relevant diseases.

  12. Automatic adventitious respiratory sound analysis: A systematic review

    PubMed Central

    Bowyer, Stuart; Rodriguez-Villegas, Esther

    2017-01-01

    Background Automatic detection or classification of adventitious sounds is useful to assist physicians in diagnosing or monitoring diseases such as asthma, Chronic Obstructive Pulmonary Disease (COPD), and pneumonia. While computerised respiratory sound analysis, specifically for the detection or classification of adventitious sounds, has recently been the focus of an increasing number of studies, a standardised approach and comparison has not been well established. Objective To provide a review of existing algorithms for the detection or classification of adventitious respiratory sounds. This systematic review provides a complete summary of methods used in the literature to give a baseline for future works. Data sources A systematic review of English articles published between 1938 and 2016, searched using the Scopus (1938-2016) and IEEExplore (1984-2016) databases. Additional articles were further obtained by references listed in the articles found. Search terms included adventitious sound detection, adventitious sound classification, abnormal respiratory sound detection, abnormal respiratory sound classification, wheeze detection, wheeze classification, crackle detection, crackle classification, rhonchi detection, rhonchi classification, stridor detection, stridor classification, pleural rub detection, pleural rub classification, squawk detection, and squawk classification. Study selection Only articles were included that focused on adventitious sound detection or classification, based on respiratory sounds, with performance reported and sufficient information provided to be approximately repeated. Data extraction Investigators extracted data about the adventitious sound type analysed, approach and level of analysis, instrumentation or data source, location of sensor, amount of data obtained, data management, features, methods, and performance achieved. Data synthesis A total of 77 reports from the literature were included in this review. 55 (71.43%) of the studies focused on wheeze, 40 (51.95%) on crackle, 9 (11.69%) on stridor, 9 (11.69%) on rhonchi, and 18 (23.38%) on other sounds such as pleural rub, squawk, as well as the pathology. Instrumentation used to collect data included microphones, stethoscopes, and accelerometers. Several references obtained data from online repositories or book audio CD companions. Detection or classification methods used varied from empirically determined thresholds to more complex machine learning techniques. Performance reported in the surveyed works were converted to accuracy measures for data synthesis. Limitations Direct comparison of the performance of surveyed works cannot be performed as the input data used by each was different. A standard validation method has not been established, resulting in different works using different methods and performance measure definitions. Conclusion A review of the literature was performed to summarise different analysis approaches, features, and methods used for the analysis. The performance of recent studies showed a high agreement with conventional non-automatic identification. This suggests that automated adventitious sound detection or classification is a promising solution to overcome the limitations of conventional auscultation and to assist in the monitoring of relevant diseases. PMID:28552969

  13. Optimization of biological and instrumental detection of explosives and ignitable liquid residues including canines, SPME/ITMS and GC/MSn

    NASA Astrophysics Data System (ADS)

    Furton, Kenneth G.; Harper, Ross J.; Perr, Jeannette M.; Almirall, Jose R.

    2003-09-01

    A comprehensive study and comparison is underway using biological detectors and instrumental methods for the rapid detection of ignitable liquid residues (ILR) and high explosives. Headspace solid phase microextraction (SPME) has been demonstrated to be an effective sampling method helping to identify active odor signature chemicals used by detector dogs to locate forensic specimens as well as a rapid pre-concentration technique prior to instrumental detection. Common ignitable liquids and common military and industrial explosives have been studied including trinitrotoluene, tetryl, RDX, HMX, EGDN, PETN and nitroglycerine. This study focuses on identifying volatile odor signature chemicals present, which can be used to enhance the level and reliability of detection of ILR and explosives by canines and instrumental methods. While most instrumental methods currently in use focus on particles and on parent organic compounds, which are often involatile, characteristic volatile organics are generally also present and can be exploited to enhance detection particularly for well-concealed devices. Specific examples include the volatile odor chemicals 2-ethyl-1-hexanol and cyclohexanone, which are readily available in the headspace of the high explosive composition C-4; whereas, the active chemical cyclo-1,3,5-trimethylene-2,4,6-trinitramine (RDX) is not. The analysis and identification of these headspace 'fingerprint' organics is followed by double-blind dog trials of the individual components using certified teams in an attempt to isolate and understand the target compounds to which dogs are sensitive. Studies to compare commonly used training aids with the actual target explosive have also been undertaken to determine their suitability and effectiveness. The optimization of solid phase microextraction (SPME) combined with ion trap mobility spectrometry (ITMS) and gas chromatography/mass spectrometry/mass spectrometry (GC/MSn) is detailed including interface development and comparisons of limits of detection. These instrumental methods are being optimized in order to detect the same target odor chemicals used by detector dogs to reliably locate explosives and ignitable liquids.

  14. Multiratio fusion change detection with adaptive thresholding

    NASA Astrophysics Data System (ADS)

    Hytla, Patrick C.; Balster, Eric J.; Vasquez, Juan R.; Neuroth, Robert M.

    2017-04-01

    A ratio-based change detection method known as multiratio fusion (MRF) is proposed and tested. The MRF framework builds on other change detection components proposed in this work: dual ratio (DR) and multiratio (MR). The DR method involves two ratios coupled with adaptive thresholds to maximize detected changes and minimize false alarms. The use of two ratios is shown to outperform the single ratio case when the means of the image pairs are not equal. MR change detection builds on the DR method by including negative imagery to produce four total ratios with adaptive thresholds. Inclusion of negative imagery is shown to improve detection sensitivity and to boost detection performance in certain target and background cases. MRF further expands this concept by fusing together the ratio outputs using a routine in which detections must be verified by two or more ratios to be classified as a true changed pixel. The proposed method is tested with synthetically generated test imagery and real datasets with results compared to other methods found in the literature. DR is shown to significantly outperform the standard single ratio method. MRF produces excellent change detection results that exhibit up to a 22% performance improvement over other methods from the literature at low false-alarm rates.

  15. Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study

    PubMed Central

    2010-01-01

    Background Animals, including humans, exhibit a variety of biological rhythms. This article describes a method for the detection and simultaneous comparison of multiple nycthemeral rhythms. Methods A statistical method for detecting periodic patterns in time-related data via harmonic regression is described. The method is particularly capable of detecting nycthemeral rhythms in medical data. Additionally a method for simultaneously comparing two or more periodic patterns is described, which derives from the analysis of variance (ANOVA). This method statistically confirms or rejects equality of periodic patterns. Mathematical descriptions of the detecting method and the comparing method are displayed. Results Nycthemeral rhythms of incidents of bodily harm in Middle Franconia are analyzed in order to demonstrate both methods. Every day of the week showed a significant nycthemeral rhythm of bodily harm. These seven patterns of the week were compared to each other revealing only two different nycthemeral rhythms, one for Friday and Saturday and one for the other weekdays. PMID:21059197

  16. Nested PCR and RFLP analysis based on the 16S rRNA gene

    USDA-ARS?s Scientific Manuscript database

    Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

  17. Microbial Profiles and Detection Techniques in Peri-Implant Diseases: a Systematic Review

    PubMed Central

    Padial-Molina, Miguel; López-Martínez, Jesús; O’Valle, Francisco

    2016-01-01

    ABSTRACT Objectives To describe the microbial profiles of peri-implant diseases and the main detection methods. Material and Methods A literature search was performed in MEDLINE via PubMed database to identify studies on microbial composition of peri-implant surfaces in humans published in the last 5 years. Studies had to have clear implant status definition for health, peri-implant mucositis and/or peri-implantitis and specifically study microbial composition of the peri-implant sulcus. Results A total of 194 studies were screened and 47 included. Peri-implant sites are reported to be different microbial ecosystems compared to periodontal sites. However, differences between periodontal and peri-implant health and disease are not consistent across all studies, possibly due to the bias introduced by the microbial detection technique. New methods non species-oriented are being used to find ‘unexpected’ microbiota not previously described in these scenarios. Conclusions Microbial profile of peri-implant diseases usually includes classic periodontopathogens. However, correlation between studies is difficult, particularly because of the use of different detection methods. New metagenomic techniques should be promoted for future studies to avoid detection bias. PMID:27833735

  18. Automated detection of hospital outbreaks: A systematic review of methods

    PubMed Central

    Buckeridge, David L.; Lepelletier, Didier

    2017-01-01

    Objectives Several automated algorithms for epidemiological surveillance in hospitals have been proposed. However, the usefulness of these methods to detect nosocomial outbreaks remains unclear. The goal of this review was to describe outbreak detection algorithms that have been tested within hospitals, consider how they were evaluated, and synthesize their results. Methods We developed a search query using keywords associated with hospital outbreak detection and searched the MEDLINE database. To ensure the highest sensitivity, no limitations were initially imposed on publication languages and dates, although we subsequently excluded studies published before 2000. Every study that described a method to detect outbreaks within hospitals was included, without any exclusion based on study design. Additional studies were identified through citations in retrieved studies. Results Twenty-nine studies were included. The detection algorithms were grouped into 5 categories: simple thresholds (n = 6), statistical process control (n = 12), scan statistics (n = 6), traditional statistical models (n = 6), and data mining methods (n = 4). The evaluation of the algorithms was often solely descriptive (n = 15), but more complex epidemiological criteria were also investigated (n = 10). The performance measures varied widely between studies: e.g., the sensitivity of an algorithm in a real world setting could vary between 17 and 100%. Conclusion Even if outbreak detection algorithms are useful complementary tools for traditional surveillance, the heterogeneity in results among published studies does not support quantitative synthesis of their performance. A standardized framework should be followed when evaluating outbreak detection methods to allow comparison of algorithms across studies and synthesis of results. PMID:28441422

  19. Method and apparatus for clockless analog-to-digital conversion and peak detection

    DOEpatents

    DeGeronimo, Gianluigi

    2007-03-06

    An apparatus and method for analog-to-digital conversion and peak detection includes at least one stage, which includes a first switch, second switch, current source or capacitor, and discriminator. The discriminator changes state in response to a current or charge associated with the input signal exceeding a threshold, thereby indicating whether the current or charge associated with the input signal is greater than the threshold. The input signal includes a peak or a charge, and the converter includes a peak or charge detect mode in which a state of the switch is retained in response to a decrease in the current or charge associated with the input signal. The state of the switch represents at least a portion of a value of the peak or of the charge.

  20. Automated detection of hospital outbreaks: A systematic review of methods.

    PubMed

    Leclère, Brice; Buckeridge, David L; Boëlle, Pierre-Yves; Astagneau, Pascal; Lepelletier, Didier

    2017-01-01

    Several automated algorithms for epidemiological surveillance in hospitals have been proposed. However, the usefulness of these methods to detect nosocomial outbreaks remains unclear. The goal of this review was to describe outbreak detection algorithms that have been tested within hospitals, consider how they were evaluated, and synthesize their results. We developed a search query using keywords associated with hospital outbreak detection and searched the MEDLINE database. To ensure the highest sensitivity, no limitations were initially imposed on publication languages and dates, although we subsequently excluded studies published before 2000. Every study that described a method to detect outbreaks within hospitals was included, without any exclusion based on study design. Additional studies were identified through citations in retrieved studies. Twenty-nine studies were included. The detection algorithms were grouped into 5 categories: simple thresholds (n = 6), statistical process control (n = 12), scan statistics (n = 6), traditional statistical models (n = 6), and data mining methods (n = 4). The evaluation of the algorithms was often solely descriptive (n = 15), but more complex epidemiological criteria were also investigated (n = 10). The performance measures varied widely between studies: e.g., the sensitivity of an algorithm in a real world setting could vary between 17 and 100%. Even if outbreak detection algorithms are useful complementary tools for traditional surveillance, the heterogeneity in results among published studies does not support quantitative synthesis of their performance. A standardized framework should be followed when evaluating outbreak detection methods to allow comparison of algorithms across studies and synthesis of results.

  1. Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent

    PubMed Central

    Li, Linlin; Deng, Xutao; Mee, Edward T.; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D.; Delwart, Eric

    2014-01-01

    Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries on the efficiency of viral detection and virus genome coverage were compared. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. PMID:25497414

  2. Basic analytical methods for identification of erythropoiesis-stimulating agents in doping control

    NASA Astrophysics Data System (ADS)

    Postnikov, P. V.; Krotov, G. I.; Efimova, Yu A.; Rodchenkov, G. M.

    2016-02-01

    The design of new erythropoiesis-stimulating agents for clinical use necessitates constant development of methods for detecting the abuse of these substances, which are prohibited under the World Anti-Doping Code and are included in the World Anti-Doping Agency (WADA) prohibited list. This review integrates and describes systematically the published data on the key methods currently used by WADA-accredited anti-doping laboratories around the world to detect the abuse of erythropoiesis-stimulating agents, including direct methods (various polyacrylamide gel electrophoresis techniques, enzyme-linked immunosorbent assay, membrane enzyme immunoassay and mass spectrometry) and indirect methods (athlete biological passport). Particular attention is given to promising approaches and investigations that can be used to control prohibited erythropoietins in the near future. The bibliography includes 122 references.

  3. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    PubMed

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Detection of visible and latent fingerprints using micro-X-ray fluorescence elemental imaging.

    PubMed

    Worley, Christopher G; Wiltshire, Sara S; Miller, Thomasin C; Havrilla, George J; Majidi, Vahid

    2006-01-01

    Using micro-X-ray fluorescence (MXRF), a novel means of detecting fingerprints was examined in which the prints were imaged based on their elemental composition. MXRF is a nondestructive technique. Although this method requires a priori knowledge about the approximate location of a print, it offers a new and complementary means for detecting fingerprints that are also left pristine for further analysis (including potential DNA extraction) or archiving purposes. Sebaceous fingerprints and those made after perspiring were detected based on elements such as potassium and chlorine present in the print residue. Unique prints were also detected including those containing lotion, saliva, banana, or sunscreen. This proof-of-concept study demonstrates the potential for visualizing fingerprints by MXRF on surfaces that can be problematic using current methods.

  5. Radioisotope Detection Device and Methods of Radioisotope Collection

    DOEpatents

    Tranter, Troy J [Idaho Falls, ID; Oertel, Christopher P [Idaho Falls, ID; Giles, John R [Pocatello, ID; Mann, Nicholas R [Rigby, ID; McIlwain, Michael E [Idaho Falls, ID

    2011-04-12

    A device for collection of radionuclides includes a mixture of a polymer, a fluorescent organic scintillator and a chemical extractant. A radionuclide detector system includes a collection device comprising a mixture of a polymer, a fluorescent agent and a selective ligand. The system includes at least one photomultiplier tube (PMT). A method of detecting radionuclides includes providing a collector device comprising a mixture comprising a polymer, a fluorescent organic scintillator and a chemical extractant. An aqueous environment is exposed to the device and radionuclides are collected from the environment. Radionuclides can be concentrated within the device.

  6. Advances in explosives analysis—part II: photon and neutron methods

    DOE PAGES

    Brown, Kathryn E.; Greenfield, Margo T.; McGrane, Shawn D.; ...

    2015-10-07

    The number and capability of explosives detection and analysis methods have increased dramatically since publication of the Analytical and Bioanalytical Chemistry special issue devoted to Explosives Analysis [Moore DS, Goodpaster JV, Anal Bioanal Chem 395:245–246, 2009]. Here we review and critically evaluate the latest (the past five years) important advances in explosives detection, with details of the improvements over previous methods, and suggest possible avenues towards further advances in, e.g., stand-off distance, detection limit, selectivity, and penetration through camouflage or packaging. Our review consists of two parts. Part I discussed methods based on animals, chemicals (including colorimetry, molecularly imprinted polymers,more » electrochemistry, and immunochemistry), ions (both ion-mobility spectrometry and mass spectrometry), and mechanical devices. In Part II, we review methods based on photons, from very energetic photons including X-rays and gamma rays down to the terahertz range, and neutrons.« less

  7. Applied Graph-Mining Algorithms to Study Biomolecular Interaction Networks

    PubMed Central

    2014-01-01

    Protein-protein interaction (PPI) networks carry vital information on the organization of molecular interactions in cellular systems. The identification of functionally relevant modules in PPI networks is one of the most important applications of biological network analysis. Computational analysis is becoming an indispensable tool to understand large-scale biomolecular interaction networks. Several types of computational methods have been developed and employed for the analysis of PPI networks. Of these computational methods, graph comparison and module detection are the two most commonly used strategies. This review summarizes current literature on graph kernel and graph alignment methods for graph comparison strategies, as well as module detection approaches including seed-and-extend, hierarchical clustering, optimization-based, probabilistic, and frequent subgraph methods. Herein, we provide a comprehensive review of the major algorithms employed under each theme, including our recently published frequent subgraph method, for detecting functional modules commonly shared across multiple cancer PPI networks. PMID:24800226

  8. Quantitative ultrasonic evaluation of concrete structures using one-sided access

    NASA Astrophysics Data System (ADS)

    Khazanovich, Lev; Hoegh, Kyle

    2016-02-01

    Nondestructive diagnostics of concrete structures is an important and challenging problem. A recent introduction of array ultrasonic dry point contact transducer systems offers opportunities for quantitative assessment of the subsurface condition of concrete structures, including detection of defects and inclusions. The methods described in this paper are developed for signal interpretation of shear wave impulse response time histories from multiple fixed distance transducer pairs in a self-contained ultrasonic linear array. This included generalizing Kirchoff migration-based synthetic aperture focusing technique (SAFT) reconstruction methods to handle the spatially diverse transducer pair locations, creating expanded virtual arrays with associated reconstruction methods, and creating automated reconstruction interpretation methods for reinforcement detection and stochastic flaw detection. Interpretation of the reconstruction techniques developed in this study were validated using the results of laboratory and field forensic studies. Applicability of the developed methods for solving practical engineering problems was demonstrated.

  9. Advances in explosives analysis—part I. animal, chemical, ion, and mechanical methods

    DOE PAGES

    Brown, Kathryn E.; Greenfield, Margo T.; McGrane, Shawn D.; ...

    2015-10-13

    The number and capability of explosives detection and analysis methods have increased substantially since the publication of the Analytical and Bioanalytical Chemistry special issue devoted to Explosives Analysis (Moore and Goodpaster, Anal Bioanal Chem 395(2):245–246, 2009). We review and critically evaluate the latest (the past five years) important advances in explosives detection, with details of the improvements over previous methods, and suggest possible avenues towards further advances in, e.g., stand-off distance, detection limit, selectivity, and penetration through camouflage or packaging. The review consists of two parts. Moreover, Part I, reviews methods based on animals, chemicals (including colorimetry, molecularly imprinted polymers,more » electrochemistry, and immunochemistry), ions (both ion-mobility spectrometry and mass spectrometry), and mechanical devices. Part II will review methods based on photons, from very energetic photons including X-rays and gamma rays down to the terahertz range, and neutrons.« less

  10. Detection methods and performance criteria for genetically modified organisms.

    PubMed

    Bertheau, Yves; Diolez, Annick; Kobilinsky, André; Magin, Kimberly

    2002-01-01

    Detection methods for genetically modified organisms (GMOs) are necessary for many applications, from seed purity assessment to compliance of food labeling in several countries. Numerous analytical methods are currently used or under development to support these needs. The currently used methods are bioassays and protein- and DNA-based detection protocols. To avoid discrepancy of results between such largely different methods and, for instance, the potential resulting legal actions, compatibility of the methods is urgently needed. Performance criteria of methods allow evaluation against a common standard. The more-common performance criteria for detection methods are precision, accuracy, sensitivity, and specificity, which together specifically address other terms used to describe the performance of a method, such as applicability, selectivity, calibration, trueness, precision, recovery, operating range, limit of quantitation, limit of detection, and ruggedness. Performance criteria should provide objective tools to accept or reject specific methods, to validate them, to ensure compatibility between validated methods, and be used on a routine basis to reject data outside an acceptable range of variability. When selecting a method of detection, it is also important to consider its applicability, its field of applications, and its limitations, by including factors such as its ability to detect the target analyte in a given matrix, the duration of the analyses, its cost effectiveness, and the necessary sample sizes for testing. Thus, the current GMO detection methods should be evaluated against a common set of performance criteria.

  11. Efficacy of brown sugar flotation and hot water methods for detecting Rhagoletis indifferens (Dipt., Tephritidae) larvae

    USDA-ARS?s Scientific Manuscript database

    The brown sugar flotation and hot water methods are accepted procedures for detecting larval western cherry fruit fly, Rhagoletis indifferens Curran, in sweet cherry [Prunus avium (L.) L.] and could be included in a systems approach for showing the absence of larvae in fruit. The methods require cr...

  12. Light Scattering based detection of food pathogens

    USDA-ARS?s Scientific Manuscript database

    The current methods for detecting foodborne pathogens are mostly destructive (i.e., samples need to be pretreated), and require time, personnel, and laboratories for analyses. Optical methods including light scattering based techniques have gained a lot of attention recently due to its their rapid a...

  13. GMDD: a database of GMO detection methods.

    PubMed

    Dong, Wei; Yang, Litao; Shen, Kailin; Kim, Banghyun; Kleter, Gijs A; Marvin, Hans J P; Guo, Rong; Liang, Wanqi; Zhang, Dabing

    2008-06-04

    Since more than one hundred events of genetically modified organisms (GMOs) have been developed and approved for commercialization in global area, the GMO analysis methods are essential for the enforcement of GMO labelling regulations. Protein and nucleic acid-based detection techniques have been developed and utilized for GMOs identification and quantification. However, the information for harmonization and standardization of GMO analysis methods at global level is needed. GMO Detection method Database (GMDD) has collected almost all the previous developed and reported GMOs detection methods, which have been grouped by different strategies (screen-, gene-, construct-, and event-specific), and also provide a user-friendly search service of the detection methods by GMO event name, exogenous gene, or protein information, etc. In this database, users can obtain the sequences of exogenous integration, which will facilitate PCR primers and probes design. Also the information on endogenous genes, certified reference materials, reference molecules, and the validation status of developed methods is included in this database. Furthermore, registered users can also submit new detection methods and sequences to this database, and the newly submitted information will be released soon after being checked. GMDD contains comprehensive information of GMO detection methods. The database will make the GMOs analysis much easier.

  14. Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2000-01-01

    A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

  15. Protocol for Detection of Yersinia pestis in Environmental ...

    EPA Pesticide Factsheets

    Methods Report This is the first ever open-access and detailed protocol available to all government departments and agencies, and their contractors to detect Yersinia pestis, the pathogen that causes plague, from multiple environmental sample types including water. Each analytical method includes sample processing procedure for each sample type in a step-by-step manner. It includes real-time PCR, traditional microbiological culture, and the Rapid Viability PCR (RV-PCR) analytical methods. For large volume water samples it also includes an ultra-filtration-based sample concentration procedure. Because of such a non-restrictive availability of this protocol to all government departments and agencies, and their contractors, the nation will now have increased laboratory capacity to analyze large number of samples during a wide-area plague incident.

  16. Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy

    PubMed Central

    Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

    2017-01-01

    This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy. PMID:29160812

  17. Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy.

    PubMed

    Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

    2017-11-21

    This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy.

  18. Method and system for detecting a failure or performance degradation in a dynamic system such as a flight vehicle

    NASA Technical Reports Server (NTRS)

    Miller, Robert H. (Inventor); Ribbens, William B. (Inventor)

    2003-01-01

    A method and system for detecting a failure or performance degradation in a dynamic system having sensors for measuring state variables and providing corresponding output signals in response to one or more system input signals are provided. The method includes calculating estimated gains of a filter and selecting an appropriate linear model for processing the output signals based on the input signals. The step of calculating utilizes one or more models of the dynamic system to obtain estimated signals. The method further includes calculating output error residuals based on the output signals and the estimated signals. The method also includes detecting one or more hypothesized failures or performance degradations of a component or subsystem of the dynamic system based on the error residuals. The step of calculating the estimated values is performed optimally with respect to one or more of: noise, uncertainty of parameters of the models and un-modeled dynamics of the dynamic system which may be a flight vehicle or financial market or modeled financial system.

  19. Detection of delamination defects in CFRP materials using ultrasonic signal processing.

    PubMed

    Benammar, Abdessalem; Drai, Redouane; Guessoum, Abderrezak

    2008-12-01

    In this paper, signal processing techniques are tested for their ability to resolve echoes associated with delaminations in carbon fiber-reinforced polymer multi-layered composite materials (CFRP) detected by ultrasonic methods. These methods include split spectrum processing (SSP) and the expectation-maximization (EM) algorithm. A simulation study on defect detection was performed, and results were validated experimentally on CFRP with and without delamination defects taken from aircraft. Comparison of the methods for their ability to resolve echoes are made.

  20. Improved epileptic seizure detection combining dynamic feature normalization with EEG novelty detection.

    PubMed

    Bogaarts, J G; Hilkman, D M W; Gommer, E D; van Kranen-Mastenbroek, V H J M; Reulen, J P H

    2016-12-01

    Continuous electroencephalographic monitoring of critically ill patients is an established procedure in intensive care units. Seizure detection algorithms, such as support vector machines (SVM), play a prominent role in this procedure. To correct for inter-human differences in EEG characteristics, as well as for intra-human EEG variability over time, dynamic EEG feature normalization is essential. Recently, the median decaying memory (MDM) approach was determined to be the best method of normalization. MDM uses a sliding baseline buffer of EEG epochs to calculate feature normalization constants. However, while this method does include non-seizure EEG epochs, it also includes EEG activity that can have a detrimental effect on the normalization and subsequent seizure detection performance. In this study, EEG data that is to be incorporated into the baseline buffer are automatically selected based on a novelty detection algorithm (Novelty-MDM). Performance of an SVM-based seizure detection framework is evaluated in 17 long-term ICU registrations using the area under the sensitivity-specificity ROC curve. This evaluation compares three different EEG normalization methods, namely a fixed baseline buffer (FB), the median decaying memory (MDM) approach, and our novelty median decaying memory (Novelty-MDM) method. It is demonstrated that MDM did not improve overall performance compared to FB (p < 0.27), partly because seizure like episodes were included in the baseline. More importantly, Novelty-MDM significantly outperforms both FB (p = 0.015) and MDM (p = 0.0065).

  1. Detection of Salmonella spp. and Listeria monocytogenes in Suspended Organic Waste by Nucleic Acid Extraction and PCR

    PubMed Central

    Burtscher, Carola; Fall, Papa A.; Wilderer, Peter A.; Wuertz, Stefan

    1999-01-01

    A nucleic acid-based method for the detection of the bacterial pathogens Salmonella spp. and Listeria monocytogenes in biological waste was developed. The detection limits were less than 10 cells per ml of biological waste. The method does not include a phenol extraction step and can be easily performed in 1 to 2 days. PMID:10224026

  2. Methods and systems for remote detection of gases

    DOEpatents

    Johnson, Timothy J.

    2007-11-27

    Novel systems and methods for remotely detecting at least one constituent of a gas via infrared detection are provided. A system includes at least one extended source of broadband infrared radiation and a spectrally sensitive receiver positioned remotely from the source. The source and the receiver are oriented such that a surface of the source is in the field of view of the receiver. The source includes a heating component thermally coupled to the surface, and the heating component is configured to heat the surface to a temperature above ambient temperature. The receiver is operable to collect spectral infrared absorption data representative of a gas present between the source and the receiver. The invention advantageously overcomes significant difficulties associated with active infrared detection techniques known in the art, and provides an infrared detection technique with a much greater sensitivity than passive infrared detection techniques known in the art.

  3. Methods and systems for remote detection of gases

    DOEpatents

    Johnson, Timothy J

    2012-09-18

    Novel systems and methods for remotely detecting at least one constituent of a gas via infrared detection are provided. A system includes at least one extended source of broadband infrared radiation and a spectrally sensitive receiver positioned remotely from the source. The source and the receiver are oriented such that a surface of the source is in the field of view of the receiver. The source includes a heating component thermally coupled to the surface, and the heating component is configured to heat the surface to a temperature above ambient temperature. The receiver is operable to collect spectral infrared absorption data representative of a gas present between the source and the receiver. The invention advantageously overcomes significant difficulties associated with active infrared detection techniques known in the art, and provides an infrared detection technique with a much greater sensitivity than passive infrared detection techniques known in the art.

  4. Critical considerations for the application of environmental DNA methods to detect aquatic species

    USGS Publications Warehouse

    Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre

    2016-01-01

    Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.

  5. [Extraction method suitable for detection of unheated crustaceans including cephalothorax by ELISA].

    PubMed

    Shibahara, Yusuke; Yamada, Itta; Uesaka, Yoshihiko; Uneo, Noriko; Abe, Akihisa; Ohashi, Eiji; Shiomi, Kazuo

    2009-08-01

    When unheated whole samples of crustaceans (shrimp, prawn and crab) were analyzed with our ELISA kit (FA test EIA-Crustacean 'Nissui') using anti-tropomyosin antibodies, a remarkable reduction in reactivity was recognized. This reduction in activity was found to be due to the digestion of tropomyosin during the extraction process by proteases contained in cephalothorax. To avoid the digestion of tropomyosin by proteases, we developed an extraction method (heating method) suitable for the detection of tropomyosin in unheated crustaceans including cephalothorax. Experiments with unheated whole samples of various species of crustaceans confirmed that the heating method greatly improved the low reactivity in the standard method; the heating method gave extraction efficiencies of as high as 93-107%. Various processed crustaceans with cephalothorax, such as dry products (unheated or weakly heated products) and pickles in soy sauce (unheated products), that showed low reactivity with the standard method were confirmed to give superior results with the heating method. These results indicated that the developed heating method is suitable for detecting unheated crustaceans with cephalothorax by means of the ELISA kit.

  6. Methods for using redox liposome biosensors

    DOEpatents

    Cheng, Quan; Stevens, Raymond C.

    2002-01-01

    The present invention provides methods and compositions for detecting the presence of biologically-important analytes by using redox liposome biosensors. In particular, the present invention provides liposome/sol-gel electrodes suitable for the detection of a wide variety of organic molecules, including but not limited to bacterial toxins.

  7. Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

    PubMed

    Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

    2013-12-01

    Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Automatic detection of retina disease: robustness to image quality and localization of anatomy structure.

    PubMed

    Karnowski, T P; Aykac, D; Giancardo, L; Li, Y; Nichols, T; Tobin, K W; Chaum, E

    2011-01-01

    The automated detection of diabetic retinopathy and other eye diseases in images of the retina has great promise as a low-cost method for broad-based screening. Many systems in the literature which perform automated detection include a quality estimation step and physiological feature detection, including the vascular tree and the optic nerve / macula location. In this work, we study the robustness of an automated disease detection method with respect to the accuracy of the optic nerve location and the quality of the images obtained as judged by a quality estimation algorithm. The detection algorithm features microaneurysm and exudate detection followed by feature extraction on the detected population to describe the overall retina image. Labeled images of retinas ground-truthed to disease states are used to train a supervised learning algorithm to identify the disease state of the retina image and exam set. Under the restrictions of high confidence optic nerve detections and good quality imagery, the system achieves a sensitivity and specificity of 94.8% and 78.7% with area-under-curve of 95.3%. Analysis of the effect of constraining quality and the distinction between mild non-proliferative diabetic retinopathy, normal retina images, and more severe disease states is included.

  9. Multi-laboratory evaluations of the performance of Catellicoccus marimammalium PCR assays developed to target gull fecal sources

    USGS Publications Warehouse

    Sinigalliano, Christopher D.; Ervin, Jared S.; Van De Werfhorst, Laurie C.; Badgley, Brian D.; Ballestée, Elisenda; Bartkowiaka, Jakob; Boehm, Alexandria B.; Byappanahalli, Muruleedhara N.; Goodwin, Kelly D.; Gourmelon, Michèle; Griffith, John; Holden, Patricia A.; Jay, Jenny; Layton, Blythe; Lee, Cheonghoon; Lee, Jiyoung; Meijer, Wim G.; Noble, Rachel; Raith, Meredith; Ryu, Hodon; Sadowsky, Michael J.; Schriewer, Alexander; Wang, Dan; Wanless, David; Whitman, Richard; Wuertz, Stefan; Santo Domingo, Jorge W.

    2013-01-01

    Here we report results from a multi-laboratory (n = 11) evaluation of four different PCR methods targeting the 16S rRNA gene of Catellicoccus marimammalium originally developed to detect gull fecal contamination in coastal environments. The methods included a conventional end-point PCR method, a SYBR® Green qPCR method, and two TaqMan® qPCR methods. Different techniques for data normalization and analysis were tested. Data analysis methods had a pronounced impact on assay sensitivity and specificity calculations. Across-laboratory standardization of metrics including the lower limit of quantification (LLOQ), target detected but not quantifiable (DNQ), and target not detected (ND) significantly improved results compared to results submitted by individual laboratories prior to definition standardization. The unit of measure used for data normalization also had a pronounced effect on measured assay performance. Data normalization to DNA mass improved quantitative method performance as compared to enterococcus normalization. The MST methods tested here were originally designed for gulls but were found in this study to also detect feces from other birds, particularly feces composited from pigeons. Sequencing efforts showed that some pigeon feces from California contained sequences similar to C. marimammalium found in gull feces. These data suggest that the prevalence, geographic scope, and ecology of C. marimammalium in host birds other than gulls require further investigation. This study represents an important first step in the multi-laboratory assessment of these methods and highlights the need to broaden and standardize additional evaluations, including environmentally relevant target concentrations in ambient waters from diverse geographic regions.

  10. Method modification of the Legipid® Legionella fast detection test kit.

    PubMed

    Albalat, Guillermo Rodríguez; Broch, Begoña Bedrina; Bono, Marisa Jiménez

    2014-01-01

    Legipid(®) Legionella Fast Detection is a test based on combined magnetic immunocapture and enzyme-immunoassay (CEIA) for the detection of Legionella in water. The test is based on the use of anti-Legionella antibodies immobilized on magnetic microspheres. Target microorganism is preconcentrated by filtration. Immunomagnetic analysis is applied on these preconcentrated water samples in a final test portion of 9 mL. The test kit was certified by the AOAC Research Institute as Performance Tested Method(SM) (PTM) No. 111101 in a PTM validation which certifies the performance claims of the test method in comparison to the ISO reference method 11731-1998 and the revision 11731-2004 "Water Quality: Detection and Enumeration of Legionella pneumophila" in potable water, industrial water, and waste water. The modification of this test kit has been approved. The modification includes increasing the target analyte from L. pneumophila to Legionella species and adding an optical reader to the test method. In this study, 71 strains of Legionella spp. other than L. pneumophila were tested to determine its reactivity with the kit based on CEIA. All the strains of Legionella spp. tested by the CEIA test were confirmed positive by reference standard method ISO 11731. This test (PTM 111101) has been modified to include a final optical reading. A methods comparison study was conducted to demonstrate the equivalence of this modification to the reference culture method. Two water matrixes were analyzed. Results show no statistically detectable difference between the test method and the reference culture method for the enumeration of Legionella spp. The relative level of detection was 93 CFU/volume examined (LOD50). For optical reading, the LOD was 40 CFU/volume examined and the LOQ was 60 CFU/volume examined. Results showed that the test Legipid Legionella Fast Detection is equivalent to the reference culture method for the enumeration of Legionella spp.

  11. Novel methods for detecting buried explosive devices

    NASA Astrophysics Data System (ADS)

    Kercel, Stephen W.; Burlage, Robert S.; Patek, David R.; Smith, Cyrus M.; Hibbs, Andrew D.; Rayner, Timothy J.

    1997-07-01

    Oak Ridge National Laboratory and Quantum Magnetics, Inc. are exploring novel landmine detection technologies. Technologies considered here include bioreporter bacteria, swept acoustic resonance, nuclear quadrupole resonance (NQR), and semiotic data fusion. Bioreporter bacteria look promising for third-world humanitarian applications; they are inexpensive, and deployment does not require high-tech methods. Swept acoustic resonance may be a useful adjunct to magnetometers in humanitarian demining. For military demining, NQR is a promising method for detecting explosive substances; of 50,000 substances that have been tested, one has an NQR signature that can be mistaken for RDX or TNT. For both military and commercial demining, sensor fusion entails two daunting tasks, identifying fusible features in both present-day and emerging technologies, and devising a fusion algorithm that runs in real-time on cheap hardware. Preliminary research in these areas is encouraging. A bioreporter bacterium for TNT detection is under development. Investigation has just started in swept acoustic resonance as an approach to a cheap mine detector for humanitarian use. Real-time wavelet processing appears to be a key to extending NQR bomb detection into mine detection, including TNT-based mines. Recent discoveries in semiotics may be the breakthrough that will lead to a robust fused detection scheme.

  12. An improved EMD method for modal identification and a combined static-dynamic method for damage detection

    NASA Astrophysics Data System (ADS)

    Yang, Jinping; Li, Peizhen; Yang, Youfa; Xu, Dian

    2018-04-01

    Empirical mode decomposition (EMD) is a highly adaptable signal processing method. However, the EMD approach has certain drawbacks, including distortions from end effects and mode mixing. In the present study, these two problems are addressed using an end extension method based on the support vector regression machine (SVRM) and a modal decomposition method based on the characteristics of the Hilbert transform. The algorithm includes two steps: using the SVRM, the time series data are extended at both endpoints to reduce the end effects, and then, a modified EMD method using the characteristics of the Hilbert transform is performed on the resulting signal to reduce mode mixing. A new combined static-dynamic method for identifying structural damage is presented. This method combines the static and dynamic information in an equilibrium equation that can be solved using the Moore-Penrose generalized matrix inverse. The combination method uses the differences in displacements of the structure with and without damage and variations in the modal force vector. Tests on a four-story, steel-frame structure were conducted to obtain static and dynamic responses of the structure. The modal parameters are identified using data from the dynamic tests and improved EMD method. The new method is shown to be more accurate and effective than the traditional EMD method. Through tests with a shear-type test frame, the higher performance of the proposed static-dynamic damage detection approach, which can detect both single and multiple damage locations and the degree of the damage, is demonstrated. For structures with multiple damage, the combined approach is more effective than either the static or dynamic method. The proposed EMD method and static-dynamic damage detection method offer improved modal identification and damage detection, respectively, in structures.

  13. A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

    PubMed

    Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

    2015-03-01

    A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

  14. A Review of Transmission Diagnostics Research at NASA Lewis Research Center

    NASA Technical Reports Server (NTRS)

    Zakajsek, James J.

    1994-01-01

    This paper presents a summary of the transmission diagnostics research work conducted at NASA Lewis Research Center over the last four years. In 1990, the Transmission Health and Usage Monitoring Research Team at NASA Lewis conducted a survey to determine the critical needs of the diagnostics community. Survey results indicated that experimental verification of gear and bearing fault detection methods, improved fault detection in planetary systems, and damage magnitude assessment and prognostics research were all critical to a highly reliable health and usage monitoring system. In response to this, a variety of transmission fault detection methods were applied to experimentally obtained fatigue data. Failure modes of the fatigue data include a variety of gear pitting failures, tooth wear, tooth fracture, and bearing spalling failures. Overall results indicate that, of the gear fault detection techniques, no one method can successfully detect all possible failure modes. The more successful methods need to be integrated into a single more reliable detection technique. A recently developed method, NA4, in addition to being one of the more successful gear fault detection methods, was also found to exhibit damage magnitude estimation capabilities.

  15. Interlaboratory validation of an improved U.S. Food and Drug Administration method for detection of Cyclospora cayetanensis in produce using TaqMan real-time PCR

    USDA-ARS?s Scientific Manuscript database

    A collaborative validation study was performed to evaluate the performance of a new U.S. Food and Drug Administration method developed for detection of the protozoan parasite, Cyclospora cayetanensis, on cilantro and raspberries. The method includes a sample preparation step in which oocysts are re...

  16. Optimization and evaluation of a method to detect adenoviruses in river water

    EPA Pesticide Factsheets

    This dataset includes the recoveries of spiked adenovirus through various stages of experimental optimization procedures. This dataset is associated with the following publication:McMinn , B., A. Korajkic, and A. Grimm. Optimization and evaluation of a method to detect adenoviruses in river water. JOURNAL OF VIROLOGICAL METHODS. Elsevier Science Ltd, New York, NY, USA, 231(1): 8-13, (2016).

  17. Comparison of Computed Tomography and Chest Radiography in the Detection of Rib Fractures in Abused Infants

    ERIC Educational Resources Information Center

    Wootton-Gorges, Sandra L.; Stein-Wexler, Rebecca; Walton, John W.; Rosas, Angela J.; Coulter, Kevin P.; Rogers, Kristen K.

    2008-01-01

    Purpose: Chest radiographs (CXR) are the standard method for evaluating rib fractures in abused infants. Computed tomography (CT) is a sensitive method to detect rib fractures. The purpose of this study was to compare CT and CXR in the evaluation of rib fractures in abused infants. Methods: This retrospective study included all 12 abused infants…

  18. Detection of J-coupling using atomic magnetometer

    DOEpatents

    Ledbetter, Micah P.; Crawford, Charles W.; Wemmer, David E.; Pines, Alexander; Knappe, Svenja; Kitching, John; Budker, Dmitry

    2015-09-22

    An embodiment of a method of detecting a J-coupling includes providing a polarized analyte adjacent to a vapor cell of an atomic magnetometer; and measuring one or more J-coupling parameters using the atomic magnetometer. According to an embodiment, measuring the one or more J-coupling parameters includes detecting a magnetic field created by the polarized analyte as the magnetic field evolves under a J-coupling interaction.

  19. Method and system for detecting explosives

    DOEpatents

    Reber, Edward L [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID; Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Derr, Kurt W [Idaho Falls, ID

    2009-03-10

    A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.

  20. Explosives detection system and method

    DOEpatents

    Reber, Edward L.; Jewell, James K.; Rohde, Kenneth W.; Seabury, Edward H.; Blackwood, Larry G.; Edwards, Andrew J.; Derr, Kurt W.

    2007-12-11

    A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.

  1. Dosimeter and method for using the same

    DOEpatents

    Warner, Benjamin P.; Johns, Deidre M.

    2003-06-24

    A very sensitive dosimeter that detects ionizing radiation is described. The dosimeter includes a breakable sealed container. A solution of a reducing agent is inside the container. The dosimeter has an air-tight dosimeter body with a transparent portion and an opaque portion. The transparent portion includes a transparent chamber that holds the breakable container with the reducing agent. The opaque portion includes an opaque chamber that holds an emulsion of silver salt (AgX) selected from silver chloride, silver bromide, silver iodide, and combinations of them. A passageway in the dosimeter provides fluid communication between the transparent chamber and the opaque chamber. The dosimeter may also include a chemical pH indicator in the breakable container that provides a detectable color change to the solution for a pH of about 3-10. The invention also includes a method of detecting ionizing radiation that involves producing the dosimeter, breaking the breakable container, allowing the solution to flow through the passageway and contact the emulsion, detecting any color change in the solution and using the color change to determine a radiation dosage.

  2. Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

    PubMed

    Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

    2018-04-27

    The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

  3. ORD research and results using biological end points to detect exposures to contaminants of emerging concern

    EPA Science Inventory

    For the past nine years the Ecological Exposure Research Division (EERD) has been developing methods for the assessment of EDCs and other contaminants of emerging concern (CECs). These methods include genomic techniques for detecting the presence and potential exposure to human p...

  4. Automated detection of retinal nerve fiber layer defects on fundus images: false positive reduction based on vessel likelihood

    NASA Astrophysics Data System (ADS)

    Muramatsu, Chisako; Ishida, Kyoko; Sawada, Akira; Hatanaka, Yuji; Yamamoto, Tetsuya; Fujita, Hiroshi

    2016-03-01

    Early detection of glaucoma is important to slow down or cease progression of the disease and for preventing total blindness. We have previously proposed an automated scheme for detection of retinal nerve fiber layer defect (NFLD), which is one of the early signs of glaucoma observed on retinal fundus images. In this study, a new multi-step detection scheme was included to improve detection of subtle and narrow NFLDs. In addition, new features were added to distinguish between NFLDs and blood vessels, which are frequent sites of false positives (FPs). The result was evaluated with a new test dataset consisted of 261 cases, including 130 cases with NFLDs. Using the proposed method, the initial detection rate was improved from 82% to 98%. At the sensitivity of 80%, the number of FPs per image was reduced from 4.25 to 1.36. The result indicates the potential usefulness of the proposed method for early detection of glaucoma.

  5. Methods for detection of GMOs in food and feed.

    PubMed

    Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

    2008-10-01

    This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

  6. Means and method for capillary zone electrophoresis with laser-induced indirect fluorescence detection

    DOEpatents

    Yeung, Edward S.; Kuhr, Werner G.

    1996-02-20

    A means and method for capillary zone electrphoresis with laser-induced indirect fluorescence detection. A detector is positioned on the capillary tube of a capillary zone electrophoresis system. The detector includes a laser which generates a laser beam which is imposed upon a small portion of the capillary tube. Fluorescence of the elutant electromigrating through the capillary tube is indirectly detected and recorded.

  7. Means and method for capillary zone electrophoresis with laser-induced indirect fluorescence detection

    DOEpatents

    Yeung, Edwards; Kuhr, Werner G.

    1991-04-09

    A means and method for capillary zone electrphoresis with laser-induced indirect fluorescence detection. A detector is positioned on the capillary tube of a capillary zone electrophoresis system. The detector includes a laser which generates a laser beam which is imposed upon a small portion of the capillary tube. Fluorescence of the elutant electromigrating through the capillary tube is indirectly detected and recorded.

  8. How to detect carbapenemase producers? A literature review of phenotypic and molecular methods.

    PubMed

    Hammoudi, D; Moubareck, C Ayoub; Sarkis, D Karam

    2014-12-01

    This review describes the current state-of-art of carbapenemase detection methods. Identification of carbapenemases is first based on conventional phenotypic tests including antimicrobial susceptibility testing, modified-Hodge test and carbapenemase-inhibitor culture tests. Second, molecular characterization of carbapenemase genes by PCR sequencing is essential. Third, innovative biochemical and spectrometric detection may be applied. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Method of Fault Detection and Rerouting

    NASA Technical Reports Server (NTRS)

    Gibson, Tracy L. (Inventor); Medelius, Pedro J. (Inventor); Lewis, Mark E. (Inventor)

    2013-01-01

    A system and method for detecting damage in an electrical wire, including delivering at least one test electrical signal to an outer electrically conductive material in a continuous or non-continuous layer covering an electrically insulative material layer that covers an electrically conductive wire core. Detecting the test electrical signals in the outer conductive material layer to obtain data that is processed to identify damage in the outer electrically conductive material layer.

  10. Detection of fatigue cracks by nondestructive testing methods

    NASA Technical Reports Server (NTRS)

    Anderson, R. T.; Delacy, T. J.; Stewart, R. C.

    1973-01-01

    The effectiveness was assessed of various NDT methods to detect small tight cracks by randomly introducing fatigue cracks into aluminum sheets. The study included optimizing NDT methods calibrating NDT equipment with fatigue cracked standards, and evaluating a number of cracked specimens by the optimized NDT methods. The evaluations were conducted by highly trained personnel, provided with detailed procedures, in order to minimize the effects of human variability. These personnel performed the NDT on the test specimens without knowledge of the flaw locations and reported on the flaws detected. The performance of these tests was measured by comparing the flaws detected against the flaws present. The principal NDT methods utilized were radiographic, ultrasonic, penetrant, and eddy current. Holographic interferometry, acoustic emission monitoring, and replication methods were also applied on a reduced number of specimens. Generally, the best performance was shown by eddy current, ultrasonic, penetrant and holographic tests. Etching provided no measurable improvement, while proof loading improved flaw detectability. Data are shown that quantify the performances of the NDT methods applied.

  11. Biomarkers for liver fibrosis

    DOEpatents

    Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel

    2017-05-16

    Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.

  12. Biomarkers for liver fibrosis

    DOEpatents

    Jacobs, Jon M.; Burnum-Johnson, Kristin E.; Baker, Erin M.; Smith, Richard D.; Gritsenko, Marina A.; Orton, Daniel

    2015-09-15

    Methods and systems for diagnosing or prognosing liver fibrosis in a subject are provided. In some examples, such methods and systems can include detecting liver fibrosis-related molecules in a sample obtained from the subject, comparing expression of the molecules in the sample to controls representing expression values expected in a subject who does not have liver fibrosis or who has non-progressing fibrosis, and diagnosing or prognosing liver fibrosis in the subject when differential expression of the molecules between the sample and the controls is detected. Kits for the diagnosis or prognosis of liver fibrosis in a subject are also provided which include reagents for detecting liver fibrosis related molecules.

  13. Intraoperative Identification of the Parathyroid Gland with a Fluorescence Detection System.

    PubMed

    Shinden, Yoshiaki; Nakajo, Akihiro; Arima, Hideo; Tanoue, Kiyonori; Hirata, Munetsugu; Kijima, Yuko; Maemura, Kosei; Natsugoe, Shoji

    2017-06-01

    Intraoperative identification of the difficult-to-spot parathyroid gland is critical during surgery for thyroid and parathyroid disease. Recently, intrinsic fluorescence of the parathyroid gland was identified, and a new method was developed for intraoperative detection of the parathyroid with an original fluorescent detection apparatus. Here, we describe a method for intraoperative detection of the parathyroid using a ready-made photodynamic eye (PDE) system without any fluorescent dye or contrast agents. Seventeen patients who underwent surgical treatment for thyroid or parathyroid disease at Kagoshima University Hospital were enrolled in this study. Intrinsic fluorescence of various tissues was detected with the PDE system. Intraoperative in vivo and ex vivo intrinsic fluorescence of the parathyroid, thyroid, lymph nodes and fat tissues was measured and analyzed. The parathyroid gland had a significantly higher fluorescence intensity than the other tissues, including the thyroid glands, lymph nodes and fat tissues, and we could identify them during surgery using the fluorescence-guided method. Our method could be applicable for two intraoperative clinical procedures: ex vivo tissue identification of parathyroid tissue and in vivo identification of the location of the parathyroid gland, including ectopic glands. The PDE system may be an easy and highly feasible method to identify the parathyroid gland during surgery.

  14. Clinical evaluation of near-infrared light transillumination in approximal dentin caries detection.

    PubMed

    Ozkan, Gokhan; Guzel, Kadriye Gorkem Ulu

    2017-08-01

    The objective of this clinical study was to compare conventional caries detection techniques, pen-type laser fluorescence device, and near-infrared light transillumination method in approximal dentin caries lesions. The study included 157 patients, aged 12-18, without any cavity in the posterior teeth. Two calibrated examiners carried out the assessments of selected approximal caries sites independently. After the assessments, the unopened sites were excluded and a total of 161 approximal sites were included in the study. When both the examiners arrived at a consensus regarding the presence of dentin caries, the detected lesions were opened with a conical diamond burr, the cavity extent was examined and validated (gold standard). Sensitivity, specificity, negative predictive value, positive predictive value, accuracy, and area under the ROC curve (Az) values among the caries detection methods were calculated. Bitewing radiography and near-infrared (NIR) light transillumination methods showed the highest sensitivity (0.83-0.82) and accuracy (0.82-0.80) among the methods. Visual inspection showed the lowest sensitivity (0.54). Laser fluorescence device and visual inspection showed nearly equal performance. Near-infrared light transillumination can be used as an alternative method to approximal dentin caries detection. Visual inspection and laser fluorescence device alone should not be used for approximal dentin caries.

  15. High-resolution melting (HRM) re-analysis of a polyposis patients cohort reveals previously undetected heterozygous and mosaic APC gene mutations.

    PubMed

    Out, Astrid A; van Minderhout, Ivonne J H M; van der Stoep, Nienke; van Bommel, Lysette S R; Kluijt, Irma; Aalfs, Cora; Voorendt, Marsha; Vossen, Rolf H A M; Nielsen, Maartje; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Tops, Carli M J; Hes, Frederik J

    2015-06-01

    Familial adenomatous polyposis is most frequently caused by pathogenic variants in either the APC gene or the MUTYH gene. The detection rate of pathogenic variants depends on the severity of the phenotype and sensitivity of the screening method, including sensitivity for mosaic variants. For 171 patients with multiple colorectal polyps without previously detectable pathogenic variant, APC was reanalyzed in leukocyte DNA by one uniform technique: high-resolution melting (HRM) analysis. Serial dilution of heterozygous DNA resulted in a lowest detectable allelic fraction of 6% for the majority of variants. HRM analysis and subsequent sequencing detected pathogenic fully heterozygous APC variants in 10 (6%) of the patients and pathogenic mosaic variants in 2 (1%). All these variants were previously missed by various conventional scanning methods. In parallel, HRM APC scanning was applied to DNA isolated from polyp tissue of two additional patients with apparently sporadic polyposis and without detectable pathogenic APC variant in leukocyte DNA. In both patients a pathogenic mosaic APC variant was present in multiple polyps. The detection of pathogenic APC variants in 7% of the patients, including mosaics, illustrates the usefulness of a complete APC gene reanalysis of previously tested patients, by a supplementary scanning method. HRM is a sensitive and fast pre-screening method for reliable detection of heterozygous and mosaic variants, which can be applied to leukocyte and polyp derived DNA.

  16. Real-time anomaly detection for very short-term load forecasting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, Jian; Hong, Tao; Yue, Meng

    Although the recent load information is critical to very short-term load forecasting (VSTLF), power companies often have difficulties in collecting the most recent load values accurately and timely for VSTLF applications. This paper tackles the problem of real-time anomaly detection in most recent load information used by VSTLF. This paper proposes a model-based anomaly detection method that consists of two components, a dynamic regression model and an adaptive anomaly threshold. The case study is developed using the data from ISO New England. This paper demonstrates that the proposed method significantly outperforms three other anomaly detection methods including two methods commonlymore » used in the field and one state-of-the-art method used by a winning team of the Global Energy Forecasting Competition 2014. Lastly, a general anomaly detection framework is proposed for the future research.« less

  17. Real-time anomaly detection for very short-term load forecasting

    DOE PAGES

    Luo, Jian; Hong, Tao; Yue, Meng

    2018-01-06

    Although the recent load information is critical to very short-term load forecasting (VSTLF), power companies often have difficulties in collecting the most recent load values accurately and timely for VSTLF applications. This paper tackles the problem of real-time anomaly detection in most recent load information used by VSTLF. This paper proposes a model-based anomaly detection method that consists of two components, a dynamic regression model and an adaptive anomaly threshold. The case study is developed using the data from ISO New England. This paper demonstrates that the proposed method significantly outperforms three other anomaly detection methods including two methods commonlymore » used in the field and one state-of-the-art method used by a winning team of the Global Energy Forecasting Competition 2014. Lastly, a general anomaly detection framework is proposed for the future research.« less

  18. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

    PubMed

    Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

    2016-04-28

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

  19. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

    PubMed Central

    Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

    2016-01-01

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

  20. Three plot correlation-based small infrared target detection in dense sun-glint environment for infrared search and track

    NASA Astrophysics Data System (ADS)

    Kim, Sungho; Choi, Byungin; Kim, Jieun; Kwon, Soon; Kim, Kyung-Tae

    2012-05-01

    This paper presents a separate spatio-temporal filter based small infrared target detection method to address the sea-based infrared search and track (IRST) problem in dense sun-glint environment. It is critical to detect small infrared targets such as sea-skimming missiles or asymmetric small ships for national defense. On the sea surface, sun-glint clutters degrade the detection performance. Furthermore, if we have to detect true targets using only three images with a low frame rate camera, then the problem is more difficult. We propose a novel three plot correlation filter and statistics based clutter reduction method to achieve robust small target detection rate in dense sun-glint environment. We validate the robust detection performance of the proposed method via real infrared test sequences including synthetic targets.

  1. Neutron imaging integrated circuit and method for detecting neutrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nagarkar, Vivek V.; More, Mitali J.

    The present disclosure provides a neutron imaging detector and a method for detecting neutrons. In one example, a method includes providing a neutron imaging detector including plurality of memory cells and a conversion layer on the memory cells, setting one or more of the memory cells to a first charge state, positioning the neutron imaging detector in a neutron environment for a predetermined time period, and reading a state change at one of the memory cells, and measuring a charge state change at one of the plurality of memory cells from the first charge state to a second charge statemore » less than the first charge state, where the charge state change indicates detection of neutrons at said one of the memory cells.« less

  2. Optical methods and systems for detecting a constituent in a gas containing oxygen in harsh environments

    DOEpatents

    Carpenter, Michael A [Scotia, NY; Sirinakis, George [Bronx, NY

    2011-01-04

    A method for detecting a gas phase constituent such as carbon monoxide, nitrogen dioxide, hydrogen, or hydrocarbons in a gas comprising oxygen such as air, includes providing a sensing material or film having a metal embedded in a catalytically active matrix such as gold embedded in a yttria stabilized zirconia (YSZ) matrix. The method may include annealing the sensing material at about 900.degree. C., exposing the sensing material and gas to a temperature above 400.degree. C., projecting light onto the sensing material, and detecting a change in the absorption spectrum of the sensing material due to the exposure of the sensing material to the gas in air at the temperature which causes a chemical reaction in the sensing material compared to the absorption spectrum of the sensing material in the absence of the gas. Systems employing such a method are also disclosed.

  3. GMDD: a database of GMO detection methods

    PubMed Central

    Dong, Wei; Yang, Litao; Shen, Kailin; Kim, Banghyun; Kleter, Gijs A; Marvin, Hans JP; Guo, Rong; Liang, Wanqi; Zhang, Dabing

    2008-01-01

    Background Since more than one hundred events of genetically modified organisms (GMOs) have been developed and approved for commercialization in global area, the GMO analysis methods are essential for the enforcement of GMO labelling regulations. Protein and nucleic acid-based detection techniques have been developed and utilized for GMOs identification and quantification. However, the information for harmonization and standardization of GMO analysis methods at global level is needed. Results GMO Detection method Database (GMDD) has collected almost all the previous developed and reported GMOs detection methods, which have been grouped by different strategies (screen-, gene-, construct-, and event-specific), and also provide a user-friendly search service of the detection methods by GMO event name, exogenous gene, or protein information, etc. In this database, users can obtain the sequences of exogenous integration, which will facilitate PCR primers and probes design. Also the information on endogenous genes, certified reference materials, reference molecules, and the validation status of developed methods is included in this database. Furthermore, registered users can also submit new detection methods and sequences to this database, and the newly submitted information will be released soon after being checked. Conclusion GMDD contains comprehensive information of GMO detection methods. The database will make the GMOs analysis much easier. PMID:18522755

  4. Assessment of soil-gas contamination at the 17th Street landfill, Fort Gordon, Georgia, 2011

    USGS Publications Warehouse

    Falls, W. Fred; Caldwell, Andral W.; Guimaraes, Wladmir G.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

    2012-01-01

    Assessments of contaminants in soil gas were conducted in two study areas at Fort Gordon, Georgia, in July and August of 2011 to supplement environmental contaminant data for previous studies at the 17th Street landfill. The two study areas include northern and eastern parts of the 17th Street landfill and the adjacent wooded areas to the north and east of the landfill. These study areas were chosen because of their close proximity to the surface water in Wilkerson Lake and McCoys Creek. A total of 48 soil-gas samplers were deployed for the July 28 to August 3, 2011, assessment in the eastern study area. The assessment mostly identified detections of total petroleum hydrocarbons (TPH), and gasoline- and diesel-range compounds, but also identified the presence of chlorinated solvents in six samplers, chloroform in three samplers, 2-methyl naphthalene in one sampler, and trimethylbenzene in one sampler. The TPH masses exceeded 0.02 microgram (μg) in all 48 samplers and exceeded 0.9 μg in 24 samplers. Undecane, one of the three diesel-range compounds used to calculate the combined mass for diesel-range compounds, was detected in 17 samplers and is the second most commonly detected compound in the eastern study area, exceeded only by the number of TPH detections. Six samplers had detections of toluene, but other gasoline compounds were detected with toluene in three of the samplers, including detections of ethylbenzene, meta- and para-xylene, and octane. All detections of chlorinated organic compounds had soil-gas masses equal to or less than 0.08 μg, including three detections of trichloroethene, three detections of perchloroethene, three chloroform detections, one 1,4-dichlorobenzene detection, and one 1,1,2-trichloroethane detection. Three methylated compounds were detected in the eastern study area, but were detected at or below method detection levels. A total of 32 soil-gas samplers were deployed for the August 11–24, 2011, assessment in the northern study area. All samplers in the survey had detections of TPH, but only eight of the samplers had detections of TPH greater than 0.9 mg. Four samplers had TPH detections greater than 9 mg; the only other fuel-related compounds detected in these four samplers included toluene in three of the samplers and undecane in the fourth sampler. Three samplers deployed along the western margin of the northern landfill had detections of both diesel-and gasoline-related compounds; however, the diesel-related compounds were detected at or below method detection levels. Seven samplers in the northern study area had detections of chlorinated compounds, including three perchloroethene detections, three chloroform detections, and one 1,4-dichloro-benzene detection. One sampler on the western margin of the landfill had detections of 1,2,4-trimethylbenzene and 1,3,5-tr-methylbenene below method detection levels.

  5. Evaluation of Moving Object Detection Based on Various Input Noise Using Fixed Camera

    NASA Astrophysics Data System (ADS)

    Kiaee, N.; Hashemizadeh, E.; Zarrinpanjeh, N.

    2017-09-01

    Detecting and tracking objects in video has been as a research area of interest in the field of image processing and computer vision. This paper evaluates the performance of a novel method for object detection algorithm in video sequences. This process helps us to know the advantage of this method which is being used. The proposed framework compares the correct and wrong detection percentage of this algorithm. This method was evaluated with the collected data in the field of urban transport which include car and pedestrian in fixed camera situation. The results show that the accuracy of the algorithm will decreases because of image resolution reduction.

  6. The Changing Role of the Clinical Microbiology Laboratory in Defining Resistance in Gram-negatives.

    PubMed

    Endimiani, Andrea; Jacobs, Michael R

    2016-06-01

    The evolution of resistance in Gram-negatives has challenged the clinical microbiology laboratory to implement new methods for their detection. Multidrug-resistant strains present major challenges to conventional and new detection methods. More rapid pathogen identification and antimicrobial susceptibility testing have been developed for use directly on specimens, including fluorescence in situ hybridization tests, automated polymerase chain reaction systems, microarrays, mass spectroscopy, next-generation sequencing, and microfluidics. Review of these methods shows the advances that have been made in rapid detection of resistance in cultures, but limited progress in direct detection from specimens. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Colorimetric detection of uranium in water

    DOEpatents

    DeVol, Timothy A [Clemson, SC; Hixon, Amy E [Piedmont, SC; DiPrete, David P [Evans, GA

    2012-03-13

    Disclosed are methods, materials and systems that can be used to determine qualitatively or quantitatively the level of uranium contamination in water samples. Beneficially, disclosed systems are relatively simple and cost-effective. For example, disclosed systems can be utilized by consumers having little or no training in chemical analysis techniques. Methods generally include a concentration step and a complexation step. Uranium concentration can be carried out according to an extraction chromatographic process and complexation can chemically bind uranium with a detectable substance such that the formed substance is visually detectable. Methods can detect uranium contamination down to levels even below the MCL as established by the EPA.

  8. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

    PubMed

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  9. Highly sensitive screening method for nitroaromatic, nitramine and nitrate ester explosives by high performance liquid chromatography-atmospheric pressure ionization-mass spectrometry (HPLC-API-MS) in forensic applications.

    PubMed

    Xu, Xiaoma; van de Craats, Anick M; de Bruyn, Peter C A M

    2004-11-01

    A highly sensitive screening method based on high performance liquid chromatography atmospheric pressure ionization mass spectrometry (HPLC-API-MS) has been developed for the analysis of 21 nitroaromatic, nitramine and nitrate ester explosives, which include the explosives most commonly encountered in forensic science. Two atmospheric pressure ionization (API) methods, atmospheric pressure chemical ionization (APCI) and electrospray ionization (ESI), and various experimental conditions have been applied to allow for the detection of all 21 explosive compounds. The limit of detection (LOD) in the full-scan mode has been found to be 0.012-1.2 ng on column for the screening of most explosives investigated. For nitrobenzene, an LOD of 10 ng was found with the APCI method in the negative mode. Although the detection of nitrobenzene, 2-, 3-, and 4-nitrotoluene is hindered by the difficult ionization of these compounds, we have found that by forming an adduct with glycine, LOD values in the range of 3-16 ng on column can be achieved. Compared with previous screening methods with thermospray ionization, the API method has distinct advantages, including simplicity and stability of the method applied, an extended screening range and a low detection limit for the explosives studied.

  10. Trace level detection of analytes using artificial olfactometry

    NASA Technical Reports Server (NTRS)

    Wong, Bernard (Inventor); Munoz, Beth C. (Inventor); Lewis, Nathan S. (Inventor); Kelso, David M. (Inventor); Severin, Erik J. (Inventor)

    2001-01-01

    The present invention provides methods for detecting the presence of an analyte indicative of various medical conditions, including halitosis, periodontal disease and other diseases are also disclosed.

  11. Neutron absorption detector

    DOEpatents

    Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

    2011-05-31

    A method of detecting an activator, the method including impinging a receptor material that is not predominately water and lacks a photoluminescent material with an activator and generating Cherenkov effect light due to the activator impinging the receptor material. The method further including identifying a characteristic of the activator based on the light.

  12. New non-invasive safe, quick, economical method of detecting various cancers was found using QRS complex or rising part of T-wave of recorded ECGs. Cancers can be screened along with their biochemical parameters & therapeutic effects of any cancer treatments can be evaluated using recorded ECGs of the same individual.

    PubMed

    Omura, Yoshiaki; Lu, Dominic; O'Young, Brian; Jones, Marilyn; Nihrane, Abdallah; Duvvi, Harsha; Shimotsuura, Yasuhiro; Ohki, Motomu

    2015-01-01

    There are many methods of detecting cancers including detection of cancer markers by blood test, (which is invasive, time consuming and relatively expensive), detection of cancers by non-invasive methods such as X-Ray, CT scan, and MRI & PET Scan (which are non-invasive and quick but very expensive). Our research was performed to develop new non-invasive, safe, quick economical method of detecting cancers and the 1st author already developed for clinically important non-invasive new methods including early stage of present method using his method of localizing accurate organ representation areas of face, eyebrows, upper lip, lower lip, surface and dorsal part of the tongue, surface backs, and palm side of the hands. This accurate localization of the organ representation area of the different parts of the body was performed using electromagnetic field resonance phenomenon between 2 identical molecules or tissues based on our US patented non-invasive method in 1993. Since year 2000, we developed the following non-invasive diagnostic methods that can be quickly identified by the patented simple non-invasive method without using expensive or bulky instrument at any office or field where there is no electricity or instrument available. The following are examples of non-invasive quick method of diagnosis and treatment of cancers using different approaches: 1) Soft red laser beam scanning of different parts of body; 2) By speaking voice; 3) Visible and invisible characteristic abnormalities on different organ representation areas of the different parts of the body, and 4) Mouth, Hand, and Foot Writings of both right and left side of the body. As a consequence of our latest research, we were able to develop a simple method of detecting cancer from existing recorded electrocardiograms. In this article, we are going to describe the method and result of clinical applications on many different cancers of different organs including lung, esophagus, breast, stomach, colon, uterus, ovary, prostate gland, as well as common bone marrow related malignancies such as Hodgkin's Lymphoma, Non-Hodgkin's Lymphoma, Multiple Myeloma as well as Leukemia.

  13. Detecting low levels of radionuclides in fluids

    DOEpatents

    Patch, Keith D.; Morgan, Dean T.

    2000-01-01

    An apparatus and method for detecting low levels of one or more radionuclides in a fluid sample uses a substrate that includes an ion exchange resin or other sorbent material to collect the radionuclides. A collecting apparatus includes a collecting chamber that exposes the substrate to a measured amount of the fluid sample such that radionuclides in the fluid sample are collected by the ion exchange resin. A drying apparatus, which can include a drying chamber, then dries the substrate. A measuring apparatus measures emissions from radionuclides collected on the substrate. The substrate is positioned in a measuring chamber proximate to a detector, which provides a signal in response to emissions from the radionuclides. Other analysis methods can be used to detect non-radioactive analytes, which can be collected with other types of sorbent materials.

  14. The Main Belt Comets and ice in the Solar System

    NASA Astrophysics Data System (ADS)

    Snodgrass, Colin; Agarwal, Jessica; Combi, Michael; Fitzsimmons, Alan; Guilbert-Lepoutre, Aurelie; Hsieh, Henry H.; Hui, Man-To; Jehin, Emmanuel; Kelley, Michael S. P.; Knight, Matthew M.; Opitom, Cyrielle; Orosei, Roberto; de Val-Borro, Miguel; Yang, Bin

    2017-11-01

    We review the evidence for buried ice in the asteroid belt; specifically the questions around the so-called Main Belt Comets (MBCs). We summarise the evidence for water throughout the Solar System, and describe the various methods for detecting it, including remote sensing from ultraviolet to radio wavelengths. We review progress in the first decade of study of MBCs, including observations, modelling of ice survival, and discussion on their origins. We then look at which methods will likely be most effective for further progress, including the key challenge of direct detection of (escaping) water in these bodies.

  15. Amplification of biological targets via on-chip culture for biosensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harper, Jason C.; Edwards, Thayne L.; Carson, Bryan

    The present invention, in part, relates to methods and apparatuses for on-chip amplification and/or detection of various targets, including biological targets and any amplifiable targets. In some examples, the microculture apparatus includes a single-use, normally-closed fluidic valve that is initially maintained in the closed position by a valve element bonded to an adhesive coating. The valve is opened using a magnetic force. The valve element includes a magnetic material or metal. Such apparatuses and methods are useful for in-field or real-time detection of targets, especially in limited resource settings.

  16. Leak detection using structure-borne noise

    NASA Technical Reports Server (NTRS)

    Holland, Stephen D. (Inventor); Roberts, Ronald A. (Inventor); Chimenti, Dale E. (Inventor)

    2010-01-01

    A method for detection and location of air leaks in a pressure vessel, such as a spacecraft, includes sensing structure-borne ultrasound waveforms associated with turbulence caused by a leak from a plurality of sensors and cross correlating the waveforms to determine existence and location of the leak. Different configurations of sensors and corresponding methods can be used. An apparatus for performing the methods is also provided.

  17. Particle measurement systems and methods

    DOEpatents

    Steele, Paul T [Livermore, CA

    2011-10-04

    A system according to one embodiment includes a light source for generating light fringes; a sampling mechanism for directing a particle through the light fringes; and at least one light detector for detecting light scattered by the particle as the particle passes through the light fringes. A method according to one embodiment includes generating light fringes using a light source; directing a particle through the light fringes; and detecting light scattered by the particle as the particle passes through the light fringes using at least one light detector.

  18. Fluorescent microplate assay method for high-throughput detection of lipase transesterification activity.

    PubMed

    Zheng, Jianyong; Wei, Wei; Lan, Xing; Zhang, Yinjun; Wang, Zhao

    2018-05-15

    This study describes a sensitive and fluorescent microplate assay method to detect lipase transesterification activity. Lipase-catalyzed transesterification between butyryl 4-methyl umbelliferone (Bu-4-Mu) and methanol in tert-butanol was selected as the model reaction. The release of 4-methylumbelliferone (4-Mu) in the reaction was determined by detecting the fluorescence intensity at λ ex 330 nm and λ em 390 nm. Several lipases were used to investigate the accuracy and efficiency of the proposed method. Apparent Michaelis constant (Km) was calculated for transesterification between Bu-4-Mu and methanol by the lipases. The main advantages of the assay method include high sensitivity, inexpensive reagents, and simple detection process. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  20. Positron emission imaging device and method of using the same

    DOEpatents

    Bingham, Philip R.; Mullens, James Allen

    2013-01-15

    An imaging system and method of imaging are disclosed. The imaging system can include an external radiation source producing pairs of substantially simultaneous radiation emissions of a picturization emission and a verification emissions at an emission angle. The imaging system can also include a plurality of picturization sensors and at least one verification sensor for detecting the picturization and verification emissions, respectively. The imaging system also includes an object stage is arranged such that a picturization emission can pass through an object supported on said object stage before being detected by one of said plurality of picturization sensors. A coincidence system and a reconstruction system can also be included. The coincidence can receive information from the picturization and verification sensors and determine whether a detected picturization emission is direct radiation or scattered radiation. The reconstruction system can produce a multi-dimensional representation of an object imaged with the imaging system.

  1. [Isolation and identification of Cronobacter (Enterobacter sakazakii) strains from food].

    PubMed

    Dong, Xiaohui; Li, Chengsi; Wu, Qingping; Zhang, Jumei; Mo, Shuping; Guo, Weipeng; Yang, Xiaojuan; Xu, Xiaoke

    2013-05-04

    This study aimed to detect and quantify Cronobacter in 300 powdered milk samples and 50 non-powdered milk samples. Totally, 24 Cronobacter (formerly Enterobacter sakazakii) strains isolated from powdered milk and other foods were identified and confirmed. Cronobacter strains were detected quantitatively using most probable number (MPN) method and molecular detection method. We identified 24 Cronobacter strains using biochemical patterns, including indole production and dulcitol, malonate, melezitose, turanose, and myo-Inositol utilization. Of the 24 strains, their 16S rRNA genes were sequenced, and constructed phylogenetic tree by N-J (Neighbour-Joining) with the 16S rRNA gene sequences of 17 identified Cronobacter strains and 10 non-Cronobacter strains. Quantitative detection showed that Cronobacter strains were detected in 23 out of 350 samples yielding 6.6% detection rate. Twenty-four Cronobacter strains were isolated from 23 samples and the Cronobacter was more than 100 MPN/100g in 4 samples out of 23 samples. The 24 Cronobacter spp. isolates strains were identified and confirmed, including 19 Cronobacter sakazakii strains, 2 C. malonaticus strains, 2 C. dubliensis subsp. lactaridi strains, and 1 C. muytjensii strain. The combination of molecular detection method and most probable number (MPN) method could be suitable for the detection of Cronobacter in powdered milk, with low rate of contamination and high demand of quantitative detection. 24 isolated strains were confirmed and identified by biochemical patterns and molecular technology, and C. sakazakii could be the dominant species. The problem of Cronobacter in powdered milk should be a hidden danger to nurseling, and should catch the government and consumer's attention.

  2. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

  3. Method and compositions for detecting of bloodstains using fluorescin-fluorescein reaction

    DOEpatents

    Di Benedetto, John; Kyle, Kevin; Boan, Terry; Marie, Charlene

    2004-02-17

    A method, compositions and kit are set forth for detecting blood stains. A reactant solution includes fluorescin solubilized (reduced) in acetic acid in ethanol. The solution may be buffered to a pH of approximately 9. After spraying the reactant solution on the suspected area an oxidizer is applied to promote the fluorescin to fluorescein reaction with the blood. The reacted fluorescein is then detected through luminescence for capture by photography.

  4. VIDAS Listeria species Xpress (LSX).

    PubMed

    Johnson, Ronald; Mills, John

    2013-01-01

    The AOAC GovVal study compared the VIDAS Listeria species Xpress (LSX) to the Health Products and Food Branch MFHPB-30 reference method for detection of Listeria on stainless steel. The LSX method utilizes a novel and proprietary enrichment media, Listeria Xpress broth, enabling detection of Listeria species in environmental samples with the automated VIDAS in a minimum of 26 h. The LSX method also includes the use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LSX presumptive results. In previous AOAC validation studies comparing VIDAS LSX to the U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA-BAM) and the U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) reference methods, the LSX method was approved as AOAC Official Method 2010.02 for the detection of Listeria species in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry, and as AOAC Performance Tested Method 100501 in a variety of foods and on environmental surfaces. The GovVal comparative study included 20 replicate test portions each at two contamination levels for stainless steel where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. In the stainless steel artificially contaminated surface study, there were 25 confirmed positives by the VIDAS LSX assay and 22 confirmed positives by the standard culture methods. Chi-square analysis indicated no statistical differences between the VIDAS LSX method and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LSX results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data in this study demonstrate that the VIDAS LSX method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of Listeria species on stainless steel.

  5. EFFECTS OF SEEDING PROCEDURES AND WATER QUALITY ON RECOVERY OF CRYPTOSPORIDIUM OOCYSTS FROM STREAM WATER BY USING U.S. ENVIRONMENTAL PROTECTION AGENCY METHOD 1623

    EPA Science Inventory

    U.S.EPA Methods 1622 and 1623 are used to detect and quantify Cryptosporidium oocysts in water. The protocol consists of filtration, immunomagnetic separation (IMS), staining with a fluorescent antibody, and microscopic analysis. Microscopic analysis includes detection by fluor...

  6. COMPARISON OF MEMBRANE FILTER, MULTIPLE-FERMENTATION-TUBE, AND PRESENCE-ABSENCE TECHNIQUES FOR DETECTING TOTAL COLIFORMS IN SMALL COMMUNITY WATER SYSTEMS

    EPA Science Inventory

    Methods for detecting total coliform bacteria in drinking water were compared using 1483 different drinking water samples from 15 small community water systems in Vermont and New Hampshire. The methods included the membrane filter (MF) technique, a ten tube fermentation tube tech...

  7. Literature Review of the Extraction and Analysis of Trace Contaminants in Food

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, Audrey Martin; Alcaraz, Armando

    2010-06-15

    There exists a serious concern that chemical warfare agents (CWA) may be used in a terrorist attack against military or civilian populations. While many precautions have been taken on the military front (e.g. protective clothing, gas masks), such precautions are not suited for the widespread application to civilian populations. Thus, defense of the civilian population, and applicable to the military population, has focused on prevention and early detection. Early detection relies on accurate and sensitive analytical methods to detect and identify CWA in a variety of matrices. Once a CWA is detected, the analytical needs take on a forensic applicationmore » – are there any chemical signatures present in the sample that could indicate its source? These signatures could include byproducts of the reaction, unreacted starting materials, degradation products, or impurities. Therefore, it is important that the analytical method used can accurately identify such signatures, as well as the CWA itself. Contained herein is a review of the open literature describing the detection of CWA in various matrices and the detection of trace toxic chemicals in food. Several relevant reviews have been published in the literature,1-5 including a review of analytical separation techniques for CWA by Hooijschuur et al.1 The current review is not meant to reiterate the published manuscripts; is focused mainly on extraction procedures, as well as the detection of VX and its hydrolysis products, as it is closely related to Russian VX, which is not prevalent in the literature. It is divided by the detection technique used, as such; extraction techniques are included with each detection method.« less

  8. Comparison of soft-input-soft-output detection methods for dual-polarized quadrature duobinary system

    NASA Astrophysics Data System (ADS)

    Chang, Chun; Huang, Benxiong; Xu, Zhengguang; Li, Bin; Zhao, Nan

    2018-02-01

    Three soft-input-soft-output (SISO) detection methods for dual-polarized quadrature duobinary (DP-QDB), including maximum-logarithmic-maximum-a-posteriori-probability-algorithm (Max-log-MAP)-based detection, soft-output-Viterbi-algorithm (SOVA)-based detection, and a proposed SISO detection, which can all be combined with SISO decoding, are presented. The three detection methods are investigated at 128 Gb/s in five-channel wavelength-division-multiplexing uncoded and low-density-parity-check (LDPC) coded DP-QDB systems by simulations. Max-log-MAP-based detection needs the returning-to-initial-states (RTIS) process despite having the best performance. When the LDPC code with a code rate of 0.83 is used, the detecting-and-decoding scheme with the SISO detection does not need RTIS and has better bit error rate (BER) performance than the scheme with SOVA-based detection. The former can reduce the optical signal-to-noise ratio (OSNR) requirement (at BER=10-5) by 2.56 dB relative to the latter. The application of the SISO iterative detection in LDPC-coded DP-QDB systems makes a good trade-off between requirements on transmission efficiency, OSNR requirement, and transmission distance, compared with the other two SISO methods.

  9. Field calibration of blowfly-derived DNA against traditional methods for assessing mammal diversity in tropical forests.

    PubMed

    Lee, Ping-Shin; Gan, Han Ming; Clements, Gopalasamy Reuben; Wilson, John-James

    2016-11-01

    Mammal diversity assessments based on DNA derived from invertebrates have been suggested as alternatives to assessments based on traditional methods; however, no study has field-tested both approaches simultaneously. In Peninsular Malaysia, we calibrated the performance of mammal DNA derived from blowflies (Diptera: Calliphoridae) against traditional methods used to detect species. We first compared five methods (cage trapping, mist netting, hair trapping, scat collection, and blowfly-derived DNA) in a forest reserve with no recent reports of megafauna. Blowfly-derived DNA and mist netting detected the joint highest number of species (n = 6). Only one species was detected by multiple methods. Compared to the other methods, blowfly-derived DNA detected both volant and non-volant species. In another forest reserve, rich in megafauna, we calibrated blowfly-derived DNA against camera traps. Blowfly-derived DNA detected more species (n = 11) than camera traps (n = 9), with only one species detected by both methods. The rarefaction curve indicated that blowfly-derived DNA would continue to detect more species with greater sampling effort. With further calibration, blowfly-derived DNA may join the list of traditional field methods. Areas for further investigation include blowfly feeding and dispersal biology, primer biases, and the assembly of a comprehensive and taxonomically-consistent DNA barcode reference library.

  10. Community Detection in Complex Networks via Clique Conductance.

    PubMed

    Lu, Zhenqi; Wahlström, Johan; Nehorai, Arye

    2018-04-13

    Network science plays a central role in understanding and modeling complex systems in many areas including physics, sociology, biology, computer science, economics, politics, and neuroscience. One of the most important features of networks is community structure, i.e., clustering of nodes that are locally densely interconnected. Communities reveal the hierarchical organization of nodes, and detecting communities is of great importance in the study of complex systems. Most existing community-detection methods consider low-order connection patterns at the level of individual links. But high-order connection patterns, at the level of small subnetworks, are generally not considered. In this paper, we develop a novel community-detection method based on cliques, i.e., local complete subnetworks. The proposed method overcomes the deficiencies of previous similar community-detection methods by considering the mathematical properties of cliques. We apply the proposed method to computer-generated graphs and real-world network datasets. When applied to networks with known community structure, the proposed method detects the structure with high fidelity and sensitivity. When applied to networks with no a priori information regarding community structure, the proposed method yields insightful results revealing the organization of these complex networks. We also show that the proposed method is guaranteed to detect near-optimal clusters in the bipartition case.

  11. Multiple-Bit Differential Detection of OQPSK

    NASA Technical Reports Server (NTRS)

    Simon, Marvin

    2005-01-01

    A multiple-bit differential-detection method has been proposed for the reception of radio signals modulated with offset quadrature phase-shift keying (offset QPSK or OQPSK). The method is also applicable to other spectrally efficient offset quadrature modulations. This method is based partly on the same principles as those of a multiple-symbol differential-detection method for M-ary QPSK, which includes QPSK (that is, non-offset QPSK) as a special case. That method was introduced more than a decade ago by the author of the present method as a means of improving performance relative to a traditional (two-symbol observation) differential-detection scheme. Instead of symbol-by-symbol detection, both that method and the present one are based on a concept of maximum-likelihood sequence estimation (MLSE). As applied to the modulations in question, MLSE involves consideration of (1) all possible binary data sequences that could have been received during an observation time of some number, N, of symbol periods and (2) selection of the sequence that yields the best match to the noise-corrupted signal received during that time. The performance of the prior method was shown to range from that of traditional differential detection for short observation times (small N) to that of ideal coherent detection (with differential encoding) for long observation times (large N).

  12. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

    PubMed Central

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

  13. DNA-PK assay

    DOEpatents

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  14. A novel infrared small moving target detection method based on tracking interest points under complicated background

    NASA Astrophysics Data System (ADS)

    Dong, Xiabin; Huang, Xinsheng; Zheng, Yongbin; Bai, Shengjian; Xu, Wanying

    2014-07-01

    Infrared moving target detection is an important part of infrared technology. We introduce a novel infrared small moving target detection method based on tracking interest points under complicated background. Firstly, Difference of Gaussians (DOG) filters are used to detect a group of interest points (including the moving targets). Secondly, a sort of small targets tracking method inspired by Human Visual System (HVS) is used to track these interest points for several frames, and then the correlations between interest points in the first frame and the last frame are obtained. Last, a new clustering method named as R-means is proposed to divide these interest points into two groups according to the correlations, one is target points and another is background points. In experimental results, the target-to-clutter ratio (TCR) and the receiver operating characteristics (ROC) curves are computed experimentally to compare the performances of the proposed method and other five sophisticated methods. From the results, the proposed method shows a better discrimination of targets and clutters and has a lower false alarm rate than the existing moving target detection methods.

  15. Detecting special nuclear materials in containers using high-energy gamma rays emitted by fission products

    DOEpatents

    Norman, Eric B.; Prussin, Stanley G.

    2007-10-02

    A method and a system for detecting the presence of special nuclear materials in a container. The system and its method include irradiating the container with an energetic beam, so as to induce a fission in the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  16. Improvement of automatic hemorrhage detection methods using brightness correction on fundus images

    NASA Astrophysics Data System (ADS)

    Hatanaka, Yuji; Nakagawa, Toshiaki; Hayashi, Yoshinori; Kakogawa, Masakatsu; Sawada, Akira; Kawase, Kazuhide; Hara, Takeshi; Fujita, Hiroshi

    2008-03-01

    We have been developing several automated methods for detecting abnormalities in fundus images. The purpose of this study is to improve our automated hemorrhage detection method to help diagnose diabetic retinopathy. We propose a new method for preprocessing and false positive elimination in the present study. The brightness of the fundus image was changed by the nonlinear curve with brightness values of the hue saturation value (HSV) space. In order to emphasize brown regions, gamma correction was performed on each red, green, and blue-bit image. Subsequently, the histograms of each red, blue, and blue-bit image were extended. After that, the hemorrhage candidates were detected. The brown regions indicated hemorrhages and blood vessels and their candidates were detected using density analysis. We removed the large candidates such as blood vessels. Finally, false positives were removed by using a 45-feature analysis. To evaluate the new method for the detection of hemorrhages, we examined 125 fundus images, including 35 images with hemorrhages and 90 normal images. The sensitivity and specificity for the detection of abnormal cases was were 80% and 88%, respectively. These results indicate that the new method may effectively improve the performance of our computer-aided diagnosis system for hemorrhages.

  17. Real-time method for establishing a detection map for a network of sensors

    DOEpatents

    Nguyen, Hung D; Koch, Mark W; Giron, Casey; Rondeau, Daniel M; Russell, John L

    2012-09-11

    A method for establishing a detection map of a dynamically configurable sensor network. This method determines an appropriate set of locations for a plurality of sensor units of a sensor network and establishes a detection map for the network of sensors while the network is being set up; the detection map includes the effects of the local terrain and individual sensor performance. Sensor performance is characterized during the placement of the sensor units, which enables dynamic adjustment or reconfiguration of the placement of individual elements of the sensor network during network set-up to accommodate variations in local terrain and individual sensor performance. The reconfiguration of the network during initial set-up to accommodate deviations from idealized individual sensor detection zones improves the effectiveness of the sensor network in detecting activities at a detection perimeter and can provide the desired sensor coverage of an area while minimizing unintentional gaps in coverage.

  18. Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; determination of 86 volatile organic compounds in water by gas chromatography/mass spectrometry, including detections less than reporting limits

    USGS Publications Warehouse

    Connor, Brooke F.; Rose, Donna L.; Noriega, Mary C.; Murtaugh, Lucinda K.; Abney, Sonja R.

    1998-01-01

    This report presents precision and accuracy data for volatile organic compounds (VOCs) in the nanogram-per-liter range, including aromatic hydrocarbons, reformulated fuel components, and halogenated hydrocarbons using purge and trap capillary-column gas chromatography/mass spectrometry. One-hundred-four VOCs were initially tested. Of these, 86 are suitable for determination by this method. Selected data are provided for the 18 VOCs that were not included. This method also allows for the reporting of semiquantitative results for tentatively identified VOCs not included in the list of method compounds. Method detection limits, method performance data, preservation study results, and blank results are presented. The authors describe a procedure for reporting low-concentration detections at less than the reporting limit. The nondetection value (NDV) is introduced as a statistically defined reporting limit designed to limit false positives and false negatives to less than 1 percent. Nondetections of method compounds are reported as ?less than NDV.? Positive detections measured at less than NDV are reported as estimated concentrations to alert the data user to decreased confidence in accurate quantitation. Instructions are provided for analysts to report data at less than the reporting limits. This method can support the use of either method reporting limits that censor detections at lower concentrations or the use of NDVs as reporting limits. The data-reporting strategy for providing analytical results at less than the reporting limit is a result of the increased need to identify the presence or absence of environmental contaminants in water samples at increasingly lower concentrations. Long-term method detection limits (LTMDLs) for 86 selected compounds range from 0.013 to 2.452 micrograms per liter (?g/L) and differ from standard method detection limits (MDLs) in that the LTMDLs include the long-term variance of multiple instruments, multiple operators, and multiple calibrations over a longer time. For these reasons, LTMDLs are expected to be slightly higher than standard MDLs. Recoveries for all of the VOCs tested ranged from 36 (tert-butyl formate) to 155 percent (pentachlorobenzene). The majority of the compounds ranged from 85 to 115 percent recovery and had less than 5 percent relative standard deviation for concentrations spiked between 1 to 500 ?g/L in volatile blank-, surface-, and ground-water samples. Recoveries of 60 set spikes at low concentrations ranged from 70 to 114 percent (1,2,3- trimethylbenzene and acetone). Recovery data were collected over 6 months with multiple instruments, operators, and calibrations. In this method, volatile organic compounds are extracted from a water sample by actively purging with helium. The VOCs are collected onto a sorbent trap, thermally desorbed, separated by a Megabore gas chromatographic capillary column, and finally determined by a full-scan quadrupole mass spectrometer. Compound identification is confirmed by the gas chromatographic retention time and by the resultant mass spectrum, typically identified by three unique ions. An unknown compound detected in a sample can be tentatively identified by comparing the unknown mass spectrum to reference spectra in the mass-spectra computer-data system library compiled by the National Institute of Standards and Technology.

  19. TreeShrink: fast and accurate detection of outlier long branches in collections of phylogenetic trees.

    PubMed

    Mai, Uyen; Mirarab, Siavash

    2018-05-08

    Sequence data used in reconstructing phylogenetic trees may include various sources of error. Typically errors are detected at the sequence level, but when missed, the erroneous sequences often appear as unexpectedly long branches in the inferred phylogeny. We propose an automatic method to detect such errors. We build a phylogeny including all the data then detect sequences that artificially inflate the tree diameter. We formulate an optimization problem, called the k-shrink problem, that seeks to find k leaves that could be removed to maximally reduce the tree diameter. We present an algorithm to find the exact solution for this problem in polynomial time. We then use several statistical tests to find outlier species that have an unexpectedly high impact on the tree diameter. These tests can use a single tree or a set of related gene trees and can also adjust to species-specific patterns of branch length. The resulting method is called TreeShrink. We test our method on six phylogenomic biological datasets and an HIV dataset and show that the method successfully detects and removes long branches. TreeShrink removes sequences more conservatively than rogue taxon removal and often reduces gene tree discordance more than rogue taxon removal once the amount of filtering is controlled. TreeShrink is an effective method for detecting sequences that lead to unrealistically long branch lengths in phylogenetic trees. The tool is publicly available at https://github.com/uym2/TreeShrink .

  20. Usefulness of detection of clarithromycin-resistant Helicobacter pylori from fecal specimens for young adults treated with eradication therapy.

    PubMed

    Osaki, Takako; Mabe, Katsuhiro; Zaman, Cynthia; Yonezawa, Hideo; Okuda, Masumi; Amagai, Kenji; Fujieda, Shinji; Goto, Mitsuhide; Shibata, Wataru; Kato, Mototsugu; Kamiya, Shigeru

    2017-10-01

    To prevent Helicobacter pylori infection in the younger generation, it is necessary to investigate the prevalence of antibiotic-resistant H. pylori. The aim of this study was to evaluate the method of PCR-based sequencing to detect clarithromycin (CAM) resistance-associated mutations using fecal samples as a noninvasive method. DNA extracted from fecal specimens and isolates from gastric biopsy specimens were collected from patients with H. pylori infection. Antibiotic resistance to CAM was analyzed by molecular and culture methods. The detection rates of CAM resistance-associated mutations (A2142C or A2143G) were compared before and after eradication therapy. With CAM resistance of H. pylori evaluated by antibiotic susceptibility test as a gold standard, the sensitivity and the specificity of gene mutation detection from fecal DNA were 80% and 84.8%, respectively. In contrast, using DNA of isolated strains, the sensitivity and the specificity were 80% and 100%. Of the seven cases in which eradication was unsuccessful by triple therapy including CAM, CAM-resistant H. pylori, and resistance-associated mutations were detected in three cases, CAM-resistant H. pylori without the mutation was detected in two patients, and resistance-associated mutation was only detected in one patient. PCR-based sequencing to detect CAM resistance-associated mutations using isolates or fecal samples was useful for finding antibiotic-resistant H. pylori infection. Although the specificity of the detection from fecal samples compared with antibiotic susceptibility testing was lower than that from isolates, this fecal detection method is suitable especially for asymptomatic subjects including children. Further improvement is needed before clinical application. © 2017 John Wiley & Sons Ltd.

  1. The use of geoscience methods for terrestrial forensic searches

    NASA Astrophysics Data System (ADS)

    Pringle, J. K.; Ruffell, A.; Jervis, J. R.; Donnelly, L.; McKinley, J.; Hansen, J.; Morgan, R.; Pirrie, D.; Harrison, M.

    2012-08-01

    Geoscience methods are increasingly being utilised in criminal, environmental and humanitarian forensic investigations, and the use of such methods is supported by a growing body of experimental and theoretical research. Geoscience search techniques can complement traditional methodologies in the search for buried objects, including clandestine graves, weapons, explosives, drugs, illegal weapons, hazardous waste and vehicles. This paper details recent advances in search and detection methods, with case studies and reviews. Relevant examples are given, together with a generalised workflow for search and suggested detection technique(s) table. Forensic geoscience techniques are continuing to rapidly evolve to assist search investigators to detect hitherto difficult to locate forensic targets.

  2. Detection and localization of change points in temporal networks with the aid of stochastic block models

    NASA Astrophysics Data System (ADS)

    De Ridder, Simon; Vandermarliere, Benjamin; Ryckebusch, Jan

    2016-11-01

    A framework based on generalized hierarchical random graphs (GHRGs) for the detection of change points in the structure of temporal networks has recently been developed by Peel and Clauset (2015 Proc. 29th AAAI Conf. on Artificial Intelligence). We build on this methodology and extend it to also include the versatile stochastic block models (SBMs) as a parametric family for reconstructing the empirical networks. We use five different techniques for change point detection on prototypical temporal networks, including empirical and synthetic ones. We find that none of the considered methods can consistently outperform the others when it comes to detecting and locating the expected change points in empirical temporal networks. With respect to the precision and the recall of the results of the change points, we find that the method based on a degree-corrected SBM has better recall properties than other dedicated methods, especially for sparse networks and smaller sliding time window widths.

  3. miRNA detection at single-cell resolution using microfluidic LNA flow-FISH

    DOE PAGES

    Wu, Meiye; Piccini, Matthew Ernest; Koh, Chung -Yan; ...

    2014-08-20

    Flow cytometry in combination with fluorescent in situ hybridization (flow-FISH) is a powerful technique that can be utilized to rapidly detect nucleic acids at single-cell resolution without the need for homogenization or nucleic acid extraction. Here, we describe a microfluidic-based method which enables the detection of microRNAs or miRNAs in single intact cells by flow-FISH using locked nucleic acid (LNA)-containing probes. Our method can be applied to all RNA species including mRNA and small noncoding RNA and is suitable for multiplexing with protein immunostaining in the same cell. For demonstration of our method, this chapter details the detection of miR155more » and CD69 protein in PMA and ionomycin-stimulated Jurkat cells. Here, we also include instructions on how to set up a microfluidic chip sample preparation station to prepare cells for imaging and analysis on a commercial flow cytometer or a custom-built micro-flow cytometer.« less

  4. Detection of incipient defects in cables by partial discharge signal analysis

    NASA Astrophysics Data System (ADS)

    Martzloff, F. D.; Simmon, E.; Steiner, J. P.; Vanbrunt, R. J.

    1992-07-01

    As one of the objectives of a program aimed at assessing test methods for in-situ detection of incipient defects in cables due to aging, a laboratory test system was implemented to demonstrate that the partial discharge analysis method can be successfully applied to low-voltage cables. Previous investigations generally involved cables rated 5 kV or higher, while the objective of the program focused on the lower voltages associated with the safety systems of nuclear power plants. The defect detection system implemented for the project was based on commercially available signal analysis hardware and software packages, customized for the specific purposes of the project. The test specimens included several cables of the type found in nuclear power plants, including artificial defects introduced at various points of the cable. The results indicate that indeed, partial discharge analysis is capable of detecting incipient defects in low-voltage cables. There are, however, some limitations of technical and non-technical nature that need further exploration before this method can be accepted in the industry.

  5. Detection of S-Nitrosothiols

    PubMed Central

    Diers, Anne R.; Keszler, Agnes; Hogg, Neil

    2015-01-01

    BACKGROUND S-Nitrosothiols have been recognized as biologically-relevant products of nitric oxide that are involved in many of the diverse activities of this free radical. SCOPE OF REVIEW This review serves to discuss current methods for the detection and analysis of protein S-nitrosothiols. The major methods of S-nitrosothiol detection include chemiluminescence-based methods and switch-based methods, each of which comes in various flavors with advantages and caveats. MAJOR CONCLUSIONS The detection of S-nitrosothiols is challenging and prone to many artifacts. Accurate measurements require an understanding of the underlying chemistry of the methods involved and the use of appropriate controls. GENERAL SIGNIFICANCE Nothing is more important to a field of research than robust methodology that is generally trusted. The field of S-Nitrosation has developed such methods but, as S-nitrosothiols are easy to introduce as artifacts, it is vital that current users learn from the lessons of the past. PMID:23988402

  6. A Targeted LC-MS/MS Method for the Simultaneous Detection and Quantitation of Egg, Milk, and Peanut Allergens in Sugar Cookies.

    PubMed

    Boo, Chelsea C; Parker, Christine H; Jackson, Lauren S

    2018-01-01

    Food allergy is a growing public health concern, with many individuals reporting allergies to multiple food sources. Compliance with food labeling regulations and prevention of inadvertent cross-contact in manufacturing requires the use of reliable methods for the detection and quantitation of allergens in processed foods. In this work, a novel liquid chromatography-tandem mass spectrometry multiple-reaction monitoring method for multiallergen detection and quantitation of egg, milk, and peanut was developed and evaluated in an allergen-incurred baked sugar cookie matrix. A systematic evaluation of method parameters, including sample extraction, concentration, and digestion, were optimized for candidate allergen peptide markers. The optimized method enabled the reliable detection and quantitation of egg, milk, and peanut allergens in sugar cookies, with allergen concentrations as low as 5 ppm allergen-incurred ingredient.

  7. Methods and Apparatus for Detecting Defects in an Object of Interest

    NASA Technical Reports Server (NTRS)

    Hartman, John K. (Inventor); Pearson, Lee H (Inventor)

    2017-01-01

    A method for detecting defects in an object of interest comprises applying an ultrasonic signal including a tone burst having a predetermined frequency and number of cycles into an object of interest, receiving a return signal reflected from the object of interest, and processing the return signal to detect defects in at least one inner material. The object may have an outer material and the at least one inner material that have different acoustic impedances. An ultrasonic sensor system includes an ultrasonic sensor configured to generate an ultrasonic signal having a tone burst at a predetermined frequency corresponding to a resonant frequency of an outer material of an object of interest.

  8. Systems and methods of monitoring acoustic pressure to detect a flame condition in a gas turbine

    DOEpatents

    Ziminsky, Willy Steve [Simpsonville, SC; Krull, Anthony Wayne [Anderson, SC; Healy, Timothy Andrew , Yilmaz, Ertan

    2011-05-17

    A method may detect a flashback condition in a fuel nozzle of a combustor. The method may include obtaining a current acoustic pressure signal from the combustor, analyzing the current acoustic pressure signal to determine current operating frequency information for the combustor, and indicating that the flashback condition exists based at least in part on the current operating frequency information.

  9. Microfluidic devices, systems, and methods for quantifying particles using centrifugal force

    DOEpatents

    Schaff, Ulrich Y.; Sommer, Gregory J.; Singh, Anup K.

    2015-11-17

    Embodiments of the present invention are directed toward microfluidic systems, apparatus, and methods for measuring a quantity of cells in a fluid. Examples include a differential white blood cell measurement using a centrifugal microfluidic system. A method may include introducing a fluid sample containing a quantity of cells into a microfluidic channel defined in part by a substrate. The quantity of cells may be transported toward a detection region defined in part by the substrate, wherein the detection region contains a density media, and wherein the density media has a density lower than a density of the cells and higher than a density of the fluid sample. The substrate may be spun such that at least a portion of the quantity of cells are transported through the density media. Signals may be detected from label moieties affixed to the cells.

  10. Imaging resolution and properties analysis of super resolution microscopy with parallel detection under different noise, detector and image restoration conditions

    NASA Astrophysics Data System (ADS)

    Yu, Zhongzhi; Liu, Shaocong; Sun, Shiyi; Kuang, Cuifang; Liu, Xu

    2018-06-01

    Parallel detection, which can use the additional information of a pinhole plane image taken at every excitation scan position, could be an efficient method to enhance the resolution of a confocal laser scanning microscope. In this paper, we discuss images obtained under different conditions and using different image restoration methods with parallel detection to quantitatively compare the imaging quality. The conditions include different noise levels and different detector array settings. The image restoration methods include linear deconvolution and pixel reassignment with Richard-Lucy deconvolution and with maximum-likelihood estimation deconvolution. The results show that the linear deconvolution share properties such as high-efficiency and the best performance under all different conditions, and is therefore expected to be of use for future biomedical routine research.

  11. Remote sensing change detection methods to track deforestation and growth in threatened rainforests in Madre de Dios, Peru

    USGS Publications Warehouse

    Shermeyer, Jacob S.; Haack, Barry N.

    2015-01-01

    Two forestry-change detection methods are described, compared, and contrasted for estimating deforestation and growth in threatened forests in southern Peru from 2000 to 2010. The methods used in this study rely on freely available data, including atmospherically corrected Landsat 5 Thematic Mapper and Moderate Resolution Imaging Spectroradiometer (MODIS) vegetation continuous fields (VCF). The two methods include a conventional supervised signature extraction method and a unique self-calibrating method called MODIS VCF guided forest/nonforest (FNF) masking. The process chain for each of these methods includes a threshold classification of MODIS VCF, training data or signature extraction, signature evaluation, k-nearest neighbor classification, analyst-guided reclassification, and postclassification image differencing to generate forest change maps. Comparisons of all methods were based on an accuracy assessment using 500 validation pixels. Results of this accuracy assessment indicate that FNF masking had a 5% higher overall accuracy and was superior to conventional supervised classification when estimating forest change. Both methods succeeded in classifying persistently forested and nonforested areas, and both had limitations when classifying forest change.

  12. Chemosensors for detection of nitroaromatic compounds (explosives)

    NASA Astrophysics Data System (ADS)

    Zyryanov, G. V.; Kopchuk, D. S.; Kovalev, I. S.; Nosova, E. V.; Rusinov, V. L.; Chupakhin, O. N.

    2014-09-01

    The key types of low-molecular-mass chemosensors for the detection of nitroaromatic compounds representing energetic substances (explosives) are analyzed. The coordination and chemical properties of these chemosensors and structural features of their complexes with nitroaromatic compounds are considered. The causes and methods for attaining high selectivity of recognition are demonstrated. The primary attention is paid to the use of low-molecular-mass chemosensors for visual detection of explosives of this class by colorimetric and photometric methods. Examples of using photo- and chemiluminescence for this purpose are described. A separate section is devoted to electrochemical methods of detection of nitroaromatic compounds. Data published from 2000 to 2014 are mainly covered. The bibliography includes 245 references.

  13. Method and apparatus for determining viscosity

    DOEpatents

    Chu, Benjamin; Dhadwal, Harbans S.

    1990-01-01

    A capillary viscometer is provided which includes a fiber-optic probe and a phototransistor which produces an output signal as a liquid meniscus falls through the field of view of a detecting fiber bundle. An analog circuit is employed for receiving the signal and starting or stopping a digital counter in response thereto. The circuit includes first and second differentiators and a zero detection portion for detecting zero value outputs from the second differentiator. The counter is started or stopped upon the generation of a triggering pulse at the time such zero value is detected.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Passarge, M; Fix, M K; Manser, P

    Purpose: To create and test an accurate EPID-frame-based VMAT QA metric to detect gross dose errors in real-time and to provide information about the source of error. Methods: A Swiss cheese model was created for an EPID-based real-time QA process. The system compares a treatmentplan- based reference set of EPID images with images acquired over each 2° gantry angle interval. The metric utilizes a sequence of independent consecutively executed error detection Methods: a masking technique that verifies infield radiation delivery and ensures no out-of-field radiation; output normalization checks at two different stages; global image alignment to quantify rotation, scaling andmore » translation; standard gamma evaluation (3%, 3 mm) and pixel intensity deviation checks including and excluding high dose gradient regions. Tolerances for each test were determined. For algorithm testing, twelve different types of errors were selected to modify the original plan. Corresponding predictions for each test case were generated, which included measurement-based noise. Each test case was run multiple times (with different noise per run) to assess the ability to detect introduced errors. Results: Averaged over five test runs, 99.1% of all plan variations that resulted in patient dose errors were detected within 2° and 100% within 4° (∼1% of patient dose delivery). Including cases that led to slightly modified but clinically equivalent plans, 91.5% were detected by the system within 2°. Based on the type of method that detected the error, determination of error sources was achieved. Conclusion: An EPID-based during-treatment error detection system for VMAT deliveries was successfully designed and tested. The system utilizes a sequence of methods to identify and prevent gross treatment delivery errors. The system was inspected for robustness with realistic noise variations, demonstrating that it has the potential to detect a large majority of errors in real-time and indicate the error source. J. V. Siebers receives funding support from Varian Medical Systems.« less

  15. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment

    PubMed Central

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-01-01

    Digital PCR has developed rapidly since it was first reported in the 1990s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products. PMID:26239916

  16. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    PubMed

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  17. Bioluminescent bioreporter integrated circuit devices and methods for detecting estrogen

    DOEpatents

    Simpson, Michael L.; Paulus, Michael J.; Sayler, Gary S.; Applegate, Bruce M.; Ripp, Steven A.

    2006-08-15

    Bioelectronic devices for the detection of estrogen include a collection of eukaryotic cells which harbor a recombinant lux gene from a high temperature microorganism wherein the gene is operably linked with a heterologous promoter gene. A detectable light-emitting lux gene product is expressed in the presence of the estrogen and detected by the device.

  18. 49 CFR 1544.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... provided in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, or a physical...) Preventing or deterring the carriage of any explosive or incendiary. Each aircraft operator operating under a...

  19. 49 CFR 1544.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... provided in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, or a physical...) Preventing or deterring the carriage of any explosive or incendiary. Each aircraft operator operating under a...

  20. 49 CFR 1544.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... provided in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, or a physical...) Preventing or deterring the carriage of any explosive or incendiary. Each aircraft operator operating under a...

  1. 49 CFR 1544.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... provided in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, or a physical...) Preventing or deterring the carriage of any explosive or incendiary. Each aircraft operator operating under a...

  2. Capillary electrophoresis method for the analysis of organic acids and amino acids in the presence of strongly alternating concentrations of aqueous lactic acid.

    PubMed

    Laube, Hendrik; Boden, Jana; Schneider, Roland

    2017-07-01

    During the production of bio-based bulk chemicals, such as lactic acid (LA), organic impurities have to be removed to produce a ready-to-market product. A capillary electrophoresis method for the simultaneous detection of LA and organic impurities in less than 10 min was developed. LA and organic impurities were detected using a direct UV detection method with micellar background electrolyte, which consisted of borate and sodium dodecyl sulfate. We investigated the effects of electrolyte composition and temperature on the speed, sensitivity, and robustness of the separation. A few validation parameters, such as linearity, limit of detection, and internal and external standards, were evaluated under optimized conditions. The method was applied for the detection of LA and organic impurities, including tyrosine, phenylalanine, and pyroglutamic acid, in samples from a continuous LA fermentation process from post-extraction tapioca starch and yeast extract.

  3. Statistics of software vulnerability detection in certification testing

    NASA Astrophysics Data System (ADS)

    Barabanov, A. V.; Markov, A. S.; Tsirlov, V. L.

    2018-05-01

    The paper discusses practical aspects of introduction of the methods to detect software vulnerability in the day-to-day activities of the accredited testing laboratory. It presents the approval results of the vulnerability detection methods as part of the study of the open source software and the software that is a test object of the certification tests under information security requirements, including software for communication networks. Results of the study showing the allocation of identified vulnerabilities by types of attacks, country of origin, programming languages used in the development, methods for detecting vulnerability, etc. are given. The experience of foreign information security certification systems related to the detection of certified software vulnerabilities is analyzed. The main conclusion based on the study is the need to implement practices for developing secure software in the development life cycle processes. The conclusions and recommendations for the testing laboratories on the implementation of the vulnerability analysis methods are laid down.

  4. Transistor-based particle detection systems and methods

    DOEpatents

    Jain, Ankit; Nair, Pradeep R.; Alam, Muhammad Ashraful

    2015-06-09

    Transistor-based particle detection systems and methods may be configured to detect charged and non-charged particles. Such systems may include a supporting structure contacting a gate of a transistor and separating the gate from a dielectric of the transistor, and the transistor may have a near pull-in bias and a sub-threshold region bias to facilitate particle detection. The transistor may be configured to change current flow through the transistor in response to a change in stiffness of the gate caused by securing of a particle to the gate, and the transistor-based particle detection system may configured to detect the non-charged particle at least from the change in current flow.

  5. Automatic patient-adaptive bleeding detection in a capsule endoscopy

    NASA Astrophysics Data System (ADS)

    Jung, Yun Sub; Kim, Yong Ho; Lee, Dong Ha; Lee, Sang Ho; Song, Jeong Joo; Kim, Jong Hyo

    2009-02-01

    We present a method for patient-adaptive detection of bleeding region for a Capsule Endoscopy (CE) images. The CE system has 320x320 resolution and transmits 3 images per second to receiver during around 10-hour. We have developed a technique to detect the bleeding automatically utilizing color spectrum transformation (CST) method. However, because of irregular conditions like organ difference, patient difference and illumination condition, detection performance is not uniform. To solve this problem, the detection method in this paper include parameter compensation step which compensate irregular image condition using color balance index (CBI). We have investigated color balance through sequential 2 millions images. Based on this pre-experimental result, we defined ΔCBI to represent deviate of color balance compared with standard small bowel color balance. The ΔCBI feature value is extracted from each image and used in CST method as parameter compensation constant. After candidate pixels were detected using CST method, they were labeled and examined with a bleeding character. We tested our method with 4,800 images in 12 patient data set (9 abnormal, 3 normal). Our experimental results show the proposed method achieves (before patient adaptive method : 80.87% and 74.25%, after patient adaptive method : 94.87% and 96.12%) of sensitivity and specificity.

  6. Development and evaluation of a culture-independent method for source determination of fecal wastes in surface and storm waters using reverse transcriptase-PCR detection of FRNA coliphage genogroup gene sequences.

    EPA Science Inventory

    A complete method, incorporating recently improved reverse transcriptase-PCR primer/probe assays and including controls for determining interferences to phage recoveries from water sample concentrates and for detecting interferences to their analysis, was developed for the direct...

  7. Development and evaluation of a culture-independent method for source determination of fecal wastes in surface and storm waters using reverse transcriptase-PCR detection of FRNA coliphage genogroup gene sequences

    EPA Science Inventory

    A complete method, incorporating recently improved reverse transcriptase-PCR primer/probe assays and including controls for determining interferences to phage recoveries from water sample concentrates and for detecting interferences to their analysis, was developed for the direct...

  8. Method and apparatus for extraction of low-frequency artifacts from brain waves for alertness detection

    DOEpatents

    Clapp, Ned E.; Hively, Lee M.

    1997-01-01

    Methods and apparatus automatically detect alertness in humans by monitoring and analyzing brain wave signals. Steps include: acquiring the brain wave (EEG or MEG) data from the subject, digitizing the data, separating artifact data from raw data, and comparing trends in f-data to alertness indicators, providing notification of inadequate alertness.

  9. The Impact of the Implementation of Edge Detection Methods on the Accuracy of Automatic Voltage Reading

    NASA Astrophysics Data System (ADS)

    Sidor, Kamil; Szlachta, Anna

    2017-04-01

    The article presents the impact of the edge detection method in the image analysis on the reading accuracy of the measured value. In order to ensure the automatic reading of the measured value by an analog meter, a standard webcam and the LabVIEW programme were applied. NI Vision Development tools were used. The Hough transform was used to detect the indicator. The programme output was compared during the application of several methods of edge detection. Those included: the Prewitt operator, the Roberts cross, the Sobel operator and the Canny edge detector. The image analysis was made for an analog meter indicator with the above-mentioned methods, and the results of that analysis were compared with each other and presented.

  10. An efficient cloud detection method for high resolution remote sensing panchromatic imagery

    NASA Astrophysics Data System (ADS)

    Li, Chaowei; Lin, Zaiping; Deng, Xinpu

    2018-04-01

    In order to increase the accuracy of cloud detection for remote sensing satellite imagery, we propose an efficient cloud detection method for remote sensing satellite panchromatic images. This method includes three main steps. First, an adaptive intensity threshold value combined with a median filter is adopted to extract the coarse cloud regions. Second, a guided filtering process is conducted to strengthen the textural features difference and then we conduct the detection process of texture via gray-level co-occurrence matrix based on the acquired texture detail image. Finally, the candidate cloud regions are extracted by the intersection of two coarse cloud regions above and we further adopt an adaptive morphological dilation to refine them for thin clouds in boundaries. The experimental results demonstrate the effectiveness of the proposed method.

  11. On detection of median filtering in digital images

    NASA Astrophysics Data System (ADS)

    Kirchner, Matthias; Fridrich, Jessica

    2010-01-01

    In digital image forensics, it is generally accepted that intentional manipulations of the image content are most critical and hence numerous forensic methods focus on the detection of such 'malicious' post-processing. However, it is also beneficial to know as much as possible about the general processing history of an image, including content-preserving operations, since they can affect the reliability of forensic methods in various ways. In this paper, we present a simple yet effective technique to detect median filtering in digital images-a widely used denoising and smoothing operator. As a great variety of forensic methods relies on some kind of a linearity assumption, a detection of non-linear median filtering is of particular interest. The effectiveness of our method is backed with experimental evidence on a large image database.

  12. Highlight on Bottlenecks in Food Allergen Analysis: Detection and Quantification by Mass Spectrometry.

    PubMed

    Planque, Mélanie; Arnould, Thierry; Renard, Patricia; Delahaut, Philippe; Dieu, Marc; Gillard, Nathlie

    2017-07-01

    Food laboratories have developed methods for testing allergens in foods. The efficiency of qualitative and quantitative methods is of prime importance in protecting allergic populations. Unfortunately, food laboratories encounter barriers to developing efficient methods. Bottlenecks include the lack of regulatory thresholds, delays in the emergence of reference materials and guidelines, and the need to detect processed allergens. In this study, ultra-HPLC coupled to tandem MS was used to illustrate difficulties encountered in determining method performances. We measured the major influences of both processing and matrix effects on the detection of egg, milk, soy, and peanut allergens in foodstuffs. The main goals of this work were to identify difficulties that food laboratories still encounter in detecting and quantifying allergens and to sensitize researchers to them.

  13. Laser-ultrasound spectroscopy apparatus and method with detection of shear resonances for measuring anisotropy, thickness, and other properties

    DOEpatents

    Levesque, Daniel; Moreau, Andre; Dubois, Marc; Monchalin, Jean-Pierre; Bussiere, Jean; Lord, Martin; Padioleau, Christian

    2000-01-01

    Apparatus and method for detecting shear resonances includes structure and steps for applying a radiation pulse from a pulsed source of radiation to an object to generate elastic waves therein, optically detecting the elastic waves generated in the object, and analyzing the elastic waves optically detected in the object. These shear resonances, alone or in combination with other information, may be used in the present invention to improve thickness measurement accuracy and to determine geometrical, microstructural, and physical properties of the object. At least one shear resonance in the object is detected with the elastic waves optically detected in the object. Preferably, laser-ultrasound spectroscopy is utilized to detect the shear resonances.

  14. Perspectives on the Future Search for Life on Mars and Beyond

    NASA Technical Reports Server (NTRS)

    Nealson, K. H.

    1998-01-01

    One can view the search for life on Mars in two ways: first, as the initial step in the search for life elsewhere, and second, as the one place where in situ methods for life detection can be tested and proved via sample return. After Mars, most of the life detection will he done via in situ studies with data return. Mars offers us the opportunity to fine tune our methods - perhaps for a long time to come. Our group is involved in the development of methods for life detection that are independent of specific signals used for detection of life on Earth. These approaches include general indicators of metabolic activity and organismal structure and composition. Using such approaches, we hope to detect the signals of life (biosignatures) that are independent of preconceived notions and yet are convincing and unambiguous. The approaches we are focusing on include stable isotopic analyses of metals, mineral formation and disolution, and elemental analysis. These methods allow us to examine samples at a variety of scales, looking for nonequilibrium distribution of elements that serve as biosignatures. For futures studies of Mars and beyond, they, or some variation of them, should allow inference or proof of life in non-Earth locations.

  15. A brief review of other notable protein detection methods on acrylamide gels.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2012-01-01

    Several methods have been described to stain proteins analyzed on acrylamide gels. These include ultrasensitive protein detection in one-dimensional and two-dimensional gel electrophoresis using a fluorescent product from the fungus Epicoccum nigrum; a fluorescence-based Coomassie Blue protein staining; visualization of proteins in acrylamide gels using ultraviolet illumination; fluorescence visualization of proteins in sodium dodecyl sulfate-polyacrylamide gels using environmentally benign, nonfixative, saline solution; and increasing the sensitivity four- to sixfold for detecting trace proteins in dye or silver stained polyacrylamide gels using polyethylene glycol 6000. All these methods are reviewed briefly in this chapter.

  16. Chemical Fingerprinting of Materials Developed Due to Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

  17. Positron emission tomography wrist detector

    DOEpatents

    Schlyer, David J.; O'Connor, Paul; Woody, Craig; Junnarkar, Sachin Shrirang; Radeka, Veljko; Vaska, Paul; Pratte, Jean-Francois

    2006-08-15

    A method of serially transferring annihilation information in a compact positron emission tomography (PET) scanner includes generating a time signal representing a time-of-occurrence of an annihilation event, generating an address signal representing a channel detecting the annihilation event, and generating a channel signal including the time and address signals. The method also includes generating a composite signal including the channel signal and another similarly generated channel signal concerning another annihilation event. An apparatus that serially transfers annihilation information includes a time signal generator, address signal generator, channel signal generator, and composite signal generator. The time signal is asynchronous and the address signal is synchronous to a clock signal. A PET scanner includes a scintillation array, detection array, front-end array, and a serial encoder. The serial encoders include the time signal generator, address signal generator, channel signal generator, and composite signal generator.

  18. Incipient Fault Detection for Rolling Element Bearings under Varying Speed Conditions.

    PubMed

    Xue, Lang; Li, Naipeng; Lei, Yaguo; Li, Ningbo

    2017-06-20

    Varying speed conditions bring a huge challenge to incipient fault detection of rolling element bearings because both the change of speed and faults could lead to the amplitude fluctuation of vibration signals. Effective detection methods need to be developed to eliminate the influence of speed variation. This paper proposes an incipient fault detection method for bearings under varying speed conditions. Firstly, relative residual (RR) features are extracted, which are insensitive to the varying speed conditions and are able to reflect the degradation trend of bearings. Then, a health indicator named selected negative log-likelihood probability (SNLLP) is constructed to fuse a feature set including RR features and non-dimensional features. Finally, based on the constructed SNLLP health indicator, a novel alarm trigger mechanism is designed to detect the incipient fault. The proposed method is demonstrated using vibration signals from bearing tests and industrial wind turbines. The results verify the effectiveness of the proposed method for incipient fault detection of rolling element bearings under varying speed conditions.

  19. Incipient Fault Detection for Rolling Element Bearings under Varying Speed Conditions

    PubMed Central

    Xue, Lang; Li, Naipeng; Lei, Yaguo; Li, Ningbo

    2017-01-01

    Varying speed conditions bring a huge challenge to incipient fault detection of rolling element bearings because both the change of speed and faults could lead to the amplitude fluctuation of vibration signals. Effective detection methods need to be developed to eliminate the influence of speed variation. This paper proposes an incipient fault detection method for bearings under varying speed conditions. Firstly, relative residual (RR) features are extracted, which are insensitive to the varying speed conditions and are able to reflect the degradation trend of bearings. Then, a health indicator named selected negative log-likelihood probability (SNLLP) is constructed to fuse a feature set including RR features and non-dimensional features. Finally, based on the constructed SNLLP health indicator, a novel alarm trigger mechanism is designed to detect the incipient fault. The proposed method is demonstrated using vibration signals from bearing tests and industrial wind turbines. The results verify the effectiveness of the proposed method for incipient fault detection of rolling element bearings under varying speed conditions. PMID:28773035

  20. Determination of allergenic egg proteins in food by protein-, mass spectrometry-, and DNA-based methods.

    PubMed

    Lee, Ji-Yun; Kim, Chang Jong

    2010-01-01

    Egg allergy is one of the most common food allergies in both adults and children, and foods including eggs and their byproducts should be declared under food allergen labeling policies in industrial countries. Therefore, to develop and validate a sensitive and specific method to detect hidden egg allergens in foods, we compared immunochemical, DNA-based, and proteomic methods for detecting egg allergens in foods using egg allergen standards such as egg whole protein, egg white protein, egg yolk protein, ovomucoid, ovalbumin, ovotransferrin, lysozyme, and alpha-livetin. Protein-based immunochemical methods, including ELISA as an initial screening quantitative analysis and immunoblotting as a final confirmatory qualitative analysis, were very sensitive and specific in detecting potentially allergenic egg residues in processed foods in trace amounts. In contrast, the proteomics-based, matrix-assisted laser desorption/ionization time-of-flight MS and LC-tandem quadrupole time-of-flight MS methods were not able to detect some egg allergens, such as ovomucoid, because of its nondenaturing property under urea and trypsin. The DNA-based PCR method could not distinguish between egg and chicken meat because it is tissue-nonspecific. In further studies for the feasibility of these immunochemical methods on 100 real raw dietary samples, four food samples without listed egg ingredients produced a positive response by ELISA, but exhibited negative results by immunoblotting.

  1. Comprehensive Analysis of Secondary Dental Root Canal Infections: A Combination of Culture and Culture-Independent Approaches Reveals New Insights

    PubMed Central

    Anderson, Annette Carola; Hellwig, Elmar; Vespermann, Robin; Wittmer, Annette; Schmid, Michael; Karygianni, Lamprini; Al-Ahmad, Ali

    2012-01-01

    Persistence of microorganisms or reinfections are the main reasons for failure of root canal therapy. Very few studies to date have included culture-independent methods to assess the microbiota, including non-cultivable microorganisms. The aim of this study was to combine culture methods with culture-independent cloning methods to analyze the microbial flora of root-filled teeth with periradicular lesions. Twenty-one samples from previously root-filled teeth were collected from patients with periradicular lesions. Microorganisms were cultivated, isolated and biochemically identified. In addition, ribosomal DNA of bacteria, fungi and archaea derived from the same samples was amplified and the PCR products were used to construct clone libraries. DNA of selected clones was sequenced and microbial species were identified, comparing the sequences with public databases. Microorganisms were found in 12 samples with culture-dependent and -independent methods combined. The number of bacterial species ranged from 1 to 12 in one sample. The majority of the 26 taxa belonged to the phylum Firmicutes (14 taxa), followed by Actinobacteria, Proteobacteria and Bacteroidetes. One sample was positive for fungi, and archaea could not be detected. The results obtained with both methods differed. The cloning technique detected several as-yet-uncultivated taxa. Using a combination of both methods 13 taxa were detected that had not been found in root-filled teeth so far. Enterococcus faecalis was only detected in two samples using culture methods. Combining the culture-dependent and –independent approaches revealed new candidate endodontic pathogens and a high diversity of the microbial flora in root-filled teeth with periradicular lesions. Both methods yielded differing results, emphasizing the benefit of combined methods for the detection of the actual microbial diversity in apical periodontitis. PMID:23152922

  2. PCR technology for screening and quantification of genetically modified organisms (GMOs).

    PubMed

    Holst-Jensen, Arne; Rønning, Sissel B; Løvseth, Astrid; Berdal, Knut G

    2003-04-01

    Although PCR technology has obvious limitations, the potentially high degree of sensitivity and specificity explains why it has been the first choice of most analytical laboratories interested in detection of genetically modified (GM) organisms (GMOs) and derived materials. Because the products that laboratories receive for analysis are often processed and refined, the quality and quantity of target analyte (e.g. protein or DNA) frequently challenges the sensitivity of any detection method. Among the currently available methods, PCR methods are generally accepted as the most sensitive and reliable methods for detection of GM-derived material in routine applications. The choice of target sequence motif is the single most important factor controlling the specificity of the PCR method. The target sequence is normally a part of the modified gene construct, for example a promoter, a terminator, a gene, or a junction between two of these elements. However, the elements may originate from wildtype organisms, they may be present in more than one GMO, and their copy number may also vary from one GMO to another. They may even be combined in a similar way in more than one GMO. Thus, the choice of method should fit the purpose. Recent developments include event-specific methods, particularly useful for identification and quantification of GM content. Thresholds for labelling are now in place in many countries including those in the European Union. The success of the labelling schemes is dependent upon the efficiency with which GM-derived material can be detected. We will present an overview of currently available PCR methods for screening and quantification of GM-derived DNA, and discuss their applicability and limitations. In addition, we will discuss some of the major challenges related to determination of the limits of detection (LOD) and quantification (LOQ), and to validation of methods.

  3. Development and validation of a 48-target analytical method for high-throughput monitoring of genetically modified organisms.

    PubMed

    Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

    2015-01-05

    The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection.

  4. Development and Validation of A 48-Target Analytical Method for High-throughput Monitoring of Genetically Modified Organisms

    PubMed Central

    Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

    2015-01-01

    The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection. PMID:25556930

  5. Ship Detection Based on Multiple Features in Random Forest Model for Hyperspectral Images

    NASA Astrophysics Data System (ADS)

    Li, N.; Ding, L.; Zhao, H.; Shi, J.; Wang, D.; Gong, X.

    2018-04-01

    A novel method for detecting ships which aim to make full use of both the spatial and spectral information from hyperspectral images is proposed. Firstly, the band which is high signal-noise ratio in the range of near infrared or short-wave infrared spectrum, is used to segment land and sea on Otsu threshold segmentation method. Secondly, multiple features that include spectral and texture features are extracted from hyperspectral images. Principal components analysis (PCA) is used to extract spectral features, the Grey Level Co-occurrence Matrix (GLCM) is used to extract texture features. Finally, Random Forest (RF) model is introduced to detect ships based on the extracted features. To illustrate the effectiveness of the method, we carry out experiments over the EO-1 data by comparing single feature and different multiple features. Compared with the traditional single feature method and Support Vector Machine (SVM) model, the proposed method can stably achieve the target detection of ships under complex background and can effectively improve the detection accuracy of ships.

  6. Assessment of groundwater, soil-gas, and soil contamination at the Vietnam Armor Training Facility, Fort Gordon, Georgia, 2009-2011

    USGS Publications Warehouse

    Guimaraes, Wladmir B.; Falls, W. Fred; Caldwell, Andral W.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

    2012-01-01

    The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, Georgia, assessed the groundwater, soil gas, and soil for contaminants at the Vietnam Armor Training Facility (VATF) at Fort Gordon, from October 2009 to September 2011. The assessment included the detection of organic compounds in the groundwater and soil gas, and inorganic compounds in the soil. In addition, organic contaminant assessment included organic compounds classified as explosives and chemical agents in selected areas. The assessment was conducted to provide environmental contamination data to the U.S. Army at Fort Gordon pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. This report is a revision of "Assessment of soil-gas, surface-water, and soil contamination at the Vietnam Armor Training Facility, Fort Gordon, Georgia, 2009-2010," Open-File Report 2011-1200, and supersedes that report to include results of additional samples collected in July 2011. Four passive samplers were deployed in groundwater wells at the VATF in Fort Gordon. Total petroleum hydrocarbons and benzene and octane were detected above the method detection level at all four wells. The only other volatile organic compounds detected above their method detection level were undecane and pentadecane, which were detected in two of the four wells. Soil-gas samplers were deployed at 72 locations in a grid pattern across the VATF on June 3, 2010, and then later retrieved on June 9, 2010. Total petroleum hydrocarbons were detected in 71 of the 72 samplers (one sampler was destroyed in the field and not analyzed) at levels above the method detection level, and the combined mass of benzene, toluene, ethylbenzene, and total xylene (BTEX) was detected above the detection level in 31 of the 71 samplers that were analyzed. Other volatile organic compounds detected above their respective method detection levels were naphthalene, 2-methyl-naphthalene, tridecane, 1,2,4-trimethylbenzene, and perchloroethylene. After the results of the 71 soil-gas samplers were received, 31 additional passive soil-gas samplers were deployed on July 14, 2011, and retrieved on July 18, 2011. These 31 samplers were deployed on a larger areal scale to better define the extent of the contamination. Total petroleum hydrocarbons were detected above their method detection level at all 31 samplers, whereas BTEX was detected above its method detection level at 17 of the 31 samplers. Other organic compounds detected above their method detection levels were naphthalene, 2-methyl-naphthalene, octane, undecane, tridecane, pentadecane, 1,2,4-trimethylbenzene, 1,3,5-trimethylbenzene, chloroform, and perchloroethylene. Subsequent to the 2010 soil-gas survey, four areas determined to have elevated contaminant mass were selected and sampled for explosives and chemical agents. No detections of explosives or chemical agents above their respective method detection levels were found at any of the sampling locations. The same four locations that were sampled for explosives and chemical agents were selected for the collection of soil samples. A fifth location also was selected on the basis of the elevated contaminant mass of the soil-gas survey. No metals that exceeded the Regional Screening Levels for Industrial Soils, as classified by the U.S. Environmental Protection Agency, were detected at any of the five VATF locations. The soil samples also were compared to values from the ambient, uncontaminated (background) levels for soils in South Carolina, as classified by the South Carolina Department of Health and Environmental Control. Because South Carolina is adjacent to Georgia and the soils in the Coastal Plain are similar, these comparisons are valid. No similar values are available for Georgia to use for comparison purposes. The metals that were detected above the ambient background levels for South Carolina, as classified by the South Carolina Department of Health and Environmental Control, include aluminum, arsenic, barium, beryllium, calcium, chromium, copper, iron, lead, magnesium, manganese, nickel, potassium, sodium, and zinc.

  7. A phantom design for assessment of detectability in PET imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wollenweber, Scott D., E-mail: scott.wollenweber@g

    2016-09-15

    Purpose: The primary clinical role of positron emission tomography (PET) imaging is the detection of anomalous regions of {sup 18}F-FDG uptake, which are often indicative of malignant lesions. The goal of this work was to create a task-configurable fillable phantom for realistic measurements of detectability in PET imaging. Design goals included simplicity, adjustable feature size, realistic size and contrast levels, and inclusion of a lumpy (i.e., heterogeneous) background. Methods: The detection targets were hollow 3D-printed dodecahedral nylon features. The exostructure sphere-like features created voids in a background of small, solid non-porous plastic (acrylic) spheres inside a fillable tank. The featuresmore » filled at full concentration while the background concentration was reduced due to filling only between the solid spheres. Results: Multiple iterations of feature size and phantom construction were used to determine a configuration at the limit of detectability for a PET/CT system. A full-scale design used a 20 cm uniform cylinder (head-size) filled with a fixed pattern of features at a contrast of approximately 3:1. Known signal-present and signal-absent PET sub-images were extracted from multiple scans of the same phantom and with detectability in a challenging (i.e., useful) range. These images enabled calculation and comparison of the quantitative observer detectability metrics between scanner designs and image reconstruction methods. The phantom design has several advantages including filling simplicity, wall-less contrast features, the control of the detectability range via feature size, and a clinically realistic lumpy background. Conclusions: This phantom provides a practical method for testing and comparison of lesion detectability as a function of imaging system, acquisition parameters, and image reconstruction methods and parameters.« less

  8. Occurrence of Organic Wastewater Contaminants, Pharmaceuticals, and Personal Care Products in Selected Water Supplies, Cape Cod, Massachusetts, June 2004

    DTIC Science & Technology

    2005-01-01

    previously detected high nitrate concen- trations. (Phenol and d- limonene , detected in equipment blanks at unacceptably high concentrations, are not...both tables, were not counted twice. (Phenol and d- limonene , detected in equipment blanks at unaccept- ably high concentrations, are not included in...The surrogate recoveries (not included in table 2) for the PPCP method were 101 and 102 percent. Three compounds, d- limonene , phenol, and

  9. Microfluidic devices with thick-film electrochemical detection

    DOEpatents

    Wang, Joseph; Tian, Baomin; Sahlin, Eskil

    2005-04-12

    An apparatus for conducting a microfluidic process and analysis, including at least one elongated microfluidic channel, fluidic transport means for transport of fluids through the microfluidic channel, and at least one thick-film electrode in fluidic connection with the outlet end of the microfluidic channel. The present invention includes an integrated on-chip combination reaction, separation and thick-film electrochemical detection microsystem, for use in detection of a wide range of analytes, and methods for the use thereof.

  10. Machine learning plus optical flow: a simple and sensitive method to detect cardioactive drugs

    NASA Astrophysics Data System (ADS)

    Lee, Eugene K.; Kurokawa, Yosuke K.; Tu, Robin; George, Steven C.; Khine, Michelle

    2015-07-01

    Current preclinical screening methods do not adequately detect cardiotoxicity. Using human induced pluripotent stem cell-derived cardiomyocytes (iPS-CMs), more physiologically relevant preclinical or patient-specific screening to detect potential cardiotoxic effects of drug candidates may be possible. However, one of the persistent challenges for developing a high-throughput drug screening platform using iPS-CMs is the need to develop a simple and reliable method to measure key electrophysiological and contractile parameters. To address this need, we have developed a platform that combines machine learning paired with brightfield optical flow as a simple and robust tool that can automate the detection of cardiomyocyte drug effects. Using three cardioactive drugs of different mechanisms, including those with primarily electrophysiological effects, we demonstrate the general applicability of this screening method to detect subtle changes in cardiomyocyte contraction. Requiring only brightfield images of cardiomyocyte contractions, we detect changes in cardiomyocyte contraction comparable to - and even superior to - fluorescence readouts. This automated method serves as a widely applicable screening tool to characterize the effects of drugs on cardiomyocyte function.

  11. Rapid Detection Methods for Asphalt Pavement Thicknesses and Defects by a Vehicle-Mounted Ground Penetrating Radar (GPR) System

    PubMed Central

    Dong, Zehua; Ye, Shengbo; Gao, Yunze; Fang, Guangyou; Zhang, Xiaojuan; Xue, Zhongjun; Zhang, Tao

    2016-01-01

    The thickness estimation of the top surface layer and surface layer, as well as the detection of road defects, are of great importance to the quality conditions of asphalt pavement. Although ground penetrating radar (GPR) methods have been widely used in non-destructive detection of pavements, the thickness estimation of the thin top surface layer is still a difficult problem due to the limitations of GPR resolution and the similar permittivity of asphalt sub-layers. Besides, the detection of some road defects, including inadequate compaction and delamination at interfaces, require further practical study. In this paper, a newly-developed vehicle-mounted GPR detection system is introduced. We used a horizontal high-pass filter and a modified layer localization method to extract the underground layers. Besides, according to lab experiments and simulation analysis, we proposed theoretical methods for detecting the degree of compaction and delamination at the interface, respectively. Moreover, a field test was carried out and the estimated results showed a satisfactory accuracy of the system and methods. PMID:27929409

  12. Rapid Detection Methods for Asphalt Pavement Thicknesses and Defects by a Vehicle-Mounted Ground Penetrating Radar (GPR) System.

    PubMed

    Dong, Zehua; Ye, Shengbo; Gao, Yunze; Fang, Guangyou; Zhang, Xiaojuan; Xue, Zhongjun; Zhang, Tao

    2016-12-06

    The thickness estimation of the top surface layer and surface layer, as well as the detection of road defects, are of great importance to the quality conditions of asphalt pavement. Although ground penetrating radar (GPR) methods have been widely used in non-destructive detection of pavements, the thickness estimation of the thin top surface layer is still a difficult problem due to the limitations of GPR resolution and the similar permittivity of asphalt sub-layers. Besides, the detection of some road defects, including inadequate compaction and delamination at interfaces, require further practical study. In this paper, a newly-developed vehicle-mounted GPR detection system is introduced. We used a horizontal high-pass filter and a modified layer localization method to extract the underground layers. Besides, according to lab experiments and simulation analysis, we proposed theoretical methods for detecting the degree of compaction and delamination at the interface, respectively. Moreover, a field test was carried out and the estimated results showed a satisfactory accuracy of the system and methods.

  13. Detection of proteins using a colorimetric bio-barcode assay.

    PubMed

    Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T

    2007-01-01

    The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).

  14. Systems and methods for detecting and processing

    DOEpatents

    Johnson, Michael M [Livermore, CA; Yoshimura, Ann S [Tracy, CA

    2006-03-28

    Embodiments of the present invention provides systems and method for detecting. Sensing modules are provided in communication with one or more detectors. In some embodiments, detectors are provided that are sensitive to chemical, biological, or radiological agents. Embodiments of sensing modules include processing capabilities to analyze, perform computations on, and/or run models to predict or interpret data received from one or more detectors. Embodiments of sensing modules form various network configurations with one another and/or with one or more data aggregation devices. Some embodiments of sensing modules include power management functionalities.

  15. Methods and systems for detecting abnormal digital traffic

    DOEpatents

    Goranson, Craig A [Kennewick, WA; Burnette, John R [Kennewick, WA

    2011-03-22

    Aspects of the present invention encompass methods and systems for detecting abnormal digital traffic by assigning characterizations of network behaviors according to knowledge nodes and calculating a confidence value based on the characterizations from at least one knowledge node and on weighting factors associated with the knowledge nodes. The knowledge nodes include a characterization model based on prior network information. At least one of the knowledge nodes should not be based on fixed thresholds or signatures. The confidence value includes a quantification of the degree of confidence that the network behaviors constitute abnormal network traffic.

  16. 49 CFR 1546.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, a physical search... of any explosive or incendiary. Each foreign air carrier operating a program under § 1546.101(a), (b...

  17. 49 CFR 1546.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, a physical search... of any explosive or incendiary. Each foreign air carrier operating a program under § 1546.101(a), (b...

  18. 49 CFR 1546.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, a physical search... of any explosive or incendiary. Each foreign air carrier operating a program under § 1546.101(a), (b...

  19. 49 CFR 1546.205 - Acceptance and screening of cargo.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... in its security program. Such methods may include TSA-approved x-ray systems, explosives detection systems, explosives trace detection, explosives detection canine teams certified by TSA, a physical search... of any explosive or incendiary. Each foreign air carrier operating a program under § 1546.101(a), (b...

  20. Culture-dependent enumeration methods failed to simultaneously detect disinfectant-injured and genetically modified Escherichia coli in drinking water.

    PubMed

    Li, Jing; Liu, Lu; Yang, Dong; Liu, Wei-Li; Shen, Zhi-Qiang; Qu, Hong-Mei; Qiu, Zhi-Gang; Hou, Ai-Ming; Wang, Da-Ning; Ding, Chen-Shi; Li, Jun-Wen; Guo, Jian-Hua; Jin, Min

    2017-05-24

    Underestimation of Escherichia coli in drinking water, an indicator microorganism of sanitary risk, may result in potential risks of waterborne diseases. However, the detection of disinfectant-injured or genetically modified (GM) E. coli has been largely overlooked so far. To evaluate the accuracy of culture-dependent enumeration with regard to disinfectant-injured and GM E. coli, chlorine- or ozone-injured wild-type (WT) and GM E. coli were prepared and characterized. Then, water samples contaminated with these E. coli strains were assayed by four widely used methods, including lactose tryptose broth-based multiple-tube fermentation (MTF), m-endo-based membrane filtration method (MFM), an enzyme substrate test (EST) known as Colilert, and Petrifilm-based testing slip method (TSM). It was found that MTF was the most effective method to detect disinfectant-injured WT E. coli (with 76.9% trials detecting all these bacteria), while this method could not effectively detect GM E. coli (with uninjured bacteria undetectable and a maximal detection rate of 21.5% for the injured). The EST was the only method which enabled considerable enumeration of uninjured GM E. coli, with a detection rate of over 93%. However, the detection rate declined to lower than 45.4% once the GM E. coli was injured by disinfectants. The MFM was invalid for both disinfectant-injured and GM E. coli. This is the first study to report the failure of these commonly used enumeration methods to simultaneously detect disinfectant-injured and GM E. coli. Thus, it highlights the urgent requirement for the development of a more accurate and versatile enumeration method which allows the detection of disinfectant-injured and GM E. coli on the assessment of microbial quality of drinking water.

  1. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    PubMed

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  2. Edge detection, cosmic strings and the south pole telescope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stewart, Andrew; Brandenberger, Robert, E-mail: stewarta@physics.mcgill.ca, E-mail: rhb@physics.mcgill.ca

    2009-02-15

    We develop a method of constraining the cosmic string tension G{mu} which uses the Canny edge detection algorithm as a means of searching CMB temperature maps for the signature of the Kaiser-Stebbins effect. We test the potential of this method using high resolution, simulated CMB temperature maps. By modeling the future output from the South Pole Telescope project (including anticipated instrumental noise), we find that cosmic strings with G{mu} > 5.5 Multiplication-Sign 10{sup -8} could be detected.

  3. Real-time PCR and NASBA for rapid and sensitive detection of Vibrio cholerae in ballast water.

    PubMed

    Fykse, Else M; Nilsen, Trine; Nielsen, Agnete Dessen; Tryland, Ingun; Delacroix, Stephanie; Blatny, Janet M

    2012-02-01

    Transport of ballast water is one major factor in the transmission of aquatic organisms, including pathogenic bacteria. The IMO-guidelines of the Convention for the Control and Management of Ships' Ballast Water and Sediments, states that ships are to discharge <1 CFU per 100 ml ballast water of toxigenic Vibrio cholerae, emphasizing the need to establish test methods. To our knowledge, there are no methods sensitive and rapid enough available for cholera surveillance of ballast water. In this study real-time PCR and NASBA methods have been evaluated to specifically detect 1 CFU/100ml of V. cholerae in ballast water. Ballast water samples spiked with V. cholerae cells were filtered and enriched in alkaline peptone water before PCR or NASBA detection. The entire method, including sample preparation and analysis was performed within 7 h, and has the potential to be used for analysis of ballast water for inspection and enforcement control. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  5. Recent patents for detecting the species of origin in animal feedstuff, and raw and processed meat products.

    PubMed

    Rogberg-Muñoz, Andrés; Posik, Diego M; Rípoli, María V; Falomir Lockhart, Agustín H; Peral-García, Pilar; Giovambattista, Guillermo

    2013-04-01

    The value of the traceability and labeling of food is attributable to two main aspects: health safety and/or product or process certification. The identification of the species related to meat production is still a major concern for economic, religious and health reasons. Many approaches and technologies have been used for species identification in animal feedstuff and food. The early methods for meat products identification include physical, anatomical, histological and chemical. Since 1970, a variety of methods were developed, these include electrophoresis (i.e. isoelectrofocusing), chromatography (i.e. HPLC), immunological techniques (i.e. ELISA), Nuclear Magnetic Resonance, Mass Spectrometry and PCR (DNA and RNA based methods). The recent patents on species detection in animal feedstuffs, raw meat and meat processed products, listed in this work, are mainly based on monoclonal antibodies and PCR, especially RT-PCR. The new developments under research are looking for more sensible, specific, less time consuming and quantitatively detection methods, which can be used in highly processed or heated treated meat food.

  6. Systems and methods for detecting an image of an object using multi-beam imaging from an X-ray beam having a polychromatic distribution

    DOEpatents

    Parham, Christopher A; Zhong, Zhong; Pisano, Etta; Connor, Jr., Dean M

    2015-03-03

    Systems and methods for detecting an image of an object using a multi-beam imaging system from an x-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a plurality of monochromator crystals in a predetermined position to directly intercept the first X-ray beam such that a plurality of second X-ray beams having predetermined energy levels are produced. Further, an object can be positioned in the path of the second X-ray beams for transmission of the second X-ray beams through the object and emission from the object as transmitted X-ray beams. The transmitted X-ray beams can each be directed at an angle of incidence upon one or more crystal analyzers. Further, an image of the object can be detected from the beams diffracted from the analyzer crystals.

  7. SiPM electro-optical detection system noise suppression method

    NASA Astrophysics Data System (ADS)

    Bi, Xiangli; Yang, Suhui; Hu, Tao; Song, Yiheng

    2014-11-01

    In this paper, the single photon detection principle of Silicon Photomultipliers (SiPM) device is introduced. The main noise factors that infect the sensitivity of the electro-optical detection system are analyzed, including background light noise, detector dark noise, preamplifier noise and signal light noise etc. The Optical, electrical and thermodynamic methods are used to suppress the SiPM electro-optical detection system noise, which improved the response sensitivity of the detector. Using SiPM optoelectronic detector with a even high sensitivity, together with small field large aperture optical system, high cutoff narrow bandwidth filters, low-noise operational amplifier circuit, the modular design of functional circuit, semiconductor refrigeration technology, greatly improved the sensitivity of optical detection system, reduced system noise and achieved long-range detection of weak laser radiation signal. Theoretical analysis and experimental results show that the proposed methods are reasonable and efficient.

  8. Detection of rhabdovirus viral RNA in oropharyngeal swabs and ectoparasites of Spanish bats.

    PubMed

    Aznar-Lopez, Carolina; Vazquez-Moron, Sonia; Marston, Denise A; Juste, Javier; Ibáñez, Carlos; Berciano, Jose Miguel; Salsamendi, Egoitz; Aihartza, Joxerra; Banyard, Ashley C; McElhinney, Lorraine; Fooks, Anthony R; Echevarria, Juan

    2013-01-01

    Rhabdoviruses infect a variety of hosts, including mammals, birds, reptiles, fish, insects and plants. As bats are the natural host for most members of the genus Lyssavirus, the specificity of the amplification methods used for active surveillance is usually restricted to lyssaviruses. However, the presence of other rhabdoviruses in bats has also been reported. In order to broaden the scope of such methods, a new RT-PCR, able to detect a diverse range of rhabdoviruses, was designed. The method detected 81 of 86 different rhabdoviruses. In total, 1488 oropharyngeal bat swabs and 38 nycteribiid samples were analysed, and 17 unique rhabdovirus-related sequences were detected. Phylogenetic analysis suggested that those sequences detected in bats did not constitute a monophyletic group, even when originating from the same bat species. However, all of the sequences detected in nycteribiids and one sequence obtained from a bat did constitute a monophyletic group with Drosophila melanogaster sigma rhabdovirus.

  9. Novel approach for the simultaneous detection of DNA from different fish species based on a nuclear target: quantification potential.

    PubMed

    Prado, Marta; Boix, Ana; von Holst, Christoph

    2012-07-01

    The development of DNA-based methods for the identification and quantification of fish in food and feed samples is frequently focused on a specific fish species and/or on the detection of mitochondrial DNA of fish origin. However, a quantitative method for the most common fish species used by the food and feed industry is needed for official control purposes, and such a method should rely on the use of a single-copy nuclear DNA target owing to its more stable copy number in different tissues. In this article, we report on the development of a real-time PCR method based on the use of a nuclear gene as a target for the simultaneous detection of fish DNA from different species and on the evaluation of its quantification potential. The method was tested in 22 different fish species, including those most commonly used by the food and feed industry, and in negative control samples, which included 15 animal species and nine feed ingredients. The results show that the method reported here complies with the requirements concerning specificity and with the criteria required for real-time PCR methods with high sensitivity.

  10. Solution-grown crystals for neutron radiation detectors, and methods of solution growth

    DOEpatents

    Zaitseva, Natalia P; Hull, Giulia; Cherepy, Nerine J; Payne, Stephen A; Stoeffl, Wolfgang

    2012-06-26

    A method according to one embodiment includes growing an organic crystal from solution, the organic crystal exhibiting a signal response signature for neutrons from a radioactive source. A system according to one embodiment includes an organic crystal having physical characteristics of formation from solution, the organic crystal exhibiting a signal response signature for neutrons from a radioactive source; and a photodetector for detecting the signal response of the organic crystal. A method according to another embodiment includes growing an organic crystal from solution, the organic crystal being large enough to exhibit a detectable signal response signature for neutrons from a radioactive source. An organic crystal according to another embodiment includes an organic crystal having physical characteristics of formation from solution, the organic crystal exhibiting a signal response signature for neutrons from a radioactive source, wherein the organic crystal has a length of greater than about 1 mm in one dimension.

  11. A multistage approach to improve performance of computer-aided detection of pulmonary embolisms depicted on CT images: preliminary investigation.

    PubMed

    Park, Sang Cheol; Chapman, Brian E; Zheng, Bin

    2011-06-01

    This study developed a computer-aided detection (CAD) scheme for pulmonary embolism (PE) detection and investigated several approaches to improve CAD performance. In the study, 20 computed tomography examinations with various lung diseases were selected, which include 44 verified PE lesions. The proposed CAD scheme consists of five basic steps: 1) lung segmentation; 2) PE candidate extraction using an intensity mask and tobogganing region growing; 3) PE candidate feature extraction; 4) false-positive (FP) reduction using an artificial neural network (ANN); and 5) a multifeature-based k-nearest neighbor for positive/negative classification. In this study, we also investigated the following additional methods to improve CAD performance: 1) grouping 2-D detected features into a single 3-D object; 2) selecting features with a genetic algorithm (GA); and 3) limiting the number of allowed suspicious lesions to be cued in one examination. The results showed that 1) CAD scheme using tobogganing, an ANN, and grouping method achieved the maximum detection sensitivity of 79.2%; 2) the maximum scoring method achieved the superior performance over other scoring fusion methods; 3) GA was able to delete "redundant" features and further improve CAD performance; and 4) limiting the maximum number of cued lesions in an examination reduced FP rate by 5.3 times. Combining these approaches, CAD scheme achieved 63.2% detection sensitivity with 18.4 FP lesions per examination. The study suggested that performance of CAD schemes for PE detection depends on many factors that include 1) optimizing the 2-D region grouping and scoring methods; 2) selecting the optimal feature set; and 3) limiting the number of allowed cueing lesions per examination.

  12. Dosimetry using silver salts

    DOEpatents

    Warner, Benjamin P.

    2003-06-24

    The present invention provides a method for detecting ionizing radiation. Exposure of silver salt AgX to ionizing radiation results in the partial reduction of the salt to a mixture of silver salt and silver metal. The mixture is further reduced by a reducing agent, which causes the production of acid (HX) and the oxidized form of the reducing agent (R). Detection of HX indicates that the silver salt has been exposed to ionizing radiation. The oxidized form of the reducing agent (R) may also be detected. The invention also includes dosimeters employing the above method for detecting ionizing radiation.

  13. Method and means of passive detection of leaks in buried pipes

    DOEpatents

    Claytor, T.

    1979-10-30

    A method and means for passive detection of a leak in a buried pipe containing fluid under pressure includes a plurality of acoustic detectors that are placed in contact with the pipe. Noise produced by the leak is detected by the detectors, and the detected signals are correlated to locate the leak. In one embodiment of the invention two detectors are placed at different locations to locate a leak between them. In an alternate embodiment two detectors of different waves are placed at substantially the same location to determine the distance of the leak from the location.

  14. Method and means of passive detection of leaks in buried pipes

    DOEpatents

    Claytor, Thomas N.

    1981-01-01

    A method and means for passive detection of a leak in a buried pipe containing fluid under pressure includes a plurality of acoustic detectors that are placed in contact with the pipe. Noise produced by the leak is detected by the detectors, and the detected signals are correlated to locate the leak. In one embodiment of the invention two detectors are placed at different locations to locate a leak between them. In an alternate embodiment two detectors of different waves are placed at substantially the same location to determine the distance of the leak from the location.

  15. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOEpatents

    Norman, Eric B [Oakland, CA; Prussin, Stanley G [Kensington, CA

    2009-05-05

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  16. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOEpatents

    Norman, Eric B [Oakland, CA; Prussin, Stanley G [Kensington, CA

    2009-01-27

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  17. Detecting special nuclear materials in suspect containers using high-energy gamma rays emitted by fission products

    DOEpatents

    Norman, Eric B [Oakland, CA; Prussin, Stanley G [Kensington, CA

    2009-01-06

    A method and a system for detecting the presence of special nuclear materials in a suspect container. The system and its method include irradiating the suspect container with a beam of neutrons, so as to induce a thermal fission in a portion of the special nuclear materials, detecting the gamma rays that are emitted from the fission products formed by the thermal fission, to produce a detector signal, comparing the detector signal with a threshold value to form a comparison, and detecting the presence of the special nuclear materials using the comparison.

  18. Analysis of microdialysate monoamines, including noradrenaline, dopamine and serotonin, using capillary ultra-high performance liquid chromatography and electrochemical detection.

    PubMed

    Ferry, Barbara; Gifu, Elena-Patricia; Sandu, Ioana; Denoroy, Luc; Parrot, Sandrine

    2014-03-01

    Electrochemical methods are very often used to detect catecholamine and indolamine neurotransmitters separated by conventional reverse-phase high performance liquid chromatography (HPLC). The present paper presents the development of a chromatographic method to detect monoamines present in low-volume brain dialysis samples using a capillary column filled with sub-2μm particles. Several parameters (repeatability, linearity, accuracy, limit of detection) for this new ultrahigh performance liquid chromatography (UHPLC) method with electrochemical detection were examined after optimization of the analytical conditions. Noradrenaline, adrenaline, serotonin, dopamine and its metabolite 3-methoxytyramine were separated in 1μL of injected sample volume; they were detected above concentrations of 0.5-1nmol/L, with 2.1-9.5% accuracy and intra-assay repeatability equal to or less than 6%. The final method was applied to very low volume dialysates from rat brain containing monoamine traces. The study demonstrates that capillary UHPLC with electrochemical detection is suitable for monitoring dialysate monoamines collected at high sampling rate. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Thresholding Based on Maximum Weighted Object Correlation for Rail Defect Detection

    NASA Astrophysics Data System (ADS)

    Li, Qingyong; Huang, Yaping; Liang, Zhengping; Luo, Siwei

    Automatic thresholding is an important technique for rail defect detection, but traditional methods are not competent enough to fit the characteristics of this application. This paper proposes the Maximum Weighted Object Correlation (MWOC) thresholding method, fitting the features that rail images are unimodal and defect proportion is small. MWOC selects a threshold by optimizing the product of object correlation and the weight term that expresses the proportion of thresholded defects. Our experimental results demonstrate that MWOC achieves misclassification error of 0.85%, and outperforms the other well-established thresholding methods, including Otsu, maximum correlation thresholding, maximum entropy thresholding and valley-emphasis method, for the application of rail defect detection.

  20. Multi-residue method for the analysis of 85 current-use and legacy pesticides in bed and suspended sediments

    USGS Publications Warehouse

    Smalling, K.L.; Kuivila, K.M.

    2008-01-01

    A multi-residue method was developed for the simultaneous determination of 85 current-use and legacy organochlorine pesticides in a single sediment sample. After microwave-assisted extraction, clean-up of samples was optimized using gel permeation chromatography and either stacked carbon and alumina solid-phase extraction cartridges or a deactivated Florisil column. Analytes were determined by gas chromatography with ion-trap mass spectrometry and electron capture detection. Method detection limits ranged from 0.6 to 8.9 ??g/kg dry weight. Bed and suspended sediments from a variety of locations were analyzed to validate the method and 29 pesticides, including at least 1 from every class, were detected.

  1. Round-robin comparison of methods for the detection of human enteric viruses in lettuce.

    PubMed

    Le Guyader, Françoise S; Schultz, Anna-Charlotte; Haugarreau, Larissa; Croci, Luciana; Maunula, Leena; Duizer, Erwin; Lodder-Verschoor, Froukje; von Bonsdorff, Carl-Henrik; Suffredini, Elizabetha; van der Poel, Wim M M; Reymundo, Rosanna; Koopmans, Marion

    2004-10-01

    Five methods that detect human enteric virus contamination in lettuce were compared. To mimic multiple contaminations as observed after sewage contamination, artificial contamination was with human calicivirus and poliovirus and animal calicivirus strains at different concentrations. Nucleic acid extractions were done at the same time in the same laboratory to reduce assay-to-assay variability. Results showed that the two critical steps are the washing step and removal of inhibitors. The more reliable methods (sensitivity, simplicity, low cost) included an elution/concentration step and a commercial kit. Such development of sensitive methods for viral detection in foods other than shellfish is important to improve food safety.

  2. A comparative study on methods of improving SCR for ship detection in SAR image

    NASA Astrophysics Data System (ADS)

    Lang, Haitao; Shi, Hongji; Tao, Yunhong; Ma, Li

    2017-10-01

    Knowledge about ship positions plays a critical role in a wide range of maritime applications. To improve the performance of ship detector in SAR image, an effective strategy is improving the signal-to-clutter ratio (SCR) before conducting detection. In this paper, we present a comparative study on methods of improving SCR, including power-law scaling (PLS), max-mean and max-median filter (MMF1 and MMF2), method of wavelet transform (TWT), traditional SPAN detector, reflection symmetric metric (RSM), scattering mechanism metric (SMM). The ability of SCR improvement to SAR image and ship detection performance associated with cell- averaging CFAR (CA-CFAR) of different methods are evaluated on two real SAR data.

  3. Use of Multiscale Entropy to Facilitate Artifact Detection in Electroencephalographic Signals

    PubMed Central

    Mariani, Sara; Borges, Ana F. T.; Henriques, Teresa; Goldberger, Ary L.; Costa, Madalena D.

    2016-01-01

    Electroencephalographic (EEG) signals present a myriad of challenges to analysis, beginning with the detection of artifacts. Prior approaches to noise detection have utilized multiple techniques, including visual methods, independent component analysis and wavelets. However, no single method is broadly accepted, inviting alternative ways to address this problem. Here, we introduce a novel approach based on a statistical physics method, multiscale entropy (MSE) analysis, which quantifies the complexity of a signal. We postulate that noise corrupted EEG signals have lower information content, and, therefore, reduced complexity compared with their noise free counterparts. We test the new method on an open-access database of EEG signals with and without added artifacts due to electrode motion. PMID:26738116

  4. Temperature detection in a gas turbine

    DOEpatents

    Lacy, Benjamin; Kraemer, Gilbert; Stevenson, Christian

    2012-12-18

    A temperature detector includes a first metal and a second metal different from the first metal. The first metal includes a plurality of wires and the second metal includes a wire. The plurality of wires of the first metal are connected to the wire of the second metal in parallel junctions. Another temperature detector includes a plurality of resistance temperature detectors. The plurality of resistance temperature detectors are connected at a plurality of junctions. A method of detecting a temperature change of a component of a turbine includes providing a temperature detector include ing a first metal and a second metal different from the first metal connected to each other at a plurality of junctions in contact with the component; and detecting any voltage change at any junction.

  5. Efficient Forest Fire Detection Index for Application in Unmanned Aerial Systems (UASs).

    PubMed

    Cruz, Henry; Eckert, Martina; Meneses, Juan; Martínez, José-Fernán

    2016-06-16

    This article proposes a novel method for detecting forest fires, through the use of a new color index, called the Forest Fire Detection Index (FFDI), developed by the authors. The index is based on methods for vegetation classification and has been adapted to detect the tonalities of flames and smoke; the latter could be included adaptively into the Regions of Interest (RoIs) with the help of a variable factor. Multiple tests have been performed upon database imagery and present promising results: a detection precision of 96.82% has been achieved for image sizes of 960 × 540 pixels at a processing time of 0.0447 seconds. This achievement would lead to a performance of 22 f/s, for smaller images, while up to 54 f/s could be reached by maintaining a similar detection precision. Additional tests have been performed on fires in their early stages, achieving a precision rate of p = 96.62%. The method could be used in real-time in Unmanned Aerial Systems (UASs), with the aim of monitoring a wider area than through fixed surveillance systems. Thus, it would result in more cost-effective outcomes than conventional systems implemented in helicopters or satellites. UASs could also reach inaccessible locations without jeopardizing people's safety. On-going work includes implementation into a commercially available drone.

  6. Advancing the detection of steady-state visual evoked potentials in brain-computer interfaces.

    PubMed

    Abu-Alqumsan, Mohammad; Peer, Angelika

    2016-06-01

    Spatial filtering has proved to be a powerful pre-processing step in detection of steady-state visual evoked potentials and boosted typical detection rates both in offline analysis and online SSVEP-based brain-computer interface applications. State-of-the-art detection methods and the spatial filters used thereby share many common foundations as they all build upon the second order statistics of the acquired Electroencephalographic (EEG) data, that is, its spatial autocovariance and cross-covariance with what is assumed to be a pure SSVEP response. The present study aims at highlighting the similarities and differences between these methods. We consider the canonical correlation analysis (CCA) method as a basis for the theoretical and empirical (with real EEG data) analysis of the state-of-the-art detection methods and the spatial filters used thereby. We build upon the findings of this analysis and prior research and propose a new detection method (CVARS) that combines the power of the canonical variates and that of the autoregressive spectral analysis in estimating the signal and noise power levels. We found that the multivariate synchronization index method and the maximum contrast combination method are variations of the CCA method. All three methods were found to provide relatively unreliable detections in low signal-to-noise ratio (SNR) regimes. CVARS and the minimum energy combination methods were found to provide better estimates for different SNR levels. Our theoretical and empirical results demonstrate that the proposed CVARS method outperforms other state-of-the-art detection methods when used in an unsupervised fashion. Furthermore, when used in a supervised fashion, a linear classifier learned from a short training session is able to estimate the hidden user intention, including the idle state (when the user is not attending to any stimulus), rapidly, accurately and reliably.

  7. Classification methods to detect sleep apnea in adults based on respiratory and oximetry signals: a systematic review.

    PubMed

    Uddin, M B; Chow, C M; Su, S W

    2018-03-26

    Sleep apnea (SA), a common sleep disorder, can significantly decrease the quality of life, and is closely associated with major health risks such as cardiovascular disease, sudden death, depression, and hypertension. The normal diagnostic process of SA using polysomnography is costly and time consuming. In addition, the accuracy of different classification methods to detect SA varies with the use of different physiological signals. If an effective, reliable, and accurate classification method is developed, then the diagnosis of SA and its associated treatment will be time-efficient and economical. This study aims to systematically review the literature and present an overview of classification methods to detect SA using respiratory and oximetry signals and address the automated detection approach. Sixty-two included studies revealed the application of single and multiple signals (respiratory and oximetry) for the diagnosis of SA. Both airflow and oxygen saturation signals alone were effective in detecting SA in the case of binary decision-making, whereas multiple signals were good for multi-class detection. In addition, some machine learning methods were superior to the other classification methods for SA detection using respiratory and oximetry signals. To deal with the respiratory and oximetry signals, a good choice of classification method as well as the consideration of associated factors would result in high accuracy in the detection of SA. An accurate classification method should provide a high detection rate with an automated (independent of human action) analysis of respiratory and oximetry signals. Future high-quality automated studies using large samples of data from multiple patient groups or record batches are recommended.

  8. Method and apparatus for extraction of low-frequency artifacts from brain waves for alertness detection

    DOEpatents

    Clapp, N.E.; Hively, L.M.

    1997-05-06

    Methods and apparatus automatically detect alertness in humans by monitoring and analyzing brain wave signals. Steps include: acquiring the brain wave (EEG or MEG) data from the subject, digitizing the data, separating artifact data from raw data, and comparing trends in f-data to alertness indicators, providing notification of inadequate alertness. 4 figs.

  9. Use of vectors in sequence analysis.

    PubMed

    Ishikawa, T; Yamamoto, K; Yoshikura, H

    1987-10-01

    Applications of the vector diagram, a new type of representation of protein structure, in homology search of various proteins including oncogene products are presented. The method takes account of various kinds of information concerning the properties of amino acids, such as Chou and Fasman's probability data. The method can detect conformational similarities of proteins which may not be detected by the conventional programs.

  10. Confocal laser scanning microscopy detection of chlorophylls and carotenoids in chloroplasts and chromoplasts of tomato fruit.

    PubMed

    D'Andrea, Lucio; Amenós, Montse; Rodríguez-Concepción, Manuel

    2014-01-01

    Plant cells are unique among eukaryotic cells because of the presence of plastids, including chloroplasts and chromoplasts. Chloroplasts are found in green tissues and harbor the photosynthetic machinery (including chlorophyll molecules), while chromoplasts are present in non-photosynthetic tissues and accumulate large amounts of carotenoids. During tomato fruit development, chloroplasts are converted into chromoplasts that accumulate high levels of lycopene, a linear carotenoid responsible for the characteristic red color of ripe fruit. Here, we describe a simple and fast method to detect both types of fully differentiated plastids (chloroplasts and chromoplasts), as well as intermediate stages, in fresh tomato fruits. The method is based on the differential autofluorescence of chlorophylls and carotenoids (lycopene) detected by Confocal Laser Scanning Microscopy.

  11. Aerosol beam-focus laser-induced plasma spectrometer device

    DOEpatents

    Cheng, Meng-Dawn

    2002-01-01

    An apparatus for detecting elements in an aerosol includes an aerosol beam focuser for concentrating aerosol into an aerosol beam; a laser for directing a laser beam into the aerosol beam to form a plasma; a detection device that detects a wavelength of a light emission caused by the formation of the plasma. The detection device can be a spectrometer having at least one grating and a gated intensified charge-coupled device. The apparatus may also include a processor that correlates the wavelength of the light emission caused by the formation of the plasma with an identity of an element that corresponds to the wavelength. Furthermore, the apparatus can also include an aerosol generator for forming an aerosol beam from bulk materials. A method for detecting elements in an aerosol is also disclosed.

  12. Micromechanical potentiometric sensors

    DOEpatents

    Thundat, Thomas G.

    2000-01-01

    A microcantilever potentiometric sensor utilized for detecting and measuring physical and chemical parameters in a sample of media is described. The microcantilevered spring element includes at least one chemical coating on a coated region, that accumulates a surface charge in response to hydrogen ions, redox potential, or ion concentrations in a sample of the media being monitored. The accumulation of surface charge on one surface of the microcantilever, with a differing surface charge on an opposing surface, creates a mechanical stress and a deflection of the spring element. One of a multitude of deflection detection methods may include the use of a laser light source focused on the microcantilever, with a photo-sensitive detector receiving reflected laser impulses. The microcantilevered spring element is approximately 1 to 100 .mu.m long, approximately 1 to 50 .mu.m wide, and approximately 0.3 to 3.0 .mu.m thick. An accuracy of detection of deflections of the cantilever is provided in the range of 0.01 nanometers of deflection. The microcantilever apparatus and a method of detection of parameters require only microliters of a sample to be placed on, or near the spring element surface. The method is extremely sensitive to the detection of the parameters to be measured.

  13. Methods for simultaneous detection of the cyanotoxins BMAA, DABA, and anatoxin-a in environmental samples.

    PubMed

    Al-Sammak, Maitham Ahmed; Hoagland, Kyle D; Snow, Daniel D; Cassada, David

    2013-12-15

    Blue-green algae, also known as cyanobacteria, can produce several different groups of toxins in the environment including hepatotoxins (microcystins), neurotoxic non-protein amino acids β-methylamino-l-alanine (BMAA), and 2,4-diaminobutyric (DABA), as well as the bicyclic amine alkaloid anatoxin-a. Few studies have addressed the methods necessary for an accurate determination of cyanotoxins in environmental samples, and none have been published that can detect these cyanotoxins together in a single sample. Cyanotoxins occur in a wide range of environmental samples including water, fish, and aquatic plant samples. Using polymeric cation exchange solid phase extraction (SPE) coupled with liquid chromatography and fluorescence detection (HPLC/FD), and liquid chromatography ion trap tandem mass spectrometry (LC/MS/MS), these compounds can for the first time be simultaneously quantified in a variety of environmental sample types. The extraction method for biological samples can distinguish bound and free cyanotoxins. Detection limits for water ranged from 5 to 7 μg/L using HPLC/FD, while detection limits for and LC/MS were in the range of 0.8-3.2 μg/L. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Probabilistic BPRRC: Robust Change Detection against Illumination Changes and Background Movements

    NASA Astrophysics Data System (ADS)

    Yokoi, Kentaro

    This paper presents Probabilistic Bi-polar Radial Reach Correlation (PrBPRRC), a change detection method that is robust against illumination changes and background movements. Most of the traditional change detection methods are robust against either illumination changes or background movements; BPRRC is one of the illumination-robust change detection methods. We introduce a probabilistic background texture model into BPRRC and add the robustness against background movements including foreground invasions such as moving cars, walking people, swaying trees, and falling snow. We show the superiority of PrBPRRC in the environment with illumination changes and background movements by using three public datasets and one private dataset: ATON Highway data, Karlsruhe traffic sequence data, PETS 2007 data, and Walking-in-a-room data.

  15. Detection of Atrial Fibrillation Using Artifical Neural Network with Power Spectrum Density of RR Interval of Electrocardiogram

    NASA Astrophysics Data System (ADS)

    Afdala, Adfal; Nuryani, Nuryani; Satrio Nugroho, Anto

    2017-01-01

    Atrial fibrillation (AF) is a disorder of the heart with fairly high mortality in adults. AF is a common heart arrythmia which is characterized by a missing or irregular contraction of atria. Therefore, finding a method to detect atrial fibrillation is necessary. In this article a system to detect atrial fibrillation has been proposed. Detection system utilized backpropagation artifical neural network. Data input in this method includes power spectrum density of R-peaks interval of electrocardiogram which is selected by wrapping method. This research uses parameter learning rate, momentum, epoch and hidden layer. System produces good performance with accuracy, sensitivity, and specificity of 83.55%, 86.72 % and 81.47 %, respectively.

  16. Face liveness detection for face recognition based on cardiac features of skin color image

    NASA Astrophysics Data System (ADS)

    Suh, Kun Ha; Lee, Eui Chul

    2016-07-01

    With the growth of biometric technology, spoofing attacks have been emerged a threat to the security of the system. Main spoofing scenarios in the face recognition system include the printing attack, replay attack, and 3D mask attack. To prevent such attacks, techniques that evaluating liveness of the biometric data can be considered as a solution. In this paper, a novel face liveness detection method based on cardiac signal extracted from face is presented. The key point of proposed method is that the cardiac characteristic is detected in live faces but not detected in non-live faces. Experimental results showed that the proposed method can be effective way for determining printing attack or 3D mask attack.

  17. Rapid detection of α-thalassaemia variants using droplet digital PCR.

    PubMed

    Lee, T-Y; Lai, M-I; Ramachandran, V; Tan, J A M A; Teh, L-K; Othman, R; Hussein, N H; George, E

    2016-08-01

    Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately. The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR). This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously. In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia. © 2016 John Wiley & Sons Ltd.

  18. Protocol vulnerability detection based on network traffic analysis and binary reverse engineering.

    PubMed

    Wen, Shameng; Meng, Qingkun; Feng, Chao; Tang, Chaojing

    2017-01-01

    Network protocol vulnerability detection plays an important role in many domains, including protocol security analysis, application security, and network intrusion detection. In this study, by analyzing the general fuzzing method of network protocols, we propose a novel approach that combines network traffic analysis with the binary reverse engineering method. For network traffic analysis, the block-based protocol description language is introduced to construct test scripts, while the binary reverse engineering method employs the genetic algorithm with a fitness function designed to focus on code coverage. This combination leads to a substantial improvement in fuzz testing for network protocols. We build a prototype system and use it to test several real-world network protocol implementations. The experimental results show that the proposed approach detects vulnerabilities more efficiently and effectively than general fuzzing methods such as SPIKE.

  19. Quantitation of secreted proteins using mCherry fusion constructs and a fluorescent microplate reader.

    PubMed

    Duellman, Tyler; Burnett, John; Yang, Jay

    2015-03-15

    Traditional assays for secreted proteins include methods such as Western blot and enzyme-linked immunosorbent assay (ELISA) detection of the protein in the cell culture medium. We describe a method for the detection of a secreted protein based on fluorescent measurement of an mCherry fusion reporter. This microplate reader-based mCherry fluorescence detection method has a wide dynamic range of 4.5 orders of magnitude and a sensitivity that allows detection of 1 to 2fmol fusion protein. Comparison with the Western blot detection method indicated greater linearity, wider dynamic range, and a similar lower detection threshold for the microplate-based fluorescent detection assay of secreted fusion proteins. An mCherry fusion protein of matrix metalloproteinase-9 (MMP-9), a secreted glycoprotein, was created and expressed by transfection of human embryonic kidney (HEK) 293 cells. The cell culture medium was assayed for the presence of the fluorescent signal up to 32 h after transfection. The secreted MMP-9-mCherry fusion protein was detected 6h after transfection with a linear increase in signal intensity over time. Treatment with chloroquine, a drug known to inhibit the secretion of many proteins, abolished the MMP-9-mCherry secretion, demonstrating the utility of this method in a biological experiment. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. On-Site Detection as a Countermeasure to Chemical Warfare/Terrorism.

    PubMed

    Seto, Y

    2014-01-01

    On-site monitoring and detection are necessary in the crisis and consequence management of wars and terrorism involving chemical warfare agents (CWAs) such as sarin. The analytical performance required for on-site detection is mainly determined by the fatal vapor concentration and volatility of the CWAs involved. The analytical performance for presently available on-site technologies and commercially available on-site equipment for detecting CWAs interpreted and compared in this review include: classical manual methods, photometric methods, ion mobile spectrometry, vibrational spectrometry, gas chromatography, mass spectrometry, sensors, and other methods. Some of the data evaluated were obtained from our experiments using authentic CWAs. We concluded that (a) no technologies perfectly fulfill all of the on-site detection requirements and (b) adequate on-site detection requires (i) a combination of the monitoring-tape method and ion-mobility spectrometry for point detection and (ii) a combination of the monitoring-tape method, atmospheric pressure chemical ionization mass spectrometry with counterflow introduction, and gas chromatography with a trap and special detectors for continuous monitoring. The basic properties of CWAs, the concept of on-site detection, and the sarin gas attacks in Japan as well as the forensic investigations thereof, are also explicated in this article. Copyright © 2014 Central Police University.

  1. A survey on object detection in optical remote sensing images

    NASA Astrophysics Data System (ADS)

    Cheng, Gong; Han, Junwei

    2016-07-01

    Object detection in optical remote sensing images, being a fundamental but challenging problem in the field of aerial and satellite image analysis, plays an important role for a wide range of applications and is receiving significant attention in recent years. While enormous methods exist, a deep review of the literature concerning generic object detection is still lacking. This paper aims to provide a review of the recent progress in this field. Different from several previously published surveys that focus on a specific object class such as building and road, we concentrate on more generic object categories including, but are not limited to, road, building, tree, vehicle, ship, airport, urban-area. Covering about 270 publications we survey (1) template matching-based object detection methods, (2) knowledge-based object detection methods, (3) object-based image analysis (OBIA)-based object detection methods, (4) machine learning-based object detection methods, and (5) five publicly available datasets and three standard evaluation metrics. We also discuss the challenges of current studies and propose two promising research directions, namely deep learning-based feature representation and weakly supervised learning-based geospatial object detection. It is our hope that this survey will be beneficial for the researchers to have better understanding of this research field.

  2. Inferences about landbird abundance from count data: recent advances and future directions

    USGS Publications Warehouse

    Nichols, J.D.; Thomas, L.; Conn, P.B.; Thomson, David L.; Cooch, Evan G.; Conroy, Michael J.

    2009-01-01

    We summarize results of a November 2006 workshop dealing with recent research on the estimation of landbird abundance from count data. Our conceptual framework includes a decomposition of the probability of detecting a bird potentially exposed to sampling efforts into four separate probabilities. Primary inference methods are described and include distance sampling, multiple observers, time of detection, and repeated counts. The detection parameters estimated by these different approaches differ, leading to different interpretations of resulting estimates of density and abundance. Simultaneous use of combinations of these different inference approaches can not only lead to increased precision but also provides the ability to decompose components of the detection process. Recent efforts to test the efficacy of these different approaches using natural systems and a new bird radio test system provide sobering conclusions about the ability of observers to detect and localize birds in auditory surveys. Recent research is reported on efforts to deal with such potential sources of error as bird misclassification, measurement error, and density gradients. Methods for inference about spatial and temporal variation in avian abundance are outlined. Discussion topics include opinions about the need to estimate detection probability when drawing inference about avian abundance, methodological recommendations based on the current state of knowledge and suggestions for future research.

  3. Development of an Efficient Entire-Capsid-Coding-Region Amplification Method for Direct Detection of Poliovirus from Stool Extracts

    PubMed Central

    Kilpatrick, David R.; Nakamura, Tomofumi; Burns, Cara C.; Bukbuk, David; Oderinde, Soji B.; Oberste, M. Steven; Kew, Olen M.; Pallansch, Mark A.; Shimizu, Hiroyuki

    2014-01-01

    Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. PMID:25339406

  4. Making great leaps forward: Accounting for detectability in herpetological field studies

    USGS Publications Warehouse

    Mazerolle, Marc J.; Bailey, Larissa L.; Kendall, William L.; Royle, J. Andrew; Converse, Sarah J.; Nichols, James D.

    2007-01-01

    Detecting individuals of amphibian and reptile species can be a daunting task. Detection can be hindered by various factors such as cryptic behavior, color patterns, or observer experience. These factors complicate the estimation of state variables of interest (e.g., abundance, occupancy, species richness) as well as the vital rates that induce changes in these state variables (e.g., survival probabilities for abundance; extinction probabilities for occupancy). Although ad hoc methods (e.g., counts uncorrected for detection, return rates) typically perform poorly in the face of no detection, they continue to be used extensively in various fields, including herpetology. However, formal approaches that estimate and account for the probability of detection, such as capture-mark-recapture (CMR) methods and distance sampling, are available. In this paper, we present classical approaches and recent advances in methods accounting for detectability that are particularly pertinent for herpetological data sets. Through examples, we illustrate the use of several methods, discuss their performance compared to that of ad hoc methods, and we suggest available software to perform these analyses. The methods we discuss control for imperfect detection and reduce bias in estimates of demographic parameters such as population size, survival, or, at other levels of biological organization, species occurrence. Among these methods, recently developed approaches that no longer require marked or resighted individuals should be particularly of interest to field herpetologists. We hope that our effort will encourage practitioners to implement some of the estimation methods presented herein instead of relying on ad hoc methods that make more limiting assumptions.

  5. Real-time method and apparatus for measuring the temperature of a fluorescing phosphor

    DOEpatents

    Britton, Jr., Charles L.; Beshears, David L.; Simpson, Marc L.; Cates, Michael R.; Allison, Steve W.

    1999-01-01

    A method for determining the temperature of a fluorescing phosphor is provided, together with an apparatus for performing the method. The apparatus includes a photodetector for detecting light emitted by a phosphor irradiated with an excitation pulse and for converting the detected light into an electrical signal. The apparatus further includes a differentiator for differentiating the electrical signal and a zero-crossing discrimination circuit that outputs a pulse signal having a pulse width corresponding to the time period between the start of the excitation pulse and the time when the differentiated electrical signal reaches zero. The width of the output pulse signal is proportional to the decay-time constant of the phosphor.

  6. Electrically conductive proppant and methods for detecting, locating and characterizing the electrically conductive proppant

    DOEpatents

    Cannan, Chad; Bartel, Lewis; Palisch, Terrence; Aldridge, David

    2015-01-13

    Electrically conductive proppants and methods for detecting, locating, and characterizing same are provided. The electrically conductive proppant can include a substantially uniform coating of an electrically conductive material having a thickness of at least 500 nm. The method can include injecting a hydraulic fluid into a wellbore extending into a subterranean formation at a rate and pressure sufficient to open a fracture therein, injecting into the fracture a fluid containing the electrically conductive proppant, electrically energizing the earth at or near the fracture, and measuring three dimensional (x, y, and z) components of electric and magnetic field responses at a surface of the earth or in an adjacent wellbore.

  7. Screen for Carbon Dioxide.

    ERIC Educational Resources Information Center

    Foster, John; And Others

    1986-01-01

    Presents a set of laboratory experiments that can assist students in the detection of carbon dioxide. Offers a variation of the supported drop method of carbon dioxide detection that provides readily visible positive results. Includes background information on carbon dioxide. (ML)

  8. QUALITY ASSESSMENT OF CONFOCAL MICROSCOPY SLIDE-BASED SYSTEMS: INSTABLITY

    EPA Science Inventory

    Background: All slide-based fluorescence cytometry detections systems basically include an excitation light source, intermediate optics, and a detection device (CCD or PMT). Occasionally, this equipment becomes unstable, generating unreliable and inferior data. Methods: A num...

  9. Method and apparatus for detecting timing errors in a system oscillator

    DOEpatents

    Gliebe, Ronald J.; Kramer, William R.

    1993-01-01

    A method of detecting timing errors in a system oscillator for an electronic device, such as a power supply, includes the step of comparing a system oscillator signal with a delayed generated signal and generating a signal representative of the timing error when the system oscillator signal is not identical to the delayed signal. An LED indicates to an operator that a timing error has occurred. A hardware circuit implements the above-identified method.

  10. Method of detecting leakage of reactor core components of liquid metal cooled fast reactors

    DOEpatents

    Holt, Fred E.; Cash, Robert J.; Schenter, Robert E.

    1977-01-01

    A method of detecting the failure of a sealed non-fueled core component of a liquid-metal cooled fast reactor having an inert cover gas. A gas mixture is incorporated in the component which includes Xenon-124; under neutron irradiation, Xenon-124 is converted to radioactive Xenon-125. The cover gas is scanned by a radiation detector. The occurrence of 188 Kev gamma radiation and/or other identifying gamma radiation-energy level indicates the presence of Xenon-125 and therefore leakage of a component. Similarly, Xe-126, which transmutes to Xe-127 and Kr-84, which produces Kr-85.sup.m can be used for detection of leakage. Different components are charged with mixtures including different ratios of isotopes other than Xenon-124. On detection of the identifying radiation, the cover gas is subjected to mass spectroscopic analysis to locate the leaking component.

  11. Method for the detection of nitro-containing compositions using ultraviolet photolysis

    DOEpatents

    Reagen, William K.; Lancaster, Gregory D.; Partin, Judy K.; Moore, Glenn A.

    2000-01-01

    A method for detecting nitro-containing compositions (e.g. nitrate/nitrite materials) in water samples and on solid substrates. In a water sample, ultraviolet light is applied to the sample so that dissolved nitro compositions therein will photolytically dissociate into gaseous nitrogen oxides (NO.sub.2(g) and/or NO.sub.(g)). A carrier gas is then introduced into the sample to generate a gaseous stream which includes the carrier gas combined with any gaseous nitrogen oxides. The carrier gas is thereafter directed into a detector. To detect nitro-compositions on solid substrates, ultraviolet light is applied thereto. A detector is then used to detect any gaseous nitrogen oxides which are photolytically generated during ultraviolet illumination. An optional carrier gas may be applied to the substrate during illumination to produce a gaseous stream which includes the carrier gas and any gaseous nitrogen oxides. The gaseous stream is then supplied to the detector.

  12. Cochlin-tomoprotein (CTP) detection test identified perilymph leakage preoperatively in revision stapes surgery.

    PubMed

    Kataoka, Yuko; Ikezono, Tetsuo; Fukushima, Kunihiro; Yuen, Koji; Maeda, Yukihide; Sugaya, Akiko; Nishizaki, Kazunori

    2013-08-01

    Perilymphatic fistula (PLF) is defined as an abnormal leakage between perilymph from the labyrinth to the middle ear. Symptoms include hearing loss, tinnitus, and vertigo. The standard mode of PLF detection is intraoperative visualization of perilymph leakage and fistula, which ostensibly confirms the existence of PLF. Other possible methods of diagnosis include confirmation of pneumolabyrinth via diagnostic imaging. Recently, a cochlin-tomoprotein (CTP) detection test has been developed that allows definitive diagnosis of PLF-related hearing loss. We report the case of a 45-year-old man who presented with right-sided tinnitus, hearing loss, and dizziness 30 years after stapes surgery. Middle ear lavage was performed after myringotomy. A preoperative diagnosis of PLF was reached using the CTP detection test. Intraoperative observations included a necrotic long process of the incus, displaced wire piston, and fibrous tissue in the oval window. Perilymph leakage was not evident. The oval window was closed with fascia, and vertigo disappeared within 2 weeks postoperatively. When PLF is suspected after stapes surgery, the CTP detection test can be a useful, highly sensitive, and less invasive method for preoperative diagnosis. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  13. Electrochemical Aptamer Scaffold Biosensors for Detection of Botulism and Ricin Proteins.

    PubMed

    Daniel, Jessica; Fetter, Lisa; Jett, Susan; Rowland, Teisha J; Bonham, Andrew J

    2017-01-01

    Electrochemical DNA (E-DNA) biosensors enable the detection and quantification of a variety of molecular targets, including oligonucleotides, small molecules, heavy metals, antibodies, and proteins. Here we describe the design, electrode preparation and sensor attachment, and voltammetry conditions needed to generate and perform measurements using E-DNA biosensors against two protein targets, the biological toxins ricin and botulinum neurotoxin. This method can be applied to generate E-DNA biosensors for the detection of many other protein targets, with potential advantages over other systems including sensitive detection limits typically in the nanomolar range, real-time monitoring, and reusable biosensors.

  14. Variable threshold method for ECG R-peak detection.

    PubMed

    Kew, Hsein-Ping; Jeong, Do-Un

    2011-10-01

    In this paper, a wearable belt-type ECG electrode worn around the chest by measuring the real-time ECG is produced in order to minimize the inconvenient in wearing. ECG signal is detected using a potential instrument system. The measured ECG signal is transmits via an ultra low power consumption wireless data communications unit to personal computer using Zigbee-compatible wireless sensor node. ECG signals carry a lot of clinical information for a cardiologist especially the R-peak detection in ECG. R-peak detection generally uses the threshold value which is fixed. There will be errors in peak detection when the baseline changes due to motion artifacts and signal size changes. Preprocessing process which includes differentiation process and Hilbert transform is used as signal preprocessing algorithm. Thereafter, variable threshold method is used to detect the R-peak which is more accurate and efficient than fixed threshold value method. R-peak detection using MIT-BIH databases and Long Term Real-Time ECG is performed in this research in order to evaluate the performance analysis.

  15. Colorimetric Method of Loop-Mediated Isothermal Amplification with the Pre-Addition of Calcein for Detecting Flavobacterium columnare and its Assessment in Tilapia Farms.

    PubMed

    Suebsing, Rungkarn; Kampeera, Jantana; Sirithammajak, Sarawut; Withyachumnarnkul, Boonsirm; Turner, Warren; Kiatpathomchai, Wansika

    2015-03-01

    Flavobacterium columnare, the causative agent of columnaris disease in fish, affects many economically important freshwater fish species. A colorimetric method of loop-mediated isothermal amplification with the pre-addition of calcein (LAMP-calcein) was developed and used to detect the presence of F. columnare in farmed tilapia (Nile Tilapia Oreochromis niloticus and red tilapia [Nile Tilapia × Mozambique Tilapia O. mossambicus]) and rearing water. The detection method, based on a change in color from orange to green, could be performed within 45 min at 63°C. The method was highly specific, as it had no cross-detections with 14 other bacterial species, including other fish pathogens and two Flavobacterium species. The method has a minimum detection limit of 2.2 × 10(2) F. columnare CFU; thus, it is about 10 times more sensitive than conventional PCR. With this method, F. columnare was detected in gonad, gill, and blood samples from apparently healthy tilapia broodstock as well as in samples of fertilized eggs, newly hatched fry, and rearing water. The bacteria isolated from the blood were further characterized biochemically and found to be phenotypically identical to F. columnare. The amplified products from the LAMP-calcein method had 97% homology with the DNA sequence of F. columnare.

  16. A new method of real-time detection of changes in periodic data stream

    NASA Astrophysics Data System (ADS)

    Lyu, Chen; Lu, Guoliang; Cheng, Bin; Zheng, Xiangwei

    2017-07-01

    The change point detection in periodic time series is much desirable in many practical usages. We present a novel algorithm for this task, which includes two phases: 1) anomaly measure- on the basis of a typical regression model, we propose a new computation method to measure anomalies in time series which does not require any reference data from other measurement(s); 2) change detection- we introduce a new martingale test for detection which can be operated in an unsupervised and nonparametric way. We have conducted extensive experiments to systematically test our algorithm. The results make us believe that our algorithm can be directly applicable in many real-world change-point-detection applications.

  17. Integrated software for the detection of epileptogenic zones in refractory epilepsy.

    PubMed

    Mottini, Alejandro; Miceli, Franco; Albin, Germán; Nuñez, Margarita; Ferrándo, Rodolfo; Aguerrebere, Cecilia; Fernandez, Alicia

    2010-01-01

    In this paper we present an integrated software designed to help nuclear medicine physicians in the detection of epileptogenic zones (EZ) by means of ictal-interictal SPECT and MR images. This tool was designed to be flexible, friendly and efficient. A novel detection method was included (A-contrario) along with the classical detection method (Subtraction analysis). The software's performance was evaluated with two separate sets of validation studies: visual interpretation of 12 patient images by an experimented observer and objective analysis of virtual brain phantom experiments by proposed numerical observers. Our results support the potential use of the proposed software to help nuclear medicine physicians in the detection of EZ in clinical practice.

  18. A dual validation approach to detect anthelmintic residues in bovine liver over an extended concentration range

    USDA-ARS?s Scientific Manuscript database

    This paper describes a method for the detection and quantification of 38 of the most widely used anthelmintics (including benzimidazoles, macrocyclic lactones and flukicides) in bovine liver at MRL and non-MRL level. A dual validation approach was adapted to reliably detect anthelmintic residues ov...

  19. Statistical approaches to the analysis of point count data: A little extra information can go a long way

    USGS Publications Warehouse

    Farnsworth, G.L.; Nichols, J.D.; Sauer, J.R.; Fancy, S.G.; Pollock, K.H.; Shriner, S.A.; Simons, T.R.; Ralph, C. John; Rich, Terrell D.

    2005-01-01

    Point counts are a standard sampling procedure for many bird species, but lingering concerns still exist about the quality of information produced from the method. It is well known that variation in observer ability and environmental conditions can influence the detection probability of birds in point counts, but many biologists have been reluctant to abandon point counts in favor of more intensive approaches to counting. However, over the past few years a variety of statistical and methodological developments have begun to provide practical ways of overcoming some of the problems with point counts. We describe some of these approaches, and show how they can be integrated into standard point count protocols to greatly enhance the quality of the information. Several tools now exist for estimation of detection probability of birds during counts, including distance sampling, double observer methods, time-depletion (removal) methods, and hybrid methods that combine these approaches. Many counts are conducted in habitats that make auditory detection of birds much more likely than visual detection. As a framework for understanding detection probability during such counts, we propose separating two components of the probability a bird is detected during a count into (1) the probability a bird vocalizes during the count and (2) the probability this vocalization is detected by an observer. In addition, we propose that some measure of the area sampled during a count is necessary for valid inferences about bird populations. This can be done by employing fixed-radius counts or more sophisticated distance-sampling models. We recommend any studies employing point counts be designed to estimate detection probability and to include a measure of the area sampled.

  20. Spatially Resolved Chemical Imaging for Biosignature Analysis: Terrestrial and Extraterrestrial Examples

    NASA Astrophysics Data System (ADS)

    Bhartia, R.; Wanger, G.; Orphan, V. J.; Fries, M.; Rowe, A. R.; Nealson, K. H.; Abbey, W. J.; DeFlores, L. P.; Beegle, L. W.

    2014-12-01

    Detection of in situ biosignatures on terrestrial and planetary missions is becoming increasingly more important. Missions that target the Earth's deep biosphere, Mars, moons of Jupiter (including Europa), moons of Saturn (Titan and Enceladus), and small bodies such as asteroids or comets require methods that enable detection of materials for both in-situ analysis that preserve context and as a means to select high priority sample for return to Earth. In situ instrumentation for biosignature detection spans a wide range of analytical and spectroscopic methods that capitalize on amino acid distribution, chirality, lipid composition, isotopic fractionation, or textures that persist in the environment. Many of the existing analytical instruments are bulk analysis methods and while highly sensitive, these require sample acquisition and sample processing. However, by combining with triaging spectroscopic methods, biosignatures can be targeted on a surface and preserve spatial context (including mineralogy, textures, and organic distribution). To provide spatially correlated chemical analysis at multiple spatial scales (meters to microns) we have employed a dual spectroscopic approach that capitalizes on high sensitivity deep UV native fluorescence detection and high specificity deep UV Raman analysis.. Recently selected as a payload on the Mars 2020 mission, SHERLOC incorporates these optical methods for potential biosignatures detection on Mars. We present data from both Earth analogs that operate as our only examples known biosignatures and meteorite samples that provide an example of abiotic organic formation, and demonstrate how provenance effects the spatial distribution and composition of organics.

  1. Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.

    PubMed

    Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam

    2016-12-20

    RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.

  2. Method and Apparatus for Detecting and Quantifying Bacterial Spores on a Surface

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian (Inventor)

    2017-01-01

    A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

  3. Method and apparatus for detecting and quantifying bacterial spores on a surface

    NASA Technical Reports Server (NTRS)

    Ponce, Adrian (Inventor)

    2009-01-01

    A method and an apparatus for detecting and quantifying bacterial spores on a surface. In accordance with the method: a matrix including lanthanide ions is provided on the surface containing the bacterial spores; functionalized aromatic molecules are released from the bacterial spores on the surface; a complex of the lanthanide ion and the aromatic molecule is formed on the surface; the complex of the lanthanide ion and the aromatic molecule is excited to generate a characteristic luminescence of the complex on the surface; and the bacterial spores exhibiting the luminescence of the complex on the surface are detected and quantified.

  4. Traffic Sign Detection System for Locating Road Intersections and Roundabouts: The Chilean Case.

    PubMed

    Villalón-Sepúlveda, Gabriel; Torres-Torriti, Miguel; Flores-Calero, Marco

    2017-05-25

    This paper presents a traffic sign detection method for signs close to road intersections and roundabouts, such as stop and yield (give way) signs. The proposed method relies on statistical templates built using color information for both segmentation and classification. The segmentation method uses the RGB-normalized (ErEgEb) color space for ROIs (Regions of Interest) generation based on a chromaticity filter, where templates at 10 scales are applied to the entire image. Templates consider the mean and standard deviation of normalized color of the traffic signs to build thresholding intervals where the expected color should lie for a given sign. The classification stage employs the information of the statistical templates over YCbCr and ErEgEb color spaces, for which the background has been previously removed by using a probability function that models the probability that the pixel corresponds to a sign given its chromaticity values. This work includes an analysis of the detection rate as a function of the distance between the vehicle and the sign. Such information is useful to validate the robustness of the approach and is often not included in the existing literature. The detection rates, as a function of distance, are compared to those of the well-known Viola-Jones method. The results show that for distances less than 48 m, the proposed method achieves a detection rate of 87.5 % and 95.4 % for yield and stop signs, respectively. For distances less than 30 m, the detection rate is 100 % for both signs. The Viola-Jones approach has detection rates below 20 % for distances between 30 and 48 m, and barely improves in the 20-30 m range with detection rates of up to 60 % . Thus, the proposed method provides a robust alternative for intersection detection that relies on statistical color-based templates instead of shape information. The experiments employed videos of traffic signs taken in several streets of Santiago, Chile, using a research platform implemented at the Robotics and Automation Laboratory of PUC to develop driver assistance systems.

  5. Traffic Sign Detection System for Locating Road Intersections and Roundabouts: The Chilean Case

    PubMed Central

    Villalón-Sepúlveda, Gabriel; Torres-Torriti, Miguel; Flores-Calero, Marco

    2017-01-01

    This paper presents a traffic sign detection method for signs close to road intersections and roundabouts, such as stop and yield (give way) signs. The proposed method relies on statistical templates built using color information for both segmentation and classification. The segmentation method uses the RGB-normalized (ErEgEb) color space for ROIs (Regions of Interest) generation based on a chromaticity filter, where templates at 10 scales are applied to the entire image. Templates consider the mean and standard deviation of normalized color of the traffic signs to build thresholding intervals where the expected color should lie for a given sign. The classification stage employs the information of the statistical templates over YCbCr and ErEgEb color spaces, for which the background has been previously removed by using a probability function that models the probability that the pixel corresponds to a sign given its chromaticity values. This work includes an analysis of the detection rate as a function of the distance between the vehicle and the sign. Such information is useful to validate the robustness of the approach and is often not included in the existing literature. The detection rates, as a function of distance, are compared to those of the well-known Viola–Jones method. The results show that for distances less than 48 m, the proposed method achieves a detection rate of 87.5% and 95.4% for yield and stop signs, respectively. For distances less than 30 m, the detection rate is 100% for both signs. The Viola–Jones approach has detection rates below 20% for distances between 30 and 48 m, and barely improves in the 20–30 m range with detection rates of up to 60%. Thus, the proposed method provides a robust alternative for intersection detection that relies on statistical color-based templates instead of shape information. The experiments employed videos of traffic signs taken in several streets of Santiago, Chile, using a research platform implemented at the Robotics and Automation Laboratory of PUC to develop driver assistance systems. PMID:28587071

  6. System and method for assaying a radionuclide

    DOEpatents

    Cadieux, James R; King, III, George S; Fugate, Glenn A

    2014-12-23

    A system for assaying a radionuclide includes a liquid scintillation detector, an analyzer connected to the liquid scintillation detector, and a delay circuit connected to the analyzer. A gamma detector and a multi-channel analyzer are connected to the delay circuit and the gamma detector. The multi-channel analyzer produces a signal reflective of the radionuclide in the sample. A method for assaying a radionuclide includes selecting a sample, detecting alpha or beta emissions from the sample with a liquid scintillation detector, producing a first signal reflective of the alpha or beta emissions, and delaying the first signal a predetermined time. The method further includes detecting gamma emissions from the sample, producing a second signal reflective of the gamma emissions, and combining the delayed first signal with the second signal to produce a third signal reflective of the radionuclide.

  7. Chemiluminescence Resonance Energy Transfer-based Detection for Microchip Electrophoresis

    PubMed Central

    Huang, Yong; Shi, Ming; Liu, Rongjun

    2010-01-01

    Since the channels in micro- and nanofluidic devices are extremely small, a sensitive detection is required following microchip electrophoresis (MCE). This work describes a highly sensitive and yet universal detection scheme based on chemiluminescence resonance energy transfer (CRET) for MCE. It was found that an efficient CRET occurred between a luminol donor and a CdTe quantum dot (QD) acceptor in the luminol-NaBrO-QD system, and that it was sensitively suppressed by the presence of certain organic compounds of biological interest including biogenic amines and thiols, amino acids, organic acids, and steroids. These findings allowed developing sensitive MCE-CL assays for the tested compounds. The proposed MCE-CL methods showed desired analytical figures of merit such as a wide concentration range of linear response. Detection limits obtained were ~10−9 M for biogenic amines including dopamine and epinephrine, and ~ 10−8 M for biogenic thiols (e.g. glutathione and acetylcysteine), organic acids (i.e. ascorbic acid and uric acid), estrogens, and native amino acids. These were 10 to 1000 times more sensitive than those of previously reported MCE-based methods with chemiluminescence, electrochemical, or laser induced fluorescence detection for quantifying corresponding compounds. To evaluate the applicability of the present MCE-CL method for analyzing real biological samples, it was used to determine amino acids in individual human red blood cells. Nine amino acids including Lys, Ser, Ala, Glu, Trp, etc. were detected. The contents ranged from 3 to 31 amol /cell. The assay proved to be simple, quick, reproducible, and very sensitive. PMID:20121202

  8. The design method and research status of vehicle detection system based on geomagnetic detection principle

    NASA Astrophysics Data System (ADS)

    Lin, Y. H.; Bai, R.; Qian, Z. H.

    2018-03-01

    Vehicle detection systems are applied to obtain real-time information of vehicles, realize traffic control and reduce traffic pressure. This paper reviews geomagnetic sensors as well as the research status of the vehicle detection system. Presented in the paper are also our work on the vehicle detection system, including detection algorithms and experimental results. It is found that the GMR based vehicle detection system has a detection accuracy up to 98% with a high potential for application in the road traffic control area.

  9. A fast button surface defects detection method based on convolutional neural network

    NASA Astrophysics Data System (ADS)

    Liu, Lizhe; Cao, Danhua; Wu, Songlin; Wu, Yubin; Wei, Taoran

    2018-01-01

    Considering the complexity of the button surface texture and the variety of buttons and defects, we propose a fast visual method for button surface defect detection, based on convolutional neural network (CNN). CNN has the ability to extract the essential features by training, avoiding designing complex feature operators adapted to different kinds of buttons, textures and defects. Firstly, we obtain the normalized button region and then use HOG-SVM method to identify the front and back side of the button. Finally, a convolutional neural network is developed to recognize the defects. Aiming at detecting the subtle defects, we propose a network structure with multiple feature channels input. To deal with the defects of different scales, we take a strategy of multi-scale image block detection. The experimental results show that our method is valid for a variety of buttons and able to recognize all kinds of defects that have occurred, including dent, crack, stain, hole, wrong paint and uneven. The detection rate exceeds 96%, which is much better than traditional methods based on SVM and methods based on template match. Our method can reach the speed of 5 fps on DSP based smart camera with 600 MHz frequency.

  10. A Swiss cheese error detection method for real-time EPID-based quality assurance and error prevention.

    PubMed

    Passarge, Michelle; Fix, Michael K; Manser, Peter; Stampanoni, Marco F M; Siebers, Jeffrey V

    2017-04-01

    To develop a robust and efficient process that detects relevant dose errors (dose errors of ≥5%) in external beam radiation therapy and directly indicates the origin of the error. The process is illustrated in the context of electronic portal imaging device (EPID)-based angle-resolved volumetric-modulated arc therapy (VMAT) quality assurance (QA), particularly as would be implemented in a real-time monitoring program. A Swiss cheese error detection (SCED) method was created as a paradigm for a cine EPID-based during-treatment QA. For VMAT, the method compares a treatment plan-based reference set of EPID images with images acquired over each 2° gantry angle interval. The process utilizes a sequence of independent consecutively executed error detection tests: an aperture check that verifies in-field radiation delivery and ensures no out-of-field radiation; output normalization checks at two different stages; global image alignment check to examine if rotation, scaling, and translation are within tolerances; pixel intensity check containing the standard gamma evaluation (3%, 3 mm) and pixel intensity deviation checks including and excluding high dose gradient regions. Tolerances for each check were determined. To test the SCED method, 12 different types of errors were selected to modify the original plan. A series of angle-resolved predicted EPID images were artificially generated for each test case, resulting in a sequence of precalculated frames for each modified treatment plan. The SCED method was applied multiple times for each test case to assess the ability to detect introduced plan variations. To compare the performance of the SCED process with that of a standard gamma analysis, both error detection methods were applied to the generated test cases with realistic noise variations. Averaged over ten test runs, 95.1% of all plan variations that resulted in relevant patient dose errors were detected within 2° and 100% within 14° (<4% of patient dose delivery). Including cases that led to slightly modified but clinically equivalent plans, 89.1% were detected by the SCED method within 2°. Based on the type of check that detected the error, determination of error sources was achieved. With noise ranging from no random noise to four times the established noise value, the averaged relevant dose error detection rate of the SCED method was between 94.0% and 95.8% and that of gamma between 82.8% and 89.8%. An EPID-frame-based error detection process for VMAT deliveries was successfully designed and tested via simulations. The SCED method was inspected for robustness with realistic noise variations, demonstrating that it has the potential to detect a large majority of relevant dose errors. Compared to a typical (3%, 3 mm) gamma analysis, the SCED method produced a higher detection rate for all introduced dose errors, identified errors in an earlier stage, displayed a higher robustness to noise variations, and indicated the error source. © 2017 American Association of Physicists in Medicine.

  11. Chemical Methods for the Direct Detection and Labeling of S-Nitrosothiols

    PubMed Central

    Bechtold, Erika

    2012-01-01

    Abstract Significance: Posttranslational modification of proteins through phosphorylation, glycosylation, and oxidation adds complexity to the proteome by reversibly altering the structure and function of target proteins in a highly controlled fashion. Recent Advances: The study of reversible cysteine oxidation highlights a role for this oxidative modification in complex signal transduction pathways. Nitric oxide (NO), and its respective metabolites (including reactive nitrogen species), participates in a variety of these cellular redox processes, including the reversible oxidation of cysteine to S-nitrosothiols (RSNOs). RSNOs act as endogenous transporters of NO, but also possess beneficial effects independent of NO-related signaling, which suggests a complex and versatile biological role. In this review, we highlight the importance of RSNOs as a required posttranslational modification and summarize the current methods available for detecting S-nitrosation. Critical Issues: Given the limitations of these indirect detection methods, the review covers recent developments toward the direct detection of RSNOs by phosphine-based chemical probes. The intrinsic properties that dictate this phosphine/RSNO reactivity are summarized. In general, RSNOs (both small molecule and protein) react with phosphines to yield reactive S-substituted aza-ylides that undergo further reactions leading to stable RSNO-based adducts. Future Directions: This newly explored chemical reactivity forms the basis of a number of exciting potential chemical methods for protein RSNO detection in biological systems. Antioxid. Redox Signal. 17, 981–991. PMID:22356122

  12. Application of an oligonucleotide microarray-based nano-amplification technique for the detection of fungal pathogens.

    PubMed

    Lu, Weiping; Gu, Dayong; Chen, Xingyun; Xiong, Renping; Liu, Ping; Yang, Nan; Zhou, Yuanguo

    2010-10-01

    The traditional techniques for diagnosis of invasive fungal infections in the clinical microbiology laboratory need improvement. These techniques are prone to delay results due to their time-consuming process, or result in misidentification of the fungus due to low sensitivity or low specificity. The aim of this study was to develop a method for the rapid detection and identification of fungal pathogens. The internal transcribed spacer two fragments of fungal ribosomal DNA were amplified using a polymerase chain reaction for all samples. Next, the products were hybridized with the probes immobilized on the surface of a microarray. These species-specific probes were designed to detect nine different clinical pathogenic fungi including Candida albicans, Candida tropocalis, Candida glabrata, Candida parapsilosis, Candida krusei, Candida lusitaniae, Candida guilliermondii, Candida keyfr, and Cryptococcus neoformans. The hybridizing signals were enhanced with gold nanoparticles and silver deposition, and detected using a flatbed scanner or visually. Fifty-nine strains of fungal pathogens, including standard and clinically isolated strains, were correctly identified by this method. The sensitivity of the assay for Candida albicans was 10 cells/mL. Ten cultures from clinical specimens and 12 clinical samples spiked with fungi were also identified correctly. This technique offers a reliable alternative to conventional methods for the detection and identification of fungal pathogens. It has higher efficiency, specificity and sensitivity compared with other methods commonly used in the clinical laboratory.

  13. A Novel Field Deployable Point-of-Care Diagnostic Test for Cutaneous Leishmaniasis

    DTIC Science & Technology

    2015-10-01

    include localized cutaneous leishmaniasis (LCL), and destructive nasal and oropharyngeal lesions of mucosal leishmaniasis (ML). LCL in the New World...the high costs, personnel training and need of sophisticated equipment. Therefore, novel methods to detect leishmaniasis at the POC are urgently needed...To date, there is no field-standardized molecular method based on DNA amplification coupled with Lateral Flow reading to detect leishmaniasis

  14. Monoclonal antibodies and method for detecting dioxins and dibenzofurans

    DOEpatents

    Vanderlaan, Martin; Stanker, Larry H.; Watkins, Bruce E.; Bailey, Nina R.

    1989-01-01

    Compositions of matter are described which include five monoclonal antibodies that react with dioxins and dibenzofurans, and the five hybridomas that produce these monoclonal antibodies. In addition, a method for the use of these antibodies in a sensitive immunoassay for dioxins and dibenzofurans is given, which permits detection of these pollutants in samples at concentrations in the range of a few parts per billion.

  15. Systematic Evaluation of In Vitro and In Vivo Adventitious Virus Assays for the Detection of Viral Contamination of Cell Banks and Biological Products1

    PubMed Central

    Gombold, James; Karakasidis, Stephen; Niksa, Paula; Podczasy, John; Neumann, Kitti; Richardson, James; Sane, Nandini; Johnson-Leva, Renita; Randolph, Valerie; Sadoff, Jerald; Minor, Phillip; Schmidt, Alexander; Duncan, Paul; Sheets, Rebecca L.

    2015-01-01

    Viral vaccines and the cell substrates used to manufacture them are subjected to tests for adventitious agents, including viruses, which might contaminant them. Some of the compendial methods (in vivo and in vitro in cell culture) were established in the mid-20th century. These methods have not been subjected to current assay validation, as new methods would need to be. This study was undertaken to provide insight into the breadth (selectivity) and sensitivity (limit of detection) of the routine methods, two such validation parameters. Sixteen viral stocks were prepared and characterized. These stocks were tested in serial dilutions by the routine methods to establish which viruses were detected by which methods and above what limit of detection. Sixteen out of sixteen viruses were detected in vitro, though one (bovine viral diarrhea virus) required special conditions to detect and another (rubella virus) was detected with low sensitivity. Many were detected at levels below 1 TCID50 or PFU (titers were established on the production cell line in most cases). In contrast, in vivo, only 6/11 viruses were detected, and 4 of these were detected only at amounts one or more logs above 1 TCID50 or PFU. Only influenza virus and vesicular stomatitis virus were detected at lower amounts in vivo than in vitro. Given the call to reduce, refine, or replace (3 R's) the use of animals in product safety testing and the emergence of new technologies for the detection of viruses, a re-examination of the current adventitious virus testing strategies seems warranted. Suggested pathways forward are offered. PMID:24681273

  16. Applying a 2D based CAD scheme for detecting micro-calcification clusters using digital breast tomosynthesis images: an assessment

    NASA Astrophysics Data System (ADS)

    Park, Sang Cheol; Zheng, Bin; Wang, Xiao-Hui; Gur, David

    2008-03-01

    Digital breast tomosynthesis (DBT) has emerged as a promising imaging modality for screening mammography. However, visually detecting micro-calcification clusters depicted on DBT images is a difficult task. Computer-aided detection (CAD) schemes for detecting micro-calcification clusters depicted on mammograms can achieve high performance and the use of CAD results can assist radiologists in detecting subtle micro-calcification clusters. In this study, we compared the performance of an available 2D based CAD scheme with one that includes a new grouping and scoring method when applied to both projection and reconstructed DBT images. We selected a dataset involving 96 DBT examinations acquired on 45 women. Each DBT image set included 11 low dose projection images and a varying number of reconstructed image slices ranging from 18 to 87. In this dataset 20 true-positive micro-calcification clusters were visually detected on the projection images and 40 were visually detected on the reconstructed images, respectively. We first applied the CAD scheme that was previously developed in our laboratory to the DBT dataset. We then tested a new grouping method that defines an independent cluster by grouping the same cluster detected on different projection or reconstructed images. We then compared four scoring methods to assess the CAD performance. The maximum sensitivity level observed for the different grouping and scoring methods were 70% and 88% for the projection and reconstructed images with a maximum false-positive rate of 4.0 and 15.9 per examination, respectively. This preliminary study demonstrates that (1) among the maximum, the minimum or the average CAD generated scores, using the maximum score of the grouped cluster regions achieved the highest performance level, (2) the histogram based scoring method is reasonably effective in reducing false-positive detections on the projection images but the overall CAD sensitivity is lower due to lower signal-to-noise ratio, and (3) CAD achieved higher sensitivity and higher false-positive rate (per examination) on the reconstructed images. We concluded that without changing the detection threshold or performing pre-filtering to possibly increase detection sensitivity, current CAD schemes developed and optimized for 2D mammograms perform relatively poorly and need to be re-optimized using DBT datasets and new grouping and scoring methods need to be incorporated into the schemes if these are to be used on the DBT examinations.

  17. A rapid low-cost high-density DNA-based multi-detection test for routine inspection of meat species.

    PubMed

    Lin, Chun Chi; Fung, Lai Ling; Chan, Po Kwok; Lee, Cheuk Man; Chow, Kwok Fai; Cheng, Shuk Han

    2014-02-01

    The increasing occurrence of food frauds suggests that species identification should be part of food authentication. Current molecular-based species identification methods have their own limitations or drawbacks, such as relatively time-consuming experimental steps, expensive equipment and, in particular, these methods cannot identify mixed species in a single experiment. This project proposes an improved method involving PCR amplification of the COI gene and detection of species-specific sequences by hybridisation. Major innovative breakthrough lies in the detection of multiple species, including pork, beef, lamb, horse, cat, dog and mouse, from a mixed sample within a single experiment. The probes used are species-specific either in sole or mixed species samples. As little as 5 pg of DNA template in the PCR is detectable in the proposed method. By designing species-specific probes and adopting reverse dot blot hybridisation and flow-through hybridisation, a low-cost high-density DNA-based multi-detection test suitable for routine inspection of meat species was developed. © 2013.

  18. Peripleural lung disease detection based on multi-slice CT images

    NASA Astrophysics Data System (ADS)

    Matsuhiro, M.; Suzuki, H.; Kawata, Y.; Niki, N.; Nakano, Y.; Ohmatsu, H.; Kusumoto, M.; Tsuchida, T.; Eguchi, K.; Kaneko, M.

    2015-03-01

    With the development of multi-slice CT technology, obtaining accurate 3D images of lung field in a short time become possible. To support that, a lot of image processing methods need to be developed. Detection peripleural lung disease is difficult due to its existence out of lung region, because lung extraction is often performed based on threshold processing. The proposed method uses thoracic inner region extracted by inner cavity of bone as well as air region, covers peripleural lung diseased cases such as lung nodule, calcification, pleural effusion and pleural plaque. We applied this method to 50 cases including 39 peripleural lung diseased cases. This method was able to detect 39 peripleural lung disease with 2.9 false positive per case.

  19. Radiologic methods of evaluating generalized osteopenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schneider, R.

    1984-10-01

    Noninvasive methods of evaluating generalized osteopenia include radiography, radionuclide studies, and various quantitative studies. These methods differ in availability, cost, accuracy, precision, radiation dose, and information supplied about bony change. A combination of methods is necessary to detect and follow the course and treatment of osteopenia.

  20. Infra-red signature neutron detector

    DOEpatents

    Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN

    2009-10-13

    A method of detecting an activator, the method including impinging with an activator a receptor material that includes a photoluminescent material that generates infrared radiation and generation a by-product of a nuclear reaction due to the activator impinging the receptor material. The method further includes generating light from the by-product via the Cherenkov effect, wherein the light activates the photoluminescent material so as to generate the infrared radiation. Identifying a characteristic of the activator based on the infrared radiation.

  1. Geologic Carbon Sequestration Leakage Detection: A Physics-Guided Machine Learning Approach

    NASA Astrophysics Data System (ADS)

    Lin, Y.; Harp, D. R.; Chen, B.; Pawar, R.

    2017-12-01

    One of the risks of large-scale geologic carbon sequestration is the potential migration of fluids out of the storage formations. Accurate and fast detection of this fluids migration is not only important but also challenging, due to the large subsurface uncertainty and complex governing physics. Traditional leakage detection and monitoring techniques rely on geophysical observations including pressure. However, the resulting accuracy of these methods is limited because of indirect information they provide requiring expert interpretation, therefore yielding in-accurate estimates of leakage rates and locations. In this work, we develop a novel machine-learning technique based on support vector regression to effectively and efficiently predict the leakage locations and leakage rates based on limited number of pressure observations. Compared to the conventional data-driven approaches, which can be usually seem as a "black box" procedure, we develop a physics-guided machine learning method to incorporate the governing physics into the learning procedure. To validate the performance of our proposed leakage detection method, we employ our method to both 2D and 3D synthetic subsurface models. Our novel CO2 leakage detection method has shown high detection accuracy in the example problems.

  2. Flow injection trace gas analysis method for on-site determination of organoarsenicals

    DOEpatents

    Aldstadt, III, Joseph H.

    1997-01-01

    A method for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere.

  3. Method and device for detecting impact events on a security barrier which includes a hollow rebar allowing insertion and removal of an optical fiber

    DOEpatents

    Pies, Ross E.

    2016-03-29

    A method and device for the detection of impact events on a security barrier. A hollow rebar is farmed within a security barrier, whereby the hollow rebar is completely surrounded by the security barrier. An optical fiber passes through the interior of the hollow rebar. An optical transmitter and an optical receiver are both optically connected to the optical fiber and connected to optical electronics. The optical electronics are configured to provide notification upon the detection of an impact event at the security barrier based on the detection of disturbances within the optical fiber.

  4. Near real time vapor detection and enhancement using aerosol adsorption

    DOEpatents

    Novick, Vincent J.; Johnson, Stanley A.

    1999-01-01

    A vapor sample detection method where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample.

  5. Near real time vapor detection and enhancement using aerosol adsorption

    DOEpatents

    Novick, V.J.; Johnson, S.A.

    1999-08-03

    A vapor sample detection method is described where the vapor sample contains vapor and ambient air and surrounding natural background particles. The vapor sample detection method includes the steps of generating a supply of aerosol that have a particular effective median particle size, mixing the aerosol with the vapor sample forming aerosol and adsorbed vapor suspended in an air stream, impacting the suspended aerosol and adsorbed vapor upon a reflecting element, alternatively directing infrared light to the impacted aerosol and adsorbed vapor, detecting and analyzing the alternatively directed infrared light in essentially real time using a spectrometer and a microcomputer and identifying the vapor sample. 13 figs.

  6. Detection of circulating tumor cells using oHSV1-hTERT-GFP in lung cancer.

    PubMed

    Gao, Hongjun; Liu, Wenjing; Yang, Shaoxing; Zhang, Wen; Li, Xiaoyan; Qin, Haifeng; Wang, Weixia; Zhao, Changyun

    2018-01-01

    This study was conducted to evaluate the clinical utility of the oHSV1-hTERT-GFP circulating tumor cell (CTC) detection method in the peripheral blood of patients with lung cancer by comparing its sensitivity to the CellSearch CTC detection method. The oHSV1-hTERT-GFP and CellSearch CTC detection methods were compared using peripheral blood samples of patients pathologically diagnosed with lung cancer. A total of 240 patients with lung cancer were recruited, including 89 patients who were newly diagnosed and 151 patients who had previously received treatment. Sixty-six newly diagnosed patients were evaluated using both methods. The CTC detection rates were 71.2% and 33.3% using the oHSV1-hTERT-GFP and CellSearch methods, respectively; this difference was statistically significant (P = 0.000). Among the entire cohort (n = 240), the CTC detection rate using the oHSV1-hTERT-GFP method was 76.3%, with a CTC count of 0-81. The CTC detection rates were 76.7%, 68.9%, and 76.3% in patients with squamous cell carcinoma, adenocarcinoma, and small cell lung cancer, respectively. There was no statistically significant difference in the CTC detection rates between these different pathological subtypes (P = 0.738). The CTC detection rates of 79.8% and 74.4% in patients with stage I-III and IV lung cancer, respectively, were not significantly different (P = 0.427). The oHSV1-hTERT-GFP method is highly effective for detecting CTCs in patients with lung cancer, independent of pathological type and disease stage, and is ideal for large-scale clinical applications. © 2017 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  7. Methods for Generation and Detection of Nonstationary Vapor Nanobubbles Around Plasmonic Nanoparticles.

    PubMed

    Lukianova-Hleb, Ekaterina Y; Lapotko, Dmitri O

    2017-01-01

    Laser pulse-induced vapor nanobubbles are nonstationary nanoevents that offer a broad range of applications, especially in the biomedical field. Plasmonic (usually gold) nanoparticles have the highest energy efficacy of the generation of vapor nanobubbles and such nanobubbles were historically named as plasmonic nanobubbles. Below we review methods (protocols) for generating and detecting plasmonic nanobubbles in liquids. The biomedical applications of plasmonic nanobubbles include in vivo and in vitro detection and imaging, gene transfer, micro-surgery, drug delivery, and other diagnostic, therapeutic, and theranostic applications.

  8. Diffraction mode terahertz tomography

    DOEpatents

    Ferguson, Bradley; Wang, Shaohong; Zhang, Xi-Cheng

    2006-10-31

    A method of obtaining a series of images of a three-dimensional object. The method includes the steps of transmitting pulsed terahertz (THz) radiation through the entire object from a plurality of angles, optically detecting changes in the transmitted THz radiation using pulsed laser radiation, and constructing a plurality of imaged slices of the three-dimensional object using the detected changes in the transmitted THz radiation. The THz radiation is transmitted through the object as a two-dimensional array of parallel rays. The optical detection is an array of detectors such as a CCD sensor.

  9. Multifunctional and multispectral biosensor devices and methods of use

    DOEpatents

    Vo-Dinh, Tuan

    2004-06-01

    An integrated biosensor system for the simultaneously detection of a plurality of different types of targets includes at least one sampling platform, the sampling platform including a plurality of receptors for binding to the targets. The plurality of receptors include at least one protein receptor and at least one nucleic acid receptor. At least one excitation source of electromagnetic radiation at a first frequency is provided for irradiating the receptors, wherein electromagnetic radiation at a second frequency different from the first frequency is emitted in response to irradiating when at least one of the different types of targets are bound to the receptor probes. An integrated circuit detector system having a plurality of detection channels is also provided for detecting electromagnetic radiation at said second frequency, the detection channels each including at least one detector.

  10. PCR-Based Method for Detecting Viral Penetration of Medical Exam Gloves

    PubMed Central

    Broyles, John M.; O'Connell, Kevin P.; Korniewicz, Denise M.

    2002-01-01

    The test approved by the U.S. Food and Drug Administration for assessment of the barrier quality of medical exam gloves includes visual inspection and a water leak test. Neither method tests directly the ability of gloves to prevent penetration by microorganisms. Methods that use microorganisms (viruses and bacteria) to test gloves have been developed but require classical culturing of the organism to detect it. We have developed a PCR assay for bacteriophage φX174 that allows the rapid detection of penetration of gloves by this virus. The method is suitable for use with both latex and synthetic gloves. The presence of glove powder on either latex or synthetic gloves had no effect on the ability of the PCR assay to detect bacteriophage DNA. The assay is rapid, sensitive, and inexpensive; requires only small sample volumes; and can be automated. PMID:12149320

  11. Data acquisition and processing system and method for investigating sub-surface features of a rock formation

    DOEpatents

    Vu, Cung Khac; Nihei, Kurt; Johnson, Paul A; Guyer, Robert; Ten Cate, James A; Le Bas, Pierre-Yves; Larmat, Carene S

    2015-01-27

    A system and a method includes generating a first signal at a first frequency; and a second signal at a second frequency. Respective sources are positioned within the borehole and controllable such that the signals intersect in an intersection volume outside the borehole. A receiver detects a difference signal returning to the borehole generated by a non-linear mixing process within the intersection volume, and records the detected signal and stores the detected signal in a storage device and records measurement parameters including a position of the first acoustic source, a position of the second acoustic source, a position of the receiver, elevation angle and azimuth angle of the first acoustic signal and elevation angle and azimuth angle of the second acoustic signal.

  12. System and method for bearing fault detection using stator current noise cancellation

    DOEpatents

    Zhou, Wei; Lu, Bin; Habetler, Thomas G.; Harley, Ronald G.; Theisen, Peter J.

    2010-08-17

    A system and method for detecting incipient mechanical motor faults by way of current noise cancellation is disclosed. The system includes a controller configured to detect indicia of incipient mechanical motor faults. The controller further includes a processor programmed to receive a baseline set of current data from an operating motor and define a noise component in the baseline set of current data. The processor is also programmed to repeatedly receive real-time operating current data from the operating motor and remove the noise component from the operating current data in real-time to isolate any fault components present in the operating current data. The processor is then programmed to generate a fault index for the operating current data based on any isolated fault components.

  13. A reporter system for replication-competent gammaretroviruses: the inGluc-MLV-DERSE assay

    PubMed Central

    Aloia, Amanda L.; Duffy, Lisa; Pak, Vladimir; Lee, KyeongEun; Sanchez-Martinez, Silvia; Derse, David; Heidecker, Gisela; Cornetta, Kenneth; Rein, Alan

    2012-01-01

    While novel retroviral vectors for use in gene-therapy products are reducing the potential for formation of replication-competent retrovirus (RCR), it remains crucial to screen products for RCR for both research and clinical purposes. For clinical grade gammaretrovirus-based vectors, RCR screening is achieved by an extended S+L− or marker rescue assay, while standard methods for replication-competent lentivirus detection are still in development. In this report, we describe a rapid and sensitive method for replication-competent gammaretrovirus detection. We used this assay to detect three members of the gammaretrovirus family and compared the sensitivity of our assay with well-established methods for retrovirus detection, including the extended S+L− assay. Results presented here demonstrate that this assay should be useful for gene-therapy product testing. PMID:22402321

  14. High-resolution metabolomics assessment of military personnel: Evaluating analytical strategies for chemical detection

    PubMed Central

    Liu, Ken H.; Walker, Douglas I.; Uppal, Karan; Tran, ViLinh; Rohrbeck, Patricia; Mallon, Timothy M.; Jones, Dean P.

    2016-01-01

    Objective To maximize detection of serum metabolites with high-resolution metabolomics (HRM). Methods Department of Defense Serum Repository (DoDSR) samples were analyzed using ultra-high resolution mass spectrometry with three complementary chromatographic phases and four ionization modes. Chemical coverage was evaluated by number of ions detected and accurate mass matches to a human metabolomics database. Results Individual HRM platforms provided accurate mass matches for up to 58% of the KEGG metabolite database. Combining two analytical methods increased matches to 72%, and included metabolites in most major human metabolic pathways and chemical classes. Detection and feature quality varied by analytical configuration. Conclusions Dual chromatography HRM with positive and negative electrospray ionization provides an effective generalized method for metabolic assessment of military personnel. PMID:27501105

  15. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

    PubMed

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-11-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

  16. Method and system for evaluating integrity of adherence of a conductor bond to a mating surface of a substrate

    DOEpatents

    Telschow, K.L.; Siu, B.K.

    1996-07-09

    A method of evaluating integrity of adherence of a conductor bond to a substrate includes: (a) impinging a plurality of light sources onto a substrate; (b) detecting optical reflective signatures emanating from the substrate from the impinged light; (c) determining location of a selected conductor bond on the substrate from the detected reflective signatures; (d) determining a target site on the selected conductor bond from the detected reflective signatures; (e) optically imparting an elastic wave at the target site through the selected conductor bond and into the substrate; (f) optically detecting an elastic wave signature emanating from the substrate resulting from the optically imparting step; and (g) determining integrity of adherence of the selected conductor bond to the substrate from the detected elastic wave signature emanating from the substrate. A system is disclosed which is capable of conducting the method. 13 figs.

  17. Method and system for evaluating integrity of adherence of a conductor bond to a mating surface of a substrate

    DOEpatents

    Telschow, Kenneth L.; Siu, Bernard K.

    1996-01-01

    A method of evaluating integrity of adherence of a conductor bond to a substrate includes: a) impinging a plurality of light sources onto a substrate; b) detecting optical reflective signatures emanating from the substrate from the impinged light; c) determining location of a selected conductor bond on the substrate from the detected reflective signatures; d) determining a target site on the selected conductor bond from the detected reflective signatures; e) optically imparting an elastic wave at the target site through the selected conductor bond and into the substrate; f) optically detecting an elastic wave signature emanating from the substrate resulting from the optically imparting step; and g) determining integrity of adherence of the selected conductor bond to the substrate from the detected elastic wave signature emanating from the substrate. A system is disclosed which is capable of conducting the method.

  18. Detection of the Dinozoans Pfiesteria piscicida and P. shumwayae: a review of detection methods and geographic distribution.

    PubMed

    Rublee, Parke A; Remington, David L; Schaefer, Eric F; Marshall, Michael M

    2005-01-01

    Molecular methods, including conventional PCR, real-time PCR, denaturing gradient gel electrophoresis, fluorescent fragment detection PCR, and fluorescent in situ hybridization, have all been developed for use in identifying and studying the distribution of the toxic dinoflagellates Pfiesteria piscicida and P. shumwayae. Application of the methods has demonstrated a worldwide distribution of both species and provided insight into their environmental tolerance range and temporal changes in distribution. Genetic variability among geographic locations generally appears low in rDNA genes, and detection of the organisms in ballast water is consistent with rapid dispersal or high gene flow among populations, but additional sequence data are needed to verify this hypothesis. The rapid development and application of these tools serves as a model for study of other microbial taxa and provides a basis for future development of tools that can simultaneously detect multiple targets.

  19. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

    PubMed Central

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-01-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

  20. Highly sensitive chemiluminescent point mutation detection by circular strand-displacement amplification reaction.

    PubMed

    Shi, Chao; Ge, Yujie; Gu, Hongxi; Ma, Cuiping

    2011-08-15

    Single nucleotide polymorphism (SNP) genotyping is attracting extensive attentions owing to its direct connections with human diseases including cancers. Here, we have developed a highly sensitive chemiluminescence biosensor based on circular strand-displacement amplification and the separation by magnetic beads reducing the background signal for point mutation detection at room temperature. This method took advantage of both the T4 DNA ligase recognizing single-base mismatch with high selectivity and the strand-displacement reaction of polymerase to perform signal amplification. The detection limit of this method was 1.3 × 10(-16)M, which showed better sensitivity than that of most of those reported detection methods of SNP. Additionally, the magnetic beads as carrier of immobility was not only to reduce the background signal, but also may have potential apply in high through-put screening of SNP detection in human genome. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Enhanced multifunctional paint for detection of radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farmer, Joseph C.; Moses, Edward Ira; Rubenchik, Alexander M.

    An enhanced multifunctional paint apparatus, systems, and methods for detecting radiation on a surface include providing scintillation particles; providing an enhance neutron absorptive material; providing a binder; combining the scintillation particles, the enhance neutron absorptive material, and the binder creating a multifunctional paint; applying the multifunctional paint to the surface; and monitoring the surface for detecting radiation.

  2. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis

    PubMed Central

    Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio

    2015-01-01

    Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990

  3. Circuitry, systems and methods for detecting magnetic fields

    DOEpatents

    Kotter, Dale K [Shelley, ID; Spencer, David F [Idaho Falls, ID; Roybal, Lyle G [Idaho Falls, ID; Rohrbaugh, David T [Idaho Falls, ID

    2010-09-14

    Circuitry for detecting magnetic fields includes a first magnetoresistive sensor and a second magnetoresistive sensor configured to form a gradiometer. The circuitry includes a digital signal processor and a first feedback loop coupled between the first magnetoresistive sensor and the digital signal processor. A second feedback loop which is discrete from the first feedback loop is coupled between the second magnetoresistive sensor and the digital signal processor.

  4. Estimating occupancy and abundance using aerial images with imperfect detection

    USGS Publications Warehouse

    Williams, Perry J.; Hooten, Mevin B.; Womble, Jamie N.; Bower, Michael R.

    2017-01-01

    Species distribution and abundance are critical population characteristics for efficient management, conservation, and ecological insight. Point process models are a powerful tool for modelling distribution and abundance, and can incorporate many data types, including count data, presence-absence data, and presence-only data. Aerial photographic images are a natural tool for collecting data to fit point process models, but aerial images do not always capture all animals that are present at a site. Methods for estimating detection probability for aerial surveys usually include collecting auxiliary data to estimate the proportion of time animals are available to be detected.We developed an approach for fitting point process models using an N-mixture model framework to estimate detection probability for aerial occupancy and abundance surveys. Our method uses multiple aerial images taken of animals at the same spatial location to provide temporal replication of sample sites. The intersection of the images provide multiple counts of individuals at different times. We examined this approach using both simulated and real data of sea otters (Enhydra lutris kenyoni) in Glacier Bay National Park, southeastern Alaska.Using our proposed methods, we estimated detection probability of sea otters to be 0.76, the same as visual aerial surveys that have been used in the past. Further, simulations demonstrated that our approach is a promising tool for estimating occupancy, abundance, and detection probability from aerial photographic surveys.Our methods can be readily extended to data collected using unmanned aerial vehicles, as technology and regulations permit. The generality of our methods for other aerial surveys depends on how well surveys can be designed to meet the assumptions of N-mixture models.

  5. Evaluation of Targeted Next-Generation Sequencing for Detection of Bovine Pathogens in Clinical Samples.

    PubMed

    Anis, Eman; Hawkins, Ian K; Ilha, Marcia R S; Woldemeskel, Moges W; Saliki, Jeremiah T; Wilkes, Rebecca P

    2018-07-01

    The laboratory diagnosis of infectious diseases, especially those caused by mixed infections, is challenging. Routinely, it requires submission of multiple samples to separate laboratories. Advances in next-generation sequencing (NGS) have provided the opportunity for development of a comprehensive method to identify infectious agents. This study describes the use of target-specific primers for PCR-mediated amplification with the NGS technology in which pathogen genomic regions of interest are enriched and selectively sequenced from clinical samples. In the study, 198 primers were designed to target 43 common bovine and small-ruminant bacterial, fungal, viral, and parasitic pathogens, and a bioinformatics tool was specifically constructed for the detection of targeted pathogens. The primers were confirmed to detect the intended pathogens by testing reference strains and isolates. The method was then validated using 60 clinical samples (including tissues, feces, and milk) that were also tested with other routine diagnostic techniques. The detection limits of the targeted NGS method were evaluated using 10 representative pathogens that were also tested by quantitative PCR (qPCR), and the NGS method was able to detect the organisms from samples with qPCR threshold cycle ( C T ) values in the 30s. The method was successful for the detection of multiple pathogens in the clinical samples, including some additional pathogens missed by the routine techniques because the specific tests needed for the particular organisms were not performed. The results demonstrate the feasibility of the approach and indicate that it is possible to incorporate NGS as a diagnostic tool in a cost-effective manner into a veterinary diagnostic laboratory. Copyright © 2018 Anis et al.

  6. Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

    PubMed

    Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

    2016-06-01

    Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

  7. Wake Vortex Avoidance System and Method

    NASA Technical Reports Server (NTRS)

    Shams, Qamar A. (Inventor); Zuckerwar, Allan J. (Inventor); Knight, Howard K. (Inventor)

    2017-01-01

    A wake vortex avoidance system includes a microphone array configured to detect low frequency sounds. A signal processor determines a geometric mean coherence based on the detected low frequency sounds. A display displays wake vortices based on the determined geometric mean coherence.

  8. An interlaboratory study on efficient detection of Shiga toxin-producing Escherichia coli O26, O103, O111, O121, O145, and O157 in food using real-time PCR assay and chromogenic agar.

    PubMed

    Hara-Kudo, Yukiko; Konishi, Noriko; Ohtsuka, Kayoko; Iwabuchi, Kaori; Kikuchi, Rie; Isobe, Junko; Yamazaki, Takumiko; Suzuki, Fumie; Nagai, Yuhki; Yamada, Hiroko; Tanouchi, Atsuko; Mori, Tetsuya; Nakagawa, Hiroshi; Ueda, Yasufumi; Terajima, Jun

    2016-08-02

    To establish an efficient detection method for Shiga toxin (Stx)-producing Escherichia coli (STEC) O26, O103, O111, O121, O145, and O157 in food, an interlaboratory study using all the serogroups of detection targets was firstly conducted. We employed a series of tests including enrichment, real-time PCR assays, and concentration by immunomagnetic separation, followed by plating onto selective agar media (IMS-plating methods). This study was particularly focused on the efficiencies of real-time PCR assays in detecting stx and O-antigen genes of the six serogroups and of IMS-plating methods onto selective agar media including chromogenic agar. Ground beef and radish sprouts samples were inoculated with the six STEC serogroups either at 4-6CFU/25g (low levels) or at 22-29CFU/25g (high levels). The sensitivity of stx detection in ground beef at both levels of inoculation with all six STEC serogroups was 100%. The sensitivity of stx detection was also 100% in radish sprouts at high levels of inoculation with all six STEC serogroups, and 66.7%-91.7% at low levels of inoculation. The sensitivity of detection of O-antigen genes was 100% in both ground beef and radish sprouts at high inoculation levels, while at low inoculation levels, it was 95.8%-100% in ground beef and 66.7%-91.7% in radish sprouts. The sensitivity of detection with IMS-plating was either the same or lower than those of the real-time PCR assays targeting stx and O-antigen genes. The relationship between the results of IMS-plating methods and Ct values of real-time PCR assays were firstly analyzed in detail. Ct values in most samples that tested negative in the IMS-plating method were higher than the maximum Ct values in samples that tested positive in the IMS-plating method. This study indicates that all six STEC serogroups in food contaminated with more than 29CFU/25g were detected by real-time PCR assays targeting stx and O-antigen genes and IMS-plating onto selective agar media. Therefore, screening of stx and O-antigen genes followed by isolation of STECs by IMS-plating methods may be an efficient method to detect the six STEC serogroups. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. High temperature ion channels and pores

    NASA Technical Reports Server (NTRS)

    Cheley, Stephen (Inventor); Gu, Li Qun (Inventor); Bayley, Hagan (Inventor); Kang, Xiaofeng (Inventor)

    2011-01-01

    The present invention includes an apparatus, system and method for stochastic sensing of an analyte to a protein pore. The protein pore may be an engineer protein pore, such as an ion channel at temperatures above 55.degree. C. and even as high as near 100.degree. C. The analyte may be any reactive analyte, including chemical weapons, environmental toxins and pharmaceuticals. The analyte covalently bonds to the sensor element to produce a detectable electrical current signal. Possible signals include change in electrical current. Detection of the signal allows identification of the analyte and determination of its concentration in a sample solution. Multiple analytes present in the same solution may also be detected.

  10. Development of bacteria-based bioassays for arsenic detection in natural waters.

    PubMed

    Diesel, Elizabeth; Schreiber, Madeline; van der Meer, Jan Roelof

    2009-06-01

    Arsenic contamination of natural waters is a worldwide concern, as the drinking water supplies for large populations can have high concentrations of arsenic. Traditional techniques to detect arsenic in natural water samples can be costly and time-consuming; therefore, robust and inexpensive methods to detect arsenic in water are highly desirable. Additionally, methods for detecting arsenic in the field have been greatly sought after. This article focuses on the use of bacteria-based assays as an emerging method that is both robust and inexpensive for the detection of arsenic in groundwater both in the field and in the laboratory. The arsenic detection elements in bacteria-based bioassays are biosensor-reporter strains; genetically modified strains of, e.g., Escherichia coli, Bacillus subtilis, Staphylococcus aureus, and Rhodopseudomonas palustris. In response to the presence of arsenic, such bacteria produce a reporter protein, the amount or activity of which is measured in the bioassay. Some of these bacterial biosensor-reporters have been successfully utilized for comparative in-field analyses through the use of simple solution-based assays, but future methods may concentrate on miniaturization using fiberoptics or microfluidics platforms. Additionally, there are other potential emerging bioassays for the detection of arsenic in natural waters including nematodes and clams.

  11. A NEW METHOD FOR FINDING POINT SOURCES IN HIGH-ENERGY NEUTRINO DATA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fang, Ke; Miller, M. Coleman

    The IceCube collaboration has reported the first detection of high-energy astrophysical neutrinos, including ∼50 high-energy starting events, but no individual sources have been identified. It is therefore important to develop the most sensitive and efficient possible algorithms to identify the point sources of these neutrinos. The most popular current method works by exploring a dense grid of possible directions to individual sources, and identifying the single direction with the maximum probability of having produced multiple detected neutrinos. This method has numerous strengths, but it is computationally intensive and because it focuses on the single best location for a point source,more » additional point sources are not included in the evidence. We propose a new maximum likelihood method that uses the angular separations between all pairs of neutrinos in the data. Unlike existing autocorrelation methods for this type of analysis, which also use angular separations between neutrino pairs, our method incorporates information about the point-spread function and can identify individual point sources. We find that if the angular resolution is a few degrees or better, then this approach reduces both false positive and false negative errors compared to the current method, and is also more computationally efficient up to, potentially, hundreds of thousands of detected neutrinos.« less

  12. Detection and traceability of genetically modified organisms in the food production chain.

    PubMed

    Miraglia, M; Berdal, K G; Brera, C; Corbisier, P; Holst-Jensen, A; Kok, E J; Marvin, H J P; Schimmel, H; Rentsch, J; van Rie, J P P F; Zagon, J

    2004-07-01

    Both labelling and traceability of genetically modified organisms are current issues that are considered in trade and regulation. Currently, labelling of genetically modified foods containing detectable transgenic material is required by EU legislation. A proposed package of legislation would extend this labelling to foods without any traces of transgenics. These new legislations would also impose labelling and a traceability system based on documentation throughout the food and feed manufacture system. The regulatory issues of risk analysis and labelling are currently harmonised by Codex Alimentarius. The implementation and maintenance of the regulations necessitates sampling protocols and analytical methodologies that allow for accurate determination of the content of genetically modified organisms within a food and feed sample. Current methodologies for the analysis of genetically modified organisms are focused on either one of two targets, the transgenic DNA inserted- or the novel protein(s) expressed- in a genetically modified product. For most DNA-based detection methods, the polymerase chain reaction is employed. Items that need consideration in the use of DNA-based detection methods include the specificity, sensitivity, matrix effects, internal reference DNA, availability of external reference materials, hemizygosity versus homozygosity, extrachromosomal DNA, and international harmonisation. For most protein-based methods, enzyme-linked immunosorbent assays with antibodies binding the novel protein are employed. Consideration should be given to the selection of the antigen bound by the antibody, accuracy, validation, and matrix effects. Currently, validation of detection methods for analysis of genetically modified organisms is taking place. In addition, new methodologies are developed, including the use of microarrays, mass spectrometry, and surface plasmon resonance. Challenges for GMO detection include the detection of transgenic material in materials with varying chromosome numbers. The existing and proposed regulatory EU requirements for traceability of genetically modified products fit within a broader tendency towards traceability of foods in general and, commercially, towards products that can be distinguished from each other. Traceability systems document the history of a product and may serve the purpose of both marketing and health protection. In this framework, segregation and identity preservation systems allow for the separation of genetically modified and non-modified products from "farm to fork". Implementation of these systems comes with specific technical requirements for each particular step of the food processing chain. In addition, the feasibility of traceability systems depends on a number of factors, including unique identifiers for each genetically modified product, detection methods, permissible levels of contamination, and financial costs. In conclusion, progress has been achieved in the field of sampling, detection, and traceability of genetically modified products, while some issues remain to be solved. For success, much will depend on the threshold level for adventitious contamination set by legislation. Copryright 2004 Elsevier Ltd.

  13. CRITERIA FOR EVALUATION OF PROPOSED PROTOZOAN DETECTION METHODS

    EPA Science Inventory

    There has been a proliferation of techniques and methods reported for analysis of water samples to determine the presence of the protozoan pathogens Cryptosporidium parvum and Giardia lamblia. Many of the proposed methods are presented as complete procedures, which include sampli...

  14. CRITERIA FOR EVALUATION OF PROPOSED PROTOZOAN DETECTION METHODS.

    EPA Science Inventory

    There has been a proliferation of techniques and methods reported for analysis of water samples to determine the presence of the protozoan pathogens Cryptosporidium parvum and Giardia lamblia. Many of the proposed methods are presented as complete procedures, which include sampli...

  15. Method to improve reliability of a fuel cell system using low performance cell detection at low power operation

    DOEpatents

    Choi, Tayoung; Ganapathy, Sriram; Jung, Jaehak; Savage, David R.; Lakshmanan, Balasubramanian; Vecasey, Pamela M.

    2013-04-16

    A system and method for detecting a low performing cell in a fuel cell stack using measured cell voltages. The method includes determining that the fuel cell stack is running, the stack coolant temperature is above a certain temperature and the stack current density is within a relatively low power range. The method further includes calculating the average cell voltage, and determining whether the difference between the average cell voltage and the minimum cell voltage is greater than a predetermined threshold. If the difference between the average cell voltage and the minimum cell voltage is greater than the predetermined threshold and the minimum cell voltage is less than another predetermined threshold, then the method increments a low performing cell timer. A ratio of the low performing cell timer and a system run timer is calculated to identify a low performing cell.

  16. Efficient Forest Fire Detection Index for Application in Unmanned Aerial Systems (UASs)

    PubMed Central

    Cruz, Henry; Eckert, Martina; Meneses, Juan; Martínez, José-Fernán

    2016-01-01

    This article proposes a novel method for detecting forest fires, through the use of a new color index, called the Forest Fire Detection Index (FFDI), developed by the authors. The index is based on methods for vegetation classification and has been adapted to detect the tonalities of flames and smoke; the latter could be included adaptively into the Regions of Interest (RoIs) with the help of a variable factor. Multiple tests have been performed upon database imagery and present promising results: a detection precision of 96.82% has been achieved for image sizes of 960 × 540 pixels at a processing time of 0.0447 seconds. This achievement would lead to a performance of 22 f/s, for smaller images, while up to 54 f/s could be reached by maintaining a similar detection precision. Additional tests have been performed on fires in their early stages, achieving a precision rate of p = 96.62%. The method could be used in real-time in Unmanned Aerial Systems (UASs), with the aim of monitoring a wider area than through fixed surveillance systems. Thus, it would result in more cost-effective outcomes than conventional systems implemented in helicopters or satellites. UASs could also reach inaccessible locations without jeopardizing people’s safety. On-going work includes implementation into a commercially available drone. PMID:27322264

  17. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

    PubMed

    Cho, Il-Hoon; Ku, Seockmo

    2017-09-30

    The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  18. Devices, systems, and methods for detecting nucleic acids using sedimentation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory J.

    Embodiments of the present invention are directed toward devices, systems, and method for conducting nucleic acid purification and quantification using sedimentation. In one example, a method includes generating complexes which bind to a plurality of beads in a fluid sample, individual ones of the complexes comprising a nucleic acid molecule such as DNA or RNA and a labeling agent. The plurality of beads including the complexes may be transported through a density media, wherein the density media has a density lower than a density of the beads and higher than a density of the fluid sample, and wherein the transportingmore » occurs, at least in part, by sedimentation. Signal may be detected from the labeling agents of the complexes.« less

  19. Monitoring Molecules in Neuroscience Then and Now

    PubMed Central

    Rice, Margaret E.

    2017-01-01

    The 16th International Conference on Monitoring Molecules in Neuroscience (MMiN) was held in Gothenburg, Sweden in late spring 2016. This conference originated as a methods meeting focused on in vivo voltammetric techniques and microdialysis. Over time, however, the scope has evolved to include a number of other methods for neurochemical detection that range from single-cell fluorescence in vitro and in vivo in animal models to whole-brain imaging in humans. Overall, MMiN provides a unique forum for introducing new developments in neurochemical detection, as well as for reporting exciting neurobiological insights provided by established and novel methods. This Viewpoint includes a brief history of the meeting, factors that have contributed its evolution, and some highlights of MMiN 2016. PMID:28169519

  20. Monitoring Molecules in Neuroscience Then and Now.

    PubMed

    Rice, Margaret E

    2017-02-15

    The 16th International Conference on Monitoring Molecules in Neuroscience (MMiN) was held in Gothenburg, Sweden in late spring 2016. This conference originated as a methods meeting focused on in vivo voltammetric techniques and microdialysis. Over time, however, the scope has evolved to include a number of other methods for neurochemical detection that range from single-cell fluorescence in vitro and in vivo in animal models to whole-brain imaging in humans. Overall, MMiN provides a unique forum for introducing new developments in neurochemical detection, as well as for reporting exciting neurobiological insights provided by established and novel methods. This Viewpoint includes a brief history of the meeting, factors that have contributed its evolution, and some highlights of MMiN 2016.

  1. Resonant frequency method for bearing ball inspection

    DOEpatents

    Khuri-Yakub, B. T.; Hsieh, Chung-Kao

    1993-01-01

    The present invention provides for an inspection system and method for detecting defects in test objects which includes means for generating expansion inducing energy focused upon the test object at a first location, such expansion being allowed to contract, thereby causing pressure wave within and on the surface of the test object. Such expansion inducing energy may be provided by, for example, a laser beam or ultrasonic energy. At a second location, the amplitudes and phases of the acoustic waves are detected and the resonant frequencies' quality factors are calculated and compared to predetermined quality factor data, such comparison providing information of whether the test object contains a defect. The inspection system and method also includes means for mounting the bearing ball for inspection.

  2. Tube curvature measuring probe and method

    DOEpatents

    Sokol, George J.

    1990-01-01

    The present invention is directed to a probe and method for measuring the radius of curvature of a bend in a section of tubing. The probe includes a member with a pair of guide means, one located at each end of the member. A strain gauge is operatively connected to the member for detecting bending stress exrted on the member as the probe is drawn through and in engagement with the inner surface of a section of tubing having a bend. The method of the present invention includes steps utilizing a probe, like the aforementioned probe, which can be made to detect bends only in a single plane when having a fixed orientation relative the section of tubing to determine the maximum radius of curvature of the bend.

  3. Real-time method and apparatus for measuring the decay-time constant of a fluorescing phosphor

    DOEpatents

    Britton, Jr., Charles L.; Beshears, David L.; Simpson, Marc L.; Cates, Michael R.; Allison, Steve W.

    1999-01-01

    A method for determining the decay-time constant of a fluorescing phosphor is provided, together with an apparatus for performing the method. The apparatus includes a photodetector for detecting light emitted by a phosphor irradiated with an excitation pulse and for converting the detected light into an electrical signal. The apparatus further includes a differentiator for differentiating the electrical signal and a zero-crossing discrimination circuit that outputs a pulse signal having a pulse width corresponding to the time period between the start of the excitation pulse and the time when the differentiated electrical signal reaches zero. The width of the output pulse signal is proportional to the decay-time constant of the phosphor.

  4. Resonant frequency method for bearing ball inspection

    DOEpatents

    Khuri-Yakub, B.T.; Chungkao Hsieh.

    1993-11-02

    The present invention provides for an inspection system and method for detecting defects in test objects which includes means for generating expansion inducing energy focused upon the test object at a first location, such expansion being allowed to contract, thereby causing pressure wave within and on the surface of the test object. Such expansion inducing energy may be provided by, for example, a laser beam or ultrasonic energy. At a second location, the amplitudes and phases of the acoustic waves are detected and the resonant frequencies' quality factors are calculated and compared to predetermined quality factor data, such comparison providing information of whether the test object contains a defect. The inspection system and method also includes means for mounting the bearing ball for inspection. 5 figures.

  5. Development of an efficient entire-capsid-coding-region amplification method for direct detection of poliovirus from stool extracts.

    PubMed

    Arita, Minetaro; Kilpatrick, David R; Nakamura, Tomofumi; Burns, Cara C; Bukbuk, David; Oderinde, Soji B; Oberste, M Steven; Kew, Olen M; Pallansch, Mark A; Shimizu, Hiroyuki

    2015-01-01

    Laboratory diagnosis has played a critical role in the Global Polio Eradication Initiative since 1988, by isolating and identifying poliovirus (PV) from stool specimens by using cell culture as a highly sensitive system to detect PV. In the present study, we aimed to develop a molecular method to detect PV directly from stool extracts, with a high efficiency comparable to that of cell culture. We developed a method to efficiently amplify the entire capsid coding region of human enteroviruses (EVs) including PV. cDNAs of the entire capsid coding region (3.9 kb) were obtained from as few as 50 copies of PV genomes. PV was detected from the cDNAs with an improved PV-specific real-time reverse transcription-PCR system and nucleotide sequence analysis of the VP1 coding region. For assay validation, we analyzed 84 stool extracts that were positive for PV in cell culture and detected PV genomes from 100% of the extracts (84/84 samples) with this method in combination with a PV-specific extraction method. PV could be detected in 2/4 stool extract samples that were negative for PV in cell culture. In PV-positive samples, EV species C viruses were also detected with high frequency (27% [23/86 samples]). This method would be useful for direct detection of PV from stool extracts without using cell culture. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Parallel evaluation of broad virus detection methods.

    PubMed

    Modrof, Jens; Berting, Andreas; Kreil, Thomas R

    2014-01-01

    The testing for adventitious viruses is of critical importance during development and production of biological products. The recent emergence and ongoing development of broad virus detection methods calls for an evaluation of whether these methods can appropriately be implemented into current adventitious agent testing procedures. To assess the suitability of several broad virus detection methods, a comparative experimental study was conducted: four virus preparations, which were spiked at two different concentrations each into two different cell culture media, were sent to four investigators in a blinded fashion for analysis with broad virus detection methods such as polymerase chain reaction-electrospray ionization mass spectrometry (PCR-ESI/MS), microarray, and two approaches utilizing massively parallel sequencing. The results that were reported by the investigators revealed that all methods were able to identify the majority of samples correctly (mean 83%), with a surprisingly narrow range among the methods, that is, between 72% (PCR-ESI/MS) and 95% (microarray). In addition to the correct results, a variety of unexpected assignments were reported for a minority of samples, again with little variation regarding the methods used (range 20-45%), while false negatives were reported for 0-25% of the samples. Regarding assay sensitivity, the viruses were detected by all methods included in this study at concentrations of about 4-5 log10 quantitative PCR copies/mL, and probably with higher sensitivity in some cases. In summary, the broad virus detection methods investigated were shown to be suitable even for detection of relatively low virus concentrations. However, there is also some potential for the production of false-positive as well as false-negative assignments, which indicates the requirement for further improvements before these methods can be considered for routine use. © PDA, Inc. 2014.

  7. Nanoparticle-based gas sensors and methods of using the same

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mickelson, William; Zettl, Alex

    Gas sensors are provided. The gas sensors include a gas sensing element having metal oxide nanoparticles and a thin-film heating element. Systems that include the gas sensors, as well as methods of using the gas sensors, are also provided. Embodiments of the present disclosure find use in a variety of different applications, including detecting whether an analyte is present in a gaseous sample.

  8. A simple method for the detection of PM2.5 air pollutions using MODIS data

    NASA Astrophysics Data System (ADS)

    Kato, Yoshinobu

    2016-05-01

    In recent years, PM2.5 air pollution is a social and transboundary environmental issue with the rapid economic growth in many countries. As PM2.5 is small and includes various ingredients, the detection of PM2.5 air pollutions by using satellite data is difficult compared with the detection of dust and sandstorms. In this paper, we examine various images (i.e., single-band images, band-difference images, RGB composite color images) to find a good method for detecting PM2.5 air pollutions by using MODIS data. A good method for the detection of PM2.5 air pollution is {R, G, B = band10, band9, T11}, where T11 is the brightness temperature of band31. In this composite color image, PM2.5 air pollutions are represented by light purple or pink color. This proposed method is simpler than the method by Nagatani et al. (2013), and is useful to grasp the distribution of PM2.5 air pollutions in the wide area (e.g., from China and India to Japan). By comparing AVI image with the image by proposed method, DSS and PM2.5 air pollutions can be classified.

  9. Detection of Coronal Mass Ejections Using Multiple Features and Space-Time Continuity

    NASA Astrophysics Data System (ADS)

    Zhang, Ling; Yin, Jian-qin; Lin, Jia-ben; Feng, Zhi-quan; Zhou, Jin

    2017-07-01

    Coronal Mass Ejections (CMEs) release tremendous amounts of energy in the solar system, which has an impact on satellites, power facilities and wireless transmission. To effectively detect a CME in Large Angle Spectrometric Coronagraph (LASCO) C2 images, we propose a novel algorithm to locate the suspected CME regions, using the Extreme Learning Machine (ELM) method and taking into account the features of the grayscale and the texture. Furthermore, space-time continuity is used in the detection algorithm to exclude the false CME regions. The algorithm includes three steps: i) define the feature vector which contains textural and grayscale features of a running difference image; ii) design the detection algorithm based on the ELM method according to the feature vector; iii) improve the detection accuracy rate by using the decision rule of the space-time continuum. Experimental results show the efficiency and the superiority of the proposed algorithm in the detection of CMEs compared with other traditional methods. In addition, our algorithm is insensitive to most noise.

  10. PCR-free quantitative detection of genetically modified organism from raw materials – A novel electrochemiluminescence-based bio-barcode method

    PubMed Central

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.

    2018-01-01

    Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

  11. PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.

    PubMed

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

    2008-05-15

    A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.

  12. Detection of neovascularization based on fractal and texture analysis with interaction effects in diabetic retinopathy.

    PubMed

    Lee, Jack; Zee, Benny Chung Ying; Li, Qing

    2013-01-01

    Diabetic retinopathy is a major cause of blindness. Proliferative diabetic retinopathy is a result of severe vascular complication and is visible as neovascularization of the retina. Automatic detection of such new vessels would be useful for the severity grading of diabetic retinopathy, and it is an important part of screening process to identify those who may require immediate treatment for their diabetic retinopathy. We proposed a novel new vessels detection method including statistical texture analysis (STA), high order spectrum analysis (HOS), fractal analysis (FA), and most importantly we have shown that by incorporating their associated interactions the accuracy of new vessels detection can be greatly improved. To assess its performance, the sensitivity, specificity and accuracy (AUC) are obtained. They are 96.3%, 99.1% and 98.5% (99.3%), respectively. It is found that the proposed method can improve the accuracy of new vessels detection significantly over previous methods. The algorithm can be automated and is valuable to detect relatively severe cases of diabetic retinopathy among diabetes patients.

  13. Compact Surface Plasmon Resonance Biosensor for Fieldwork Environmental Detection

    NASA Astrophysics Data System (ADS)

    Boyd, Margrethe; Drake, Madison; Stipe, Kristian; Serban, Monica; Turner, Ivana; Thomas, Aaron; Macaluso, David

    2017-04-01

    The ability to accurately and reliably detect biomolecular targets is important in innumerable applications, including the identification of food-borne parasites, viral pathogens in human tissue, and environmental pollutants. While detection methods do exist, they are typically slow, expensive, and restricted to laboratory use. The method of surface plasmon resonance based biosensing offers a unique opportunity to characterize molecular targets while avoiding these constraints. By incorporating a plasmon-supporting gold film within a prism/laser optical system, it is possible to reliably detect and quantify the presence of specific biomolecules of interest in real time. This detection is accomplished by observing shifts in plasmon formation energies corresponding to optical absorption due to changes in index of refraction near the gold-prism interface caused by the binding of target molecules. A compact, inexpensive, battery-powered surface plasmon resonance biosensor based on this method is being developed at the University of Montana to detect waterborne pollutants in field-based environmental research.

  14. Comparison of real-time PCR methods for the detection of Naegleria fowleri in surface water and sediment.

    PubMed

    Streby, Ashleigh; Mull, Bonnie J; Levy, Karen; Hill, Vincent R

    2015-05-01

    Naegleria fowleri is a thermophilic free-living ameba found in freshwater environments worldwide. It is the cause of a rare but potentially fatal disease in humans known as primary amebic meningoencephalitis. Established N. fowleri detection methods rely on conventional culture techniques and morphological examination followed by molecular testing. Multiple alternative real-time PCR assays have been published for rapid detection of Naegleria spp. and N. fowleri. Foursuch assays were evaluated for the detection of N. fowleri from surface water and sediment. The assays were compared for thermodynamic stability, analytical sensitivity and specificity, detection limits, humic acid inhibition effects, and performance with seeded environmental matrices. Twenty-one ameba isolates were included in the DNA panel used for analytical sensitivity and specificity analyses. N. fowleri genotypes I and III were used for method performance testing. Two of the real-time PCR assays were determined to yield similar performance data for specificity and sensitivity for detecting N. fowleri in environmental matrices.

  15. Comparison of real-time PCR methods for the detection of Naegleria fowleri in surface water and sediment

    PubMed Central

    Streby, Ashleigh; Mull, Bonnie J.; Levy, Karen

    2015-01-01

    Naegleria fowleri is a thermophilic free-living ameba found in freshwater environments worldwide. It is the cause of a rare but potentially fatal disease in humans known as primary amebic meningoencephalitis. Established N. fowleri detection methods rely on conventional culture techniques and morphological examination followed by molecular testing. Multiple alternative real-time PCR assays have been published for rapid detection of Naegleria spp. and N. fowleri. Four such assays were evaluated for the detection of N. fowleri from surface water and sediment. The assays were compared for thermodynamic stability, analytical sensitivity and specificity, detection limits, humic acid inhibition effects, and performance with seeded environmental matrices. Twenty-one ameba isolates were included in the DNA panel used for analytical sensitivity and specificity analyses. N. fowleri genotypes I and III were used for method performance testing. Two of the real-time PCR assays were determined to yield similar performance data for specificity and sensitivity for detecting N. fowleri in environmental matrices. PMID:25855343

  16. Portable evanescent wave fiber biosensor for highly sensitive detection of Shigella

    NASA Astrophysics Data System (ADS)

    Xiao, Rui; Rong, Zhen; Long, Feng; Liu, Qiqi

    2014-11-01

    A portable evanescent wave fiber biosensor was developed to achieve the rapid and highly sensitive detection of Shigella. In this study, a DNA probe was covalently immobilized onto fiber-optic biosensors that can hybridize with a fluorescently labeled complementary DNA. The sensitivity of detection for synthesized oligonucleotides can reach 10-10 M. The surface of the sensor can be regenerated with 0.5% sodium dodecyl sulfate solution (pH 1.9) for over 30 times without significant deterioration of performance. The total analysis time for a single sample, including the time for measurement and surface regeneration, was less than 6 min. We employed real-time polymerase chain reaction (PCR) and compared the results of both methods to investigate the actual Shigella DNA detection capability of the fiber-optic biosensor. The fiber-optic biosensor could detect as low as 102 colony-forming unit/mL Shigella. This finding was comparable with that by real-time PCR, which suggests that this method is a potential alternative to existing detection methods.

  17. Trace gas detection in hyperspectral imagery using the wavelet packet subspace

    NASA Astrophysics Data System (ADS)

    Salvador, Mark A. Z.

    This dissertation describes research into a new remote sensing method to detect trace gases in hyperspectral and ultra-spectral data. This new method is based on the wavelet packet transform. It attempts to improve both the computational tractability and the detection of trace gases in airborne and spaceborne spectral imagery. Atmospheric trace gas research supports various Earth science disciplines to include climatology, vulcanology, pollution monitoring, natural disasters, and intelligence and military applications. Hyperspectral and ultra-spectral data significantly increases the data glut of existing Earth science data sets. Spaceborne spectral data in particular significantly increases spectral resolution while performing daily global collections of the earth. Application of the wavelet packet transform to the spectral space of hyperspectral and ultra-spectral imagery data potentially improves remote sensing detection algorithms. It also facilities the parallelization of these methods for high performance computing. This research seeks two science goals, (1) developing a new spectral imagery detection algorithm, and (2) facilitating the parallelization of trace gas detection in spectral imagery data.

  18. Analysis of Endocrine Disrupting Pesticides by Capillary GC with Mass Spectrometric Detection

    PubMed Central

    Matisová, Eva; Hrouzková, Svetlana

    2012-01-01

    Endocrine disrupting chemicals, among them many pesticides, alter the normal functioning of the endocrine system of both wildlife and humans at very low concentration levels. Therefore, the importance of method development for their analysis in food and the environment is increasing. This also covers contributions in the field of ultra-trace analysis of multicomponent mixtures of organic pollutants in complex matrices. With this fact conventional capillary gas chromatography (CGC) and fast CGC with mass spectrometric detection (MS) has acquired a real importance in the analysis of endocrine disrupting pesticide (EDP) residues. This paper provides an overview of GC methods, including sample preparation steps, for analysis of EDPs in a variety of matrices at ultra-trace concentration levels. Emphasis is put on separation method, mode of MS detection and ionization and obtained limits of detection and quantification. Analysis time is one of the most important aspects that should be considered in the choice of analytical methods for routine analysis. Therefore, the benefits of developed fast GC methods are important. PMID:23202677

  19. Initial study of Schroedinger eigenmaps for spectral target detection

    NASA Astrophysics Data System (ADS)

    Dorado-Munoz, Leidy P.; Messinger, David W.

    2016-08-01

    Spectral target detection refers to the process of searching for a specific material with a known spectrum over a large area containing materials with different spectral signatures. Traditional target detection methods in hyperspectral imagery (HSI) require assuming the data fit some statistical or geometric models and based on the model, to estimate parameters for defining a hypothesis test, where one class (i.e., target class) is chosen over the other classes (i.e., background class). Nonlinear manifold learning methods such as Laplacian eigenmaps (LE) have extensively shown their potential use in HSI processing, specifically in classification or segmentation. Recently, Schroedinger eigenmaps (SE), which is built upon LE, has been introduced as a semisupervised classification method. In SE, the former Laplacian operator is replaced by the Schroedinger operator. The Schroedinger operator includes by definition, a potential term V that steers the transformation in certain directions improving the separability between classes. In this regard, we propose a methodology for target detection that is not based on the traditional schemes and that does not need the estimation of statistical or geometric parameters. This method is based on SE, where the potential term V is taken into consideration to include the prior knowledge about the target class and use it to steer the transformation in directions where the target location in the new space is known and the separability between target and background is augmented. An initial study of how SE can be used in a target detection scheme for HSI is shown here. In-scene pixel and spectral signature detection approaches are presented. The HSI data used comprise various target panels for testing simultaneous detection of multiple objects with different complexities.

  20. Semi-continuous detection of mercury in gases

    DOEpatents

    Granite, Evan J [Wexford, PA; Pennline, Henry W [Bethel Park, PA

    2011-12-06

    A new method for the semi-continuous detection of heavy metals and metalloids including mercury in gaseous streams. The method entails mass measurement of heavy metal oxides and metalloid oxides with a surface acoustic wave (SAW) sensor having an uncoated substrate. An array of surface acoustic wave (SAW) sensors can be used where each sensor is for the semi-continuous emission monitoring of a particular heavy metal or metalloid.

  1. Method and apparatus for current-output peak detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Geronimo, Gianluigi

    2017-01-24

    A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.

  2. Cost and detection rate of glaucoma screening with imaging devices in a primary care center

    PubMed Central

    Anton, Alfonso; Fallon, Monica; Cots, Francesc; Sebastian, María A; Morilla-Grasa, Antonio; Mojal, Sergi; Castells, Xavier

    2017-01-01

    Purpose To analyze the cost and detection rate of a screening program for detecting glaucoma with imaging devices. Materials and methods In this cross-sectional study, a glaucoma screening program was applied in a population-based sample randomly selected from a population of 23,527. Screening targeted the population at risk of glaucoma. Examinations included optic disk tomography (Heidelberg retina tomograph [HRT]), nerve fiber analysis, and tonometry. Subjects who met at least 2 of 3 endpoints (HRT outside normal limits, nerve fiber index ≥30, or tonometry ≥21 mmHg) were referred for glaucoma consultation. The currently established (“conventional”) detection method was evaluated by recording data from primary care and ophthalmic consultations in the same population. The direct costs of screening and conventional detection were calculated by adding the unit costs generated during the diagnostic process. The detection rate of new glaucoma cases was assessed. Results The screening program evaluated 414 subjects; 32 cases were referred for glaucoma consultation, 7 had glaucoma, and 10 had probable glaucoma. The current detection method assessed 677 glaucoma suspects in the population, of whom 29 were diagnosed with glaucoma or probable glaucoma. Glaucoma screening and the conventional detection method had detection rates of 4.1% and 3.1%, respectively, and the cost per case detected was 1,410 and 1,435€, respectively. The cost of screening 1 million inhabitants would be 5.1 million euros and would allow the detection of 4,715 new cases. Conclusion The proposed screening method directed at population at risk allows a detection rate of 4.1% and a cost of 1,410 per case detected. PMID:28243057

  3. Optoelectronic method for detection of cervical intraepithelial neoplasia and cervical cancer

    NASA Astrophysics Data System (ADS)

    Pruski, D.; Przybylski, M.; Kędzia, W.; Kędzia, H.; Jagielska-Pruska, J.; Spaczyński, M.

    2011-12-01

    The optoelectronic method is one of the most promising concepts of biophysical program of the diagnostics of CIN and cervical cancer. Objectives of the work are evaluation of sensitivity and specificity of the optoelectronic method in the detection of CIN and cervical cancer. The paper shows correlation between the pNOR number and sensitivity/specificity of the optoelectronic method. The study included 293 patients with abnormal cervical cytology result and the following examinations: examination with the use of the optoelectronic method — Truscreen, colposcopic examination, and histopathologic biopsy. Specificity of the optoelectronic method for LGSIL was estimated at 65.70%, for HGSIL and squamous cell carcinoma of cervix amounted to 90.38%. Specificity of the optoelectronic method used to confirm lack of cervical pathology was estimated at 78.89%. The field under the ROC curve for the optoelectronic method was estimated at 0.88 (95% CI, 0.84-0.92) which shows high diagnostic value of the test in the detection of HGSIL and squamous cell carcinoma. The optoelectronic method is characterised by high usefulness in the detection of CIN, present in the squamous epithelium and squamous cell carcinoma of cervix.

  4. Comparison of methods for determination of volatile organic compounds in drinking water.

    PubMed

    Golfinopoulos, S K; Lekkas, T D; Nikolaou, A D

    2001-10-01

    Comparison of four methods including liquid-liquid extraction (LLE), direct aqueous injection (DAI), purge and trap (PAT) and head space (HS) were carried out in this work for determination of volatile organic compounds (VOCs) including trihalomethanes (THMs) in drinking water. This comparison is made especially to show the advantages and disadvantages and specifically the different detection limits (DL) that can be obtained for a given type of analysis. LLE is applicable only for determination of the THMs concentrations, while DAI, PAT, HS methods with different DL each of them are applicable for all VOCs, with PAT to be the most sensitive. Sampling apparatus and procedure for all these methods except of PAT are very simple and easy, but possible disadvantages for LLE and DAI are the low sensitivity and especially the detection only of THMs with LLE.

  5. System and method for anomaly detection

    DOEpatents

    Scherrer, Chad

    2010-06-15

    A system and method for detecting one or more anomalies in a plurality of observations is provided. In one illustrative embodiment, the observations are real-time network observations collected from a stream of network traffic. The method includes performing a discrete decomposition of the observations, and introducing derived variables to increase storage and query efficiencies. A mathematical model, such as a conditional independence model, is then generated from the formatted data. The formatted data is also used to construct frequency tables which maintain an accurate count of specific variable occurrence as indicated by the model generation process. The formatted data is then applied to the mathematical model to generate scored data. The scored data is then analyzed to detect anomalies.

  6. Method for improving the limit of detection in a data signal

    DOEpatents

    Synovec, Robert E.; Yueng, Edward S.

    1989-10-17

    A method for improving the limit of detection for a data set in which experimental noise is uncorrelated along a given abscissa and an analytical signal is correlated to the abscissa, the steps comprising collecting the data set, converting the data set into a data signal including an analytical portion and the experimental noise portion, designating and adjusting a baseline of the data signal to center the experimental noise numerically about a zero reference, and integrating the data signal preserving the corresponding information for each point of the data signal. The steps of the method produce an enhanced integrated data signal which improves the limit of detection of the data signal.

  7. Method for improving the limit of detection in a data signal

    DOEpatents

    Synovec, R.E.; Yueng, E.S.

    1989-10-17

    Disclosed is a method for improving the limit of detection for a data set in which experimental noise is uncorrelated along a given abscissa and an analytical signal is correlated to the abscissa, the steps comprising collecting the data set, converting the data set into a data signal including an analytical portion and the experimental noise portion, designating and adjusting a baseline of the data signal to center the experimental noise numerically about a zero reference, and integrating the data signal preserving the corresponding information for each point of the data signal. The steps of the method produce an enhanced integrated data signal which improves the limit of detection of the data signal. 8 figs.

  8. A cascade method for TFT-LCD defect detection

    NASA Astrophysics Data System (ADS)

    Yi, Songsong; Wu, Xiaojun; Yu, Zhiyang; Mo, Zhuoya

    2017-07-01

    In this paper, we propose a novel cascade detection algorithm which focuses on point and line defects on TFT-LCD. At the first step of the algorithm, we use the gray level difference of su-bimage to segment the abnormal area. The second step is based on phase only transform (POT) which corresponds to the Discrete Fourier Transform (DFT), normalized by the magnitude. It can remove regularities like texture and noise. After that, we improve the method of setting regions of interest (ROI) with the method of edge segmentation and polar transformation. The algorithm has outstanding performance in both computation speed and accuracy. It can solve most of the defect detections including dark point, light point, dark line, etc.

  9. Exploring a Nearby Habitable World...Orbiting an M-Dwarf Star

    NASA Technical Reports Server (NTRS)

    Deming, Drake

    2010-01-01

    Topics include: the landscape of extrasolar planets and detection techniques, direct and indirect detection methods, summary of the known exoplanets, exploiting transits to characterize super earth atmospheres, how to characterize exoplanet atmospheres, and emitted or reflected spectra of hot Jupiters.

  10. Evaluating and implementing temporal, spatial, and spatio-temporal methods for outbreak detection in a local syndromic surveillance system.

    PubMed

    Mathes, Robert W; Lall, Ramona; Levin-Rector, Alison; Sell, Jessica; Paladini, Marc; Konty, Kevin J; Olson, Don; Weiss, Don

    2017-01-01

    The New York City Department of Health and Mental Hygiene has operated an emergency department syndromic surveillance system since 2001, using temporal and spatial scan statistics run on a daily basis for cluster detection. Since the system was originally implemented, a number of new methods have been proposed for use in cluster detection. We evaluated six temporal and four spatial/spatio-temporal detection methods using syndromic surveillance data spiked with simulated injections. The algorithms were compared on several metrics, including sensitivity, specificity, positive predictive value, coherence, and timeliness. We also evaluated each method's implementation, programming time, run time, and the ease of use. Among the temporal methods, at a set specificity of 95%, a Holt-Winters exponential smoother performed the best, detecting 19% of the simulated injects across all shapes and sizes, followed by an autoregressive moving average model (16%), a generalized linear model (15%), a modified version of the Early Aberration Reporting System's C2 algorithm (13%), a temporal scan statistic (11%), and a cumulative sum control chart (<2%). Of the spatial/spatio-temporal methods we tested, a spatial scan statistic detected 3% of all injects, a Bayes regression found 2%, and a generalized linear mixed model and a space-time permutation scan statistic detected none at a specificity of 95%. Positive predictive value was low (<7%) for all methods. Overall, the detection methods we tested did not perform well in identifying the temporal and spatial clusters of cases in the inject dataset. The spatial scan statistic, our current method for spatial cluster detection, performed slightly better than the other tested methods across different inject magnitudes and types. Furthermore, we found the scan statistics, as applied in the SaTScan software package, to be the easiest to program and implement for daily data analysis.

  11. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  12. Set of new draft methods for the analysis of organic disinfection by-products, including 551 and 552. Draft report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-01-01

    The set of documents discusses the new draft methods (EPA method 551, EPA method 552) for the analysis of disinfection byproducts contained in drinking water. The methods use the techniques of liquid/liquid extraction and gas chromatography with electron capture detection.

  13. Patient-Specific Early Seizure Detection from Scalp EEG

    PubMed Central

    Minasyan, Georgiy R.; Chatten, John B.; Chatten, Martha Jane; Harner, Richard N.

    2010-01-01

    Objective Develop a method for automatic detection of seizures prior to or immediately after clinical onset using features derived from scalp EEG. Methods This detection method is patient-specific. It uses recurrent neural networks and a variety of input features. For each patient we trained and optimized the detection algorithm for two cases: 1) during the period immediately preceding seizure onset, and 2) during the period immediately following seizure onset. Continuous scalp EEG recordings (duration 15 – 62 h, median 25 h) from 25 patients, including a total of 86 seizures, were used in this study. Results Pre-onset detection was successful in 14 of the 25 patients. For these 14 patients, all of the testing seizures were detected prior to seizure onset with a median pre-onset time of 51 sec and false positive rate was 0.06/h. Post-onset detection had 100% sensitivity, 0.023/hr false positive rate and median delay of 4 sec after onset. Conclusions The unique results of this study relate to pre-onset detection. Significance Our results suggest that reliable pre-onset seizure detection may be achievable for a significant subset of epilepsy patients without use of invasive electrodes. PMID:20461014

  14. Validation of DESS as a DNA Preservation Method for the Detection of Strongyloides spp. in Canine Feces.

    PubMed

    Beknazarova, Meruyert; Millsteed, Shelby; Robertson, Gemma; Whiley, Harriet; Ross, Kirstin

    2017-06-09

    Strongyloides stercoralis is a gastrointestinal parasitic nematode with a life cycle that includes free-living and parasitic forms. For both clinical (diagnostic) and environmental evaluation, it is important that we can detect Strongyloides spp. in both human and non-human fecal samples. Real-time PCR is the most feasible method for detecting the parasite in both clinical and environmental samples that have been preserved. However, one of the biggest challenges with PCR detection is DNA degradation during the postage time from rural and remote areas to the laboratory. This study included a laboratory assessment and field validation of DESS (dimethyl sulfoxide, disodium EDTA, and saturated NaCl) preservation of Strongyloides spp. DNA in fecal samples. The laboratory study investigated the capacity of 1:1 and 1:3 sample to DESS ratios to preserve Strongyloides ratti in spike canine feces. It was found that both ratios of DESS significantly prevented DNA degradation compared to the untreated sample. This method was then validated by applying it to the field-collected canine feces and detecting Strongyloides DNA using PCR. A total of 37 canine feces samples were collected and preserved in the 1:3 ratio (sample: DESS) and of these, 17 were positive for Strongyloides spp. The study shows that both 1:1 and 1:3 sample to DESS ratios were able to preserve the Strongyloides spp. DNA in canine feces samples stored at room temperature for up to 56 days. This DESS preservation method presents the most applicable and feasible method for the Strongyloides DNA preservation in field-collected feces.

  15. Searching for life in the Universe: unconventional methods for an unconventional problem.

    PubMed

    Nealson, K H; Tsapin, A; Storrie-Lombardi, M

    2002-12-01

    The search for life, on and off our planet, can be done by conventional methods with which we are all familiar. These methods are sensitive and specific, and are often capable of detecting even single cells. However, if the search broadens to include life that may be different (even subtly different) in composition, the methods and even the approach must be altered. Here we discuss the development of what we call non-earthcentric life detection--detecting life with methods that could detect life no matter what its form or composition. To develop these methods, we simply ask, can we define life in terms of its general properties and particularly those that can be measured and quantified? Taking such an approach we can search for life using physics and chemistry to ask questions about structure, chemical composition, thermodynamics, and kinetics. Structural complexity can be searched for using computer algorithms that recognize complex structures. Once identified, these structures can be examined for a variety of chemical traits, including elemental composition, chirality, and complex chemistry. A second approach involves defining our environment in terms of energy sources (i.e., reductants), and oxidants (e.g. what is available to eat and breathe), and then looking for areas in which such phenomena are inexplicably out of chemical equilibrium. These disequilibria, when found, can then be examined in detail for the presence of the structural and chemical complexity that presumably characterizes any living systems. By this approach, we move the search for life to one that should facilitate the detection of any earthly life it encountered, as well as any non-conventional life forms that have structure, complex chemistry, and live via some form of redox chemistry.

  16. Advancing the detection of steady-state visual evoked potentials in brain-computer interfaces

    NASA Astrophysics Data System (ADS)

    Abu-Alqumsan, Mohammad; Peer, Angelika

    2016-06-01

    Objective. Spatial filtering has proved to be a powerful pre-processing step in detection of steady-state visual evoked potentials and boosted typical detection rates both in offline analysis and online SSVEP-based brain-computer interface applications. State-of-the-art detection methods and the spatial filters used thereby share many common foundations as they all build upon the second order statistics of the acquired Electroencephalographic (EEG) data, that is, its spatial autocovariance and cross-covariance with what is assumed to be a pure SSVEP response. The present study aims at highlighting the similarities and differences between these methods. Approach. We consider the canonical correlation analysis (CCA) method as a basis for the theoretical and empirical (with real EEG data) analysis of the state-of-the-art detection methods and the spatial filters used thereby. We build upon the findings of this analysis and prior research and propose a new detection method (CVARS) that combines the power of the canonical variates and that of the autoregressive spectral analysis in estimating the signal and noise power levels. Main results. We found that the multivariate synchronization index method and the maximum contrast combination method are variations of the CCA method. All three methods were found to provide relatively unreliable detections in low signal-to-noise ratio (SNR) regimes. CVARS and the minimum energy combination methods were found to provide better estimates for different SNR levels. Significance. Our theoretical and empirical results demonstrate that the proposed CVARS method outperforms other state-of-the-art detection methods when used in an unsupervised fashion. Furthermore, when used in a supervised fashion, a linear classifier learned from a short training session is able to estimate the hidden user intention, including the idle state (when the user is not attending to any stimulus), rapidly, accurately and reliably.

  17. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

    PubMed

    Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

    Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  18. Redundancy relations and robust failure detection

    NASA Technical Reports Server (NTRS)

    Chow, E. Y.; Lou, X. C.; Verghese, G. C.; Willsky, A. S.

    1984-01-01

    All failure detection methods are based on the use of redundancy, that is on (possible dynamic) relations among the measured variables. Consequently the robustness of the failure detection process depends to a great degree on the reliability of the redundancy relations given the inevitable presence of model uncertainties. The problem of determining redundancy relations which are optimally robust in a sense which includes the major issues of importance in practical failure detection is addressed. A significant amount of intuition concerning the geometry of robust failure detection is provided.

  19. Uncued Low SNR Detection with Likelihood from Image Multi Bernoulli Filter

    NASA Astrophysics Data System (ADS)

    Murphy, T.; Holzinger, M.

    2016-09-01

    Both SSA and SDA necessitate uncued, partially informed detection and orbit determination efforts for small space objects which often produce only low strength electro-optical signatures. General frame to frame detection and tracking of objects includes methods such as moving target indicator, multiple hypothesis testing, direct track-before-detect methods, and random finite set based multiobject tracking. This paper will apply the multi-Bernoilli filter to low signal-to-noise ratio (SNR), uncued detection of space objects for space domain awareness applications. The primary novel innovation in this paper is a detailed analysis of the existing state-of-the-art likelihood functions and a likelihood function, based on a binary hypothesis, previously proposed by the authors. The algorithm is tested on electro-optical imagery obtained from a variety of sensors at Georgia Tech, including the GT-SORT 0.5m Raven-class telescope, and a twenty degree field of view high frame rate CMOS sensor. In particular, a data set of an extended pass of the Hitomi Astro-H satellite approximately 3 days after loss of communication and potential break up is examined.

  20. Determination of airborne carbonyls: comparison of a thermal desorption/GC method with the standard DNPH/HPLC method.

    PubMed

    Ho, Steven Sai Hang; Yu, Jian Zhen

    2004-02-01

    The standard method for the determination of gaseous carbonyls is to collect carbonyls onto 2,4-dinitrophenyl hydrazine (DNPH) coated solid sorbent followed by solvent extraction of the solid sorbent and analysis of the derivatives using high-pressure liquid chromatography (HPLC). This paper describes a newly developed approach that involves collection of the carbonyls onto pentafluorophenyl hydrazine (PFPH) coated solid sorbents followed by thermal desorption and gas chromatographic (GC) analysis of the PFPH derivatives with mass spectrometric (MS) detection. Sampling tubes loaded with 510 nmol of PFPH on Tenax sorbent effectively collect gaseous carbonyls, including formaldehyde, acetaldehyde, propanal, butanal, heptanal, octanal, acrolein, 2-furfural, benzaldehyde, p-tolualdehyde, glyoxal, and methylglyoxal, at a flow rate of at least up to 100 mL/min. All of the tested carbonyls are shown to have method detection limits (MDLs) of subnanomoles per sampling tube, corresponding to air concentrations of <0.3 ppbv for a sampled volume of 24 L. These limits are 2-12 times lower than those that can be obtained using the DNPH/HPLC method. The improvement of MDLs is especially pronounced for carbonyls larger than formaldehyde and acetaldehyde. The PFPH/GC method also offers better peak separation and more sensitive and specific detection through the use of MS detection. Comparison studies on ambient samples and kitchen exhaust samples have demonstrated that the two methods do not yield systematic differences in concentrations of the carbonyls that are above their respective MDLs in both methods, including formaldehyde, acetaldehyde, acrolein, and butanal. The lower MDLs afforded by the PFPH/ GC method also enable the determination of a few more carbonyls in both applications.

  1. Detection of medication-related problems in hospital practice: a review

    PubMed Central

    Manias, Elizabeth

    2013-01-01

    This review examines the effectiveness of detection methods in terms of their ability to identify and accurately determine medication-related problems in hospitals. A search was conducted of databases from inception to June 2012. The following keywords were used in combination: medication error or adverse drug event or adverse drug reaction, comparison, detection, hospital and method. Seven detection methods were considered: chart review, claims data review, computer monitoring, direct care observation, interviews, prospective data collection and incident reporting. Forty relevant studies were located. Detection methods that were better able to identify medication-related problems compared with other methods tested in the same study included chart review, computer monitoring, direct care observation and prospective data collection. However, only small numbers of studies were involved in comparisons with direct care observation (n = 5) and prospective data collection (n = 6). There was little focus on detecting medication-related problems during various stages of the medication process, and comparisons associated with the seriousness of medication-related problems were examined in 19 studies. Only 17 studies involved appropriate comparisons with a gold standard, which provided details about sensitivities and specificities. In view of the relatively low identification of medication-related problems with incident reporting, use of this method in tracking trends over time should be met with some scepticism. Greater attention should be placed on combining methods, such as chart review and computer monitoring in examining trends. More research is needed on the use of claims data, direct care observation, interviews and prospective data collection as detection methods. PMID:23194349

  2. Chromatographic separation and detection of contaminants from whole milk powder using a chitosan-modified silver nanoparticles surface-enhanced Raman scattering device.

    PubMed

    Li, Dan; Lv, Di Y; Zhu, Qing X; Li, Hao; Chen, Hui; Wu, Mian M; Chai, Yi F; Lu, Feng

    2017-06-01

    Methods for the on-site analysis of food contaminants are in high demand. Although portable Raman spectroscopy is commonly used to test food on-site, it can be challenge to achieve this goal with rapid detection and inexpensive substrate. In this study, we detected trace food contaminants in samples of whole milk powder using the methods that combined chromatography with surface-enhanced Raman scattering detection (SERS). We developed a simple and efficient technique to fabricate the paper with chitosan-modified silver nanoparticles as a SERS-active substrate. The soaking time of paper and the concentration of chitosan solution were optimized for chromatographic separation and SERS detection. We then studied the separation properties for real applications including complex sample matrices, and detected melamine at 1mg/L, dicyandiamide at 100mg/L and sodium sulfocyanate at 10mg/L in whole milk powder. As such, our methods have great potential for field-based detection of milk contaminants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Detection of trans–cis flips and peptide-plane flips in protein structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Touw, Wouter G., E-mail: wouter.touw@radboudumc.nl; Joosten, Robbie P.; Vriend, Gert, E-mail: wouter.touw@radboudumc.nl

    A method is presented to detect peptide bonds that need either a trans–cis flip or a peptide-plane flip. A coordinate-based method is presented to detect peptide bonds that need correction either by a peptide-plane flip or by a trans–cis inversion of the peptide bond. When applied to the whole Protein Data Bank, the method predicts 4617 trans–cis flips and many thousands of hitherto unknown peptide-plane flips. A few examples are highlighted for which a correction of the peptide-plane geometry leads to a correction of the understanding of the structure–function relation. All data, including 1088 manually validated cases, are freely availablemore » and the method is available from a web server, a web-service interface and through WHAT-CHECK.« less

  4. Encapsulated microsensors for reservoir interrogation

    DOEpatents

    Scott, Eddie Elmer; Aines, Roger D.; Spadaccini, Christopher M.

    2016-03-08

    In one general embodiment, a system includes at least one microsensor configured to detect one or more conditions of a fluidic medium of a reservoir; and a receptacle, wherein the receptacle encapsulates the at least one microsensor. In another general embodiment, a method include injecting the encapsulated at least one microsensor as recited above into a fluidic medium of a reservoir; and detecting one or more conditions of the fluidic medium of the reservoir.

  5. Assessment of hyporheic zone, flood-plain, soil-gas, soil, and surface-water contamination at the Old Incinerator Area, Fort Gordon, Georgia, 2009-2010

    USGS Publications Warehouse

    Guimaraes, Wladmir B.; Falls, W. Fred; Caldwell, Andral W.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

    2011-01-01

    The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, Georgia, assessed the hyporheic zone, flood plain, soil gas, soil, and surface-water for contaminants at the Old Incinerator Area at Fort Gordon, from October 2009 to September 2010. The assessment included the detection of organic contaminants in the hyporheic zone, flood plain, soil gas, and surface water. In addition, the organic contaminant assessment included the analysis of explosives and chemical agents in selected areas. Inorganic contaminants were assessed in soil and surface-water samples. The assessment was conducted to provide environmental contamination data to the U.S. Army at Fort Gordon pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. Total petroleum hydrocarbons were detected above the method detection level in all 13 samplers deployed in the hyporheic zone and flood plain of an unnamed tributary to Spirit Creek. The combined concentrations of benzene, toluene, ethylbenzene, and total xylene were detected at 3 of the 13 samplers. Other organic compounds detected in one sampler included octane and trichloroethylene. In the passive soil-gas survey, 28 of the 60 samplers detected total petroleum hydrocarbons above the method detection level. Additionally, 11 of the 60 samplers detected the combined masses of benzene, toluene, ethylbenzene, and total xylene above the method detection level. Other compounds detected above the method detection level in the passive soil-gas survey included octane, trimethylbenzene, perchlorethylene, and chloroform. Subsequent to the passive soil-gas survey, six areas determined to have relatively high contaminant mass were selected, and soil-gas samplers were deployed, collected, and analyzed for explosives and chemical agents. No explosives or chemical agents were detected above their method detection levels, but those that were detected were above the nondetection level. The same six locations that were sampled for explosives and chemical agents were selected for the collection of soil samples. No metals that exceeded the Regional Screening Levels for Industrial Soils as classified by the U.S. Environmental Protection Agency were detected at any of the six Old Incinerator Area locations. The soil samples also were compared to values from the ambient, uncontaminated (background) levels for soils in South Carolina. Because South Carolina is adjacent to Georgia and the soils in the coastal plain are similar, these comparisons are valid. No similar values are available for Georgia to use for comparison purposes. The only metal detected above the ambient background levels for South Carolina was barium. A surface-water sample collected from a tributary west and north of the Old Incinerator Area was analyzed for volatile organic compounds, semivolatile organic compounds, and inorganic compounds (metals). The only volatile organic and (or) semivolatile organic compound that was detected above the laboratory reporting level was toluene. The compounds 4-isopropyl-1-methylbenzene and isophorone were detected above the nondetection level but below the laboratory reporting level and were estimated. These compounds were detected at levels below the maximum contaminant levels set by the U.S. Environmental Protection Agency National Primary Drinking Water Standard. Iron was the only inorganic compound detected in the surface-water sample that exceeded the maximum contaminant level set by the U.S. Environmental Protection Agency National Secondary Drinking Water Standard. No other inorganic compounds exceeded the maximum contaminant levels for the U.S. Environmental Protection Agency National Primary Drinking Water Standard, National Secondary Drinking Water Standard, or the Georgia In-Stream Water Quality Standard.

  6. a Comparison of Empirical and Inteligent Methods for Dust Detection Using Modis Satellite Data

    NASA Astrophysics Data System (ADS)

    Shahrisvand, M.; Akhoondzadeh, M.

    2013-09-01

    Nowadays, dust storm in one of the most important natural hazards which is considered as a national concern in scientific communities. This paper considers the capabilities of some classical and intelligent methods for dust detection from satellite imagery around the Middle East region. In the study of dust detection, MODIS images have been a good candidate due to their suitable spectral and temporal resolution. In this study, physical-based and intelligent methods including decision tree, ANN (Artificial Neural Network) and SVM (Support Vector Machine) have been applied to detect dust storms. Among the mentioned approaches, in this paper, SVM method has been implemented for the first time in domain of dust detection studies. Finally, AOD (Aerosol Optical Depth) images, which are one the referenced standard products of OMI (Ozone Monitoring Instrument) sensor, have been used to assess the accuracy of all the implemented methods. Since the SVM method can distinguish dust storm over lands and oceans simultaneously, therefore the accuracy of SVM method is achieved better than the other applied approaches. As a conclusion, this paper shows that SVM can be a powerful tool for production of dust images with remarkable accuracy in comparison with AOT (Aerosol Optical Thickness) product of NASA.

  7. Review of Methods for the Detection and Determination of Malachite Green and Leuco-Malachite Green in Aquaculture.

    PubMed

    Zhou, Xinhui; Zhang, Jiaran; Pan, Zhongli; Li, Daoliang

    2018-05-14

    Malachite green (MG) has been widely used in the aquaculture industry as a fungicide and parasiticide because of its high efficiency and low cost, and it is commonly found in aquatic products and environmental water. However, MG and its primary metabolite, leuco-malachite green (LMG), are also toxic inorganic contaminants that are hazardous to the health of humans and other organisms. A variety of methods have been proposed in recent years for detecting and monitoring MG and LMG. This article was compiled as a general review of the methods proposed for MG and LMG detection, and several important detection parameters, such as the limit of detection, recovery and relative standard deviation, were tabulated. The analytical methods for the determination of MG and LMG in various matrices include high-performance liquid chromatography separation-based methods, liquid chromatography tandem mass spectrometry, surface-enhanced Raman spectroscopy, electrochemical methods, immunological assays, spectrophotometry and fluorescent methods which were described in detail in this article. In addition, some sample preparation techniques were also described. This review can provide expert guidance to the reader on the advantages, disadvantages and applicability of the different methodologies. This review also discussed challenges and several perspectives on the future trends in the determination of MG and LMG.

  8. PSO Algorithm Particle Filters for Improving the Performance of Lane Detection and Tracking Systems in Difficult Roads

    PubMed Central

    Cheng, Wen-Chang

    2012-01-01

    In this paper we propose a robust lane detection and tracking method by combining particle filters with the particle swarm optimization method. This method mainly uses the particle filters to detect and track the local optimum of the lane model in the input image and then seeks the global optimal solution of the lane model by a particle swarm optimization method. The particle filter can effectively complete lane detection and tracking in complicated or variable lane environments. However, the result obtained is usually a local optimal system status rather than the global optimal system status. Thus, the particle swarm optimization method is used to further refine the global optimal system status in all system statuses. Since the particle swarm optimization method is a global optimization algorithm based on iterative computing, it can find the global optimal lane model by simulating the food finding way of fish school or insects under the mutual cooperation of all particles. In verification testing, the test environments included highways and ordinary roads as well as straight and curved lanes, uphill and downhill lanes, lane changes, etc. Our proposed method can complete the lane detection and tracking more accurately and effectively then existing options. PMID:23235453

  9. Ship detection in optical remote sensing images based on deep convolutional neural networks

    NASA Astrophysics Data System (ADS)

    Yao, Yuan; Jiang, Zhiguo; Zhang, Haopeng; Zhao, Danpei; Cai, Bowen

    2017-10-01

    Automatic ship detection in optical remote sensing images has attracted wide attention for its broad applications. Major challenges for this task include the interference of cloud, wave, wake, and the high computational expenses. We propose a fast and robust ship detection algorithm to solve these issues. The framework for ship detection is designed based on deep convolutional neural networks (CNNs), which provide the accurate locations of ship targets in an efficient way. First, the deep CNN is designed to extract features. Then, a region proposal network (RPN) is applied to discriminate ship targets and regress the detection bounding boxes, in which the anchors are designed by intrinsic shape of ship targets. Experimental results on numerous panchromatic images demonstrate that, in comparison with other state-of-the-art ship detection methods, our method is more efficient and achieves higher detection accuracy and more precise bounding boxes in different complex backgrounds.

  10. A Nanocoaxial-Based Electrochemical Sensor for the Detection of Cholera Toxin

    NASA Astrophysics Data System (ADS)

    Archibald, Michelle M.; Rizal, Binod; Connolly, Timothy; Burns, Michael J.; Naughton, Michael J.; Chiles, Thomas C.

    2015-03-01

    Sensitive, real-time detection of biomarkers is of critical importance for rapid and accurate diagnosis of disease for point of care (POC) technologies. Current methods do not allow for POC applications due to several limitations, including sophisticated instrumentation, high reagent consumption, limited multiplexing capability, and cost. Here, we report a nanocoaxial-based electrochemical sensor for the detection of bacterial toxins using an electrochemical enzyme-linked immunosorbent assay (ELISA) and differential pulse voltammetry (DPV). Proof-of-concept was demonstrated for the detection of cholera toxin (CT). The linear dynamic range of detection was 10 ng/ml - 1 μg/ml, and the limit of detection (LOD) was found to be 2 ng/ml. This level of sensitivity is comparable to the standard optical ELISA used widely in clinical applications. In addition to matching the detection profile of the standard ELISA, the nanocoaxial array provides a simple electrochemical readout and a miniaturized platform with multiplexing capabilities for the simultaneous detection of multiple biomarkers, giving the nanocoax a desirable advantage over the standard method towards POC applications. Sensitive, real-time detection of biomarkers is of critical importance for rapid and accurate diagnosis of disease for point of care (POC) technologies. Current methods do not allow for POC applications due to several limitations, including sophisticated instrumentation, high reagent consumption, limited multiplexing capability, and cost. Here, we report a nanocoaxial-based electrochemical sensor for the detection of bacterial toxins using an electrochemical enzyme-linked immunosorbent assay (ELISA) and differential pulse voltammetry (DPV). Proof-of-concept was demonstrated for the detection of cholera toxin (CT). The linear dynamic range of detection was 10 ng/ml - 1 μg/ml, and the limit of detection (LOD) was found to be 2 ng/ml. This level of sensitivity is comparable to the standard optical ELISA used widely in clinical applications. In addition to matching the detection profile of the standard ELISA, the nanocoaxial array provides a simple electrochemical readout and a miniaturized platform with multiplexing capabilities for the simultaneous detection of multiple biomarkers, giving the nanocoax a desirable advantage over the standard method towards POC applications. This work was supported by the National Institutes of Health (National Cancer Institute award No. CA137681 and National Institute of Allergy and Infectious Diseases Award No. AI100216).

  11. Area X-ray or UV camera system for high-intensity beams

    DOEpatents

    Chapman, Henry N.; Bajt, Sasa; Spiller, Eberhard A.; Hau-Riege, Stefan , Marchesini, Stefano

    2010-03-02

    A system in one embodiment includes a source for directing a beam of radiation at a sample; a multilayer mirror having a face oriented at an angle of less than 90 degrees from an axis of the beam from the source, the mirror reflecting at least a portion of the radiation after the beam encounters a sample; and a pixellated detector for detecting radiation reflected by the mirror. A method in a further embodiment includes directing a beam of radiation at a sample; reflecting at least some of the radiation diffracted by the sample; not reflecting at least a majority of the radiation that is not diffracted by the sample; and detecting at least some of the reflected radiation. A method in yet another embodiment includes directing a beam of radiation at a sample; reflecting at least some of the radiation diffracted by the sample using a multilayer mirror; and detecting at least some of the reflected radiation.

  12. Evaluation of a rapid immunodiagnostic test kit for rabies virus.

    PubMed

    Kang, BoKyu; Oh, JinSik; Lee, ChulSeung; Park, Bong-Kyun; Park, YoungNam; Hong, KyungSoo; Lee, KyungGi; Cho, ByungKi; Song, DaeSub

    2007-10-01

    A rapid immunodiagnostic test kit for rabies virus detection was evaluated using 51 clinical samples and 4 isolates of rabies virus. The quick detection of rabies virus under field conditions may be helpful in determining if post-exposure prophylaxis is needed, thereby avoiding unnecessary treatments, as well as undue economic burden. There are several widely used diagnostic methods for rabies, including fluorescent antibody tests, reverse transcription polymerase chain reaction, and electron microscopy; however, these methods include time-consuming, intricate, and costly procedures. The rapid immunodiagnostic test was able to detect rabies virus in clinical samples, including brain tissue and saliva, in addition to 10(3.2) 50% lethal dose (LD(50))/mL cell-adapted rabies virus. The assay was not cross-reactive with non-rabies virus microbes. When the performance of the rapid immunodiagnostic test was compared to a fluorescent antibody test, the rapid immunodiagnostic test had a sensitivity of 91.7% and specificity of 100% (95.8% CI).

  13. Redox active polymer devices and methods of using and manufacturing the same

    DOEpatents

    Johnson, Paul; Bautista-Martinez, Jose Antonio; Friesen, Cody; Switzer, Elise

    2018-06-05

    The disclosed technology relates generally to apparatus comprising conductive polymers and more particularly to tag and tag devices comprising a redox-active polymer film, and method of using and manufacturing the same. In one aspect, an apparatus includes a substrate and a conductive structure formed on the substrate which includes a layer of redox-active polymer film having mobile ions and electrons. The conductive structure further includes a first terminal and a second terminal configured to receive an electrical signal therebetween, where the layer of redox-active polymer is configured to conduct an electrical current generated by the mobile ions and the electrons in response to the electrical signal. The apparatus additionally includes a detection circuit operatively coupled to the conductive structure and configured to detect the electrical current flowing through the conductive structure.

  14. Systems and Methods for Correcting Optical Reflectance Measurements

    NASA Technical Reports Server (NTRS)

    Yang, Ye (Inventor); Shear, Michael A. (Inventor); Soller, Babs R. (Inventor); Soyemi, Olusola O. (Inventor)

    2014-01-01

    We disclose measurement systems and methods for measuring analytes in target regions of samples that also include features overlying the target regions. The systems include: (a) a light source; (b) a detection system; (c) a set of at least first, second, and third light ports which transmit light from the light source to a sample and receive and direct light reflected from the sample to the detection system, generating a first set of data including information corresponding to both an internal target within the sample and features overlying the internal target, and a second set of data including information corresponding to features overlying the internal target; and (d) a processor configured to remove information characteristic of the overlying features from the first set of data using the first and second sets of data to produce corrected information representing the internal target.

  15. Systems and methods for correcting optical reflectance measurements

    NASA Technical Reports Server (NTRS)

    Yang, Ye (Inventor); Soller, Babs R. (Inventor); Soyemi, Olusola O. (Inventor); Shear, Michael A. (Inventor)

    2009-01-01

    We disclose measurement systems and methods for measuring analytes in target regions of samples that also include features overlying the target regions. The systems include: (a) a light source; (b) a detection system; (c) a set of at least first, second, and third light ports which transmit light from the light source to a sample and receive and direct light reflected from the sample to the detection system, generating a first set of data including information corresponding to both an internal target within the sample and features overlying the internal target, and a second set of data including information corresponding to features overlying the internal target; and (d) a processor configured to remove information characteristic of the overlying features from the first set of data using the first and second sets of data to produce corrected information representing the internal target.

  16. [Research progress on identification and quality evaluation of glues medicines].

    PubMed

    Li, Hui-Hu; Ren, Gang; Chen, Li-Min; Zhong, Guo-Yue

    2018-01-01

    Glues medicines is a special kind of traditional Chinese medicine.As the market demand is large, the raw materials are in short supply and lacks proper quality evaluation technology, which causes inconsistent quality of products on the market. Its authentic identification and evaluation stay a problem to be solved. In this paper, the research progress of the methods and techniques of the evaluation of the identification and quality of glues medicines were reviewed. The researches of medicinal glue type identification and quality evaluation mainly concentrated in four aspects of medicinal materials of physical and chemical properties, trace elements, organic chemicals and biological genetic methods and techniques. The methods of physicochemical properties include thermal analysis, gel electrophoresis, isoelectric focusing electrophoresis, infrared spectroscopy, gel exclusion chromatography, and circular dichroism. The methods including atomic absorption spectrometry, X-ray fluorescence spectrometry, plasma emission spectrometry and visible spectrophotometry were used for the study of the trace elements of glues medicines. The organic chemical composition was studied by methods of composition of amino acids, content detection, odor detection, lipid soluble component, organic acid detection. Methods based on the characteristics of biogenetics include DNA, polypeptide and amino acid sequence difference analysis. Overall, because of relative components similarity of the glues medicines (such as amino acids, proteins and peptides), its authenticity and quality evaluation index is difficult to judge objectively, all sorts of identification evaluation methods have different characteristics, but also their limitations. It indicates that further study should focus on identification of evaluation index and various technology integrated application combining with the characteristics of the production process. Copyright© by the Chinese Pharmaceutical Association.

  17. Radioactive anomaly discrimination from spectral ratios

    DOEpatents

    Maniscalco, James; Sjoden, Glenn; Chapman, Mac Clements

    2013-08-20

    A method for discriminating a radioactive anomaly from naturally occurring radioactive materials includes detecting a first number of gamma photons having energies in a first range of energy values within a predetermined period of time and detecting a second number of gamma photons having energies in a second range of energy values within the predetermined period of time. The method further includes determining, in a controller, a ratio of the first number of gamma photons having energies in the first range and the second number of gamma photons having energies in the second range, and determining that a radioactive anomaly is present when the ratio exceeds a threshold value.

  18. Finger wear detection for production line battery tester

    DOEpatents

    Depiante, Eduardo V.

    1997-01-01

    A method for detecting wear in a battery tester probe. The method includes providing a battery tester unit having at least one tester finger, generating a tester signal using the tester fingers and battery tester unit with the signal characteristic of the electrochemical condition of the battery and the tester finger, applying wavelet transformation to the tester signal including computing a mother wavelet to produce finger wear indicator signals, analyzing the signals to create a finger wear index, comparing the wear index for the tester finger with the index for a new tester finger and generating a tester finger signal change signal to indicate achieving a threshold wear change.

  19. Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

    PubMed Central

    Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

    2005-01-01

    A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

  20. Marine Targets Detection in Pol-SAR Data

    NASA Astrophysics Data System (ADS)

    Chen, Peng; Yang, Jingsong

    2016-08-01

    In this poster, we present a new method of marine target detection in Pol-SAR data. One band SAR image, like HH, VV or VH, can be used to find marine target using a Contant False Alarm Ratio (CFAR) algorithm. But some false detection may happen, as the sidelobe of antenna, Azimuth ambiguity, strong speckle noise and so on in the single band SAR image. Pol-SAR image can get more information of targets. After decomposition and false color composite, the sidelobe of antenna and Azimuth ambiguity could be deleted. So, the method presented include three steps, decomposion, false color composite and supervised classification. The result of Radarsat-2 SAR image test indicates a good accuracy. The detection results are compared with Automatic Indentify Sistem (AIS) data, the accuracy of right detection is above 95% and false detection ratio is below 5%.

  1. Mini-lidar sensor for the remote stand-off sensing of chemical/biological substances and method for sensing same

    DOEpatents

    Ray, Mark D.; Sedlacek, Arthur J.

    2003-08-19

    A method and apparatus for remote, stand-off, and high efficiency spectroscopic detection of biological and chemical substances. The apparatus including an optical beam transmitter which transmits a beam having an axis of transmission to a target, the beam comprising at least a laser emission. An optical detector having an optical detection path to the target is provided for gathering optical information. The optical detection path has an axis of optical detection. A beam alignment device fixes the transmitter proximal to the detector and directs the beam to the target along the optical detection path such that the axis of transmission is within the optical detection path. Optical information gathered by the optical detector is analyzed by an analyzer which is operatively connected to the detector.

  2. [Research on early fire detection with CO-CO2 FTIR-spectroscopy].

    PubMed

    Du, Jian-hua; Zhang, Ren-cheng; Huang, Xiang-ying; Gong, Xue; Zhang, Xiao-hua

    2007-05-01

    A new fire detection method is put forward based on the theory of FTIR spectroscopy through analyzing all kinds of detection methods, in which CO and CO2 are chosen as early fire detection objects, and an early fire experiment system has been set up. The concentration characters of CO and CO2 were obtained through early fire experiments including real alarm sources and nuisance alarm sources. In real alarm sources there are abundant CO and CO2 which change regularly. In nuisance alarm sources there is almost no CO. So it's feasible to reduce the false alarms and increase the sensitivity of early fire detectors through analyzing the concentration characters of CO and CO2.

  3. [Comparative research into sensitivity and specificity of immune-enzyme analysis with chemiluminescence and colorimetric detection for detecting antigens and antibodies to avian influenza viruses and newcastle disease].

    PubMed

    Vitkova, O N; Kapustina, T P; Mikhailova, V V; Safonov, G A; Vlasova, N N; Belousova, R V

    2015-01-01

    The goal of this work was to demonstrate the results of the development of the enzyme-linked immunosorbent tests with chemiluminescence detection and colorimetric detection of specific viral antigens and antibodies for identifying the avian influenza and the Newcastle disease viruses: high sensitivity and specificity of the immuno- chemiluminescence assay, which are 10-50 times higher than those of the ELISA colorimetric method. The high effectiveness of the results and the automation of the process of laboratory testing (using a luminometer) allow these methods to be recommended for including in primary screening tests for these infectious diseases.

  4. Potential Impact of Rapid Blood Culture Testing for Gram-Positive Bacteremia in Japan with the Verigene Gram-Positive Blood Culture Test

    PubMed Central

    Matsuda, Mari; Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Tega-Ishii, Michiru; Sansaka, Kaori; Negishi, Kenta; Shimada, Kimie; Umemura, Jun; Notake, Shigeyuki; Yanagisawa, Hideji; Yabusaki, Reiko; Araoka, Hideki; Yoneyama, Akiko

    2017-01-01

    Background. Early detection of Gram-positive bacteremia and timely appropriate antimicrobial therapy are required for decreasing patient mortality. The purpose of our study was to evaluate the performance of the Verigene Gram-positive blood culture assay (BC-GP) in two special healthcare settings and determine the potential impact of rapid blood culture testing for Gram-positive bacteremia within the Japanese healthcare delivery system. Furthermore, the study included simulated blood cultures, which included a library of well-characterized methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE) isolates reflecting different geographical regions in Japan. Methods. A total 347 BC-GP assays were performed on clinical and simulated blood cultures. BC-GP results were compared to results obtained by reference methods for genus/species identification and detection of resistance genes using molecular and MALDI-TOF MS methodologies. Results. For identification and detection of resistance genes at two clinical sites and simulated blood cultures, overall concordance of BC-GP with reference methods was 327/347 (94%). The time for identification and antimicrobial resistance detection by BC-GP was significantly shorter compared to routine testing especially at the cardiology hospital, which does not offer clinical microbiology services on weekends and holidays. Conclusion. BC-GP generated accurate identification and detection of resistance markers compared with routine laboratory methods for Gram-positive organisms in specialized clinical settings providing more rapid results than current routine testing. PMID:28316631

  5. Can Detectability Analysis Improve the Utility of Point Counts for Temperate Forest Raptors?

    EPA Science Inventory

    Temperate forest breeding raptors are poorly represented in typical point count surveys because these birds are cryptic and typically breed at low densities. In recent years, many new methods for estimating detectability during point counts have been developed, including distanc...

  6. Selective chromogenic detection of thiol-containing biomolecules using carbonaceous nanospheres loaded with silver nanoparticles as carrier.

    PubMed

    Hu, Bo; Zhao, Yang; Zhu, Hai-Zhou; Yu, Shu-Hong

    2011-04-26

    Thiol-containing biomolecules show strong affinity with noble metal nanostructures and could not only stably protect them but also control the self-assembly process of these special nanostructures. A highly selective and sensitive chromogenic detection method has been designed for the low and high molecular weight thiol-containing biomolecules, including cysteine, glutathione, dithiothreitol, and bovine serum albumin, using a new type of carbonaceous nanospheres loaded with silver nanoparticles (Ag NPs) as carrier. This strategy relies upon the place-exchange process between the reporter dyes on the surface of Ag NPs and the thiol groups of thiol-containing biomolecules. The concentration of biomolecules can be determined by monitoring with the fluorescence intensity of reporter dyes dispersed in solution. This new chromogenic assay method could selectively detect these biomolecules in the presence of various other amino acids and monosaccharides and even sensitively detect the thiol-containing biomolecules with different molecular weight, even including proteins.

  7. Do Circulating Tumor Cells, Exosomes, and Circulating Tumor Nucleic Acids Have Clinical Utility?

    PubMed Central

    Gold, Bert; Cankovic, Milena; Furtado, Larissa V.; Meier, Frederick; Gocke, Christopher D.

    2016-01-01

    Diagnosing and screening for tumors through noninvasive means represent an important paradigm shift in precision medicine. In contrast to tissue biopsy, detection of circulating tumor cells (CTCs) and circulating tumor nucleic acids provides a minimally invasive method for predictive and prognostic marker detection. This allows early and serial assessment of metastatic disease, including follow-up during remission, characterization of treatment effects, and clonal evolution. Isolation and characterization of CTCs and circulating tumor DNA (ctDNA) are likely to improve cancer diagnosis, treatment, and minimal residual disease monitoring. However, more trials are required to validate the clinical utility of precise molecular markers for a variety of tumor types. This review focuses on the clinical utility of CTCs and ctDNA testing in patients with solid tumors, including somatic and epigenetic alterations that can be detected. A comparison of methods used to isolate and detect CTCs and some of the intricacies of the characterization of the ctDNA are also provided. PMID:25908243

  8. Methods for measuring exchangeable protons in glycosaminoglycans.

    PubMed

    Beecher, Consuelo N; Larive, Cynthia K

    2015-01-01

    Recent NMR studies of the exchangeable protons of GAGs in aqueous solution, including those of the amide, sulfamate, and hydroxyl moieties, have demonstrated potential for the detection of intramolecular hydrogen bonds, providing insights into secondary structure preferences. GAG amide protons are observable by NMR over wide pH and temperature ranges; however, specific solution conditions are required to reduce the exchange rate of the sulfamate and hydroxyl protons and allow their detection by NMR. Building on the vast body of knowledge on detection of hydrogen bonds in peptides and proteins, a variety of methods can be used to identify hydrogen bonds in GAGs including temperature coefficient measurements, evaluation of chemical shift differences between oligo- and monosaccharides, and relative exchange rates measured through line shape analysis and EXSY spectra. Emerging strategies to allow direct detection of hydrogen bonds through heteronuclear couplings offer promise for the future. Molecular dynamic simulations are important in this effort both to predict and confirm hydrogen bond donors and acceptors.

  9. Use of Acoustic Emission and Pattern Recognition for Crack Detection of a Large Carbide Anvil

    PubMed Central

    Chen, Bin; Wang, Yanan; Yan, Zhaoli

    2018-01-01

    Large-volume cubic high-pressure apparatus is commonly used to produce synthetic diamond. Due to the high pressure, high temperature and alternative stresses in practical production, cracks often occur in the carbide anvil, thereby resulting in significant economic losses or even casualties. Conventional methods are unsuitable for crack detection of the carbide anvil. This paper is concerned with acoustic emission-based crack detection of carbide anvils, regarded as a pattern recognition problem; this is achieved using a microphone, with methods including sound pulse detection, feature extraction, feature optimization and classifier design. Through analyzing the characteristics of background noise, the cracked sound pulses are separated accurately from the originally continuous signal. Subsequently, three different kinds of features including a zero-crossing rate, sound pressure levels, and linear prediction cepstrum coefficients are presented for characterizing the cracked sound pulses. The original high-dimensional features are adaptively optimized using principal component analysis. A hybrid framework of a support vector machine with k nearest neighbors is designed to recognize the cracked sound pulses. Finally, experiments are conducted in a practical diamond workshop to validate the feasibility and efficiency of the proposed method. PMID:29382144

  10. Use of Acoustic Emission and Pattern Recognition for Crack Detection of a Large Carbide Anvil.

    PubMed

    Chen, Bin; Wang, Yanan; Yan, Zhaoli

    2018-01-29

    Large-volume cubic high-pressure apparatus is commonly used to produce synthetic diamond. Due to the high pressure, high temperature and alternative stresses in practical production, cracks often occur in the carbide anvil, thereby resulting in significant economic losses or even casualties. Conventional methods are unsuitable for crack detection of the carbide anvil. This paper is concerned with acoustic emission-based crack detection of carbide anvils, regarded as a pattern recognition problem; this is achieved using a microphone, with methods including sound pulse detection, feature extraction, feature optimization and classifier design. Through analyzing the characteristics of background noise, the cracked sound pulses are separated accurately from the originally continuous signal. Subsequently, three different kinds of features including a zero-crossing rate, sound pressure levels, and linear prediction cepstrum coefficients are presented for characterizing the cracked sound pulses. The original high-dimensional features are adaptively optimized using principal component analysis. A hybrid framework of a support vector machine with k nearest neighbors is designed to recognize the cracked sound pulses. Finally, experiments are conducted in a practical diamond workshop to validate the feasibility and efficiency of the proposed method.

  11. Method and apparatus for determining the physical properties of materials using dynamic light scattering techniques

    NASA Technical Reports Server (NTRS)

    Dhadwal, Harbans S. (Inventor)

    1992-01-01

    A system for determining the physical properties of materials through the use of dynamic light scattering is disclosed. The system includes a probe, a laser source for directing a laser beam into the probe, and a photodetector for converting scattered light detected by the probe into electrical signals. The probe includes at least one optical fiber connected to the laser source and a second optical fiber connected to the photodetector. Each of the fibers may adjoin a gradient index microlens which is capable of providing a collimated laser beam into a scattering medium. The position of the second optical fiber with respect to the optical axis of the probe determines whether homodyne or self-beating detection is provided. Self-beating detection may be provided without a gradient index microlens. This allows a very small probe to be constructed which is insertable through a hypodermic needle or the like into a droplet extending from such a needle. A method of detecting scattered light through the use of a collimated, Gaussian laser beam is also provided. A method for controlling the waist and divergence of the optical field emanating from the free end of an optical fiber is also provided.

  12. Infra-red detector and method of making and using same

    DOEpatents

    Craig, Richard A [Richland, WA; Griffin, Jeffrey W [Kennewick, WA

    2007-02-20

    A low-cost infra-red detector is disclosed including a method of making and using the same. The detector employs a substrate, a filtering layer, a converting layer, and a diverter to be responsive to wavelengths up to about 1600 nm. The detector is useful for a variety of applications including spectroscopy, imaging, and defect detection.

  13. Assessment of groundwater, soil-gas, and soil contamination at the Vietnam Armor Training Facility, Fort Gordon, Georgia, 2009-2010

    USGS Publications Warehouse

    Guimaraes, Wladmir B.; Falls, W. Fred; Caldwell, Andral W.; Ratliff, W. Hagan; Wellborn, John B.; Landmeyer, James E.

    2011-01-01

    The U.S. Geological Survey, in cooperation with the U.S. Department of the Army Environmental and Natural Resources Management Office of the U.S. Army Signal Center and Fort Gordon, Georgia, assessed the groundwater, soil gas, and soil for contaminants at the Vietnam Armor Training Facility (VATF) at Fort Gordon, from October 2009 to September 2010. The assessment included the detection of organic compounds in the groundwater and soil gas, and inorganic compounds in the soil. In addition, organic contaminant assessment included organic compounds classified as explosives and chemical agents in selected areas. The assessment was conducted to provide environmental contamination data to the U.S. Army at Fort Gordon pursuant to requirements of the Resource Conservation and Recovery Act Part B Hazardous Waste Permit process. Four passive samplers were deployed in groundwater wells at the VATF in Fort Gordon. Total petroleum hydrocarbons were detected above the method detection level at all four wells. The only other volatile organic compounds detected above their method detection level were undecane and pentadecane, which were detected in two of the four wells sampled. Soil-gas samplers were deployed at 72 locations in a grid pattern across the VATF. Total petroleum hydrocarbons were detected in 71 of the 72 samplers (one sampler was destroyed in the field and not analyzed) at levels above the method detection level, and the combined mass of benzene, toluene, ethylbenzene, and total xylene was detected above the detection level in 31 of the 71 samplers that were analyzed. Other volatile organic compounds detected above their respective method detection levels were naphthalene, 2-methyl-naphthalene, tridecane, 1,2,4-trimethylbenzene, and perchloroethene. Subsequent to the soil-gas survey, four areas determined to have elevated contaminant mass were selected and sampled for explosives and chemical agents. No detections of explosives or chemical agents above their respective method detection levels were found at any of the sampling locations. The same four locations that were sampled for explosives and chemical agents were selected for the collection of soil samples. A fifth location also was selected on the basis of the elevated contaminant mass of the soil-gas survey. No metals that exceeded the Regional Screening Levels for Industrial Soils as classified by the U.S. Environmental Protection Agency were detected at any of the five VATF locations. The soil samples also were compared to values from the ambient, uncontaminated (background) levels for soils in South Carolina, as classified by the South Carolina Department of Health and Environmental Control. Because South Carolina is adjacent to Georgia and the soils in the coastal plain are similar, these comparisons are valid. No similar values are available for Georgia to use for comparison purposes. The metals that were detected above the ambient background levels for South Carolina, as classified by the South Carolina Department of Health and Environmental Control, include aluminum, arsenic, barium, beryllium, calcium, chromium, copper, iron, lead, magnesium, manganese, nickel, potassium, sodium, and zinc.

  14. Hydrogeologic and chemical data for the O-Field area, Aberdeen Proving Ground, Maryland

    USGS Publications Warehouse

    Nemoff, P.R.; Vroblesky, D.A.

    1989-01-01

    O-Field, located at the Edgewood area of Aberdeen Proving Ground , Maryland, was periodically used for disposal of munitions, waste chemicals, and chemical-warfare agents from World War II through the 1950' s. This report includes various physical, geologic, chemical, and hydrologic data obtained from well-core, groundwater, surface water, and bottom-sediment sampling sites at and near the O-Field disposal area. The data are presented in tables and hydrographs. Three site-location maps are also included. Well-core data include lithologic logs for 11 well- cluster sites, grain-size distributions, various chemical characteristics, and confining unit characteristics. Groundwater data include groundwater chemistry, method blanks for volatile organic carbon, available data on volatile and base/neutral organics, and compilation of corresponding method blanks, chemical-warfare agents, explosive-related products, radionuclides, herbicides, and groundwater levels. Surface-water data include field-measured characteristics; concentrations of various inorganic constituents including arsenic; selected organic constituents with method blanks; detection limits of organics; and a compilation of information on corresponding acids, volatiles, and semivolatiles. Bottom- sediment data include inorganic properties and constituents; organic chemistry; detection limits for organic chemicals; a compilation of information on acids, volatiles, and semivolatiles; and method blanks corresponding to acids, volatiles, and semivolatiles. A set of 15 water- level hydrographs for the period March 1986 through September 1987 also is included in the report. (USGS)

  15. Evaluation of growth based rapid microbiological methods for sterility testing of vaccines and other biological products.

    PubMed

    Parveen, Seema; Kaur, Simleen; David, Selwyn A Wilson; Kenney, James L; McCormick, William M; Gupta, Rajesh K

    2011-10-19

    Most biological products, including vaccines, administered by the parenteral route are required to be tested for sterility at the final container and also at various stages during manufacture. The sterility testing method described in the Code of Federal Regulations (21 CFR 610.12) and the United States Pharmacopoeia (USP, Chapter <71>) is based on the observation of turbidity in liquid culture media due to growth of potential contaminants. We evaluated rapid microbiological methods (RMM) based on detection of growth 1) by adenosine triphosphate (ATP) bioluminescence technology (Rapid Milliflex(®) Detection System [RMDS]), and 2) by CO(2) monitoring technologies (BacT/Alert and the BACTEC systems), as alternate sterility methods. Microorganisms representing Gram negative, Gram positive, aerobic, anaerobic, spore forming, slow growing bacteria, yeast, and fungi were prepared in aliquots of Fluid A or a biological matrix (including inactivated influenza vaccines) to contain approximately 0.1, 1, 10 and 100 colony forming units (CFU) in an inoculum of 10 ml. These preparations were inoculated to the specific media required for the various methods: 1) fluid thioglycollate medium (FTM) and tryptic soy broth (TSB) of the compendial sterility method (both membrane filtration and direct inoculation); 2) tryptic soy agar (TSA), Sabouraud dextrose agar (SDA) and Schaedler blood agar (SBA) of the RMDS; 3) iAST and iNST media of the BacT/Alert system and 4) Standard 10 Aerobic/F and Standard Anaerobic/F media of the BACTEC system. RMDS was significantly more sensitive in detecting various microorganisms at 0.1CFU than the compendial methods (p<0.05), whereas the compendial membrane filtration method was significantly more sensitive than the BACTEC and BacT/Alert methods (p<0.05). RMDS detected all microorganisms significantly faster than the compendial method (p<0.05). BacT/Alert and BACTEC methods detected most microorganisms significantly faster than the compendial method (p<0.05), but took almost the same time to detect the slow growing microorganism P. acnes, compared to the compendial method. RMDS using SBA detected all test microorganisms in the presence of a matrix containing preservative 0.01% thimerosal, whereas the BacT/Alert and BACTEC systems did not consistently detect all the test microorganisms in the presence of 0.01% thimerosal. RMDS was compatible with inactivated influenza vaccines and aluminum phosphate or aluminum hydroxide adjuvants at up to 8 mg/ml without any interference in bioluminescence. RMDS was shown to be acceptable as an alternate sterility method taking 5 days as compared to the 14 days required of the compendial method. Isolation of microorganisms from the RMDS was accomplished by re-incubation of membranes with fresh SBA medium and microbial identification was confirmed using the MicroSEQ Identification System. BacT/Alert and BACTEC systems may be applicable as alternate methods to the compendial direct inoculation sterility method for products that do not contain preservatives or anti-microbial agents. Published by Elsevier Ltd.

  16. Evaluating and implementing temporal, spatial, and spatio-temporal methods for outbreak detection in a local syndromic surveillance system

    PubMed Central

    Lall, Ramona; Levin-Rector, Alison; Sell, Jessica; Paladini, Marc; Konty, Kevin J.; Olson, Don; Weiss, Don

    2017-01-01

    The New York City Department of Health and Mental Hygiene has operated an emergency department syndromic surveillance system since 2001, using temporal and spatial scan statistics run on a daily basis for cluster detection. Since the system was originally implemented, a number of new methods have been proposed for use in cluster detection. We evaluated six temporal and four spatial/spatio-temporal detection methods using syndromic surveillance data spiked with simulated injections. The algorithms were compared on several metrics, including sensitivity, specificity, positive predictive value, coherence, and timeliness. We also evaluated each method’s implementation, programming time, run time, and the ease of use. Among the temporal methods, at a set specificity of 95%, a Holt-Winters exponential smoother performed the best, detecting 19% of the simulated injects across all shapes and sizes, followed by an autoregressive moving average model (16%), a generalized linear model (15%), a modified version of the Early Aberration Reporting System’s C2 algorithm (13%), a temporal scan statistic (11%), and a cumulative sum control chart (<2%). Of the spatial/spatio-temporal methods we tested, a spatial scan statistic detected 3% of all injects, a Bayes regression found 2%, and a generalized linear mixed model and a space-time permutation scan statistic detected none at a specificity of 95%. Positive predictive value was low (<7%) for all methods. Overall, the detection methods we tested did not perform well in identifying the temporal and spatial clusters of cases in the inject dataset. The spatial scan statistic, our current method for spatial cluster detection, performed slightly better than the other tested methods across different inject magnitudes and types. Furthermore, we found the scan statistics, as applied in the SaTScan software package, to be the easiest to program and implement for daily data analysis. PMID:28886112

  17. Rapid fusion method for the determination of Pu, Np, and Am in large soil samples

    DOE PAGES

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; ...

    2015-02-14

    A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measuredmore » using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.« less

  18. Inverse Abbe-method for observing small refractive index changes in liquids.

    PubMed

    Räty, Jukka; Peiponen, Kai-Erik

    2015-05-01

    This study concerns an optical method for the detection of minuscule refractive index changes in the liquid phase. The proposed method reverses the operation of the traditional Abbe refractometer and thus utilizes the light dispersion properties of materials, i.e. it involves the dependence of the refractive index on light wavelength. In practice, the method includes the detection of light reflection spectra in the visible spectral range. This inverse Abbe method is suitable for liquid quality studies e.g. for monitoring water purity. Tests have shown that the method reveals less than per mil NaCl or ethanol concentrations in water. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  20. Controllable assembly and disassembly of nanoparticle systems via protein and DNA agents

    DOEpatents

    Lee, Soo-Kwan; Gang, Oleg; van der Lelie, Daniel

    2014-05-20

    The invention relates to the use of peptides, proteins, and other oligomers to provide a means by which normally quenched nanoparticle fluorescence may be recovered upon detection of a target molecule. Further, the inventive technology provides a structure and method to carry out detection of target molecules without the need to label the target molecules before detection. In another aspect, a method for forming arbitrarily shaped two- and three-dimensional protein-mediated nanoparticle structures and the resulting structures are described. Proteins mediating structure formation may themselves be functionalized with a variety of useful moieties, including catalytic functional groups.

  1. Flow injection trace gas analysis method for on-site determination of organoarsenicals

    DOEpatents

    Aldstadt, J.H. III

    1997-06-24

    A method is described for real-time determination of the concentration of Lewisite in the ambient atmosphere, the method includes separating and collecting a Lewisite sample from the atmosphere in a collection chamber, converting the collected Lewisite to an arsenite ion solution sample, pumping the arsenite ion containing sample to an electrochemical detector connected to the collection chamber, and electrochemically detecting the converted arsenite ions in the sample, whereby the concentration of arsenite ions detected is proportional to the concentration of Lewisite in the atmosphere. 2 figs.

  2. Oxazine-based sensor for contaminant detection, fabrication method therefor, and uses thereof

    DOEpatents

    Nnanna, Agbai Agwu; Jalal, Ahmed Hasnian

    2014-05-27

    A sensor, a method for its fabrication, and a method for its use to detect contaminants, for example, ammonia, in stagnant and dynamic fluid media, especially liquid media. The sensor is an opto-chemical sensor that includes a polymer optical fiber, a sensing layer comprising oxazine 170 perchlorate on the polymer optical fiber, and a membrane layer on the sensing layer. The membrane layer is gas permeable and not permeable to the fluid in the fluid system, and moisture is entrapped by and between the sensing and membrane layers.

  3. A multi-scale tensor voting approach for small retinal vessel segmentation in high resolution fundus images.

    PubMed

    Christodoulidis, Argyrios; Hurtut, Thomas; Tahar, Houssem Ben; Cheriet, Farida

    2016-09-01

    Segmenting the retinal vessels from fundus images is a prerequisite for many CAD systems for the automatic detection of diabetic retinopathy lesions. So far, research efforts have concentrated mainly on the accurate localization of the large to medium diameter vessels. However, failure to detect the smallest vessels at the segmentation step can lead to false positive lesion detection counts in a subsequent lesion analysis stage. In this study, a new hybrid method for the segmentation of the smallest vessels is proposed. Line detection and perceptual organization techniques are combined in a multi-scale scheme. Small vessels are reconstructed from the perceptual-based approach via tracking and pixel painting. The segmentation was validated in a high resolution fundus image database including healthy and diabetic subjects using pixel-based as well as perceptual-based measures. The proposed method achieves 85.06% sensitivity rate, while the original multi-scale line detection method achieves 81.06% sensitivity rate for the corresponding images (p<0.05). The improvement in the sensitivity rate for the database is 6.47% when only the smallest vessels are considered (p<0.05). For the perceptual-based measure, the proposed method improves the detection of the vasculature by 7.8% against the original multi-scale line detection method (p<0.05). Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. An Efficient Silent Data Corruption Detection Method with Error-Feedback Control and Even Sampling for HPC Applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Di, Sheng; Berrocal, Eduardo; Cappello, Franck

    The silent data corruption (SDC) problem is attracting more and more attentions because it is expected to have a great impact on exascale HPC applications. SDC faults are hazardous in that they pass unnoticed by hardware and can lead to wrong computation results. In this work, we formulate SDC detection as a runtime one-step-ahead prediction method, leveraging multiple linear prediction methods in order to improve the detection results. The contributions are twofold: (1) we propose an error feedback control model that can reduce the prediction errors for different linear prediction methods, and (2) we propose a spatial-data-based even-sampling method tomore » minimize the detection overheads (including memory and computation cost). We implement our algorithms in the fault tolerance interface, a fault tolerance library with multiple checkpoint levels, such that users can conveniently protect their HPC applications against both SDC errors and fail-stop errors. We evaluate our approach by using large-scale traces from well-known, large-scale HPC applications, as well as by running those HPC applications on a real cluster environment. Experiments show that our error feedback control model can improve detection sensitivity by 34-189% for bit-flip memory errors injected with the bit positions in the range [20,30], without any degradation on detection accuracy. Furthermore, memory size can be reduced by 33% with our spatial-data even-sampling method, with only a slight and graceful degradation in the detection sensitivity.« less

  5. Non-destructive techniques for the detection of fungal infection in cereal grains.

    PubMed

    Orina, Irene; Manley, Marena; Williams, Paul J

    2017-10-01

    Infection of cereal grains by fungi is a serious problem worldwide. Depending on the environmental conditions, cereal grains may be colonised by different species of fungi. These fungi cause reduction in yield, quality and nutritional value of the grain; and of major concern is their production of mycotoxins which are harmful to both humans and animals. Early detection of fungal contamination is an essential control measure for ensuring storage longevity and food safety. Conventional methods for detection of fungal infection, such as culture and colony techniques or immunological methods are either slow, labour intensive or difficult to automate. In recent years, there has been an increasing need to develop simple, rapid, non-destructive methods for early detection of fungal infection and mycotoxins contamination in cereal grains. Methods such as near infrared (NIR) spectroscopy, NIR hyperspectral imaging, and electronic nose were evaluated for these purposes. This paper reviews the different non-destructive techniques that have been considered thus far for detection of fungal infection and mycotoxins in cereal grains, including their principles, application and limitations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Human rhinovirus C infections in pediatric hematology and oncology patients.

    PubMed

    Loria, Carolina; Domm, Jennifer A; Halasa, Natasha B; Heitman, Elizabeth; Miller, E Kathryn; Xu, Meng; Saville, Benjamin R; Frangoul, Haydar; Williams, John V

    2015-02-01

    Children with cancer and HSCT recipients are at high risk for common viral infections. We sought to define the viral etiology of ARI and identify risk factors. Nasal wash samples were collected from pediatric hematology-oncology patients and HSCT recipients with ARI during the 2003-2005 winter seasons. Real-time RT-PCR was performed to detect Flu A, influenza B, RSV, PIV 1-3, human MPV, and HRV. HRV specimens were sequenced and genotyped. Seventy-eight samples from 62 children were included. Viruses were detected in 31 of 78 samples (40%). HRV were detected most frequently, in 16 (52%) including five HRVC; followed by seven (22%) RSV, five (16%) Flu A, four (13%) MPV, and two (6%) PIV2. There was a trend toward higher risk of viral infection for children in day care. Only 8% of the study children had received influenza vaccine. HRV, including the recently discovered HRVC, are an important cause of infection in pediatric oncology and HSCT patients. Molecular testing is superior to conventional methods and should be standard of care, as HRV are not detected by conventional methods. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Three-dimensional, position-sensitive radiation detection

    DOEpatents

    He, Zhong; Zhang, Feng

    2010-04-06

    Disclosed herein is a method of determining a characteristic of radiation detected by a radiation detector via a multiple-pixel event having a plurality of radiation interactions. The method includes determining a cathode-to-anode signal ratio for a selected interaction of the plurality of radiation interactions based on electron drift time data for the selected interaction, and determining the radiation characteristic for the multiple-pixel event based on both the cathode-to-anode signal ratio and the electron drift time data. In some embodiments, the method further includes determining a correction factor for the radiation characteristic based on an interaction depth of the plurality of radiation interactions, a lateral distance between the selected interaction and a further interaction of the plurality of radiation interactions, and the lateral positioning of the plurality of radiation interactions.

  8. Methods and apparatus for rotor blade ice detection

    DOEpatents

    LeMieux, David Lawrence

    2006-08-08

    A method for detecting ice on a wind turbine having a rotor and one or more rotor blades each having blade roots includes monitoring meteorological conditions relating to icing conditions and monitoring one or more physical characteristics of the wind turbine in operation that vary in accordance with at least one of the mass of the one or more rotor blades or a mass imbalance between the rotor blades. The method also includes using the one or more monitored physical characteristics to determine whether a blade mass anomaly exists, determining whether the monitored meteorological conditions are consistent with blade icing; and signaling an icing-related blade mass anomaly when a blade mass anomaly is determined to exist and the monitored meteorological conditions are determined to be consistent with icing.

  9. The Development of DNA Based Methods for the Reliable and Efficient Identification of Nicotiana tabacum in Tobacco and Its Derived Products

    PubMed Central

    Fan, Wei; Li, Rong; Li, Sifan; Ping, Wenli; Li, Shujun; Naumova, Alexandra; Peelen, Tamara; Yuan, Zheng; Zhang, Dabing

    2016-01-01

    Reliable methods are needed to detect the presence of tobacco components in tobacco products to effectively control smuggling and classify tariff and excise in tobacco industry to control illegal tobacco trade. In this study, two sensitive and specific DNA based methods, one quantitative real-time PCR (qPCR) assay and the other loop-mediated isothermal amplification (LAMP) assay, were developed for the reliable and efficient detection of the presence of tobacco (Nicotiana tabacum) in various tobacco samples and commodities. Both assays targeted the same sequence of the uridine 5′-monophosphate synthase (UMPS), and their specificities and sensitivities were determined with various plant materials. Both qPCR and LAMP methods were reliable and accurate in the rapid detection of tobacco components in various practical samples, including customs samples, reconstituted tobacco samples, and locally purchased cigarettes, showing high potential for their application in tobacco identification, particularly in the special cases where the morphology or chemical compositions of tobacco have been disrupted. Therefore, combining both methods would facilitate not only the detection of tobacco smuggling control, but also the detection of tariff classification and of excise. PMID:27635142

  10. Multispecies Adulteration Detection of Camellia Oil by Chemical Markers.

    PubMed

    Dou, Xinjing; Mao, Jin; Zhang, Liangxiao; Xie, Huali; Chen, Lin; Yu, Li; Ma, Fei; Wang, Xiupin; Zhang, Qi; Li, Peiwu

    2018-01-25

    Adulteration of edible oils has attracted attention from more researchers and consumers in recent years. Complex multispecies adulteration is a commonly used strategy to mask the traditional adulteration detection methods. Most of the researchers were only concerned about single targeted adulterants, however, it was difficult to identify complex multispecies adulteration or untargeted adulterants. To detect adulteration of edible oil, identification of characteristic markers of adulterants was proposed to be an effective method, which could provide a solution for multispecies adulteration detection. In this study, a simple method of multispecies adulteration detection for camellia oil (adulterated with soybean oil, peanut oil, rapeseed oil) was developed by quantifying chemical markers including four isoflavones, trans-resveratrol and sinapic acid, which used liquid chromatography tandem mass spectrometry (LC-MS/MS) combined with solid phase extraction (SPE). In commercial camellia oil, only two of them were detected of daidzin with the average content of 0.06 ng/g while other markers were absent. The developed method was highly sensitive as the limits of detection (LODs) ranged from 0.02 ng/mL to 0.16 ng/mL and the mean recoveries ranged from 79.7% to 113.5%, indicating that this method was reliable to detect potential characteristic markers in edible oils. Six target compounds for pure camellia oils, soybean oils, peanut oils and rapeseed oils had been analyzed to get the results. The validation results indicated that this simple and rapid method was successfully employed to determine multispecies adulteration of camellia oil adulterated with soybean, peanut and rapeseed oils.

  11. Diagnostics of Tree Diseases Caused by Phytophthora austrocedri Species.

    PubMed

    Mulholland, Vincent; Elliot, Matthew; Green, Sarah

    2015-01-01

    We present methods for the detection and quantification of four Phytophthora species which are pathogenic on trees; Phytophthora ramorum, Phytophthora kernoviae, Phytophthora lateralis, and Phytophthora austrocedri. Nucleic acid extraction methods are presented for phloem tissue from trees, soil, and pure cultures on agar plates. Real-time PCR methods are presented and include primer and probe sets for each species, general advice on real-time PCR setup and data analysis. A method for sequence-based identification, useful for pure cultures, is also included.

  12. Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

    PubMed Central

    Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

    2008-01-01

    Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

  13. Evaluation of a new ultrasensitive assay for cardiac troponin I.

    PubMed

    Casals, Gregori; Filella, Xavier; Bedini, Josep Lluis

    2007-12-01

    We evaluated the analytical and clinical performance of a new ultrasensitive cardiac troponin I assay (cTnI) on the ADVIA Centaur system (TnI-Ultra). The evaluation included the determination of detection limit, within-assay and between-assay variation and comparison with two other non-ultrasensitive methods. Moreover, cTnI was determined in 120 patients with acute chest pain with three methods. To evaluate the ability of the new method to detect MI earlier, it was assayed in 8 MI patients who first tested negative then positive by the other methods. The detection limit was 0.009 microg/L and imprecision was <10% at all concentrations evaluated. In comparison with two other methods, 10% of the anginas diagnosed were recategorized to MI. The ADVIA Centaur TnI-Ultra assay presented high reproducibility and high sensitivity. The use of the recommended lower cutpoint (0.044 microg/L) implied an increased and earlier identification of MI.

  14. [A review of mixed gas detection system based on infrared spectroscopic technique].

    PubMed

    Dang, Jing-Min; Fu, Li; Yan, Zi-Hui; Zheng, Chuan-Tao; Chang, Yu-Chun; Chen, Chen; Wang, Yi-Din

    2014-10-01

    In order to provide the experiences and references to the researchers who are working on infrared (IR) mixed gas detection field. The proposed manuscript reviews two sections of the aforementioned field, including optical multiplexing structure and detection method. At present, the coherent light sources whose representative are quantum cascade laser (QCL) and inter-band cascade laser(ICL) become the mainstream light source in IR mixed gas detection, which replace the traditional non-coherent light source, such as IR radiation source and IR light emitting diode. In addition, the photon detector which has a super high detectivity and very short response time is gradually beyond thermal infrared detector, dominant in the field of infrared detector. The optical multiplexing structure is the key factor of IR mixed gas detection system, which consists of single light source multi-plexing detection structure and multi light source multiplexing detection structure. Particularly, single light source multiplexing detection structure is advantages of small volume and high integration, which make it a plausible candidate for the portable mixed gas detection system; Meanwhile, multi light source multiplexing detection structure is embodiment of time division multiplex, frequency division multiplexing and wavelength division multiplexing, and become the leading structure of the mixed gas detection system because of its wider spectral range, higher spectral resolution, etc. The detection method applied to IR mixed gas detection includes non-dispersive infrared (NDIR) spectroscopy, wavelength and frequency-modulation spectroscopy, cavity-enhanced spectroscopy and photoacoustic spectroscopy, etc. The IR mixed gas detection system designed by researchers after recognizing the whole sections of the proposed system, which play a significant role in industrial and agricultural production, environmental monitoring, and life science, etc.

  15. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    USDA-ARS?s Scientific Manuscript database

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  16. ESTABLISH AND STANDARDIZE METHODOLOGY FOR DETECTION OF WATERBORNE VIRUSES FROM HUMAN SOURCES

    EPA Science Inventory

    Research is conducted to develop and standardize methods to detect and measure occurrence of human enteric viruses that cause waterborne disease. The viruses of concern include the emerging pathogens--hepatitis E virus and group B rotaviruses. Also of concern are the coxsackiev...

  17. Study of Cyclodextrin-Based Polymers to Extract Patulin from Apple Juice

    USDA-ARS?s Scientific Manuscript database

    Synthetic sorbents offer a means to develop more robust materials to detect analytes in complex matrices, including methods to detect naturally occurring contaminants in agricultural commodities. Patulin is a mold metabolite associated with rotting apples and poses health risks to humans and animal...

  18. Search for extraterrestrial intelligence (SETI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morrison, P.; Billingham, J.; Wolfe, J.

    1977-01-01

    Findings are presented of a series of workshops on the existence of extraterrestrial intelligent life and ways in which extraterrestrial intelligence might be detected. The coverage includes the cosmic and cultural evolutions, search strategies, detection of other planetary systems, alternate methods of communication, and radio frequency interference. 17 references. (JFP)

  19. Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

    PubMed

    Long, Ju

    2016-05-01

    In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. A stereo-vision hazard-detection algorithm to increase planetary lander autonomy

    NASA Astrophysics Data System (ADS)

    Woicke, Svenja; Mooij, Erwin

    2016-05-01

    For future landings on any celestial body, increasing the lander autonomy as well as decreasing risk are primary objectives. Both risk reduction and an increase in autonomy can be achieved by including hazard detection and avoidance in the guidance, navigation, and control loop. One of the main challenges in hazard detection and avoidance is the reconstruction of accurate elevation models, as well as slope and roughness maps. Multiple methods for acquiring the inputs for hazard maps are available. The main distinction can be made between active and passive methods. Passive methods (cameras) have budgetary advantages compared to active sensors (radar, light detection and ranging). However, it is necessary to proof that these methods deliver sufficiently good maps. Therefore, this paper discusses hazard detection using stereo vision. To facilitate a successful landing not more than 1% wrong detections (hazards that are not identified) are allowed. Based on a sensitivity analysis it was found that using a stereo set-up at a baseline of ≤ 2 m is feasible at altitudes of ≤ 200 m defining false positives of less than 1%. It was thus shown that stereo-based hazard detection is an effective means to decrease the landing risk and increase the lander autonomy. In conclusion, the proposed algorithm is a promising candidate for future landers.

  1. Sensitivity and accuracy of high-throughput metabarcoding methods for early detection of invasive fish species

    NASA Astrophysics Data System (ADS)

    Hatzenbuhler, Chelsea; Kelly, John R.; Martinson, John; Okum, Sara; Pilgrim, Erik

    2017-04-01

    High-throughput DNA metabarcoding has gained recognition as a potentially powerful tool for biomonitoring, including early detection of aquatic invasive species (AIS). DNA based techniques are advancing, but our understanding of the limits to detection for metabarcoding complex samples is inadequate. For detecting AIS at an early stage of invasion when the species is rare, accuracy at low detection limits is key. To evaluate the utility of metabarcoding in future fish community monitoring programs, we conducted several experiments to determine the sensitivity and accuracy of routine metabarcoding methods. Experimental mixes used larval fish tissue from multiple “common” species spiked with varying proportions of tissue from an additional “rare” species. Pyrosequencing of genetic marker, COI (cytochrome c oxidase subunit I) and subsequent sequence data analysis provided experimental evidence of low-level detection of the target “rare” species at biomass percentages as low as 0.02% of total sample biomass. Limits to detection varied interspecifically and were susceptible to amplification bias. Moreover, results showed some data processing methods can skew sequence-based biodiversity measurements from corresponding relative biomass abundances and increase false absences. We suggest caution in interpreting presence/absence and relative abundance in larval fish assemblages until metabarcoding methods are optimized for accuracy and precision.

  2. Detection of measles, mumps, and rubella viruses.

    PubMed

    Tipples, Graham; Hiebert, Joanne

    2011-01-01

    Measles, mumps, and rubella are infections caused by RNA viruses of the same name and are vaccine preventable. The vaccines are frequently administered in a trivalent form. Laboratory diagnostic methods can include indirect detection via antibody (IgM and IgG) detection methods and direct detection by viral culture or viral genome detection. There are challenges for the laboratory in areas with low prevalence due to high vaccine uptake. In those areas, routine serological methods such as IgM detection may have a reduced positive predictive value and thus require confirmation by other methods. Direct detection of viral genomic material using reverse transcription polymerase chain reaction (RT-PCR) methodologies can play an important role for laboratory confirmation of acute infections. Furthermore, genotyping of these three viruses provides useful molecular epidemiological data for differentiating vaccine from wild-type strains, linking cases and outbreaks, and tracking geographic spread and elimination. The purpose of this chapter is to provide guidance for the laboratory diagnosis of measles, mumps, and rubella virus infections. Where assays are commercially available or previously published, the appropriate references are provided as well as brief comments on the interpretation of results. Detailed protocols are provided for the molecular assays which have been developed and more commonly applied in recent years.

  3. Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

    PubMed

    Tattiyapong, P; Sirikanchana, K; Surachetpong, W

    2018-02-01

    Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

  4. Hydrogeology and human health

    USDA-ARS?s Scientific Manuscript database

    Over the past 50 years, significant progress has been made in improving our understanding of the extent and potential consequences of groundwater contamination, with research advancing on several fronts including groundwater sampling methods, laboratory detection methods, subsurface transport (and m...

  5. Microfluidic microarray systems and methods thereof

    DOEpatents

    West, Jay A. A. [Castro Valley, CA; Hukari, Kyle W [San Ramon, CA; Hux, Gary A [Tracy, CA

    2009-04-28

    Disclosed are systems that include a manifold in fluid communication with a microfluidic chip having a microarray, an illuminator, and a detector in optical communication with the microarray. Methods for using these systems for biological detection are also disclosed.

  6. Real-time x-ray fluoroscopy-based catheter detection and tracking for cardiac electrophysiology interventions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma Yingliang; Housden, R. James; Razavi, Reza

    2013-07-15

    Purpose: X-ray fluoroscopically guided cardiac electrophysiology (EP) procedures are commonly carried out to treat patients with arrhythmias. X-ray images have poor soft tissue contrast and, for this reason, overlay of a three-dimensional (3D) roadmap derived from preprocedural volumetric images can be used to add anatomical information. It is useful to know the position of the catheter electrodes relative to the cardiac anatomy, for example, to record ablation therapy locations during atrial fibrillation therapy. Also, the electrode positions of the coronary sinus (CS) catheter or lasso catheter can be used for road map motion correction.Methods: In this paper, the authors presentmore » a novel unified computational framework for image-based catheter detection and tracking without any user interaction. The proposed framework includes fast blob detection, shape-constrained searching and model-based detection. In addition, catheter tracking methods were designed based on the customized catheter models input from the detection method. Three real-time detection and tracking methods are derived from the computational framework to detect or track the three most common types of catheters in EP procedures: the ablation catheter, the CS catheter, and the lasso catheter. Since the proposed methods use the same blob detection method to extract key information from x-ray images, the ablation, CS, and lasso catheters can be detected and tracked simultaneously in real-time.Results: The catheter detection methods were tested on 105 different clinical fluoroscopy sequences taken from 31 clinical procedures. Two-dimensional (2D) detection errors of 0.50 {+-} 0.29, 0.92 {+-} 0.61, and 0.63 {+-} 0.45 mm as well as success rates of 99.4%, 97.2%, and 88.9% were achieved for the CS catheter, ablation catheter, and lasso catheter, respectively. With the tracking method, accuracies were increased to 0.45 {+-} 0.28, 0.64 {+-} 0.37, and 0.53 {+-} 0.38 mm and success rates increased to 100%, 99.2%, and 96.5% for the CS, ablation, and lasso catheters, respectively. Subjective clinical evaluation by three experienced electrophysiologists showed that the detection and tracking results were clinically acceptable.Conclusions: The proposed detection and tracking methods are automatic and can detect and track CS, ablation, and lasso catheters simultaneously and in real-time. The accuracy of the proposed methods is sub-mm and the methods are robust toward low-dose x-ray fluoroscopic images, which are mainly used during EP procedures to maintain low radiation dose.« less

  7. Use of the ecf1 gene to detect Shiga toxin-producing Escherichia coli in beef samples.

    PubMed

    Livezey, Kristin W; Groschel, Bettina; Becker, Michael M

    2015-04-01

    Escherichia coli O157:H7 and six serovars (O26, O103, O121, O111, O145, and O45) are frequently implicated in severe clinical illness worldwide. Standard testing methods using stx, eae, and O serogroup-specific gene sequences for detecting the top six non-O157 STEC bear the disadvantage that these genes may reside, independently, in different nonpathogenic organisms, leading to false-positive results. The ecf operon has previously been identified in the large enterohemolysin-encoding plasmid of eae-positive Shiga toxin-producing E. coli (STEC). Here, we explored the utility of the ecf operon as a single marker to detect eae-positive STEC from pure broth and primary meat enrichments. Analysis of 501 E. coli isolates demonstrated a strong correlation (99.6%) between the presence of the ecf1 gene and the combined presence of stx, eae, and ehxA genes. Two large studies were carried out to determine the utility of an ecf1 detection assay to detect non-O157 STEC strains in enriched meat samples in comparison to the results using the U. S. Department of Agriculture Food Safety and Inspection Service (FSIS) method that detects stx and eae genes. In ground beef samples (n = 1,065), the top six non-O157 STEC were detected in 4.0% of samples by an ecf1 detection assay and in 5.0% of samples by the stx- and eae-based method. In contrast, in beef samples composed largely of trim (n = 1,097), the top six non-O157 STEC were detected at 1.1% by both methods. Estimation of false-positive rates among the top six non-O157 STEC revealed a lower rate using the ecf1 detection method (0.5%) than using the eae and stx screening method (1.1%). Additionally, the ecf1 detection assay detected STEC strains associated with severe illness that are not included in the FSIS regulatory definition of adulterant STEC.

  8. On the robustness of EC-PC spike detection method for online neural recording.

    PubMed

    Zhou, Yin; Wu, Tong; Rastegarnia, Amir; Guan, Cuntai; Keefer, Edward; Yang, Zhi

    2014-09-30

    Online spike detection is an important step to compress neural data and perform real-time neural information decoding. An unsupervised, automatic, yet robust signal processing is strongly desired, thus it can support a wide range of applications. We have developed a novel spike detection algorithm called "exponential component-polynomial component" (EC-PC) spike detection. We firstly evaluate the robustness of the EC-PC spike detector under different firing rates and SNRs. Secondly, we show that the detection Precision can be quantitatively derived without requiring additional user input parameters. We have realized the algorithm (including training) into a 0.13 μm CMOS chip, where an unsupervised, nonparametric operation has been demonstrated. Both simulated data and real data are used to evaluate the method under different firing rates (FRs), SNRs. The results show that the EC-PC spike detector is the most robust in comparison with some popular detectors. Moreover, the EC-PC detector can track changes in the background noise due to the ability to re-estimate the neural data distribution. Both real and synthesized data have been used for testing the proposed algorithm in comparison with other methods, including the absolute thresholding detector (AT), median absolute deviation detector (MAD), nonlinear energy operator detector (NEO), and continuous wavelet detector (CWD). Comparative testing results reveals that the EP-PC detection algorithm performs better than the other algorithms regardless of recording conditions. The EC-PC spike detector can be considered as an unsupervised and robust online spike detection. It is also suitable for hardware implementation. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Methods to control for unmeasured confounding in pharmacoepidemiology: an overview.

    PubMed

    Uddin, Md Jamal; Groenwold, Rolf H H; Ali, Mohammed Sanni; de Boer, Anthonius; Roes, Kit C B; Chowdhury, Muhammad A B; Klungel, Olaf H

    2016-06-01

    Background Unmeasured confounding is one of the principal problems in pharmacoepidemiologic studies. Several methods have been proposed to detect or control for unmeasured confounding either at the study design phase or the data analysis phase. Aim of the Review To provide an overview of commonly used methods to detect or control for unmeasured confounding and to provide recommendations for proper application in pharmacoepidemiology. Methods/Results Methods to control for unmeasured confounding in the design phase of a study are case only designs (e.g., case-crossover, case-time control, self-controlled case series) and the prior event rate ratio adjustment method. Methods that can be applied in the data analysis phase include, negative control method, perturbation variable method, instrumental variable methods, sensitivity analysis, and ecological analysis. A separate group of methods are those in which additional information on confounders is collected from a substudy. The latter group includes external adjustment, propensity score calibration, two-stage sampling, and multiple imputation. Conclusion As the performance and application of the methods to handle unmeasured confounding may differ across studies and across databases, we stress the importance of using both statistical evidence and substantial clinical knowledge for interpretation of the study results.

  10. Detecting Seismic Events Using a Supervised Hidden Markov Model

    NASA Astrophysics Data System (ADS)

    Burks, L.; Forrest, R.; Ray, J.; Young, C.

    2017-12-01

    We explore the use of supervised hidden Markov models (HMMs) to detect seismic events in streaming seismogram data. Current methods for seismic event detection include simple triggering algorithms, such as STA/LTA and the Z-statistic, which can lead to large numbers of false positives that must be investigated by an analyst. The hypothesis of this study is that more advanced detection methods, such as HMMs, may decreases false positives while maintaining accuracy similar to current methods. We train a binary HMM classifier using 2 weeks of 3-component waveform data from the International Monitoring System (IMS) that was carefully reviewed by an expert analyst to pick all seismic events. Using an ensemble of simple and discrete features, such as the triggering of STA/LTA, the HMM predicts the time at which transition occurs from noise to signal. Compared to the STA/LTA detection algorithm, the HMM detects more true events, but the false positive rate remains unacceptably high. Future work to potentially decrease the false positive rate may include using continuous features, a Gaussian HMM, and multi-class HMMs to distinguish between types of seismic waves (e.g., P-waves and S-waves). Acknowledgement: Sandia National Laboratories is a multi-mission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.SAND No: SAND2017-8154 A

  11. Investigation of Coherent and Incoherent Change Detection Algorithms

    DTIC Science & Technology

    2017-12-01

    Office of Management and Budget, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE December...Data Management System (SDMS) in order to compare the various change detection techniques. These change detection methods include the following: a...SAR) is presented in this thesis. This investigation utilizes data gathered from the Air Force Research Laboratory (AFRL) Sensor Data Management

  12. Systems and methods for detecting nuclear radiation in the presence of backgrounds

    DOEpatents

    Bross, Alan D.; Mellott, Kerry L.; Pla-Dalmau, Anna

    2005-06-21

    Systems and methods for the simultaneous detection and identification of radiation species, including neutrons, gammas/x-rays and minimum ionizing particles (MIPs). A plurality of rectangular and/or triangularly shaped radiation sensitive scintillators can be configured from a plurality of nano-sized particles, dopants and an extruded plastic material. A wavelength-shifting fiber can then be located within a central hole of each extruded scintillator, wherein the wavelength-shifting fiber absorbs scintillation light and re-emits the light at a longer wavelength, thereby piping the light to a photodetector whose response to the light indicates the presence of radiation The resulting method and system can simultaneously detect neutrons, gamma rays, x-rays and cosmic rays (MIPs) and identify each.

  13. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  14. Blood doping: risks to athletes' health and strategies for detection.

    PubMed

    Oliveira, Carolina Dizioli Rodrigues de; Bairros, André Valle de; Yonamine, Mauricio

    2014-07-01

    Blood doping has been defined as the misuse of substances or certain techniques to optimize oxygen delivery to muscles with the aim to increase performance in sports activities. It includes blood transfusion, administration of erythropoiesis-stimulating agents or blood substitutes, and gene manipulations. The main reasons for the widespread use of blood doping include: its availability for athletes (erythropoiesis-stimulating agents and blood transfusions), its efficiency in improving performance, and its difficult detection. This article reviews and discusses the blood doping substances and methods used for in sports, the adverse effects related to this practice, and current strategies for its detection.

  15. Method and system for monitoring environmental conditions

    DOEpatents

    Kulesz, James J [Oak Ridge, TN; Lee, Ronald W [Oak Ridge, TN

    2010-11-16

    A system for detecting the occurrence of anomalies includes a plurality of spaced apart nodes, with each node having adjacent nodes, each of the nodes having one or more sensors associated with the node and capable of detecting anomalies, and each of the nodes having a controller connected to the sensors associated with the node. The system also includes communication links between adjacent nodes, whereby the nodes form a network. At least one software agent is capable of changing the operation of at least one of the controllers in response to the detection of an anomaly by a sensor.

  16. Online updating of context-aware landmark detectors for prostate localization in daily treatment CT images

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Xiubin; Gao, Yaozong; Shen, Dinggang, E-mail: dgshen@med.unc.edu

    2015-05-15

    Purpose: In image guided radiation therapy, it is crucial to fast and accurately localize the prostate in the daily treatment images. To this end, the authors propose an online update scheme for landmark-guided prostate segmentation, which can fully exploit valuable patient-specific information contained in the previous treatment images and can achieve improved performance in landmark detection and prostate segmentation. Methods: To localize the prostate in the daily treatment images, the authors first automatically detect six anatomical landmarks on the prostate boundary by adopting a context-aware landmark detection method. Specifically, in this method, a two-layer regression forest is trained as amore » detector for each target landmark. Once all the newly detected landmarks from new treatment images are reviewed or adjusted (if necessary) by clinicians, they are further included into the training pool as new patient-specific information to update all the two-layer regression forests for the next treatment day. As more and more treatment images of the current patient are acquired, the two-layer regression forests can be continually updated by incorporating the patient-specific information into the training procedure. After all target landmarks are detected, a multiatlas random sample consensus (multiatlas RANSAC) method is used to segment the entire prostate by fusing multiple previously segmented prostates of the current patient after they are aligned to the current treatment image. Subsequently, the segmented prostate of the current treatment image is again reviewed (or even adjusted if needed) by clinicians before including it as a new shape example into the prostate shape dataset for helping localize the entire prostate in the next treatment image. Results: The experimental results on 330 images of 24 patients show the effectiveness of the authors’ proposed online update scheme in improving the accuracies of both landmark detection and prostate segmentation. Besides, compared to the other state-of-the-art prostate segmentation methods, the authors’ method achieves the best performance. Conclusions: By appropriate use of valuable patient-specific information contained in the previous treatment images, the authors’ proposed online update scheme can obtain satisfactory results for both landmark detection and prostate segmentation.« less

  17. Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review

    PubMed Central

    Czajkowski, R; Pérombelon, MCM; Jafra, S; Lojkowska, E; Potrykus, M; van der Wolf, JM; Sledz, W

    2015-01-01

    The soft rot Enterobacteriaceae (SRE) Pectobacterium and Dickeya species (formerly classified as pectinolytic Erwinia spp.) cause important diseases on potato and other arable and horticultural crops. They may affect the growing potato plant causing blackleg and are responsible for tuber soft rot in storage thereby reducing yield and quality. Efficient and cost-effective detection and identification methods are essential to investigate the ecology and pathogenesis of the SRE as well as in seed certification programmes. The aim of this review was to collect all existing information on methods available for SRE detection. The review reports on the sampling and preparation of plant material for testing and on over thirty methods to detect, identify and differentiate the soft rot and blackleg causing bacteria to species and subspecies level. These include methods based on biochemical characters, serology, molecular techniques which rely on DNA sequence amplification as well as several less-investigated ones. PMID:25684775

  18. Local Measurement of Tropospheric HO(x)

    NASA Technical Reports Server (NTRS)

    Crosley, David R.

    1994-01-01

    In March of 1992 a workshop sponsored by NASA and NSF was held at SRI International to assess the current ability to measure atmospheric OH and HO2. The measurement techniques reviewed during the workshop for detection of OH included five laser-induced fluorescence schemes, five laser-based adsorption techniques, and four non-laser methods. Six instruments or instrument concepts for HO2 detection, including chemical amplification, conversion to OH with subsequent OH detection, or direct spectroscopic detection of the HO2 were also discussed. The conclusions from the workshop identify several measurement techniques for OH and HO2 that are ready for field tests. These have the ability to measure the radicals with sufficient sensitivity and accuracy to form meaningful comparison with atmospheric model predictions. The workshop conclusions also include recommendations for informal and formal intercomparison protocols.

  19. Non-seismic tsunamis: filling the forecast gap

    NASA Astrophysics Data System (ADS)

    Moore, C. W.; Titov, V. V.; Spillane, M. C.

    2015-12-01

    Earthquakes are the generation mechanism in over 85% of tsunamis. However, non-seismic tsunamis, including those generated by meteorological events, landslides, volcanoes, and asteroid impacts, can inundate significant area and have a large far-field effect. The current National Oceanographic and Atmospheric Administration (NOAA) tsunami forecast system falls short in detecting these phenomena. This study attempts to classify the range of effects possible from these non-seismic threats, and to investigate detection methods appropriate for use in a forecast system. Typical observation platforms are assessed, including DART bottom pressure recorders and tide gauges. Other detection paths include atmospheric pressure anomaly algorithms for detecting meteotsunamis and the early identification of asteroids large enough to produce a regional hazard. Real-time assessment of observations for forecast use can provide guidance to mitigate the effects of a non-seismic tsunami.

  20. Challenges for Detecting Valproic Acid in a Nontargeted Urine Drug Screening Method.

    PubMed

    Pope, Jeffrey D; Black, Marion J; Drummer, Olaf H; Schneider, Hans G

    2017-08-01

    Valproic acid (VPA) is a widely prescribed medicine, and acute toxicity is possible. As such, it should be included in any nontargeted urine drug screening method. In many published liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS/MS) methods, VPA is usually measured using a pseudo-multiple reaction monitoring (MRM) transition. We investigate a simple ultra-high-performance liquid chromatography-quadrupole time-of-flight (QTof) approach to detect the presence of VPA with more confidence. Three commercially sourced VPA metabolites were characterized and added to a nontargeted high-resolution MS urine drug screening method. All analyses were performed on a Waters Xevo G2-XS LC-QTof in negative electrospray ionization mode. The mass detector was operated in MS mode, and data were processed with UNIFI software. Sixty-eight patient urine samples, which were previously identified by a well-established gas chromatography-MS method as containing VPA, were analyzed on the Waters Xevo G2-XS LC-QTof, to validate this approach. VPA metabolite standards were characterized, and their detection data were added to the broad drug screening library. VPA metabolites were readily detectable in the urine of patients taking VPA. The inclusion of characterized VPA metabolites provides a simple and reliable method enabling the detection of VPA in nontargeted urine drug screening.

Top