Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

PubMed Central

Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

2000-01-01

We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Identification and characterization of Theileria ovis surface protein (ToSp) resembled TaSp in Theileria annulata.

PubMed

Shayan, P; Jafari, S; Fattahi, R; Ebrahimzade, E; Amininia, N; Changizi, E

2016-05-01

Ovine theileriosis is an important hemoprotozoal disease of sheep and goats in tropical and subtropical regions which caused high economic loses in the livestock industry. Theileria annulata surface protein (TaSp) was used previously as a tool for serological analysis in livestock. Since the amino acid sequences of TaSp is, at least, in part very conserved in T. annulata, Theileria lestoquardi and Theileria china I and II, it is very important to determine the amino acid sequence of this protein in Theileria ovis as well, to avoid false interpretation of serological data based on this protein in small animal. In the present study, the nucleotide sequence and amino acid sequence of T. ovis surface protein (ToSp) were determined. The comparison of the nucleotide sequence of ToSp showed 96, 96, 99, and 86 % homology to the corresponding nucleotide sequence of TaSp genes by T. annulata, T. China I, T. China II and T. lestoquardi, previously registered in GenBank under accession nos. AJ316260.1, AY274329.1, DQ120058.1, and EF092924.1 respectively. The amino acid sequence analysis showed 95, 81, 98 and 70 % homology to the corresponding amino acid sequence of T. annulata, T chinaI, T china II and T. lestoquardi, registered in GenBank under accession nos. CAC87478.1, AAP36993.1, AAZ30365.1 and AAP36999.11, respectively. Interestingly, in contrast to the C terminus, a significant difference in amino acid sequence in the N teminus of the ToSp protein could be determined compared to the other known corresponding TaSp sequences, which make this region attractive for designing of a suitable tool for serological diagnosis.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida.

PubMed Central

Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K

1987-01-01

The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Completion of full length genome sequence of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan.

PubMed

Yamamoto, Eiji; Ito, Toshihiro; Ito, Hiroshi

2016-11-01

The nucleotide sequences of nucleocapsid protein (N); phosphoprotein (P); matrix protein (M); hemagglutinin-neuraminidase (HN); and large polymerase protein (L) genes, 3'-end leader, 5'-end trailer and intergenic regions of the avian paramyxovirus (APMV) strain goose/Shimane/67/2000 (APMV/Shimane67) were determined. Together with previously reported data on fusion protein (F) gene sequence [46], the determination of the genome sequence of APMV/Shimane67 has been completed in this study. The genome of APMV/Shimane67 comprised 16,146 nucleotides in length and contains six genes in the order of 3'-N-P-M-F-HN-L-5'. The features of the APMV/Shimane67 genome (e.g., nucleotide length of whole genome and each of the six genes, and predicted amino acid length of each of the six genes) were distinct from those of other APMV serotypes. Phylogenetic analysis indicated that although APMV/Shimane67 was grouped with APMV-1, -9 and -12, the evolutionary distance between APMV/Shimane67 and these viruses was longer than that observed between intra-serotype viruses. These results show that the genome sequence of APMV/Shimane67 contains specific characteristics and is distinguishable from other types of APMV.

Precise detection of chromosomal translocation or inversion breakpoints by whole-genome sequencing.

PubMed

Suzuki, Toshifumi; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Saitsu, Hirotomo; Takeda, Satoru; Matsumoto, Naomichi

2014-12-01

Structural variations (SVs), including translocations, inversions, deletions and duplications, are potentially associated with Mendelian diseases and contiguous gene syndromes. Determination of SV-related breakpoints at the nucleotide level is important to reveal the genetic causes for diseases. Whole-genome sequencing (WGS) by next-generation sequencers is expected to determine structural abnormalities more directly and efficiently than conventional methods. In this study, 14 SVs (9 balanced translocations, 1 inversion and 4 microdeletions) in 9 patients were analyzed by WGS with a shallow (5 × ) to moderate read coverage (20 × ). Among 28 breakpoints (as each SV has two breakpoints), 19 SV breakpoints had been determined previously at the nucleotide level by any other methods and 9 were uncharacterized. BreakDancer and Integrative Genomics Viewer determined 20 breakpoints (16 translocation, 2 inversion and 2 deletion breakpoints), but did not detect 8 breakpoints (2 translocation and 6 deletion breakpoints). These data indicate the efficacy of WGS for the precise determination of translocation and inversion breakpoints.

Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

PubMed

Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

1994-08-02

Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1997-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1999-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

PubMed

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Complete nucleotide sequence of spring beauty latent virus, a bromovirus infectious to Arabidopsis thaliana.

PubMed

Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T

2003-01-01

Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1999-08-31

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

PubMed Central

Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

1985-01-01

The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Selection rhizosphere-competent microbes for development of microbial products as biocontrol agents

NASA Astrophysics Data System (ADS)

Mashinistova, A. V.; Elchin, A. A.; Gorbunova, N. V.; Muratov, V. S.; Kydralieva, K. A.; Khudaibergenova, B. M.; Shabaev, V. P.; Jorobekova, Sh. J.

2009-04-01

Rhizosphere-borne microorganisms reintroduced to the soil-root interface can establish without inducing permanent disturbance in the microbial balance and effectively colonise the rhizosphere due to carbon sources of plant root exudates. A challenge for future development of microbial products for use in agriculture will be selection of rhizosphere-competent microbes that both protect the plant from pathogens and improve crop establishment and persistence. In this study screening, collection, identification and expression of stable and technological microbial strains living in soils and in the rhizosphere of abundant weed - couch-grass Elytrigia repens L. Nevski were conducted. A total of 98 bacteria isolated from the rhizosphere were assessed for biocontrol activity in vitro against phytopathogenic fungi including Fusarium culmorum, Fusarium heterosporum, Fusarium oxysporum, Drechslera teres, Bipolaris sorokiniana, Piricularia oryzae, Botrytis cinerea, Colletothrichum atramentarium and Cladosporium sp., Stagonospora nodorum. Biocontrol activity were performed by the following methods: radial and parallel streaks, "host - pathogen" on the cuts of wheat leaves. A culture collection comprising 64 potential biocontrol agents (BCA) against wheat and barley root diseases has been established. Of these, the most effective were 8 isolates inhibitory to at least 4 out of 5 phytopathogenic fungi tested. The remaining isolates inhibited at least 1 of 5 fungi tested. Growth stimulating activity of proposed rhizobacteria-based preparations was estimated using seedling and vegetative pot techniques. Seeds-inoculation and the tests in laboratory and field conditions were conducted for different agricultural crops - wheat and barley. Intact cells, liquid culture filtrates and crude extracts of the four beneficial bacterial strains isolated from the rhizosphere of weed were studied to stimulate plant growth. As a result, four bacterial strains selected from rhizosphere of weed - couch-grass Elytrigia repens L. Nevski were chosen as a core of collection of 98 pure cultures with high fungicidal and plant growth-stimulating potentials. Partial determination of nucleotide sequence of 16S ribosomes of tested bacteria indicated that Pseudomonas and Bacillus species were the most dominant bacteria exhibiting biocontrol activity. Typing of bacterial strains was performed on the basis of partial determination of nucleotide sequence 16S ribosome of the studying strain. For this purpose polymerase chain reaction (PCR), using specific primers was provided with chromosomal DNA of bacterial strain under study. After determination of nucleotide sequences of the obtained PCR-fragments, the data obtained was compared with the sequences available in the bank of data (GENEBANK: http://www.ncbi.nlm.nih.gov), with the aim to determine close related strain to the organism under study. When the level of homology exceeded the level of 98%, one could conclude that the strain under study was identical to the available in the bank of data. Amplification and sequencing of gene 16S pDNA was performed using universal for the majority of prokaryotes primers. Thermopolimerase Long PCR Enzyme Mix «Fermentas», dNTP -«Fermentas» was used for amplification. While performing PCR, reagent concentrations corresponded to the protocols described in a set Long PCR Enzyme Mix «Fermentas». DNA separation from the sample was performed with DNeasy Plant Mini Kit «QIAGEN». DNA separation from gel was performed with QIAquick Gel Extraction Kit«QIAGEN». Phylogenetic affinity was determined on the basis of the comparison of nucleotide sequence - 400 nucleotides that approximately corresponded to the positions from 500 to 907 nucleotides by nomenclature of E.coli. Primary analysis of the similarity of nucleotide sequences of genes 16S рDNA of the strains under study was performed on the basis of data Genbank. Sequences were aligned according to nucleotide sequences of those bacteria, which had the highest degree of homology with the strains under study, applying the program ClustalX 1.83. Building of rootless phylogenetic trees of the studying bacteria was carried out with the help of the program Njplot. Acknowledgement. This research was supported by the grant of ISTC KR-993.2.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Genomic organization and sequence of the Gus-s/sup a/ allele of the murine. beta. -glucuronidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funkenstein, B.; Leary, S.L.; Stein, J.C.

1988-03-01

The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

USDA-ARS?s Scientific Manuscript database

The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

Treesearch

K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

1998-01-01

DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured microphage from the turkey gastrointestinal system

PubMed Central

2011-01-01

The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

PubMed

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

USDA-ARS?s Scientific Manuscript database

Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

PubMed Central

Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

1988-01-01

Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1997-08-26

A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Complete genome sequence of a divergent strain of Japanese yam mosaic virus from China

USDA-ARS?s Scientific Manuscript database

A novel strain of Japanese yam mosaic virus (JYMV-CN) was identified in a yam plant with foliar mottle symptoms in China. The complete genomic sequence of JYMV-CN was determined. Its genomic sequence of 9701 nucleotides encodes a polyprotein of 3247 amino acids. Its organization was virtually identi...

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L.

PubMed Central

Zúñiga, M C; Steitz, J A

1977-01-01

The nucleotide sequence of tRNA1Gly isolated from the posterior silk gland of Bombyx mori has been determined. This transfer RNA is present in high amounts in the posterior silk gland during the fifth larval instar. It has a GCC anticodon, capable of decoding a major glycine codon in the fibroin messenger RNA, GGU. Structural features of Bombyx tRNA1Gly and its homology to other eukaryotic glycine tRNAs are discussed. Images PMID:414206

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Swellix: a computational tool to explore RNA conformational space.

PubMed

Sloat, Nathan; Liu, Jui-Wen; Schroeder, Susan J

2017-11-21

The sequence of nucleotides in an RNA determines the possible base pairs for an RNA fold and thus also determines the overall shape and function of an RNA. The Swellix program presented here combines a helix abstraction with a combinatorial approach to the RNA folding problem in order to compute all possible non-pseudoknotted RNA structures for RNA sequences. The Swellix program builds on the Crumple program and can include experimental constraints on global RNA structures such as the minimum number and lengths of helices from crystallography, cryoelectron microscopy, or in vivo crosslinking and chemical probing methods. The conceptual advance in Swellix is to count helices and generate all possible combinations of helices rather than counting and combining base pairs. Swellix bundles similar helices and includes improvements in memory use and efficient parallelization. Biological applications of Swellix are demonstrated by computing the reduction in conformational space and entropy due to naturally modified nucleotides in tRNA sequences and by motif searches in Human Endogenous Retroviral (HERV) RNA sequences. The Swellix motif search reveals occurrences of protein and drug binding motifs in the HERV RNA ensemble that do not occur in minimum free energy or centroid predicted structures. Swellix presents significant improvements over Crumple in terms of efficiency and memory use. The efficient parallelization of Swellix enables the computation of sequences as long as 418 nucleotides with sufficient experimental constraints. Thus, Swellix provides a practical alternative to free energy minimization tools when multiple structures, kinetically determined structures, or complex RNA-RNA and RNA-protein interactions are present in an RNA folding problem.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Complete genome sequence of keunjorong mosaic virus, a potyvirus from Cynanchum wilfordii.

PubMed

Nam, Moon; Lee, Joo-Hee; Choi, Hong Soo; Lim, Hyoun-Sub; Moon, Jae Sun; Lee, Su-Heon

2013-08-01

We have determined the complete genome sequence of keunjorong mosaic virus (KjMV). The KjMV genome is composed of 9,611 nucleotides, excluding the 3'-terminal poly(A) tail. It contains two open reading frames (ORFs), with the large one encoding a polyprotein of 3,070 amino acids and the small overlapping ORF encoding a PIPO protein of 81 amino acids. The KjMV genome shared the highest nucleotide sequence identity (57.5  %) with pepper mottle virus and freesia mosaic virus, two members of the genus Potyvirus. Based on the phylogenetic relatedness to known potyviruses, KjMV appears to be a member of a new species in the genus Potyvirus.

Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli.

PubMed Central

Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C

1985-01-01

Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

PubMed

Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

2017-09-01

The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

PubMed

Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

2016-06-01

As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

The complete genome sequence of a second distinct betabaculovirus from the true armyworm, Mythimna unipuncta

USDA-ARS?s Scientific Manuscript database

The betabaculovirus Pseudaletia (Mythimna) sp. granulovirus #8 (MyspGV#8) was examined by electron microscopy, host barcoding PCR, and determination of the nucleotide sequence of its genome. Scanning and transmission electron microscopy revealed that the occlusion bodies of MyspGV#8 possessed the c...

Epidemic Keratoconjunctivitis Due to the Novel Hexon-Chimeric-Intermediate 22,37/H8 Human Adenovirus ▿

PubMed Central

Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo

2008-01-01

In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

PubMed Central

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

2'-O-methyl-5-formylcytidine (f5Cm), a new modified nucleotide at the 'wobble' of two cytoplasmic tRNAs Leu (NAA) from bovine liver.

PubMed Central

Païs de Barros, J P; Keith, G; El Adlouni, C; Glasser, A L; Mack, G; Dirheimer, G; Desgrès, J

1996-01-01

The nucleotide analysis of a cytoplasmic tRNA(Leu) isolated from bovine liver revealed the presence of an unknown modified nucleotide N. The corresponding N nucleoside was isolated by different enzymatic and chromatographic protocols from a partially purified preparation of this tRNA(Leu). Its chemical characterization was determined from its chromatographic properties, UV-absorption spectroscopy and mass spectrometric measurements, as well as from those of the borohydride reduced N nucleoside and its etheno-trimethylsilyl derivative. The structure of N was established as 2'-O-methyl-5-formylcytidine (f5CM), and its reduced derivative as 2'-O-methyl-5-hydroxy-methylcytidine (om5Cm). By sequencing the bovine liver tRNA(Leu), the structure of the anticodon was determined as f5CmAA. In addition, the nucleotide sequence showed two primary structures differing only by the nucleotide 47c which is either uridine or adenosine. The two slightly differing bovine liver tRNAs-Leu(f5CmAA) are the only tRNAs so far sequenced which contain f5Cm. The role of such a modified cytidine at the first position of the anticodon is discussed in terms of decoding properties for the UUG and UUA leucine codons. Recently, precise evidence was obtained for the presence of f5Cm at the same position in tRNAs(Leu)(NAA) isolated from rabbit and lamb liver. Therefore, the 2'-O-methyl-5-formyl modification of cytidine at position 34 could be a general feature of cytoplasmic tRNAs(Leu)(NAA) in mammals. PMID:8628682

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

PubMed Central

Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

2016-01-01

Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Complete genome sequence of yam chlorotic necrosis virus, a novel macluravirus infecting yam

USDA-ARS?s Scientific Manuscript database

Complete genomic sequence of a novel member of the genus Macluravirus was determined from yam plants with chlorotic and necrotic symptoms in China. The genomic RNA consists of 8,261 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing one long open reading frame (ORF) encoding a larg...

Genome characterization and genetic diversity of sweet potato symptomless virus 1: a mastrevirus with an unusual nonanucleotide

USDA-ARS?s Scientific Manuscript database

Complete genomic sequences of nine isolates of sweet potato symptomless virus 1 (SPSMV-1), a virus of genus Mastrevirus in the family Geminiviridae, was determined to be 2,559-2,602 nucleotides from sweet potato accessions from different countries. These isolates shared genomic sequence identities o...

Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.

PubMed Central

Schollmeier, K; Hillen, W

1984-01-01

The nucleotide sequence of the central part of Tn10 has been determined from the rightmost HindIII site to IS10R. This sequence contains two open reading frames with opposite polarity. The in vivo transcription start points in this sequence have been determined by S1 mapping. These results define one minor and two major promoters. The transcription starts of the two major promoters are only 18 base pairs apart, and the transcripts show different polarity and overlap by 18 base pairs. The nucleotide sequence reveals two regions with palindromic symmetry which may serve as operators. Their possible involvement in the regulation of transcription of both genes is discussed. Taken together these results allow for a maximal coding capacity of 138 amino acids directed toward IS10R and 197 amino acids directed toward tetA. The possible function of these gene products is discussed. The accompanying article (Braus et al., J. Bacteriol. 160:504-509, 1984) presents evidence that these genes are expressed. Images PMID:6094471

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

PubMed

Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

2013-10-01

The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

PubMed

Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

2012-12-01

A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis

PubMed Central

Zheng, Jin-shuang; Sun, Cheng-zhen; Zhang, Shu-ning; Hou, Xi-lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis. PMID:27507974

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

PubMed

Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

PubMed Central

Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

2001-01-01

The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

Deletion within the metallothionein locus of cadmium-tolerant Synechococcus PCC 6301 involving a highly iterated palindrome (HIP1).

PubMed

Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J

1993-01-01

Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.

PubMed Central

del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R

1989-01-01

The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308

The GS (genetic selection) Principle.

PubMed

Abel, David L

2009-01-01

The GS (Genetic Selection) Principle states that biological selection must occur at the nucleotide-sequencing molecular-genetic level of 3'5' phosphodiester bond formation. After-the-fact differential survival and reproduction of already-living phenotypic organisms (ordinary natural selection) does not explain polynucleotide prescription and coding. All life depends upon literal genetic algorithms. Even epigenetic and "genomic" factors such as regulation by DNA methylation, histone proteins and microRNAs are ultimately instructed by prior linear digital programming. Biological control requires selection of particular configurable switch-settings to achieve potential function. This occurs largely at the level of nucleotide selection, prior to the realization of any integrated biofunction. Each selection of a nucleotide corresponds to the setting of two formal binary logic gates. The setting of these switches only later determines folding and binding function through minimum-free-energy sinks. These sinks are determined by the primary structure of both the protein itself and the independently prescribed sequencing of chaperones. The GS Principle distinguishes selection of existing function (natural selection) from selection for potential function (formal selection at decision nodes, logic gates and configurable switch-settings).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurilla, M.G.; Stone, H.O.; Keene, J.D.

The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminalmore » 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

PubMed

Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

1987-01-01

The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

PubMed

Brunak, S; Engelbrecht, J

1996-06-01

A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Complete Genome Sequence of Petrimonas sp. Strain IBARAKI, Assembled from the Metagenome Data of a Culture Containing Dehalococcoides spp.

PubMed

Ikegami, Kentaro; Aita, Yuto; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Shinzato, Misuzu; Ohki, Shun; Nakano, Kazuma; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi; Yohda, Masafumi

2018-05-03

The complete genome sequence of Petrimonas sp. strain IBARAKI in a Dehalococcoides -containing culture was determined using the PacBio RS II platform. The genome is a single circular chromosome of 3,693,233 nucleotides (nt), with a GC content of 44%. This is the first genome sequence of a Petrimonas species. Copyright © 2018 Ikegami et al.

Nucleotide sequence and further characterization of the Synechococcus sp. strain PCC 7002 recA gene: complementation of a cyanobacterial recA mutation by the Escherichia coli recA gene.

PubMed Central

Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D

1990-01-01

The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307

Rate-determining Step of Flap Endonuclease 1 (FEN1) Reflects a Kinetic Bias against Long Flaps and Trinucleotide Repeat Sequences.

PubMed

Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah

2015-08-21

Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

An Outbreak of Acute Hepatitis Caused by Genotype IB Hepatitis A Viruses Contaminating the Water Supply in Thailand.

PubMed

Ruchusatsawat, Kriangsak; Wongpiyabovorn, Jongkonnee; Kawidam, Chonthicha; Thiemsing, Laddawan; Sangkitporn, Somchai; Yoshizaki, Sayaka; Tatsumi, Masashi; Takeda, Naokazu; Ishii, Koji

2016-01-01

In 2000, an outbreak of acute hepatitis A was reported in a province adjacent to Bangkok, Thailand. To investigate the cause of the 2000 hepatitis A outbreaks in Thailand using molecular epidemiological analysis. Serum and stool specimens were collected from patients who were clinically diagnosed with acute viral hepatitis. Water samples from drinking water and deep-drilled wells were also collected. These specimens were subjected to polymerase chain reaction (PCR) amplification and sequencing of the VP1/2A region of the hepatitis A virus (HAV) genome. The entire genome sequence of one of the fecal specimens was determined and phylogenetically analyzed with those of known HAV sequences. Eleven of 24 fecal specimens collected from acute viral hepatitis patients were positive as determined by semi- nested reverse transcription PCR targeting the VP1/2A region of HAV. The nucleotide sequence of these samples had an identical genotype IB sequence, suggesting that the same causative agent was present. The complete nucleotide sequence derived from one of the samples indicated that the Thai genotype IB strain should be classified in a unique phylogenetic cluster. The analysis using an adjusted odds ratio showed that the consumption of groundwater was the most likely risk factor associated with the disease. © 2017 S. Karger AG, Basel.

Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

PubMed Central

Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

2014-01-01

Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

PubMed Central

Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

2016-01-01

Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

PubMed Central

Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.

2015-01-01

From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

USDA-ARS?s Scientific Manuscript database

The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus

USDA-ARS?s Scientific Manuscript database

The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and was found to be closely related to Maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long, excluding the poly (A) tail, and encodes...

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peters, J.; Peters, M.; Lottspeich, F.

1987-11-01

The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

PubMed

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

PubMed Central

Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

2015-01-01

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

PubMed

Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

2008-06-05

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

DNA Sequence Polymorphism of the Lactate Dehydrogenase Genefrom Iranian Plasmodium vivax and Plasmodium falciparum Isolates.

PubMed

Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza

2015-01-01

Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallan, Pradeep S.; Marshall, William S.; Harp, Joel

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter.more » Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.« less

Absence of ancient DNA in sub-fossil insect inclusions preserved in 'Anthropocene' Colombian copal.

PubMed

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L; Preziosi, Richard F; Brown, Terence A

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in 'Anthropocene' Colombian copal, dated to 'post-Bomb' and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal.

Absence of Ancient DNA in Sub-Fossil Insect Inclusions Preserved in ‘Anthropocene’ Colombian Copal

PubMed Central

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L.; Preziosi, Richard F.; Brown, Terence A.

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in ‘Anthropocene’ Colombian copal, dated to ‘post-Bomb’ and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal. PMID:24039876

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

PubMed Central

Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M

1982-01-01

A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Methods of automatic nucleotide-sequence analysis. Multicomponent spectrophotometric analysis of mixtures of nucleic acid components by a least-squares procedure

PubMed Central

Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.

1965-01-01

1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087

DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and comparison with the DNA sequence of the fibrotropic prototype strain.

PubMed

Astell, C R; Gardiner, E M; Tattersall, P

1986-02-01

The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).

Molecular Detection, Isolation, and Physiological Characterization of Functionally Dominant Phenol-Degrading Bacteria in Activated Sludge

PubMed Central

Watanabe, Kazuya; Teramoto, Maki; Futamata, Hiroyuki; Harayama, Shigeaki

1998-01-01

DNA was isolated from phenol-digesting activated sludge, and partial fragments of the 16S ribosomal DNA (rDNA) and the gene encoding the largest subunit of multicomponent phenol hydroxylase (LmPH) were amplified by PCR. An analysis of the amplified fragments by temperature gradient gel electrophoresis (TGGE) demonstrated that two major 16S rDNA bands (bands R2 and R3) and two major LmPH gene bands (bands P2 and P3) appeared after the activated sludge became acclimated to phenol. The nucleotide sequences of these major bands were determined. In parallel, bacteria were isolated from the activated sludge by direct plating or by plating after enrichment either in batch cultures or in a chemostat culture. The bacteria isolated were classified into 27 distinct groups by a repetitive extragenic palindromic sequence PCR analysis. The partial nucleotide sequences of 16S rDNAs and LmPH genes of members of these 27 groups were then determined. A comparison of these nucleotide sequences with the sequences of the major TGGE bands indicated that the major bacterial populations, R2 and R3, possessed major LmPH genes P2 and P3, respectively. The dominant populations could be isolated either by direct plating or by chemostat culture enrichment but not by batch culture enrichment. One of the dominant strains (R3) which contained a novel type of LmPH (P3), was closely related to Valivorax paradoxus, and the result of a kinetic analysis of its phenol-oxygenating activity suggested that this strain was the principal phenol digester in the activated sludge. PMID:9797297

Genetic diversity and potential vectors and reservoirs of Cucurbit aphid-borne yellows virus in southeastern Spain.

PubMed

Kassem, Mona A; Juarez, Miguel; Gómez, Pedro; Mengual, Carmen M; Sempere, Raquel N; Plaza, María; Elena, Santiago F; Moreno, Aranzazu; Fereres, Alberto; Aranda, Miguel A

2013-11-01

The genetic variability of a Cucurbit aphid-borne yellows virus (CABYV) (genus Polerovirus, family Luteoviridae) population was evaluated by determining the nucleotide sequences of two genomic regions of CABYV isolates collected in open-field melon and squash crops during three consecutive years in Murcia (southeastern Spain). A phylogenetic analysis showed the existence of two major clades. The sequences did not cluster according to host, year, or locality of collection, and nucleotide similarities among isolates were 97 to 100 and 94 to 97% within and between clades, respectively. The ratio of nonsynonymous to synonymous nucleotide substitutions reflected that all open reading frames have been under purifying selection. Estimates of the population's genetic diversity were of the same magnitude as those previously reported for other plant virus populations sampled at larger spatial and temporal scales, suggesting either the presence of CABYV in the surveyed area long before it was first described, multiple introductions, or a particularly rapid diversification. We also determined the full-length sequences of three isolates, identifying the occurrence and location of recombination events along the CABYV genome. Furthermore, our field surveys indicated that Aphis gossypii was the major vector species of CABYV and the most abundant aphid species colonizing melon fields in the Murcia (Spain) region. Our surveys also suggested the importance of the weed species Ecballium elaterium as an alternative host and potential virus reservoir.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

Leek yellow stripe virus isolates from Brazil form a distant clade based on the P1 gene

USDA-ARS?s Scientific Manuscript database

The complete genomic sequence of a garlic isolate of Leek yellow stripe virus from Brazil (LYSV-MG) has been determined, and phylogenetic comparisons made to LYSV isolates from other parts of the world. In addition, the nucleotide sequence of the 5'UTR and part of the P1 gene of multiple LYSV isolat...

First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

PubMed

Ali, Akhtar

2017-01-12

In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

Molecular Characterization of the Meyer Lemon Isolate of Citrus Tatter Leaf Virus: Complete Genome Sequence and Development of Biologically Active In Vitro Transcripts

USDA-ARS?s Scientific Manuscript database

Citrus tatter leaf virus isolated from Meyer lemon trees (CTLV-ML) from California and Florida induces bud union incompatibility of citrus trees grafted on the widely used trifoliate and trifoliate hybrid rootstocks. The complete genome sequence of CTLV-ML was determined to be 6,495 nucleotides (nts...

Differentiated evolutionary conservatism and lack of polymorphism of crucial sex determination genes (SRY and SOX9) in four species of the family Canidae.

PubMed

Nowacka-Woszuk, Joanna; Switonski, Marek

2009-01-01

The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.

A novel model for DNA sequence similarity analysis based on graph theory.

PubMed

Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan

2011-01-01

Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.

[Phylogenetic relationship of street rabies virus strains and their antigenic reactivity with antibodies induced by vaccine strains. I. Analysis of phylogenetic relationship of street rabies virus strains isolated in Poland].

PubMed

Sadkowska-Todys, M

2000-01-01

The aims of these studies were: genetic characteristic of street rabies virus strains isolated from different animal species in Poland and determination of phylogenetic relationships to reference laboratory strains of the street rabies viruses belonging to genotype 1 and 5. The variability of rabies isolates and their phylogenetic relationship were studied by comparing the nucleotide sequence of the virus genome fragment. The Polish strains of genotype 1 belong to four phylogenetic groups (NE, CE, NEE, EE) corresponding to four variants: fox-racoon dog (F-RD); European fox 1 (F1); European fox 2 (F2) and European fox 3 (F3). On the Polish territories there are no rabies strains representing the variant dog-wolf and typical for arctic fox variant. The similarity of nucleotide and amino acid sequences of street rabies strains belonging to genotype 1 and laboratory strain CVS is very high. It is about 91% similarity at nucleotide level and 95% at amino acid level. Rabies strain CVS is similar to genotype 5 bat strains (EBL 1) only in about 69% and 74% at nucleotide and amino acid level, respectively. The genetic divergence of rabies strains circulating in Poland raised the need of permanent epidemiological and virological surveillance. The genotype and variant of isolated strains should be determined (using PCR and RLFP methods).

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

PubMed Central

Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

1980-01-01

The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

PubMed

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

PubMed Central

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, J.E.; Beck, T.W.; Brennscheidt, U.

1994-03-01

The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less

Molecular cloning and nucleotide sequences of the genes for two essential proteins constituting a novel enzyme system for heptaprenyl diphosphate synthesis.

PubMed

Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K

1995-08-04

The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).

The nucleotides they are a-changin': function of RNA binding proteins in post-transcriptional messenger RNA editing and modification in Arabidopsis.

PubMed

Kramer, Marianne C; Anderson, Stephen J; Gregory, Brian D

2018-06-05

During and after transcription, the fate of an RNA molecule is almost entirely directed by the cohorts of interacting RNA-binding proteins (RBPs). RBPs regulate all stages of the life cycle of a messenger RNA (mRNA) molecule, including splicing, polyadenylation, transport out of the nucleus, RNA stability, and translation. In addition to these functions, RBPs can function to modify or edit the sequences encoded by the RNA. While the sequence for each transcript is determined in the genome, by the time an RNA reaches its final fate, the sequence may have been edited, where one nucleotide is converted to another, or modified, where a chemical group, or sometimes others moieties, are covalently linked to a nucleotide base. These changes to the RNA sequence have major consequences on the function of the RNA. Additionally, variation in the levels of the RBPs that perform the editing or modification can drastically affect the fitness of an organism. Here, we review RBPs that are known to edit or modify RNA ribonucleotides, focusing on the RNA editing ability of the pentatricopeptide repeat (PPR) proteins and the RBPs that modify adenosine to N 6 - methyladenosine. Copyright © 2018 Elsevier Ltd. All rights reserved.

Identification and functional activity of a staphylocoagulase type XI variant originating from staphylococcal food poisoning isolates.

PubMed

Suzuki, Y; Matsushita, S; Kubota, H; Kobayashi, M; Murauchi, K; Higuchi, Y; Kato, R; Hirai, A; Sadamasu, K

2016-09-01

Staphylocoagulase, an extracellular protein secreted by Staphylococcus aureus, has been used as an epidemiological marker. At least 12 serotypes and 24 genotypes subdivided on the basis of nucleotide sequence have been reported to date. In this study, we identified a novel staphylocoagulase nucleotide sequence, coa310, from staphylococcal food poisoning isolates that had the ability to coagulate plasma, but could not be typed using the conventional method. The protein encoded by coa310 contained the six fundamental conserved domains of staphylocoagulase. The full-length nucleotide sequence of coa310 shared the highest similarity (77·5%) with that of staphylocoagulase-type (SCT) XIa. The sequence of the D1 region, which would be responsible for the determination of SCT, shared the highest similarity (91·8%) with that of SCT XIa. These results suggest that coa310 is a novel variant of SCT XI. Moreover, we demonstrated that coa310 encodes a functioning coagulase, by confirming the coagulating activity of the recombinant protein expressed from coa310. This is the first study to directly demonstrate that Coa310, a putative SCT XI, has coagulating activity. These findings may be useful for the improvement of the staphylocoagulase-typing method, including serotyping and genotyping. This is the first study to identify a novel variant of staphylocoagulase type XI based on its nucleotide sequence and to demonstrate coagulating activity in the variant using a recombinant protein. Elucidation of the variety of staphylocoagulases will provide suggestions for further improvement of the staphylocoagulase-typing method and contribute to our understanding of the epidemiologic characterization of Staphylococcus aureus. © 2016 The Society for Applied Microbiology.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

PubMed Central

Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

1982-01-01

The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Sequencing the Connectome

PubMed Central

Zador, Anthony M.; Dubnau, Joshua; Oyibo, Hassana K.; Zhan, Huiqing; Cao, Gang; Peikon, Ian D.

2012-01-01

Connectivity determines the function of neural circuits. Historically, circuit mapping has usually been viewed as a problem of microscopy, but no current method can achieve high-throughput mapping of entire circuits with single neuron precision. Here we describe a novel approach to determining connectivity. We propose BOINC (“barcoding of individual neuronal connections”), a method for converting the problem of connectivity into a form that can be read out by high-throughput DNA sequencing. The appeal of using sequencing is that its scale—sequencing billions of nucleotides per day is now routine—is a natural match to the complexity of neural circuits. An inexpensive high-throughput technique for establishing circuit connectivity at single neuron resolution could transform neuroscience research. PMID:23109909

Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

PubMed Central

Anwar, R; Booth, A; Churchill, A J; Markham, A F

1996-01-01

The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

PubMed

Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

1997-05-01

The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Genome sequence variation in the constricta strain dramatically alters the protein interaction and localization map of Potato yellow dwarf virus

USDA-ARS?s Scientific Manuscript database

The genome sequence of the constricta strain of Potato yellow dwarf virus (CYDV) was determined to be 12,792 nucleotides long and organized into seven open reading frames with the gene order 3’-N-X-P-Y-M-G-L-5’, which encodes the nucleocapsid, phosphoprotein, movement, matrix, glycoprotein and RNA-d...

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-beta from Niger.

PubMed

Shih, S L; Kumar, S; Tsai, W S; Lee, L M; Green, S K

2009-01-01

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

PubMed Central

De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

1992-01-01

The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Substrate-specifying determinants of the nucleotide pyrophosphatases/phosphodiesterases NPP1 and NPP2

PubMed Central

2004-01-01

The nucleotide pyrophosphatases/phosphodiesterases NPP1 and NPP2/autotaxin are structurally related eukaryotic ecto-enzymes, but display a very different substrate specificity. NPP1 releases nucleoside 5′-monophosphates from various nucleotides, whereas NPP2 mainly functions as a lysophospholipase D. We have used a domain-swapping approach to map substrate-specifying determinants of NPP1 and NPP2. The catalytic domain of NPP1 fused to the N- and C-terminal domains of NPP2 was hyperactive as a nucleotide phosphodiesterase, but did not show any lysophospholipase D activity. In contrast, chimaeras of the catalytic domain of NPP2 and the N- and/or C-terminal domains of NPP1 were completely inactive. These data indicate that the catalytic domain as well as both extremities of NPP2 contain lysophospholipid-specifying sequences. Within the catalytic domain of NPP1 and NPP2, we have mapped residues close to the catalytic site that determine the activities towards nucleotides and lysophospholipids. We also show that the conserved Gly/Phe-Xaa-Gly-Xaa-Xaa-Gly (G/FXGXXG) motif near the catalytic site is required for metal binding, but is not involved in substrate-specification. Our data suggest that the distinct activities of NPP1 and NPP2 stem from multiple differences throughout the polypeptide chain. PMID:15096095

HomSI: a homozygous stretch identifier from next-generation sequencing data.

PubMed

Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil

2014-02-01

In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.

Gene 2 of the sigma rhabdovirus genome encodes the P protein, and gene 3 encodes a protein related to the reverse transcriptase of retroelements.

PubMed

Landès-Devauchelle, C; Bras, F; Dezélée, S; Teninges, D

1995-11-10

The nucleotide sequence of the genes 2 and 3 of the Drosophila rhabdovirus sigma was determined from cDNAs to viral genome and poly(A)+ mRNAs. Gene 2 comprises 1032 nucleotides and contains a long ORF encoding a molecular weight 35,208 polypeptide present in infected cells and in virions which migrates in SDS-PAGE as a doublet of M(r) about 60 kDa. The distribution of acidic charges as well as the electrophoretic properties of the protein are characteristic of the rhabdovirus P proteins. Gene 3 comprises 923 nucleotides and contains a long ORF capable of coding a polypeptide of 298 amino acids of MW 33,790. The putative protein (PP3) is similar in size to a minor component of the virions. Computer analysis shows that the sequence of PP3 contains three motifs related to the conserved motifs of reverse transcriptases.

Multiple nucleotide preferences determine cleavage-site recognition by the HIV-1 and M-MuLV RNases H.

PubMed

Schultz, Sharon J; Zhang, Miaohua; Champoux, James J

2010-03-19

The RNase H activity of reverse transcriptase is required during retroviral replication and represents a potential target in antiviral drug therapies. Sequence features flanking a cleavage site influence the three types of retroviral RNase H activity: internal, DNA 3'-end-directed, and RNA 5'-end-directed. Using the reverse transcriptases of HIV-1 (human immunodeficiency virus type 1) and Moloney murine leukemia virus (M-MuLV), we evaluated how individual base preferences at a cleavage site direct retroviral RNase H specificity. Strong test cleavage sites (designated as between nucleotide positions -1 and +1) for the HIV-1 and M-MuLV enzymes were introduced into model hybrid substrates designed to assay internal or DNA 3'-end-directed cleavage, and base substitutions were tested at specific nucleotide positions. For internal cleavage, positions +1, -2, -4, -5, -10, and -14 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV significantly affected RNase H cleavage efficiency, while positions -7 and -12 for HIV-1 and positions -4, -9, and -11 for M-MuLV had more modest effects. DNA 3'-end-directed cleavage was influenced substantially by positions +1, -2, -4, and -5 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV. Cleavage-site distance from the recessed end did not affect sequence preferences for M-MuLV reverse transcriptase. Based on the identified sequence preferences, a cleavage site recognized by both HIV-1 and M-MuLV enzymes was introduced into a sequence that was otherwise resistant to RNase H. The isolated RNase H domain of M-MuLV reverse transcriptase retained sequence preferences at positions +1 and -2 despite prolific cleavage in the absence of the polymerase domain. The sequence preferences of retroviral RNase H likely reflect structural features in the substrate that favor cleavage and represent a novel specificity determinant to consider in drug design. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

PubMed

Winterhagen, Patrick; Wünsche, Jens-Norbert

2016-05-01

Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

PubMed

Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

1990-05-01

The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

PubMed Central

Laehnemann, David; Borkhardt, Arndt

2016-01-01

Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

A single nucleotide polymorphism at the right terminal region of Mexican papita viroid is a virulent determinant factor on tomato

USDA-ARS?s Scientific Manuscript database

Mexican papita viroid (MPVd), a pospiviroid, causes serious disease outbreaks on greenhouse tomato in North America. Two dominant genotypes (MPV-S and MPV-M), sharing 93.8% sequence identity, incited striking different symptom expression (severe and mild) on tomato ‘Rutgers’. To determine genetic ...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

[Analysis on mutation of S gene and P gene of hepatitis B virus in two counties of Sichuan Province].

PubMed

Tong, Wen-Bin; He, Ji-Lan; Sun, Li

2009-02-01

To analyze HBV S gene/P gene mutation in 2 counties (districts) of Sichuan province. HBV DNA were extracted from sera positive both for HBsAg and HBeAg. After PCR and nucleotide sequencing, nucleotide/amino acid mutation in S and P gene were compared and analyzed. Of 47 serum samples from patients with chronic HBV infection, amino acid mutation in 'a' determinant occurred in 12 samples (25.53%,12/47), correlating with T126A, I126T/S, P127T, T131N, M133L, M133T and T140I; high proportion of mutation clustered in first loop of 'a' determinant (92.86%,13/14), rtV207I mutation in C domain of reverse transcription occured in one sample. Naturally occurring mutation in 'a' determinant clustered predominantly in the first loop and usually associated with altered antigenicity, posing a potential threat to successfully vaccinated individuals; Lamivudine-resistant mutant might occur in patient even without nucleotide analogue treatment.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Avian influenza virus and Newcastle disease virus (NDV) surveillance in commercial breeding farm in China and the characterization of Class I NDV isolates.

PubMed

Hu, Beixia; Huang, Yanyan; He, Yefeng; Xu, Chuantian; Lu, Xishan; Zhang, Wei; Meng, Bin; Yan, Shigan; Zhang, Xiumei

2010-07-29

In order to determine the actual prevalence of avian influenza virus (AIV) and Newcastle disease virus (NDV) in ducks in Shandong province of China, extensive surveillance studies were carried out in the breeding ducks of an intensive farm from July 2007 to September 2008. Each month cloacal and tracheal swabs were taken from 30 randomly selected birds that appeared healthy. All of the swabs were negative for influenza A virus recovery, whereas 87.5% of tracheal swabs and 100% cloacal swabs collected in September 2007, were positive for Newcastle disease virus isolation. Several NDV isolates were recovered from tracheal and cloacal swabs of apparently healthy ducks. All of the isolates were apathogenic as determined by the MDT and ICPI. The HN gene and the variable region of F gene (nt 47-420) of four isolates selected at random were sequenced. A 374 bp region of F gene and the full length of HN gene were used for phylogenetic analysis. Four isolates were identified as the same isolate based on nucleotide sequences identities of 99.2-100%, displaying a closer phylogenetic relationship to lentogenic Class I viruses. There were 1.9-9.9% nucleotide differences between the isolates and other Class I virus in the variable region of F gene (nt 47-420), whereas there were 38.5-41.2% nucleotide difference between the isolates and Class II viruses. The amino acid sequences of the F protein cleavage sites in these isolates were 112-ERQERL-117. The full length of HN gene of these isolates was 1851 bp, coding 585 amino acids. The homology analysis of the nucleotide sequence of HN gene indicated that there were 2.0-4.2% nucleotide differences between the isolates and other Class I viruses, whereas there were 29.5-40.9% differences between the isolates and Class II viruses. The results shows that these isolates are not phylogenetically related to the vaccine strain (LaSota). This study adds to the understanding of the ecology of influenza viruses and Newcastle disease viruses in ducks and emphasizes the need for constant surveillance in times of an ongoing and expanding epidemic of AIV and NDV. Copyright (c) 2010 Elsevier B.V. All rights reserved.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Deciphering mRNA Sequence Determinants of Protein Production Rate

NASA Astrophysics Data System (ADS)

Szavits-Nossan, Juraj; Ciandrini, Luca; Romano, M. Carmen

2018-03-01

One of the greatest challenges in biophysical models of translation is to identify coding sequence features that affect the rate of translation and therefore the overall protein production in the cell. We propose an analytic method to solve a translation model based on the inhomogeneous totally asymmetric simple exclusion process, which allows us to unveil simple design principles of nucleotide sequences determining protein production rates. Our solution shows an excellent agreement when compared to numerical genome-wide simulations of S. cerevisiae transcript sequences and predicts that the first 10 codons, which is the ribosome footprint length on the mRNA, together with the value of the initiation rate, are the main determinants of protein production rate under physiological conditions. Finally, we interpret the obtained analytic results based on the evolutionary role of the codons' choice for regulating translation rates and ribosome densities.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Molecular characterization and phylogenetic relationships of Desmodium leaf distortion virus (DeLDV): a new begomovirus infecting Desmodium glabrum in Yucatan, Mexico.

PubMed

Hernández-Zepeda, Cecilia; Argüello-Astorga, Gerardo; Idris, Ali M; Carnevali, Germán; Brown, Judith K; Moreno-Valenzuela, Oscar A

2009-12-01

The complete DNA-A component sequence of Desmodium leaf distortion virus (DeLDV, Begomovirus) isolated in Yucatan was determined to be 2569 nucleotides (nt) in length, and it was most closely related to Cotton leaf crumple virus-California (CLCrV-[Cal]), at 76%. The complete DNA-B component sequence was 2514 nt in length, and shared its highest nucleotide identity (60%) with Potato yellow mosaic Trinidad virus (PYMTV). Phylogenetic analyses group the DeLDV DNA-A component in the SLCV clade, whereas, the DeLDV DNA-B was grouped with the Abutilon mosaic virus clade, which also contains PYMV, suggesting that the DeLDV components have distinct evolutionary histories, possibly as the result of recombination and reassortment.

Partial sequencing analysis of the NS5B region confirmed the predominance of hepatitis C virus genotype 1 infection in Jeddah, Saudi Arabia.

PubMed

El Hadad, Sahar; Al-Hamdan, Hesa; Linjawi, Sabah

2017-01-01

Chronic hepatitis C virus (HCV) infection and its progression are major health problems that many countries including Saudi Arabia are facing. Determination of HCV genotypes and subgenotypes is critical for epidemiological and clinical analysis and aids in the determination of the ideal treatment strategy that needs to be followed and the expected therapy response. Although HCV infection has been identified as the second most predominant type of hepatitis in Saudi Arabia, little is known about the molecular epidemiology and genetic variability of HCV circulating in the Jeddah province of Saudi Arabia. The aim of this study was to determine the dominance of various HCV genotypes and subgenotypes circulating in Jeddah using partial sequencing of the NS5B region. To the best of our knowledge, this is the first study of its kind in Saudi Arabia. To characterize HCV genotypes and subgenotypes, serum samples from 56 patients with chronic HCV infection were collected and subjected to partial NS5B gene amplification and sequence analysis. Phylogenetic analysis of the NS5B partial sequences revealed that HCV/1 was the predominant genotype (73%), followed by HCV/4 (24.49%) and HCV/3 (2.04%). Moreover, pairwise analysis also confirmed these results based on the average specific nucleotide distance identity: ±0.112, ±0.112, and ±0.179 for HCV/1, HCV/4, and HCV/3, respectively, without any interference between genotypes. Notably, the phylogenetic tree of the HCV/1 subgenotypes revealed that all the isolates (100%) from the present study belonged to the HCV/1a subgenotype. Our findings also revealed similarities in the nucleotide sequences between HCV circulating in Saudi Arabia and those circulating in countries such as Morocco, Egypt, Canada, India, Pakistan, and France. These results indicated that determination of HCV genotypes and subgenotypes based on partial sequence analysis of the NS5B region is accurate and reliable for HCV subtype determination.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

PubMed

Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

2015-01-01

The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

PubMed

Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

2014-08-01

In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.

Interactions of Human Nucleotide Excision Repair Protein XPA with DNA and RPA70 Delta c327: Chemical Shift Mapping and N-15 NMR Relaxation Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchko, Garry W.; Daughdrill, Gary W.; De Lorimier, Robert

1999-12-28

Human XPA is an essential component in the multienzyme nucleotide excision repair (NER) pathway. The solution structure of the minimal DNA binding domain of XPA (XPA-MBD: M98-F219) was recently determined [Buchko et al. (1998) Nucleic Acids Res. 26, 2779-2788, Ikegami et al (1998) Nat. Struct. Biol. 5, 701-706] and shown to consist of a compact zinc-binding core and a loop-rich C-terminal subdomain connected by a linker sequence.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Molecular characterization of faba bean necrotic yellows viruses in Tunisia.

PubMed

Kraberger, Simona; Kumari, Safaa G; Najar, Asma; Stainton, Daisy; Martin, Darren P; Varsani, Arvind

2018-03-01

Faba bean necrotic yellows virus (FBNYV) (genus Nanovirus; family Nanoviridae) has a genome comprising eight individually encapsidated circular single-stranded DNA components. It has frequently been found infecting faba bean (Vicia faba L.) and chickpea (Cicer arietinum L.) in association with satellite molecules (alphasatellites). Genome sequences of FBNYV from Azerbaijan, Egypt, Iran, Morocco, Spain and Syria have been determined previously and we now report the first five genome sequences of FBNYV and associated alphasatellites from faba bean sampled in Tunisia. In addition, we have determined the genome sequences of two additional FBNYV isolates from chickpea plants sampled in Syria and Iran. All individual FBNYV genome component sequences that were determined here share > 84% nucleotide sequence identity with FBNYV sequences available in public databases, with the DNA-M component displaying the highest degree of diversity. As with other studied nanoviruses, recombination and genome component reassortment occurs frequently both between FBNYV genomes and between genomes of nanoviruses belonging to other species.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

NASA Technical Reports Server (NTRS)

Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

1986-01-01

The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

PubMed Central

Hughes, Joseph; van Beurden, Steven J.; Suárez, Nicolás M.; Haenen, Olga L. M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J. L.

2017-01-01

ABSTRACT Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. PMID:28860243

Error correction and diversity analysis of population mixtures determined by NGS

PubMed Central

Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.

2014-01-01

The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074

Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

PubMed

Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

2018-05-29

Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

PubMed

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

Nucleotide sequence analysis of a DNA region involved in capsular polysaccharide biosynthesis reveals the molecular basis of the nontypeability of two Actinobacillus pleuropneumoniae isolates.

PubMed

Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro

2016-11-01

The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Molecular detection and characterization of Theileria species in the Philippines.

PubMed

Belotindos, Lawrence P; Lazaro, Jonathan V; Villanueva, Marvin A; Mingala, Claro N

2014-09-01

Theileriosis is a tick-borne disease of domestic and wild animals that cause devastating economic loss in livestock in tropical and subtropical regions. Theileriosis is not yet documented in the Philippines as compared to babesiosis and anaplasmosis which are considered major tick-borne diseases that infect livestock in the country and contribute major losses to the livestock industry. The study was aimed to detect Theileria sp. at genus level in blood samples of cattle using polymerase chain reaction (PCR) assay. Specifically, it determined the phylogenetic relationship of Theileria species affecting cattle in the Philippines to other Theileria sp. registered in the GenBank. A total of 292 blood samples of cattle that were collected from various provinces were used. Theileria sp. was detected in 43/292 from the cattle blood samples using PCR assay targeting the major piroplasm surface protein (MPSP) gene. DNA sequence showed high similarity (90-99%) among the reported Theileria sp. isolates in the GenBank and the Philippine isolates of Theileria. Phylogenetic tree construction using nucleotide sequence classified the Philippine isolates of Theileria as benign. However, nucleotide polymorphism was observed in the new isolate based on nucleotide sequence alignment. It revealed that the new isolate can be a new species of Theileria.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Assessment of genetic diversity among four orchids based on ddRAD sequencing data for conservation purposes.

PubMed

Roy, Subhas Chandra; Moitra, Kaushik; De Sarker, Dilip

2017-01-01

Genetic diversity was assessed in the four orchid species using NGS based ddRAD sequencing data. The assembled nucleotide sequences (fastq) were deposited in the SRA archive of NCBI Database with accession number (SRP063543 for Dendrobium , SRP065790 for Geodorum, SRP072201 for Cymbidium and SRP072378 for Rhynchostylis ). Total base pair read was 1.1 Mbp in case of Dendrobium sp., 553.3 Kbp for Geodorum sp., 1.6 Gbp for Cymbidium , and 1.4 Gbp for Rhynchostylis . Average GC% was 43.9 in Geodorum , 43.7% in Dendrobium , 41.2% in Cymbidium and 42.3% in Rhynchostylis . Four partial gene sequences were used in DnaSP5 program for nucleotide diversity and phylogenetic relationship determination ( Ycf2 gene of Dendrobium, matK gene of Geodorum , psbD gene of Cymbidium and Ycf2 gene of Ryhnchostylis ). Nucleotide diversity (per site) Pi (π) was 0.10560 in Dendrobium, 0.03586 in Geodorum, 0.01364 in Cymbidium and 0.011344 in Rhynchostylis . Neutrality test statistics showed the negative value in all the four orchid species (Tajima's D value -2.17959 in Dendrobium , -2.01655 in Geodorum, -2.12362 in Rhynchostylis and -1.54222 in Cymbidium ) indicating the purifying selection. Result for these gene sequences ( mat K and Ycf 2 and psb D) indicate that they were not evolved neutrally, but signifying that selection might have played a role in evolution of these genes in these four groups of orchids. Phylogenetic relationship was analyzed by reconstructing dendrogram based on the matK, psbD and Ycf2 gene sequences using maximum likelihood method in MEGA6 program.

CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.

PubMed

Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E

2018-05-03

Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.

Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

PubMed Central

Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

2013-01-01

Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

PubMed

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.

PubMed

Beverly, Michael; Hagen, Caitlin; Slack, Olga

2018-02-01

The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.

Comparison and correlation of Simple Sequence Repeats distribution in genomes of Brucella species

PubMed Central

Kiran, Jangampalli Adi Pradeep; Chakravarthi, Veeraraghavulu Praveen; Kumar, Yellapu Nanda; Rekha, Somesula Swapna; Kruti, Srinivasan Shanthi; Bhaskar, Matcha

2011-01-01

Computational genomics is one of the important tools to understand the distribution of closely related genomes including simple sequence repeats (SSRs) in an organism, which gives valuable information regarding genetic variations. The central objective of the present study was to screen the SSRs distributed in coding and non-coding regions among different human Brucella species which are involved in a range of pathological disorders. Computational analysis of the SSRs in the Brucella indicates few deviations from expected random models. Statistical analysis also reveals that tri-nucleotide SSRs are overrepresented and tetranucleotide SSRs underrepresented in Brucella genomes. From the data, it can be suggested that over expressed tri-nucleotide SSRs in genomic and coding regions might be responsible in the generation of functional variation of proteins expressed which in turn may lead to different pathogenicity, virulence determinants, stress response genes, transcription regulators and host adaptation proteins of Brucella genomes. Abbreviations SSRs - Simple Sequence Repeats, ORFs - Open Reading Frames. PMID:21738309

Phylogeny of North American Powassan virus.

PubMed

Ebel, G D; Spielman, A; Telford, S R

2001-07-01

To determine whether Powassan virus (POW) and deer tick virus (DTV) constitute distinct flaviviral populations transmitted by ixodid ticks in North America, we analysed diverse nucleotide sequences from 16 strains of these viruses. Two distinct genetic lineages are evident, which may be defined by geographical and host associations. The nucleotide and amino acid sequences of lineage one (comprising New York and Canadian POW isolates) are highly conserved across time and space, but those of lineage two (comprising isolates from deer ticks and a fox) are more variable. The divergence between lineages is much greater than the variation within either lineage, and lineage two appears to be more diverse genetically than is lineage one. Application of McDonald-Kreitman tests to the sequences of these strains indicates that adaptive evolution of the envelope protein separates lineage one from lineage two. The two POW lineages circulating in North America possess a pattern of genetic diversity suggesting that they comprise distinct subtypes that may perpetuate in separate enzootic cycles.

Complete Sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: Gene arrangements indicate that platyhelminths are eutrochozoans

DOE Office of Scientific and Technical Information (OSTI.GOV)

von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.

2001-01-01

Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also formore » the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.« less

The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames.

PubMed Central

Benne, R; De Vries, B F; Van den Burg, J; Klaver, B

1983-01-01

The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Mitochondrial genome of the bullet tuna Auxis rochei from Indo-West Pacific collection provides novel genetic information about two subspecies.

PubMed

Li, Mingming; Guo, Liang; Zhang, Heng; Yang, Sen; Chen, Xinghan; Lin, Haoran; Meng, Zining

2016-09-01

Previously morphological studies supported the division of the bullet tuna into the two subspecies, Auxis rochei rochei and A. rochei eudorax. As a cosmopolitan species, A. rochei rochei ranges in the Indo-West Pacific and Atlantic oceans, while A. rochei eudorax inhabits in eastern Pacific region. Here, we used the HiSeq next-generation sequencing technique to determine the mitochondrial genome (mitogenome) of A. rochei from Indo-West Pacific collection, and then compared our data with mitogenomic sequences of the Atlantic and eastern Pacific retrieved from NCBI database. Results showed the mitogenome of A. rochei from three geographic collections shared the same genes and gene order, similar to typical teleosts. Also, we examined a low level of nucleotide diversity among these mitogenomic sequences. Interestingly, nucleotide diversity of intra-subspecies (Atlantic versus Indo-West) was higher than that of inter-subspecies (Atlantic versus eastern Pacific, Indo-West versus eastern Pacific).

A study of lactose metabolism in Lactococcus garvieae reveals a genetic marker for distinguishing between dairy and fish biotypes.

PubMed

Fortina, Maria Grazia; Ricci, Giovanni; Borgo, Francesca

2009-06-01

Dairy and fish isolates of Lactococcus garvieae were tested for their ability to utilize lactose and to grow in milk. Fish isolates were unable to assimilate lactose, but unexpectedly, they possessed the ability to grow in milk. Genetic studies, carried out constructing different vectorette libraries, provided evidence that in fish isolates, no genes involved in lactose utilization were present. For L. garvieae dairy isolates, a single system for the catabolism of lactose was found. It consists of a lactose transport and hydrolysis depending on a phosphoenolpyruvate-dependent phosphotransferase system combined with a phospho-beta-galactosidase. The genes involved were highly similar at the nucleotide sequence level to their counterparts in Lactococcus lactis; however, while in many L. lactis strains these genes are plasmid encoded, in L. garvieae they are chromosomally located. Thus, in the species L. garvieae, the phospho-beta-galactosidase gene, detectable in all strains of dairy origin but lacking in fish isolates, can be considered a reliable genetic marker for distinguishing biotypes in the two diverse ecological niches. Moreover, we obtained information regarding the complete nucleotide sequence of the gal operon in L. garvieae, consisting of a galactose permease and the Leloir pathway enzymes. This is one of the first reports concerning the determination of the nucleotide sequences of genes (other than the 16S rDNA gene) in L. garvieae and should be considered a step in a continuous effort to explore the genome of this species, with the aim of determining the real relationship between the presence of L. garvieae in dairy products and food safety.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

An adaptive, object oriented strategy for base calling in DNA sequence analysis.

PubMed Central

Giddings, M C; Brumley, R L; Haker, M; Smith, L M

1993-01-01

An algorithm has been developed for the determination of nucleotide sequence from data produced in fluorescence-based automated DNA sequencing instruments employing the four-color strategy. This algorithm takes advantage of object oriented programming techniques for modularity and extensibility. The algorithm is adaptive in that data sets from a wide variety of instruments and sequencing conditions can be used with good results. Confidence values are provided on the base calls as an estimate of accuracy. The algorithm iteratively employs confidence determinations from several different modules, each of which examines a different feature of the data for accurate peak identification. Modules within this system can be added or removed for increased performance or for application to a different task. In comparisons with commercial software, the algorithm performed well. Images PMID:8233787

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.

PubMed

Kim, K S; Lee, S E; Jeong, H W; Ha, J H

1998-10-01

The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.

Organization and transient expression of the gene for human U11 snRNA

PubMed Central

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

Molecular characterisation of Atlantic salmon paramyxovirus (ASPV): A novel paramyxovirus associated with proliferative gill inflammation

USGS Publications Warehouse

Falk, K.; Batts, W.N.; Kvellestad, A.; Kurath, G.; Wiik-Nielsen, J.; Winton, J.R.

2008-01-01

Atlantic salmon paramyxovirus (ASPV) was isolated in 1995 from gills of farmed Atlantic salmon suffering from proliferative gill inflammation. The complete genome sequence of ASPV was determined, revealing a genome 16,968 nucleotides in length consisting of six non-overlapping genes coding for the nucleo- (N), phospho- (P), matrix- (M), fusion- (F), haemagglutinin-neuraminidase- (HN) and large polymerase (L) proteins in the order 3???-N-P-M-F-HN-L-5???. The various conserved features related to virus replication found in most paramyxoviruses were also found in ASPV. These include: conserved and complementary leader and trailer sequences, tri-nucleotide intergenic regions and highly conserved transcription start and stop signal sequences. The P gene expression strategy of ASPV was like that of the respiro-, morbilli- and henipaviruses, which express the P and C proteins from the primary transcript and edit a portion of the mRNA to encode V and W proteins. Sequence similarities among various features related to virus replication, pairwise comparisons of all deduced ASPV protein sequences with homologous regions from other members of the family Paramyxoviridae, and phylogenetic analyses of these amino acid sequences suggested that ASPV was a novel member of the sub-family Paramyxovirinae, most closely related to the respiroviruses. ?? 2008 Elsevier B.V. All rights reserved.

Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

PubMed

Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

2016-03-01

The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

A population study of the minicircles in Trypanosoma cruzi: predicting guide RNAs in the absence of empirical RNA editing.

PubMed

Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R

2007-05-24

The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.

Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, M.D.; Shoffner, J.M.; Wallace, D.C.

1996-01-22

The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients ormore » 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.« less

Nucleotide sequence of the beta-lactamase gene from Enterococcus faecalis HH22 and its similarity to staphylococcal beta-lactamase genes.

PubMed Central

Zscheck, K K; Murray, B E

1991-01-01

The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840

Molecular characterization and expression of the M6 gene of grass carp hemorrhage virus (GCHV), an aquareovirus.

PubMed

Qiu, T; Lu, R H; Zhang, J; Zhu, Z Y

2001-07-01

The complete nucleotide sequence of M6 gene of grass carp hemorrhage virus (GCHV) was determined. It is 2039 nucleotides in length and contains a single large open reading frame that could encode a protein of 648 amino acids with predicted molecular mass of 68.7 kDa. Amino acid sequence comparison revealed that the protein encoded by GCHV M6 is closely related to the protein mu1 of mammalian reovirus. The M6 gene, encoding the major outer-capsid protein, was expressed using the pET fusion protein vector in Escherichia coli and detected by Western blotting using chicken anti-GCHV immunoglobulin (IgY). The result indicates that the protein encoded by M6 may share a putative Asn-42-Pro-43 proteolytic cleavage site with mu1.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The Apis mellifera filamentous virus genome

USDA-ARS?s Scientific Manuscript database

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double strand DNA molecule of approximately 498’500 nucleotides with a GC content of 50.8%. It encompasses 251 non overlapping open reading frames (ORFs), e...

Molecular epidemiology of infectious laryngotracheitis: a review

USDA-ARS?s Scientific Manuscript database

Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity

PubMed Central

Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna

2013-01-01

Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005

Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands.

PubMed

Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L

2017-08-31

Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.

Structure, sequence and expression of the hepatitis delta (δ) viral genome

NASA Astrophysics Data System (ADS)

Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

1986-10-01

Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

Gene encoding a novel extracellular metalloprotease in Bacillus subtilis.

PubMed Central

Sloma, A; Rudolph, C F; Rufo, G A; Sullivan, B J; Theriault, K A; Ally, D; Pero, J

1990-01-01

The gene for a novel extracellular metalloprotease was cloned, and its nucleotide sequence was determined. The gene (mpr) encodes a primary product of 313 amino acids that has little similarity to other known Bacillus proteases. The amino acid sequence of the mature protease was preceded by a signal sequence of approximately 34 amino acids and a pro sequence of 58 amino acids. Four cysteine residues were found in the deduced amino acid sequence of the mature protein, indicating the possible presence of disulfide bonds. The mpr gene mapped in the cysA-aroI region of the chromosome and was not required for growth or sporulation. Images FIG. 2 FIG. 7 PMID:2105291

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed Central

Bergman, Casey M.; Haddrill, Penelope R.

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center. PMID:25717372

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed

Bergman, Casey M; Haddrill, Penelope R

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

PubMed Central

Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B

1986-01-01

A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

PubMed Central

Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

2005-01-01

Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sequencing RNA by a combination of exonuclease digestion and uridine specific chemical cleavage using MALDI-TOF.

PubMed Central

Tolson, D A; Nicholson, N H

1998-01-01

The determination of DNA sequences by partial exonuclease digestion followed by Matrix-Assisted Laser Desorption Time of Flight Mass Spectrometry (MALDI-TOF) is a well established method. When the same procedure is applied to RNA, difficulties arise due to the small (1 Da) mass difference between the nucleotides U and C, which makes unambiguous assignment difficult using a MALDI-TOF instrument. Here we report our experiences with sequence specific endonucleases and chemical methods followed by MALDI-TOF to resolve these sequence ambiguities. We have found chemical methods superior to endonucleases both in terms of correct specificity and extent of sequence coverage. This methodology can be used in combination with exonuclease digestion to rapidly assign RNA sequences. PMID:9421498

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Sequence comparison in the crossover region of an oncogenic avian retrovirus recombinant and its nononcogenic parent: Genetic regions that control growth rate and oncogenic potential

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsichlis, P.N.; Donehower, L.; Hager, G.

1982-11-01

NTRE is an avian retrovirus recombinant of the endogeneous nononcogenic Rous-associated virus-0 (RAV-0) and the oncogenic, exogeneous, transformation-defective (td) Prague strain of Rous sarcoma virus B (td-PrRSV-B). Oligonucleotide mapping had shown that the recombinant virus is indistinguishable from its RAV-0 parent except for the 3'-end sequences, which were derived from td-PrRSV-B. However, the virus exhibits properties which are typical of an exogenous virus: it grows to high titers in tissue culture, and it is oncogenic in vivo. To accurately define the genetic region responsible for these properties, the authors determined the nucleotide sequences of the recombinant and its RAV-0 parentmore » by using molecular clones of their DNA. These were compared with sequences already available for PrRSV-C, a virus closely related to the exogenous parent td-PrRSV-B. The results suggested that the crossover event which generated NTRE 7 took place in a region -501 to -401 nucleotides from the 3' end of the td-PrRSV parental genome and that sequences to the right of the recombination region were responsible for its growth properties and oncogenic potential. Since the exogenous-virus-specific sequences are expected to be missing from transformation-defective mutants of the Schmidt-Ruppin strain of RSV, which, like other exogeneous viruses, grow to high tiers in tissue culture and are oncogenic in vivo, the authors concluded that the growth properties and oncogenic potential of the exogeneous viruses are determined by sequences in the U3 region of the long terminal repeat. However, the authors propose that the exogeneous-virus-specific region may play a role in determining the oncogenic spectrum of a given oncogenic virus.« less

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Complete genomic sequence of an infectious pancreatic necrosis virus isolated from rainbow trout (Oncorhynchus mykiss) in China.

PubMed

Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming

2017-04-01

Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Vaccine-induced rabies in a red fox (Vulpes vulpes): isolation of vaccine virus in brain tissue and salivary glands.

PubMed

Hostnik, Peter; Picard-Meyer, Evelyne; Rihtarič, Danijela; Toplak, Ivan; Cliquet, Florence

2014-04-01

Oral vaccination campaigns to eliminate fox rabies were initiated in Slovenia in 1995. In May 2012, a young fox (Vulpes vulpes) with typical rabies signs was captured. Its brain and salivary gland tissues were found to contain vaccine strain SAD B19. The Basic Logical Alignment Search Tool alignment of 589 nucleotides determined from the N gene of the virus isolated from the brain and salivary glands of the affected fox was 100% identical to the GenBank reference SAD B19 strain. Sequence analysis of the N and M genes (4,351 nucleotides) showed two nucleotide modifications at position 1335 (N gene) and 3114 (M gene) in the KC522613 isolate identified in the fox compared to SAD B19.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

PubMed Central

Cozens, A L; Walker, J E

1986-01-01

The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Mitochondrial D-loop sequence of domesticated waterfowl in Central Java: goose and muscovy duck

NASA Astrophysics Data System (ADS)

Susanti, R.; Iswari, R. S.

2018-03-01

This study aims to determine the genetic characterization of domesticated waterfowl (goose and Muscovy duck) in Central Java based on a D-loop mtDNA gene. The D-loop gene was amplified using PCR technique by specific primer and sequenced using dideoxy termination method. Multiple alignments of D-loop gene obtained were 710 nucleotides at position 74 to 783 at the 5’ end (for goose) and 712 nucleotides at position 48 to 759 at the 5’ end (for Muscovy duck). The results of the polymorphism analysis on D-loop sequences of muscovy duck produced 3 haplotypes. In the D-loop gene of goose does not show polymorphism, with substitution at G117A. Phylogenetic trees reconstructions of goose and Muscovy duck, which was collected during this research compared with another species from Anser, Chairina and Anas was generated 2 forms of clusters. The first group consists of all kind of Muscovy duck together with Chairina moschata and Anas, while the second group consists of all geese and Anser cygnoides the other. The determination of Muscovy duck and geese identity can be distinguished from the genetic marker information. Based on the phylogenetic analysis, it can be concluded that the Muscovy duck is closely related to Chairina moschata, while geese is closely related to Anser cygnoides.

Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

PubMed Central

Alishiri, Athar; Rakhshandehroo, Farshad; Zamanizadeh, Hamid-Reza; Palukaitis, Peter

2013-01-01

The incidence and distribution of Tobacco mosaic virus (TMV) and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP) gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100%) among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population. PMID:25288953

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Nucleotide sequence of the Varkud mitochondrial plasmid of Neurospora and synthesis of a hybrid transcript with a 5' leader derived from mitochondrial RNA.

PubMed

Akins, R A; Grant, D M; Stohl, L L; Bottorff, D A; Nargang, F E; Lambowitz, A M

1988-11-05

The Mauriceville and Varkud mitochondrial plasmids of Neurospora are closely related, closed circular DNAs (3.6 and 3.7 kb, respectively; 1 kb = 10(3) bases or base-pairs), whose characteristics suggest relationships to mitochondrial DNA introns and retrotransposons. Here, we characterized the structure of the Varkud plasmid, determined its complete nucleotide sequence and mapped its major transcripts. The Mauriceville and Varkud plasmids have more than 97% positional identity. Both plasmids contain a 710 amino acid open reading frame that encodes a reverse transcriptase-like protein. The amino acid sequence of this open reading frame is strongly conserved between the two plasmids (701/710 amino acids) as expected for a functionally important protein. Both plasmids have a 0.4 kb region that contains five PstI palindromes and a direct repeat of approximately 160 base-pairs. Comparison of sequences in this region suggests that the Varkud plasmid has diverged less from a common ancestor than has the Mauriceville plasmid. Two major transcripts of the Varkud plasmid were detected by Northern hybridization experiments: a full-length linear RNA of 3.7 kb and an additional prominent transcript of 4.9 kb, 1.2 kb longer than monomer plasmid. Remarkably, we find that the 4.9 kb transcript is a hybrid RNA consisting of the full-length 3.7 kb Varkud plasmid transcript plus a 5' leader of 1.2 kb that is derived from the 5' end of the mitochondrial small rRNA. This and other findings suggest that the Varkud plasmid, like certain RNA viruses, has a mechanism for joining heterologous RNAs to the 5' end of its major transcript, and that, under some circumstances, nucleotide sequences in mitochondria may be recombined at the RNA level.

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

PubMed

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

2018-01-09

Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of LDH as a therapeutic drug target.

Finding specific RNA motifs: Function in a zeptomole world?

PubMed Central

KNIGHT, ROB; YARUS, MICHAEL

2003-01-01

We have developed a new method for estimating the abundance of any modular (piecewise) RNA motif within a longer random region. We have used this method to estimate the size of the active motifs available to modern SELEX experiments (picomoles of unique sequences) and to a plausible RNA World (zeptomoles of unique sequences: 1 zmole = 602 sequences). Unexpectedly, activities such as specific isoleucine binding are almost certainly present in zeptomoles of molecules, and even ribozymes such as self-cleavage motifs may appear (depending on assumptions about the minimal structures). The number of specified nucleotides is not the only important determinant of a motif’s rarity: The number of modules into which it is divided, and the details of this division, are also crucial. We propose three maxims for easily isolated motifs: the Maxim of Minimization, the Maxim of Multiplicity, and the Maxim of the Median. These maxims together state that selected motifs should be small and composed of as many separate, equally sized modules as possible. For evenly divided motifs with four modules, the largest accessible activity in picomole scale (1–1000 pmole) pools of length 100 is about 34 nucleotides; while for zeptomole scale (1–1000 zmole) pools it is about 20 specific nucleotides (50% probability of occurrence). This latter figure includes some ribozymes and aptamers. Consequently, an RNA metabolism apparently could have begun with only zeptomoles of RNA molecules. PMID:12554865

Seroprevalence of porcine circovirus type 2 in swine populations in Canada and Costa Rica

PubMed Central

Liu, Qiang; Wang, Li; Willson, Philip; O'Connor, Brendan; Keenliside, Julia; Chirino-Trejo, Manuel; Meléndez, Ronald; Babiuk, Lorne

2002-01-01

Porcine circovirus (PCV) was recently divided into 2 antigenically distinct types that differ (65% amino acid identity) in the protein encoded by open reading frame 2 (ORF2). Porcine circovirus 1 is apparently non-pathogenic and, in contrast, PCV2 is associated with porcine multisystemic wasting syndrome (PMWS). Our objective was to determine the extent of exposure of normal pigs in Canada and Costa Rica to PCV2. Recombinant DNA techniques were used to produce an antigen from ORF2 of PCV2 that was suitable for the detection of antibody in swine sera. The presence of PCV2 nucleotide sequences was detected using polymerase chain reaction (PCR) techniques. Using these tests, specific antibody and nucleotide sequences were demonstrated in sera from a cohort of pigs during a PMWS outbreak. Antibody was detected in normal, healthy hogs slaughtered in Canada (82.4% of 386) and in Costa Rica (14.6% of 322). This is the first report indicating the presence of PCV2 in Latin America. More than 50% of these sera also contained PCV2 nucleotide sequence. Although these hogs were healthy when slaughtered, they were infected with PCV2 and may have previously been ill. The widespread occurrence of PCV2 in swine suggests that this virus is adapted to replication in porcine tissue. PMID:12418777

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Molecular characterization of the complete genome of falconid herpesvirus strain S-18

USDA-ARS?s Scientific Manuscript database

Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...

Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

PubMed

Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

2015-04-01

The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Length requirements for tRNA-specific enzymes and cleavage specificity at the 3' end of turnip yellow mosaic virus RNA.

PubMed Central

Joshi, S; Chapeville, F; Haenni, A L

1982-01-01

This paper describes the minimum length of the turnip yellow mosaic virus (TYMV) RNA necessary to fulfill the tRNA-like properties of the viral RNA: 50 to 75 nucleotides and 86 nucleotides from the 3' end of TYMV RNA are sufficient for adenylation and valylation respectively by the Escherichia coli system. The size of the tRNA-like fragments obtained in vitro in the presence of an E. coli, a reticulocyte or a chinese cabbage leaf extract has also been determined. Among the major fragments liberated from the 3' end of TYMV RNA by the three systems are fragments of 117 and 112 nucleotides. In addition, the E. coli extract liberates fragments of 139 and 61 nucleotides, and the reticulocyte lysate fragments of 109, 94, 84, 73 and 46 nucleotides. The cleavage of the viral RNA by several systems in vitro to yield RNA fragments encompassing the tRNA-like sequence suggests that such fragments might also be liberated in vivo. Images PMID:6176943

Determination of ABO genotypes with DNA extracted from formalin-fixed, paraffin-embedded tissues.

PubMed

Yamada, M; Yamamoto, Y; Tanegashima, A; Kane, M; Ikehara, Y; Fukunaga, T; Nishi, K

1994-01-01

The gene encoding the specific glycosyltransferases which catalyze the conversion of the H antigen to A or B antigens shows a slight but distinct variation in its allelic nucleotide sequence and can be divided into 6 genotypes when digested with specific restriction enzymes. We extracted DNA from formalin-fixed, paraffin-embedded tissues using SDS/proteinase K treatment followed by phenol/chloroform extraction. The sequence of nucleotides for the A, B and O genes was amplified by the polymerase chain reaction (PCR). DNA fragments of 128 bp and 200 bp could be amplified in the second round of PCR, using an aliquot of the first round PCR product as template. Degraded DNA from paraffin blocks stored for up to 10.7 years could be successfully typed. The ABO genotype was deduced from the digestion patterns with an appropriate combination of restriction enzymes and was compatible with the phenotype obtained from the blood sample.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Genetic variability in E6, E7 and L1 genes of Human Papillomavirus 62 and its prevalence in Mexico.

PubMed

Artaza-Irigaray, Cristina; Flores-Miramontes, María Guadalupe; Olszewski, Dominik; Magaña-Torres, María Teresa; López-Cardona, María Guadalupe; Leal-Herrera, Yelda Aurora; Piña-Sánchez, Patricia; Jave-Suárez, Luis Felipe; Aguilar-Lemarroy, Adriana

2017-01-01

Human papillomavirus (HPV) is the main etiological agent of cervical cancer, the third most common cancer among women globally and the second most frequent in Mexico. Persistent infection with high-risk HPV genotypes is associated with premalignant lesions and cervical cancer development. HPVs considered as low risk or not yet classified, are often found in coinfection with different HPV genotypes. Indeed, HPV62 is one of the most prevalent HPV detected in some countries, but there is limited information about its prevalence in other regions and there are no HPV62 variants currently described. The aim of this study was to determine the prevalence of HPV62 in cervical samples from Mexican women and to identify mutations in the L1, E6 and E7 genes, which have never been reported in our population. HPV screening was performed by Cobas HPV Test in women who attended prevention health programs and dysplasia clinics. All HPV positive samples ( n  = 491) and 87 additional cervical cancer samples were then genotyped with Linear Array HPV Genotyping test. Some samples were selected to corroborate genotyping by Next-Generation sequencing. On the other hand, nucleotide changes in L1, E6 and E7 genes were determined using PCR, Sanger sequencing and analysis with the CLC-MainWorkbench 7.6.1 software. L1 protein structure was predicted with the I-TASSER server. Using Linear Array, HPV62 prevalence was 7.6% in general population, 8% in Cervical Intraepithelial Neoplasia grade 1 (CIN1) samples and 4.6% in cervical samples. The presence of HPV62 was confirmed with Next-Generation sequencing. Regarding L1 gene, novel sequence variations were detected, but they did not alter the tertiary structure of the protein. Moreover, several nucleotide substitutions were found in E6 and E7 genes compared to reference HPV62 genomic sequence. Specifically, three non-synonymous sequence variations were detected, two in E6 and one in E7. HPV62 is a frequent HPV genotype found mainly in general population and in women with CIN1, and in 90.5% of the cases it was found in coinfection with other HPVs. Novel nucleotide changes in its L1, E6 and E7 genes were detected, some of them lead to changes in the protein sequence.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Analysis of the primary structure of the long terminal repeat and the gag and pol genes of the human spumaretrovirus.

PubMed Central

Maurer, B; Bannert, H; Darai, G; Flügel, R M

1988-01-01

The nucleotide sequence of the human spumaretrovirus (HSRV) genome was determined. The 5' long terminal repeat region was analyzed by strong stop cDNA synthesis and S1 nuclease mapping. The length of the RU5 region was determined and found to be 346 nucleotides long. The 5' long terminal repeat is 1,123 base pairs long and is bound by an 18-base-pair primer-binding site complementary to the 3' end of mammalian lysine-1,2-specific tRNA. Open reading frames for gag and pol genes were identified. Surprisingly, the HSRV gag protein does not contain the cysteine motif of the nucleic acid-binding proteins found in and typical of all other retroviral gag proteins; instead the HSRV gag gene encodes a strongly basic protein reminiscent of those of hepatitis B virus and retrotransposons. The carboxy-terminal part of the HSRV gag gene products encodes a protease domain. The pol gene overlaps the gag gene and is postulated to be synthesized as a gag/pol precursor via translational frameshifting analogous to that of Rous sarcoma virus, with 7 nucleotides immediately upstream of the termination codons of gag conserved between the two viral genomes. The HSRV pol gene is 2,730 nucleotides long, and its deduced protein sequence is readily subdivided into three well-conserved domains, the reverse transcriptase, the RNase H, and the integrase. Although the degree of homology of the HSRV reverse transcriptase domain is highest to that of murine leukemia virus, the HSRV genomic organization is more similar to that of human and simian immunodeficiency viruses. The data justify classifying the spumaretroviruses as a third subfamily of Retroviridae. Images PMID:2451755

[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

PubMed Central

2007-01-01

Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

Genotype analysis, using PCR with type-specific primers, of hepatitis B virus isolates from patients coinfected with hepatitis delta virus genotype II from Miyako Island, Japan.

PubMed

Moriyama, Moriyama; Taira, Masaaki; Matsumura, Hiroshi; Aoki, Hiroshi; Mikuni, Morio; Kaneko, Miki; Shioda, Atsuo; Iwaguchi, Kayo; Arai, Shinobu; Ichijima, Sagiri; Iwasaki, Hiroko; Tanaka, Naohide; Abe, Kenji; Arakawa, Yasuyuki

2003-01-01

The aims of this study were to determine the hepatitis B virus (HBV) genotypes in hepatitis delta virus (HDV) RNA-positive patients and to characterize the HBV nucleotide sequences that may be found on a distant island of Japan. This study included three patients with chronic hepatitis who were positive for hepatitis B surface antigen (enzyme-linked immunosorbent assay; ELISA), HDV antibody (ELISA) and HDV RNA by polymerase chain reaction (PCR). The HBV genotype was determined by nested PCR using type-specific primers. The first-round PCR products from two patients were sequenced, followed by an investigation of nucleotide homology. Viruses from all three patients in this study were classified as HBV genotype B. Comparison with HBV isolates from geographically neighboring regions revealed that the two HBV isolates had 97.9-98.6% identity at the nucleotide level to a Chinese isolate, 98.3-98.6% identity to the Okinawa isolate and 98.6-98.8% identity to a Japanese isolate of genotype B. On phylogenetic analysis, the HBV isolates from the two patients were classified as HBV genotype B. The HBV isolates of cases 1 and 3 clustered in the same group as isolates from the Chinese mainland and Japanese mainland, which are geographically near Miyako Island. The HBV isolates coinfected with HDV found on Miyako Island were of genotype B. The PCR method based on genotype-specific primers was useful in determining HBV genotypes. Copyright 2003 S. Karger AG, Basel

Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

PubMed

Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

2016-04-01

The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

Noninvasive Prenatal Paternity Testing (NIPAT) through Maternal Plasma DNA Sequencing: A Pilot Study.

PubMed

Jiang, Haojun; Xie, Yifan; Li, Xuchao; Ge, Huijuan; Deng, Yongqiang; Mu, Haofang; Feng, Xiaoli; Yin, Lu; Du, Zhou; Chen, Fang; He, Nongyue

2016-01-01

Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels in order to verify the performance in clinical cases. Combining targeted deep sequencing of selective SNP and informative bioinformatics pipeline, we calculated the combined paternity index (CPI) of 17 cases to determine paternity. Sequencing-based NIPAT results fully agreed with invasive prenatal paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Trans splicing in Leishmania enriettii and identification of ribonucleoprotein complexes containing the spliced leader and U2 equivalent RNAs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, S.I.; Wirth, D.F.

1988-06-01

The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. The authors' previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus atmore » the splice junction of the SL and the SLIS. The authors examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominately in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. They also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, they determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.« less

Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

USGS Publications Warehouse

Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

1996-01-01

Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

PubMed

Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

2016-01-01

Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

PubMed Central

Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

2012-01-01

The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khani, S.C.; Lin, D.; Magovcevic, I.

1994-09-01

Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

PubMed

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

PubMed

Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

2012-04-01

Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

A ruler protein in a complex for antiviral defense determines the length of small interfering CRISPR RNAs.

PubMed

Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A

2013-09-27

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

PubMed

Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

2012-11-20

Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.

Extracellular proteins of Vibrio cholerae: molecular cloning, nucleotide sequence and characterization of the deoxyribonuclease (DNase) together with its periplasmic localization in Escherichia coli K-12.

PubMed

Focareta, T; Manning, P A

1987-01-01

The gene encoding the extracellular DNase of Vibrio cholerae was cloned into Escherichia coli K-12. A maximal coding region of 1.2 kb and a minimal region of 0.6 kb were determined by transposon mutagenesis and deletion analysis. The nucleotide sequence of this region contained a single open reading frame of 690 bp corresponding to a protein of Mr 26,389 with a typical N-terminal signal sequence of 18 aa which, when removed, would give a mature protein of Mr 24,163. This is in good agreement with the size of 24 kDa, calculated directly by Coomassie blue staining following sodium dodecyl sulphate-polyacrylamide gel electrophoresis and indirectly via a DNA-hydrolysis assay. The protein is located in the periplasmic space of E. coli K-12 unlike in V. cholerae where it is excreted into the extracellular medium. The introduction of the DNase gene into a periplasmic (tolA) leaky mutant of E. coli K-12 facilitates the release of the protein, further confirming the periplasmic location.

Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)

PubMed Central

Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.

1996-01-01

The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146

Genetic diversity and epidemiology of infectious hematopoietic necrosis virus in Alaska

USGS Publications Warehouse

Emmenegger, E.G; Meyers, T.R.; Burton, T.O.; Kurath, G.

2000-01-01

Forty-two infectious hematopoietic necrosis virus (IHNV) isolates from Alaska were analyzed using the ribonuclease protection assay (RPA) and nucleotide sequencing. RPA analyses, utilizing 4 probes, N5, N3 (N gene), GF (G gene), and NV (NV gene), determined that the haplotypes of all 3 genes demonstrated a consistent spatial pattern. Virus isolates belonging to the most common haplotype groups were distributed throughout Alaska, whereas isolates in small haplotype groups were obtained from only 1 site (hatchery, lake, etc.). The temporal pattern of the GF haplotypes suggested a 'genetic acclimation' of the G gene, possibly due to positive selection on the glycoprotein. A pairwise comparison of the sequence data determined that the maximum nucleotide diversity of the isolates was 2.75% (10 mismatches) for the NV gene, and 1.99% (6 mismatches) for a 301 base pair region of the G gene, indicating that the genetic diversity of IHNV within Alaska is notably lower than in the more southern portions of the IHNV North American range. Phylogenetic analysis of representative Alaskan sequences and sequences of 12 previously characterized IHNV strains from Washington, Oregon, Idaho, California (USA) and British Columbia (Canada) distinguished the isolates into clusters that correlated with geographic origin and indicated that the Alaskan and British Columbia isolates may have a common viral ancestral lineage. Comparisons of multiple isolates from the same site provided epidemiological insights into viral transmission patterns and indicated that viral evolution, viral introduction, and genetic stasis were the mechanisms involved with IHN virus population dynamics in Alaska. The examples of genetic stasis and the overall low sequence heterogeneity of the Alaskan isolates suggested that they are evolutionarily constrained. This study establishes a baseline of genetic fingerprint patterns and sequence groups representing the genetic diversity of Alaskan IHNV isolates. This information could be used to determine the source of an IHN outbreak and to facilitate decisions in fisheries management of Alaskan salmonid stocks.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Recombinatorial biases and convergent recombination determine interindividual TCRβ sharing in murine thymocytes.

PubMed

Li, Hanjie; Ye, Congting; Ji, Guoli; Wu, Xiaohui; Xiang, Zhe; Li, Yuanyue; Cao, Yonghao; Liu, Xiaolong; Douek, Daniel C; Price, David A; Han, Jiahuai

2012-09-01

Overlap of TCR repertoires among individuals provides the molecular basis for public T cell responses. By deep-sequencing the TCRβ repertoires of CD4+CD8+ thymocytes from three individual mice, we observed that a substantial degree of TCRβ overlap, comprising ∼10-15% of all unique amino acid sequences and ∼5-10% of all unique nucleotide sequences across any two individuals, is already present at this early stage of T cell development. The majority of TCRβ sharing between individual thymocyte repertoires could be attributed to the process of convergent recombination, with additional contributions likely arising from recombinatorial biases; the role of selection during intrathymic development was negligible. These results indicate that the process of TCR gene recombination is the major determinant of clonotype sharing between individuals.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Nucleotide sequences of the tet(M) genes from the American and Dutch type tetracycline resistance plasmids of Neisseria gonorrhoeae.

PubMed

Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M

1993-11-01

High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.

The complete mitochondrial genome of Rapana venosa (Gastropoda, Muricidae).

PubMed

Sun, Xiujun; Yang, Aiguo

2016-01-01

The complete mitochondrial (mt) genome of the veined rapa whelk, Rapana venosa, was determined using genome walking techniques in this study. The total length of the mt genome sequence of R. venosa was 15,271 bp, which is comparable to the reported Muricidae mitogenomes to date. It contained 13 protein-coding genes, 21 transfer RNA genes, and two ribosomal RNA genes. A bias towards a higher representation of nucleotides A and T (69%) was detected in the mt genome of R. venosa. A small number of non-coding nucleotides (302 bp) was detected, and the largest non-coding region was 74 bp in length.

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Connecting Common Genetic Polymorphisms to Protein Function: A Modular Project Sequence for Lecture or Lab

ERIC Educational Resources Information Center

Berndsen, Christopher E.; Young, Byron H.; McCormick, Quinlin J.; Enke, Raymond A.

2016-01-01

Single nucleotide polymorphisms (SNPs) in DNA can result in phenotypes where the biochemical basis may not be clear due to the lack of protein structures. With the growing number of modeling and simulation software available on the internet, students can now participate in determining how small changes in genetic information impact cellular…

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Improved purification, crystallization and primary structure of pyruvate:ferredoxin oxidoreductase from Halobacterium halobium.

PubMed

Plaga, W; Lottspeich, F; Oesterhelt, D

1992-04-01

An improved purification procedure, including nickel chelate affinity chromatography, is reported which resulted in a crystallizable pyruvate:ferredoxin oxidoreductase preparation from Halobacterium halobium. Crystals of the enzyme were obtained using potassium citrate as the precipitant. The genes coding for pyruvate:ferredoxin oxidoreductase were cloned and their nucleotide sequences determined. The genes of both subunits were adjacent to one another on the halobacterial genome. The derived amino acid sequences were confirmed by partial primary structure analysis of the purified protein. The structural motif of thiamin-diphosphate-binding enzymes was unequivocally located in the deduced amino acid sequence of the small subunit.

Toscana Virus Genome Stability: Data from a Meningoencephalitis Case in Mantua, Italy

PubMed Central

Baggieri, Melissa; Gattuso, Gianni; Fortuna, Claudia; Remoli, Maria Elena; Vaccari, Gabriele; Zaccaria, Guendalina; Marchi, Antonella; Bucci, Paola; Benedetti, Eleonora; Fiorentini, Cristiano; Nicoletti, Loredana

2014-01-01

Abstract In July of 2013, samples from a patient with a neurological syndrome were collected from Mantua hospital and sent to the National Reference Laboratory for Arboviruses (National Institute of Health, Rome). On the basis of the symptoms, serological and molecular assays were performed to diagnose either West Nile virus (WNV) or Toscana virus (TOSV) infection. Molecular and serological tests confirmed TOSV infection. Virus isolation was obtained from cerebrospinal fluid. A full genome sequence was determined from this TOSV strain with next-generation sequencing using Ion Torrent technology. Nucleotide and amino acidic sequences grouped phylogenetically with lineage TOSV A and showed a low genome variability. PMID:25514123

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

PubMed

Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

2004-06-01

Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Evolutionary conservation analysis increases the colocalization of predicted exonic splicing enhancers in the BRCA1 gene with missense sequence changes and in-frame deletions, but not polymorphisms

PubMed Central

Pettigrew, Christopher; Wayte, Nicola; Lovelock, Paul K; Tavtigian, Sean V; Chenevix-Trench, Georgia; Spurdle, Amanda B; Brown, Melissa A

2005-01-01

Introduction Aberrant pre-mRNA splicing can be more detrimental to the function of a gene than changes in the length or nature of the encoded amino acid sequence. Although predicting the effects of changes in consensus 5' and 3' splice sites near intron:exon boundaries is relatively straightforward, predicting the possible effects of changes in exonic splicing enhancers (ESEs) remains a challenge. Methods As an initial step toward determining which ESEs predicted by the web-based tool ESEfinder in the breast cancer susceptibility gene BRCA1 are likely to be functional, we have determined their evolutionary conservation and compared their location with known BRCA1 sequence variants. Results Using the default settings of ESEfinder, we initially detected 669 potential ESEs in the coding region of the BRCA1 gene. Increasing the threshold score reduced the total number to 464, while taking into consideration the proximity to splice donor and acceptor sites reduced the number to 211. Approximately 11% of these ESEs (23/211) either are identical at the nucleotide level in human, primates, mouse, cow, dog and opossum Brca1 (conserved) or are detectable by ESEfinder in the same position in the Brca1 sequence (shared). The frequency of conserved and shared predicted ESEs between human and mouse is higher in BRCA1 exons (2.8 per 100 nucleotides) than in introns (0.6 per 100 nucleotides). Of conserved or shared putative ESEs, 61% (14/23) were predicted to be affected by sequence variants reported in the Breast Cancer Information Core database. Applying the filters described above increased the colocalization of predicted ESEs with missense changes, in-frame deletions and unclassified variants predicted to be deleterious to protein function, whereas they decreased the colocalization with known polymorphisms or unclassified variants predicted to be neutral. Conclusion In this report we show that evolutionary conservation analysis may be used to improve the specificity of an ESE prediction tool. This is the first report on the prediction of the frequency and distribution of ESEs in the BRCA1 gene, and it is the first reported attempt to predict which ESEs are most likely to be functional and therefore which sequence variants in ESEs are most likely to be pathogenic. PMID:16280041

Characterization of Austrian koi herpesvirus samples based on the ORF40 region.

PubMed

Marek, A; Schachner, O; Bilic, I; Hess, M

2010-02-17

Using a PCR that amplifies a region of the thymidine kinase (TK) gene, an epidemic spread of koi herpesvirus (KHV) was determined in koi carps in Austria in 2007. A total of 15 virus samples from different locations in Austria were analyzed to determine their genetic relatedness following PCR and nucleic acid sequencing of the open reading frame 40 (ORF40) region of the KHV genome. ORF40-specific PCR amplification products that were obtained from tissue samples shared 100% nucleotide sequence identity with the published sequence of the Japanese strain of KHV. The ORF40 sequence of one isolate from the UK that was included in the present study was 100% identical with the published sequence of an Israeli strain of KHV. This is the first study that used a larger number of samples and a PCR method, which allowed distinguishing all 3 strains of KHV. The present investigation provides information on the epidemiology of KHV infections in Europe and describes a useful molecular tool for epidemiological studies.

Nanopores and nucleic acids: prospects for ultrarapid sequencing

NASA Technical Reports Server (NTRS)

Deamer, D. W.; Akeson, M.

2000-01-01

DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

Human renin 5'-flanking DNA to nucleotide-2750.

PubMed

Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

1995-01-01

Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Distinctive acceptor-end structure and other determinants of Escherichia coli tRNAPro identity.

PubMed Central

McClain, W H; Schneider, J; Gabriel, K

1994-01-01

The previously uncharacterized determinants of the specificity of tRNAPro for aminoacylation (tRNAPro identity) were defined by a computer comparison of all Escherichia coli tRNA sequences and tested by a functional analysis of amber suppressor tRNAs in vivo. We determined the amino acid specificity of tRNA by sequencing a suppressed protein and the aminoacylation efficiency of tRNA by examining the steady-state level of aminoacyl-tRNA. On substituting nucleotides derived from the acceptor end and variable pocket of tRNAPro for the corresponding nucleotides in a tRNAPhe gene, the identity of the resulting tRNA changed substantially but incompletely to that of tRNAPro. The redesigned tRNAPhe was weakly active and aminoacyl-tRNA was not detected. Ethyl methanesulfonate mutagenesis of the redesigned tRNAPhe gene produced a mutant with a wobble pair in place of a base pair in the end of the acceptor-stem helix of the transcribed tRNA. This mutant exhibited both a tRNAPro identity and substantial aminoacyl-tRNA. The results speak for the importance of a distinctive conformation in the acceptor-stem helix of tRNAPro for aminoacylation by the prolyl-tRNA synthetase. The anticodon also contributes to tRNAPro identity but is not necessary in vivo. Images PMID:8127693

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

Methods for decoding Cas9 protospacer adjacent motif (PAM) sequences: A brief overview.

PubMed

Karvelis, Tautvydas; Gasiunas, Giedrius; Siksnys, Virginijus

2017-05-15

Recently the Cas9, an RNA guided DNA endonuclease, emerged as a powerful tool for targeted genome manipulations. Cas9 protein can be reprogrammed to cleave, bind or nick any DNA target by simply changing crRNA sequence, however a short nucleotide sequence, termed PAM, is required to initiate crRNA hybridization to the DNA target. PAM sequence is recognized by Cas9 protein and must be determined experimentally for each Cas9 variant. Exploration of Cas9 orthologs could offer a diversity of PAM sequences and novel biochemical properties that may be beneficial for genome editing applications. Here we briefly review and compare Cas9 PAM identification assays that can be adopted for other PAM-dependent CRISPR-Cas systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.

PubMed

Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette

2002-01-01

Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.

Co-circulation of a novel phlebovirus and Massilia virus in sandflies, Portugal.

PubMed

Amaro, Fátima; Zé-Zé, Líbia; Alves, Maria J; Börstler, Jessica; Clos, Joachim; Lorenzen, Stephan; Becker, Stefanie Christine; Schmidt-Chanasit, Jonas; Cadar, Daniel

2015-10-24

In Portugal, entomological surveys to detect phleboviruses in their natural vectors have not been performed so far. Thus, the aims of the present study were to detect, isolate and characterize phleboviruses in sandfly populations of Portugal. From May to October 2007-2008, 896 female sandflies were trapped in Arrábida region, located on the southwest coast of Portugal. Phlebovirus RNA was detected by using a pan-phlebovirus RT-PCR in 4 out of 34 Phlebotomus perniciosus pools. Direct sequencing of the amplicons showed that 2 samples exhibited 72 % nucleotide identity with Arbia virus, and two showed 96 % nucleotide identity with Massilia virus. The Arbia-like virus (named Alcube virus) was isolated in cell culture and complete genomic sequences of one Alcube and two Massila viruses were determined using next-generation sequencing technology. Phylogenetic analysis demonstrated that Alcube virus clustered with members of the Salehabad virus species complex. Within this clade, Alcube virus forms a monophyletic lineage with the Arbia, Salehabad and Adana viruses sharing a common ancestor. Arbia virus has been identified as the most closely related virus with 20-28 % nucleotide and 10-27 % amino acid divergences depending on the analysed segment. We have provided genetic evidence for the circulation of a novel phlebovirus species named Alcube virus in Ph. perniciosus and co-circulation of Massilia virus, in Arrábida region, southwest of Portugal. Further epidemiological investigations and surveillance for sandfly-borne phleboviruses in Portugal are needed to elucidate their medical importance.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

PubMed Central

2017-01-01

Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events. PMID:29181193

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Characterization of the complete genome segments from BmCPV-SZ, a novel Bombyx mori cypovirus 1 isolate.

PubMed

Cao, Guangli; Meng, Xiangkun; Xue, Renyu; Zhu, Yuexiong; Zhang, Xiaorong; Pan, Zhonghua; Zheng, Xiaojian; Gong, Chengliang

2012-07-01

A novel Bombyx mori cypovirus 1 isolated from infected silkworm larvae and tentatively assigned as Bombyx mori cypovirus 1 isolate Suzhou (BmCPV-SZ). The complete nucleotide sequences of genomic segments S1-S10 from BmCPV-SZ were determined. All segments possessed a single open reading frame; however, bioinformatic evidence suggested a short overlapping coding sequence in S1. Each BmCPV-SZ segment possessed the conserved terminal sequences AGUAA and GUUAGCC at the 5' and 3' ends, respectively. The conserved A/G at the -3 position in relation to the AUG codon could be found in the BmCPV-SZ genome, and it was postulated that this conserved A/G may be the most important nucleotide for efficient translation initiation in cypoviruses (CPVs). Examination of the putative amino acid sequences encoded by BmCPV-SZ revealed some characteristic motifs. Homology searches showed that viral structural proteins VP1, VP3, and VP4 had localized homologies with proteins of Rice ragged stunt virus , a member of the genus Oryzavirus within the family Reoviridae. A phylogenetic tree based on RNA-dependent RNA polymerase sequences demonstrated that CPV is more closely related to Rice ragged stunt virus and Aedes pseudoscutellaris reovirus than to other members of Reoviridae, suggesting that they may have originated from common ancestors.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Infectious hematopoietic necrosis virus: monophyletic origin of European isolates from North American genogroup M.

PubMed

Enzmann, P J; Kurath, G; Fichtner, D; Bergmann, S M

2005-09-23

Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe.

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

PubMed Central

Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

2004-01-01

Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

PubMed Central

Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J

1996-01-01

In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

PubMed

Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

2014-10-24

Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

The Nucleotide Sequence and Spliced pol mRNA Levels of the Nonprimate Spumavirus Bovine Foamy Virus

PubMed Central

Holzschu, Donald L.; Delaney, Mari A.; Renshaw, Randall W.; Casey, James W.

1998-01-01

We have determined the complete nucleotide sequence of a replication-competent clone of bovine foamy virus (BFV) and have quantitated the amount of splice pol mRNA processed early in infection. The 544-amino-acid Gag protein precursor has little sequence similarity with its primate foamy virus homologs, but the putative nucleocapsid (NC) protein, like the primate NCs, contains the three glycine-arginine-rich regions that are postulated to bind genomic RNA during virion assembly. The BFV gag and pol open reading frames overlap, with pro and pol in the same translational frame. As with the human foamy virus (HFV) and feline foamy virus, we have detected a spliced pol mRNA by PCR. Quantitatively, this mRNA approximates the level of full-length genomic RNA early in infection. The integrase (IN) domain of reverse transcriptase does not contain the canonical HH-CC zinc finger motif present in all characterized retroviral INs, but it does contain a nearby histidine residue that could conceivably participate as a member of the zinc finger. The env gene encodes a protein that is over 40% identical in sequence to the HFV Env. By comparison, the Gag precursor of BFV is predicted to be only 28% identical to the HFV protein. PMID:9499074

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

PubMed Central

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

PubMed

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

Distinct retroelement classes define evolutionary breakpoints demarcating sites of evolutionary novelty

PubMed Central

Longo, Mark S; Carone, Dawn M; Green, Eric D; O'Neill, Michael J; O'Neill, Rachel J

2009-01-01

Background Large-scale genome rearrangements brought about by chromosome breaks underlie numerous inherited diseases, initiate or promote many cancers and are also associated with karyotype diversification during species evolution. Recent research has shown that these breakpoints are nonrandomly distributed throughout the mammalian genome and many, termed "evolutionary breakpoints" (EB), are specific genomic locations that are "reused" during karyotypic evolution. When the phylogenetic trajectory of orthologous chromosome segments is considered, many of these EB are coincident with ancient centromere activity as well as new centromere formation. While EB have been characterized as repeat-rich regions, it has not been determined whether specific sequences have been retained during evolution that would indicate previous centromere activity or a propensity for new centromere formation. Likewise, the conservation of specific sequence motifs or classes at EBs among divergent mammalian taxa has not been determined. Results To define conserved sequence features of EBs associated with centromere evolution, we performed comparative sequence analysis of more than 4.8 Mb within the tammar wallaby, Macropus eugenii, derived from centromeric regions (CEN), euchromatic regions (EU), and an evolutionary breakpoint (EB) that has undergone convergent breakpoint reuse and past centromere activity in marsupials. We found a dramatic enrichment for long interspersed nucleotide elements (LINE1s) and endogenous retroviruses (ERVs) and a depletion of short interspersed nucleotide elements (SINEs) shared between CEN and EBs. We analyzed the orthologous human EB (14q32.33), known to be associated with translocations in many cancers including multiple myelomas and plasma cell leukemias, and found a conserved distribution of similar repetitive elements. Conclusion Our data indicate that EBs tracked within the class Mammalia harbor sequence features retained since the divergence of marsupials and eutherians that may have predisposed these genomic regions to large-scale chromosomal instability. PMID:19630942

Mitochondrial DNA variant at HVI region as a candidate of genetic markers of type 2 diabetes

NASA Astrophysics Data System (ADS)

Gumilar, Gun Gun; Purnamasari, Yunita; Setiadi, Rahmat

2016-02-01

Mitochondrial DNA (mtDNA) is maternally inherited. mtDNA mutations which can contribute to the excess of maternal inheritance of type 2 diabetes. Due to the high mutation rate, one of the areas in the mtDNA that is often associated with the disease is the hypervariable region I (HVI). Therefore, this study was conducted to determine the genetic variants of human mtDNA HVI that related to the type 2 diabetes in four samples that were taken from four generations in one lineage. Steps being taken include the lyses of hair follicles, amplification of mtDNA HVI fragment using Polymerase Chain Reaction (PCR), detection of PCR products through agarose gel electrophoresis technique, the measurement of the concentration of mtDNA using UV-Vis spectrophotometer, determination of the nucleotide sequence via direct sequencing method and analysis of the sequencing results using SeqMan DNASTAR program. Based on the comparison between nucleotide sequence of samples and revised Cambridge Reference Sequence (rCRS) obtained six same mutations that these are C16147T, T16189C, C16193del, T16127C, A16235G, and A16293C. After comparing the data obtained to the secondary data from Mitomap and NCBI, it were found that two mutations, T16189C and T16217C, become candidates as genetic markers of type 2 diabetes even the mutations were found also in the generations of undiagnosed type 2 diabetes. The results of this study are expected to give contribution to the collection of human mtDNA database of genetic variants that associated to metabolic diseases, so that in the future it can be utilized in various fields, especially in medicine.

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

The ferredoxin-thioredoxin reductase variable subunit gene from Anacystis nidulans.

PubMed

Szekeres, M; Droux, M; Buchanan, B B

1991-03-01

The ferredoxin-thioredoxin reductase variable subunit gene of Anacystis nidulans was cloned, and its nucleotide sequence was determined. A single-copy 219-bp open reading frame encoded a protein of 73 amino acid residues, with a calculated Mr of 8,400. The monocistronic transcripts were represented in a 400-base and a less abundant 300-base mRNA form.