Sample records for developing snp markers

  1. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng


    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  2. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  3. SNP marker development for linkage map construction, anchoring of the common bean whole genome sequence and genetic research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our objectives were to identify SNP DNA markers based on a diverse set of common bean cultivars via next generation sequencing technologies; to develop Illumina Infinium BeadChip assays containing SNPs with high polymorphism within and between common bean market classes, to create high density genet...

  4. Development of genetic markers in abalone through construction of a SNP database.


    Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S


    In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis.

  5. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication

    PubMed Central

    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun


    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to “Gopoong” and “K-1” were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information. PMID:27271615

  6. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.


    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun


    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

  7. Development of SRAP, SNP and multiplexed SCAR molecular markers for the major seed coat color gene in Brassica rapa L.


    Rahman, Mukhlesur; McVetty, Peter B E; Li, Genyi


    Seed coat color inheritance in B. rapa was studied in F(1), F(2), F(3), and BC(1) progenies from a cross of a Canadian brown-seeded variety 'SPAN' and a Bangladeshi yellow sarson variety 'BARI-6'. A pollen effect was found when the yellow sarson line was used as the maternal parent. Seed coat color segregated into brown, yellow-brown and bright yellow classes. Segregation was under digenic control where the brown or yellow-brown color was dominant over bright yellow seed coat color. A sequence related amplified polymorphism (SRAP) marker linked closely to a major seed coat color gene (Br1/br1) was developed. This dominant SRAP molecular marker was successfully converted into single nucleotide polymorphism (SNP) markers and sequence characterized amplification region (SCAR) markers after the extended flanking sequence of the SRAP was obtained with chromosome walking. In total, 24 SNPs were identified with more than 2-kb sequence. A 12-bp deletion allowed the development of a SCAR marker linked closely to the Br1 gene. Using the five-fluorescence dye set supplied by ABI, four labeled M13 primers were integrated with different SCAR primers to increase the throughput of SCAR marker detection. Using multiplexed SCAR markers targeting insertions and deletions in a genome shows great potential for marker assisted selection in plant breeding.

  8. Genomic-assisted haplotype analysis and the development of high-throughput SNP markers for salinity tolerance in soybean

    PubMed Central

    Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.


    Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337

  9. Development and Validation of Single Nucleotide Polymorphism (SNP) Markers from an Expressed Sequence Tag (EST) Database in Olive Flounder (Paralichthys olivaceus).


    Kim, Jung Eun; Lee, Young Mee; Lee, Jeong-Ho; Noh, Jae Koo; Kim, Hyun Chul; Park, Choul-Ji; Park, Jong-Won; Kim, Kyung-Kil


    To successful molecular breeding, identification and functional characterization of breeding related genes and development of molecular breeding techniques using DNA markers are essential. Although the development of a useful marker is difficult in the aspect of time, cost and effort, many markers are being developed to be used in molecular breeding and developed markers have been used in many fields. Single nucleotide polymorphisms (SNPs) markers were widely used for genomic research and breeding, but has hardly been validated for screening functional genes in olive flounder. We identified single nucleotide polymorphisms (SNPs) from expressed sequence tag (EST) database in olive flounder; out of a total 4,327 ESTs, 693 contigs and 514 SNPs were detected in total EST, and these substitutions include 297 transitions and 217 transversions. As a result, 144 SNP markers were developed on the basis of 514 SNP to selection of useful gene region, and then applied to each of eight wild and culture olive flounder (total 16 samples). In our experimental result, only 32 markers had detected polymorphism in sample, also identified 21 transitions and 11 transversions, whereas indel was not detected in polymorphic SNPs. Heterozygosity of wild and cultured olive flounder using the 32 SNP markers is 0.34 and 0.29, respectively. In conclusion, we identified SNP and polymorphism in olive flounder using newly designed marker, it supports that developed markers are suitable for SNP detection and diversity analysis in olive flounder. The outcome of this study can be basic data for researches for immunity gene and characteristic with SNP.

  10. De novo assembly and transcriptome analysis of the rubber tree (Hevea brasiliensis) and SNP markers development for rubber biosynthesis pathways.


    Mantello, Camila Campos; Cardoso-Silva, Claudio Benicio; da Silva, Carla Cristina; de Souza, Livia Moura; Scaloppi Junior, Erivaldo José; de Souza Gonçalves, Paulo; Vicentini, Renato; de Souza, Anete Pereira


    Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

  11. Genetic diversity and structure in Asian native goat analyzed by newly developed SNP markers.


    Lin, Bang Zhong; Kato, Taiki; Kaneda, Makoto; Matsumoto, Hirokazu; Sasazaki, Shinji; Mannen, Hideyuki


    In the current study, a total of 65 single nucleotide polymorphisms (SNPs) within the intron region were developed in goat (Capra hircus) by utilizing genomic information of cattle and sheep due to poor available genomic information on goat. Using these markers, we carried out genetic diversity and structure analyses for 10 Asian goat populations. The phylogenetic tree and principal components analysis showed good correspondence between clustered populations and their geographic locations. The STRUCTURE software analysis illustrated six divergent genetic structures among 10 populations. Myanmar and Cambodia populations showed high admixture patterns with different ancestry, suggesting genetic introgression into native goat populations. We also investigated the correlation between genetic diversity and geographic distance from a domestication center. This result showed a decreasing trend of genetic diversity according to the distance (P = 0.014). This result supported common consensus that western Asia is one of the centers of origin for modern Asian domestic goat.

  12. SNP discovery and marker development for disease resistance candidate genes in common carp (Cyprinus carpio)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single nucleotide polymorphisms (SNPs) in immune response genes have been reported as markers of susceptibility to infectious diseases in human and livestock. A disease caused by cyprinid herpes virus 3 (CyHV-3) is highly contagious and virulent in common carp. With the aim to investigate the gene...

  13. SNP marker diversity in common bean (Phaseolus vulgaris L.).


    Cortés, Andrés J; Chavarro, Martha C; Blair, Matthew W


    Single nucleotide polymorphism (SNP) markers have become a genetic technology of choice because of their automation and high precision of allele calls. In this study, our goal was to develop 94 SNPs and test them across well-chosen common bean (Phaseolus vulgaris L.) germplasm. We validated and accessed SNP diversity at 84 gene-based and 10 non-genic loci using KASPar technology in a panel of 70 genotypes that have been used as parents of mapping populations and have been previously evaluated for SSRs. SNPs exhibited high levels of genetic diversity, an excess of middle frequency polymorphism, and a within-genepool mismatch distribution as expected for populations affected by sudden demographic expansions after domestication bottlenecks. This set of markers was useful for distinguishing Andean and Mesoamerican genotypes but less useful for distinguishing within each gene pool. In summary, slightly greater polymorphism and race structure was found within the Andean gene pool than within the Mesoamerican gene pool but polymorphism rate between genotypes was consistent with genepool and race identity. Our survey results represent a baseline for the choice of SNP markers for future applications because gene-associated SNPs could themselves be causative SNPs for traits. Finally, we discuss that the ideal genetic marker combination with which to carry out diversity, mapping and association studies in common bean should consider a mix of both SNP and SSR markers.

  14. SNP detection from de novo transcriptome sequencing in the bivalve Macoma balthica: marker development for evolutionary studies.


    Pante, Eric; Rohfritsch, Audrey; Becquet, Vanessa; Belkhir, Khalid; Bierne, Nicolas; Garcia, Pascale


    Hybrid zones are noteworthy systems for the study of environmental adaptation to fast-changing environments, as they constitute reservoirs of polymorphism and are key to the maintenance of biodiversity. They can move in relation to climate fluctuations, as temperature can affect both selection and migration, or remain trapped by environmental and physical barriers. There is therefore a very strong incentive to study the dynamics of hybrid zones subjected to climate variations. The infaunal bivalve Macoma balthica emerges as a noteworthy model species, as divergent lineages hybridize, and its native NE Atlantic range is currently contracting to the North. To investigate the dynamics and functioning of hybrid zones in M. balthica, we developed new molecular markers by sequencing the collective transcriptome of 30 individuals. Ten individuals were pooled for each of the three populations sampled at the margins of two hybrid zones. A single 454 run generated 277 Mb from which 17K SNPs were detected. SNP density averaged 1 polymorphic site every 14 to 19 bases, for mitochondrial and nuclear loci, respectively. An [Formula: see text] scan detected high genetic divergence among several hundred SNPs, some of them involved in energetic metabolism, cellular respiration and physiological stress. The high population differentiation, recorded for nuclear-encoded ATP synthase and NADH dehydrogenase as well as most mitochondrial loci, suggests cytonuclear genetic incompatibilities. Results from this study will help pave the way to a high-resolution study of hybrid zone dynamics in M. balthica, and the relative importance of endogenous and exogenous barriers to gene flow in this system. PMID:23300636

  15. SNP marker detection and genotyping in tilapia.


    Van Bers, N E M; Crooijmans, R P M A; Groenen, M A M; Dibbits, B W; Komen, J


    We have generated a unique resource consisting of nearly 175 000 short contig sequences and 3569 SNP markers from the widely cultured GIFT (Genetically Improved Farmed Tilapia) strain of Nile tilapia (Oreochromis niloticus). In total, 384 SNPs were selected to monitor the wider applicability of the SNPs by genotyping tilapia individuals from different strains and different geographical locations. In all strains and species tested (O. niloticus, O. aureus and O. mossambicus), the genotyping assay was working for a similar number of SNPs (288-305 SNPs). The actual number of polymorphic SNPs was, as expected, highest for individuals from the GIFT population (255 SNPs). In the individuals from an Egyptian strain and in individuals caught in the wild in the basin of the river Volta, 197 and 163 SNPs were polymorphic, respectively. A pairwise calculation of Nei's genetic distance allowed the discrimination of the individual strains and species based on the genotypes determined with the SNP set. We expect that this set will be widely applicable for use in tilapia aquaculture, e.g. for pedigree reconstruction. In addition, this set is currently used for assaying the genetic diversity of native Nile tilapia in areas where tilapia is, or will be, introduced in aquaculture projects. This allows the tracing of escapees from aquaculture and the monitoring of effects of introgression and hybridization. PMID:22524158

  16. SNP marker detection and genotyping in tilapia.


    Van Bers, N E M; Crooijmans, R P M A; Groenen, M A M; Dibbits, B W; Komen, J


    We have generated a unique resource consisting of nearly 175 000 short contig sequences and 3569 SNP markers from the widely cultured GIFT (Genetically Improved Farmed Tilapia) strain of Nile tilapia (Oreochromis niloticus). In total, 384 SNPs were selected to monitor the wider applicability of the SNPs by genotyping tilapia individuals from different strains and different geographical locations. In all strains and species tested (O. niloticus, O. aureus and O. mossambicus), the genotyping assay was working for a similar number of SNPs (288-305 SNPs). The actual number of polymorphic SNPs was, as expected, highest for individuals from the GIFT population (255 SNPs). In the individuals from an Egyptian strain and in individuals caught in the wild in the basin of the river Volta, 197 and 163 SNPs were polymorphic, respectively. A pairwise calculation of Nei's genetic distance allowed the discrimination of the individual strains and species based on the genotypes determined with the SNP set. We expect that this set will be widely applicable for use in tilapia aquaculture, e.g. for pedigree reconstruction. In addition, this set is currently used for assaying the genetic diversity of native Nile tilapia in areas where tilapia is, or will be, introduced in aquaculture projects. This allows the tracing of escapees from aquaculture and the monitoring of effects of introgression and hybridization.

  17. Development of SNP markers and their application for genetic diversity analysis in the oil palm (Elaeis guineensis).


    Ong, P W; Maizura, I; Abdullah, N A P; Rafii, M Y; Ooi, L C L; Low, E T L; Singh, R


    The genetic evaluation of oil palm germplasm collections is required for insight into the variability among populations. The information obtained is also useful for incorporating new genetic materials into current breeding programs. Single nucleotide polymorphisms (SNPs) have been widely used in many plant genetic studies due to the availability of large numbers of genomic sequences and expressed sequence tags. The present study examined 219 oil palms collected from two natural Angolan populations, a few hundred kilometers apart. A total of 62 SNPs were designed from oil palm genomic sequences and converted to cleaved amplified polymorphic sequence (CAPS). Of these, nine were found to be informative across the two populations. The nine informative SNPs revealed mean major allele frequency of 0.693. The average expected and observed heterozygosities were 0.398 and 0.400, respectively. The mean polymorphism information content was 0.315 (ranging between 0.223 and 0.375). None of the loci deviated from Hardy-Weinberg equilibrium and no rare alleles were detected. In cluster analysis using unweighted pair group method with arithmetic, the 219 oil palms fell into two clusters. This was further supported by the population structure analysis result (K = 2), suggesting that the samples were divided into two main genetic groups. However, the two groups did not coincide with the geographic populations. Analysis of molecular variance indicated that within-population variation contributed 93% of the total genetic variation. This study showed that SNP-based CAPS markers are useful for studying the genetic diversity of oil palm and have potential application for marker-trait association studies.

  18. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide...

  19. Development of single nucleotide polymorphism (SNP) markers from the mango (Mangiferaindica) transcriptome for mapping and estimation of genetic diversity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development of resources for genomic studies in Mangifera indica (mango) will allow marker-assisted selection and identification of genetically diverse germplasm, greatly aiding mango breeding programs. We report here a first step in developing such resources, our identification of thousands una...

  20. Large-scale development of cost-effective SNP marker assays for diversity assessment and genetic mapping in chickpea and comparative mapping in legumes

    PubMed Central

    Hiremath, Pavana J; Kumar, Ashish; Penmetsa, Ramachandra Varma; Farmer, Andrew; Schlueter, Jessica A; Chamarthi, Siva K; Whaley, Adam M; Carrasquilla-Garcia, Noelia; Gaur, Pooran M; Upadhyaya, Hari D; Kavi Kishor, Polavarapu B; Shah, Trushar M; Cook, Douglas R; Varshney, Rajeev K


    A set of 2486 single nucleotide polymorphisms (SNPs) were compiled in chickpea using four approaches, namely (i) Solexa/Illumina sequencing (1409), (ii) amplicon sequencing of tentative orthologous genes (TOGs) (604), (iii) mining of expressed sequence tags (ESTs) (286) and (iv) sequencing of candidate genes (187). Conversion of these SNPs to the cost-effective and flexible throughput Competitive Allele Specific PCR (KASPar) assays generated successful assays for 2005 SNPs. These marker assays have been designated as Chickpea KASPar Assay Markers (CKAMs). Screening of 70 genotypes including 58 diverse chickpea accessions and 12 BC3F2 lines showed 1341 CKAMs as being polymorphic. Genetic analysis of these data clustered chickpea accessions based on geographical origin. Genotyping data generated for 671 CKAMs on the reference mapping population (Cicer arietinum ICC 4958 × Cicer reticulatum PI 489777) were compiled with 317 unpublished TOG-SNPs and 396 published markers for developing the genetic map. As a result, a second-generation genetic map comprising 1328 marker loci including novel 625 CKAMs, 314 TOG-SNPs and 389 published marker loci with an average inter-marker distance of 0.59 cM was constructed. Detailed analyses of 1064 mapped loci of this second-generation chickpea genetic map showed a higher degree of synteny with genome of Medicago truncatula, followed by Glycine max, Lotus japonicus and least with Vigna unguiculata. Development of these cost-effective CKAMs for SNP genotyping will be useful not only for genetics research and breeding applications in chickpea, but also for utilizing genome information from other sequenced or model legumes. PMID:22703242

  1. Development of genotyping by sequencing (GBS) and array derived SNP markers for stem rust resistance gene Sr42

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The stem rust fungus, particularly race TTKSK (Ug99), poses a serious threat to world wheat production. Gene Sr42 or SrCad (which could be the same gene or an allele of Sr42) is effective against race TTKSK. However, known genetic markers for Sr42 are mostly SSR markers which are generally labor i...

  2. SNP marker discovery in koala TLR genes.


    Cui, Jian; Frankham, Greta J; Johnson, Rebecca N; Polkinghorne, Adam; Timms, Peter; O'Meally, Denis; Cheng, Yuanyuan; Belov, Katherine


    Toll-like receptors (TLRs) play a crucial role in the early defence against invading pathogens, yet our understanding of TLRs in marsupial immunity is limited. Here, we describe the characterisation of nine TLRs from a koala immune tissue transcriptome and one TLR from a draft sequence of the koala genome and the subsequent development of an assay to study genetic diversity in these genes. We surveyed genetic diversity in 20 koalas from New South Wales, Australia and showed that one gene, TLR10 is monomorphic, while the other nine TLR genes have between two and 12 alleles. 40 SNPs (16 non-synonymous) were identified across the ten TLR genes. These markers provide a springboard to future studies on innate immunity in the koala, a species under threat from two major infectious diseases.

  3. SNP marker discovery in koala TLR genes.


    Cui, Jian; Frankham, Greta J; Johnson, Rebecca N; Polkinghorne, Adam; Timms, Peter; O'Meally, Denis; Cheng, Yuanyuan; Belov, Katherine


    Toll-like receptors (TLRs) play a crucial role in the early defence against invading pathogens, yet our understanding of TLRs in marsupial immunity is limited. Here, we describe the characterisation of nine TLRs from a koala immune tissue transcriptome and one TLR from a draft sequence of the koala genome and the subsequent development of an assay to study genetic diversity in these genes. We surveyed genetic diversity in 20 koalas from New South Wales, Australia and showed that one gene, TLR10 is monomorphic, while the other nine TLR genes have between two and 12 alleles. 40 SNPs (16 non-synonymous) were identified across the ten TLR genes. These markers provide a springboard to future studies on innate immunity in the koala, a species under threat from two major infectious diseases. PMID:25799012

  4. SNP discovery and development of genetic markers for mapping immune response genes in common carp (Cyprinus carpio)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single nucleotide polymorphisms (SNPs) in immune response genes have been reported as markers for susceptibility to infectious diseases in human and livestock. A disease caused by cyprinid herpesvirus 3 (CyHV-3) is highly contagious and virulent in common carp (Cyprinus carpio). With the aim to de...

  5. Transcriptome sequencing, and rapid development and application of SNP markers for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae).


    Margam, Venu M; Coates, Brad S; Bayles, Darrell O; Hellmich, Richard L; Agunbiade, Tolulope; Seufferheld, Manfredo J; Sun, Weilin; Kroemer, Jeremy A; Ba, Malick N; Binso-Dabire, Clementine L; Baoua, Ibrahim; Ishiyaku, Mohammad F; Covas, Fernando G; Srinivasan, Ramasamy; Armstrong, Joel; Murdock, Larry L; Pittendrigh, Barry R


    The legume pod borer, Maruca vitrata (Lepidoptera: Crambidae), is an insect pest species of crops grown by subsistence farmers in tropical regions of Africa. We present the de novo assembly of 3729 contigs from 454- and Sanger-derived sequencing reads for midgut, salivary, and whole adult tissues of this non-model species. Functional annotation predicted that 1320 M. vitrata protein coding genes are present, of which 631 have orthologs within the Bombyx mori gene model. A homology-based analysis assigned M. vitrata genes into a group of paralogs, but these were subsequently partitioned into putative orthologs following phylogenetic analyses. Following sequence quality filtering, a total of 1542 putative single nucleotide polymorphisms (SNPs) were predicted within M. vitrata contig assemblies. Seventy one of 1078 designed molecular genetic markers were used to screen M. vitrata samples from five collection sites in West Africa. Population substructure may be present with significant implications in the insect resistance management recommendations pertaining to the release of biological control agents or transgenic cowpea that express Bacillus thuringiensis crystal toxins. Mutation data derived from transcriptome sequencing is an expeditious and economical source for genetic markers that allow evaluation of ecological differentiation.

  6. Transcriptome Sequencing, and Rapid Development and Application of SNP Markers for the Legume Pod Borer Maruca vitrata (Lepidoptera: Crambidae)

    PubMed Central

    Margam, Venu M.; Coates, Brad S.; Bayles, Darrell O.; Hellmich, Richard L.; Agunbiade, Tolulope; Seufferheld, Manfredo J.; Sun, Weilin; Kroemer, Jeremy A.; Ba, Malick N.; Binso-Dabire, Clementine L.; Baoua, Ibrahim; Ishiyaku, Mohammad F.; Covas, Fernando G.; Srinivasan, Ramasamy; Armstrong, Joel; Murdock, Larry L.; Pittendrigh, Barry R.


    The legume pod borer, Maruca vitrata (Lepidoptera: Crambidae), is an insect pest species of crops grown by subsistence farmers in tropical regions of Africa. We present the de novo assembly of 3729 contigs from 454- and Sanger-derived sequencing reads for midgut, salivary, and whole adult tissues of this non-model species. Functional annotation predicted that 1320 M. vitrata protein coding genes are present, of which 631 have orthologs within the Bombyx mori gene model. A homology-based analysis assigned M. vitrata genes into a group of paralogs, but these were subsequently partitioned into putative orthologs following phylogenetic analyses. Following sequence quality filtering, a total of 1542 putative single nucleotide polymorphisms (SNPs) were predicted within M. vitrata contig assemblies. Seventy one of 1078 designed molecular genetic markers were used to screen M. vitrata samples from five collection sites in West Africa. Population substructure may be present with significant implications in the insect resistance management recommendations pertaining to the release of biological control agents or transgenic cowpea that express Bacillus thuringiensis crystal toxins. Mutation data derived from transcriptome sequencing is an expeditious and economical source for genetic markers that allow evaluation of ecological differentiation. PMID:21754987

  7. Identification of Immune-Related Genes and Development of SSR/SNP Markers from the Spleen Transcriptome of Schizothorax prenanti

    PubMed Central

    Zhang, Zhengshi; Lv, Changhuan; Zheng, Shuming; Wang, Zhiyong; Wang, Xiaoqing


    Schizothorax prenanti (S. prenanti) is mainly distributed in the upstream regions of the Yangtze River and its tributaries in China. This species is indigenous and commercially important. However, in recent years, wild populations and aquacultures have faced the serious challenges of germplasm variation loss and an increased susceptibility to a range of pathogens. Currently, the genetics and immune mechanisms of S. prenanti are unknown, partly due to a lack of genome and transcriptome information. Here, we sought to identify genes related to immune functions and to identify molecular markers to study the function of these genes and for trait mapping. To this end, the transcriptome from spleen tissues of S. prenanti was analyzed and sequenced. Using paired-end reads from the Illumina Hiseq2500 platform, 48,517 transcripts were isolated from the spleen transcriptome. These transcripts could be clustered into 37,785 unigenes with an N50 length of 2,539 bp. The majority of the unigenes (35,653, 94.4%) were successfully annotated using non-redundant nucleotide sequence analysis (nt), and the non-redundant protein (nr), Swiss-Prot, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. KEGG pathway assignment identified more than 500 immune-related genes. Furthermore, 7,545 putative simple sequence repeats (SSRs), 857,535 single nucleotide polymorphisms (SNPs), and 53,481 insertion/deletion (InDels) were detected from the transcriptome. This is the first reported high-throughput transcriptome analysis of S. prenanti, and it provides valuable genetic resources for the investigation of immune mechanisms, conservation of germplasm, and molecular marker-assisted breeding of S. prenanti. PMID:27019203

  8. Marker development

    SciTech Connect

    Adams, M.R.


    This report is to discuss the marker development for radioactive waste disposal sites. The markers must be designed to last 10,000 years, and place no undue burdens on the future generations. Barriers cannot be constructed that preclude human intrusion. Design specifications for surface markers will be discussed, also marker pictograms will also be covered.

  9. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple.


    Chagné, David; Crowhurst, Ross N; Troggio, Michela; Davey, Mark W; Gilmore, Barbara; Lawley, Cindy; Vanderzande, Stijn; Hellens, Roger P; Kumar, Satish; Cestaro, Alessandro; Velasco, Riccardo; Main, Dorrie; Rees, Jasper D; Iezzoni, Amy; Mockler, Todd; Wilhelm, Larry; Van de Weg, Eric; Gardiner, Susan E; Bassil, Nahla; Peace, Cameron


    As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide evaluation of allelic variation in apple (Malus×domestica) breeding germplasm. For genome-wide SNP discovery, 27 apple cultivars were chosen to represent worldwide breeding germplasm and re-sequenced at low coverage with the Illumina Genome Analyzer II. Following alignment of these sequences to the whole genome sequence of 'Golden Delicious', SNPs were identified using SoapSNP. A total of 2,113,120 SNPs were detected, corresponding to one SNP to every 288 bp of the genome. The Illumina GoldenGate® assay was then used to validate a subset of 144 SNPs with a range of characteristics, using a set of 160 apple accessions. This validation assay enabled fine-tuning of the final subset of SNPs for the Illumina Infinium® II system. The set of stringent filtering criteria developed allowed choice of a set of SNPs that not only exhibited an even distribution across the apple genome and a range of minor allele frequencies to ensure utility across germplasm, but also were located in putative exonic regions to maximize genotyping success rate. A total of 7867 apple SNPs was established for the IRSC apple 8K SNP array v1, of which 5554 were polymorphic after evaluation in segregating families and a germplasm collection. This publicly available genomics resource will provide an unprecedented resolution of SNP haplotypes, which will enable marker-locus-trait association discovery, description of the genetic architecture of quantitative traits, investigation of genetic variation (neutral and functional), and genomic selection in apple.

  10. Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing

    PubMed Central

    Yu, ShiGang; Chu, WeiWei; Zhang, LiFan; Han, HouMing; Zhao, RongXue; Wu, Wei; Zhu, JiangNing; Dodson, Michael V.; Wei, Wei; Liu, HongLin; Chen, Jie


    Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS) strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD) sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP) and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV) or low estimated breeding value (LEBV). A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the candidate laying

  11. Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing.


    Yu, ShiGang; Chu, WeiWei; Zhang, LiFan; Han, HouMing; Zhao, RongXue; Wu, Wei; Zhu, JiangNing; Dodson, Michael V; Wei, Wei; Liu, HongLin; Chen, Jie


    Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS) strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD) sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP) and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV) or low estimated breeding value (LEBV). A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the candidate laying

  12. Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing.


    Yu, ShiGang; Chu, WeiWei; Zhang, LiFan; Han, HouMing; Zhao, RongXue; Wu, Wei; Zhu, JiangNing; Dodson, Michael V; Wei, Wei; Liu, HongLin; Chen, Jie


    Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS) strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD) sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP) and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV) or low estimated breeding value (LEBV). A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the candidate laying

  13. An improved consensus linkage map of barley based on flow-sorted chromosomes and SNP markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent advances in high-throughput genotyping have made it easier to combine information from different mapping populations into consensus genetic maps, which provide increased marker density and genome coverage compared to individual maps. Previously, a SNP-based genotyping platform was developed a...

  14. Identification of a SNP marker associated with WB242 nematode resistance in sugar beet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The beet-cyst nematode (Heterodera schachtii Schmidt) is one of the major diseases of sugar beet. The identification of molecular markers associated to the nematode resistance would be helpful for developing resistant varieties. The aim of this study was the identification of SNP (Single Nucleotide ...

  15. Use of microsatellite and SNP markers to characterize biotypes in Hessian fly

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Exploration of the biotype structure of Hessian fly, Mayetiola destructor (Say), would improve our knowledge regarding variation in virulence phenotypes and difference in genetic background. The objective of this study was to develop and test a panel of 18 microsatellite and 22 SNP markers to reveal...

  16. Verification of genetic identity of introduced cacao germplasm in Ghana using single nucleotide polymorphism (SNP) markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate identification of individual genotypes is important for cacao (Theobroma cacao L.) breeding, germplasm conservation and seed propagation. The development of single nucleotide polymorphism (SNP) markers in cacao offers an effective way to use a high-throughput genotyping system for cacao gen...

  17. RAD tag sequencing as a source of SNP markers in Cynara cardunculus L

    PubMed Central


    Background The globe artichoke (Cynara cardunculus L. var. scolymus) genome is relatively poorly explored, especially compared to those of the other major Asteraceae crops sunflower and lettuce. No SNP markers are in the public domain. We have combined the recently developed restriction-site associated DNA (RAD) approach with the Illumina DNA sequencing platform to effect the rapid and mass discovery of SNP markers for C. cardunculus. Results RAD tags were sequenced from the genomic DNA of three C. cardunculus mapping population parents, generating 9.7 million reads, corresponding to ~1 Gbp of sequence. An assembly based on paired ends produced ~6.0 Mbp of genomic sequence, separated into ~19,000 contigs (mean length 312 bp), of which ~21% were fragments of putative coding sequence. The shared sequences allowed for the discovery of ~34,000 SNPs and nearly 800 indels, equivalent to a SNP frequency of 5.6 per 1,000 nt, and an indel frequency of 0.2 per 1,000 nt. A sample of heterozygous SNP loci was mapped by CAPS assays and this exercise provided validation of our mining criteria. The repetitive fraction of the genome had a high representation of retrotransposon sequence, followed by simple repeats, AT-low complexity regions and mobile DNA elements. The genomic k-mers distribution and CpG rate of C. cardunculus, compared with data derived from three whole genome-sequenced dicots species, provided a further evidence of the random representation of the C. cardunculus genome generated by RAD sampling. Conclusion The RAD tag sequencing approach is a cost-effective and rapid method to develop SNP markers in a highly heterozygous species. Our approach permitted to generate a large and robust SNP datasets by the adoption of optimized filtering criteria. PMID:22214349

  18. QTL analysis using SNP markers developed by next-generation sequencing for identification of candidate genes controlling 4-methylthio-3-butenyl glucosinolate contents in roots of radish, Raphanus sativus L.


    Zou, Zhongwei; Ishida, Masahiko; Li, Feng; Kakizaki, Tomohiro; Suzuki, Sho; Kitashiba, Hiroyasu; Nishio, Takeshi


    SNP markers for QTL analysis of 4-MTB-GSL contents in radish roots were developed by determining nucleotide sequences of bulked PCR products using a next-generation sequencer. DNA fragments were amplified from two radish lines by multiplex PCR with six primer pairs, and those amplified by 2,880 primer pairs were mixed and sequenced. By assembling sequence data, 1,953 SNPs in 750 DNA fragments, 437 of which have been previously mapped in a linkage map, were identified. A linkage map of nine linkage groups was constructed with 188 markers, and five QTLs were detected in two F(2) populations, three of them accounting for more than 50% of the total phenotypic variance being repeatedly detected. In the identified QTL regions, nine SNP markers were newly produced. By synteny analysis of the QTLs regions with Arabidopsis thaliana and Brassica rapa genome sequences, three candidate genes were selected, i.e., RsMAM3 for production of aliphatic glucosinolates linked to GSL-QTL-4, RsIPMDH1 for leucine biosynthesis showing strong co-expression with glucosinolate biosynthesis genes linked to GSL-QTL-2, and RsBCAT4 for branched-chain amino acid aminotransferase linked to GSL-QTL-1. Nucleotide sequences and expression of these genes suggested their possible function in 4MTB-GSL biosynthesis in radish roots.

  19. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.


    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M


    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  20. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies

    PubMed Central

    Gimode, Davis; Odeny, Damaris A.; de Villiers, Etienne P.; Wanyonyi, Solomon; Dida, Mathews M.; Mneney, Emmarold E.; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M.


    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  1. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.


    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M


    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  2. RNA-Seq Identifies SNP Markers for Growth Traits in Rainbow Trout

    PubMed Central

    Salem, Mohamed; Vallejo, Roger L.; Leeds, Timothy D.; Palti, Yniv; Liu, Sixin; Sabbagh, Annas; Rexroad, Caird E.; Yao, Jianbo


    Fast growth is an important and highly desired trait, which affects the profitability of food animal production, with feed costs accounting for the largest proportion of production costs. Traditional phenotype-based selection is typically used to select for growth traits; however, genetic improvement is slow over generations. Single nucleotide polymorphisms (SNPs) explain 90% of the genetic differences between individuals; therefore, they are most suitable for genetic evaluation and strategies that employ molecular genetics for selective breeding. SNPs found within or near a coding sequence are of particular interest because they are more likely to alter the biological function of a protein. We aimed to use SNPs to identify markers and genes associated with genetic variation in growth. RNA-Seq whole-transcriptome analysis of pooled cDNA samples from a population of rainbow trout selected for improved growth versus unselected genetic cohorts (10 fish from 1 full-sib family each) identified SNP markers associated with growth-rate. The allelic imbalances (the ratio between the allele frequencies of the fast growing sample and that of the slow growing sample) were considered at scores >5.0 as an amplification and <0.2 as loss of heterozygosity. A subset of SNPs (n = 54) were validated and evaluated for association with growth traits in 778 individuals of a three-generation parent/offspring panel representing 40 families. Twenty-two SNP markers and one mitochondrial haplotype were significantly associated with growth traits. Polymorphism of 48 of the markers was confirmed in other commercially important aquaculture stocks. Many markers were clustered into genes of metabolic energy production pathways and are suitable candidates for genetic selection. The study demonstrates that RNA-Seq at low sequence coverage of divergent populations is a fast and effective means of identifying SNPs, with allelic imbalances between phenotypes. This technique is suitable for marker

  3. Association of Agronomic Traits with SNP Markers in Durum Wheat (Triticum turgidum L. durum (Desf.))

    PubMed Central

    Hu, Xin; Ren, Jing; Ren, Xifeng; Huang, Sisi; Sabiel, Salih A. I.; Luo, Mingcheng; Nevo, Eviatar; Fu, Chunjie; Peng, Junhua; Sun, Dongfa


    Association mapping is a powerful approach to detect associations between traits of interest and genetic markers based on linkage disequilibrium (LD) in molecular plant breeding. In this study, 150 accessions of worldwide originated durum wheat germplasm (Triticum turgidum spp. durum) were genotyped using 1,366 SNP markers. The extent of LD on each chromosome was evaluated. Association of single nucleotide polymorphisms (SNP) markers with ten agronomic traits measured in four consecutive years was analyzed under a mix linear model (MLM). Two hundred and one significant association pairs were detected in the four years. Several markers were associated with one trait, and also some markers were associated with multiple traits. Some of the associated markers were in agreement with previous quantitative trait loci (QTL) analyses. The function and homology analyses of the corresponding ESTs of some SNP markers could explain many of the associations for plant height, length of main spike, number of spikelets on main spike, grain number per plant, and 1000-grain weight, etc. The SNP associations for the observed traits are generally clustered in specific chromosome regions of the wheat genome, mainly in 2A, 5A, 6A, 7A, 1B, and 6B chromosomes. This study demonstrates that association mapping can complement and enhance previous QTL analyses and provide additional information for marker-assisted selection. PMID:26110423

  4. Varietal identification of tea (Camellia sinensis) using nanofluidic array of single nucleotide polymorphism (SNP) markers

    PubMed Central

    Fang, Wan-Ping; Meinhardt, Lyndel W; Tan, Hua-Wei; Zhou, Lin; Mischke, Sue; Zhang, Dapeng


    Apart from water, tea is the world’s most widely consumed beverage. Tea is produced in more than 50 countries with an annual production of approximately 4.7 million tons. The market segment for specialty tea has been expanding rapidly owing to increased demand, resulting in higher revenues and profits for tea growers and the industry. Accurate varietal identification is critically important to ensure traceability and authentication of premium tea products, which in turn contribute to on-farm conservation of tea genetic diversity. Using a set of single nucleotide polymorphism (SNP) markers developed from the expressed sequence tag (EST) database of Camilla senensis, we genotyped deoxyribonucleic acid (DNA) samples extracted from a diverse group of tea varieties, including both fresh and processed commercial loose-leaf teas. The validation led to the designation of 60 SNPs that unambiguously identified all 40 tested tea varieties with high statistical rigor (p<0.0001). Varietal authenticity and genetic relationships among the analyzed cultivars were further characterized by ordination and Bayesian clustering analysis. These SNP markers, in combination with a high-throughput genotyping protocol, effectively established and verified specific DNA fingerprints for all tested tea varieties. This method provides a powerful tool for variety authentication and quality control for the tea industry. It is also highly useful for the management of tea genetic resources and breeding, where accurate and efficient genotype identification is essential. PMID:26504544

  5. SNP markers-based map construction and genome-wide linkage analysis in Brassica napus.


    Raman, Harsh; Dalton-Morgan, Jessica; Diffey, Simon; Raman, Rosy; Alamery, Salman; Edwards, David; Batley, Jacqueline


    An Illumina Infinium array comprising 5306 single nucleotide polymorphism (SNP) markers was used to genotype 175 individuals of a doubled haploid population derived from a cross between Skipton and Ag-Spectrum, two Australian cultivars of rapeseed (Brassica napus L.). A genetic linkage map based on 613 SNP and 228 non-SNP (DArT, SSR, SRAP and candidate gene markers) covering 2514.8 cM was constructed and further utilized to identify loci associated with flowering time and resistance to blackleg, a disease caused by the fungus Leptosphaeria maculans. Comparison between genetic map positions of SNP markers and the sequenced Brassica rapa (A) and Brassica oleracea (C) genome scaffolds showed several genomic rearrangements in the B. napus genome. A major locus controlling resistance to L. maculans was identified at both seedling and adult plant stages on chromosome A07. QTL analyses revealed that up to 40.2% of genetic variation for flowering time was accounted for by loci having quantitative effects. Comparative mapping showed Arabidopsis and Brassica flowering genes such as Phytochrome A/D, Flowering Locus C and agamous-Like MADS box gene AGL1 map within marker intervals associated with flowering time in a DH population from Skipton/Ag-Spectrum. Genomic regions associated with flowering time and resistance to L. maculans had several SNP markers mapped within 10 cM. Our results suggest that SNP markers will be suitable for various applications such as trait introgression, comparative mapping and high-resolution mapping of loci in B. napus.

  6. A high-throughput SNP marker system for parental polymorphism screening, and diversity analysis in common bean (Phaseolus vulgaris L.).


    Blair, Matthew W; Cortés, Andrés J; Penmetsa, R Varma; Farmer, Andrew; Carrasquilla-Garcia, Noelia; Cook, Doug R


    Single nucleotide polymorphism (SNP) detection has become a marker system of choice, because of the high abundance of source polymorphisms and the ease with which allele calls are automated. Various technologies exist for the evaluation of SNP loci and previously we validated two medium throughput technologies. In this study, our goal was to utilize a 768 feature, Illumina GoldenGate assay for common bean (Phaseolus vulgaris L.) developed from conserved legume gene sequences and to use the new technology for (1) the evaluation of parental polymorphisms in a mini-core set of common bean accessions and (2) the analysis of genetic diversity in the crop. A total of 736 SNPs were scored on 236 diverse common bean genotypes with the GoldenGate array. Missing data and heterozygosity levels were low and 94 % of the SNPs were scorable. With the evaluation of the parental polymorphism genotypes, we estimated the utility of the SNP markers in mapping for inter-genepool and intra-genepool populations, the latter being of lower polymorphism than the former. When we performed the diversity analysis with the diverse genotypes, we found Illumina GoldenGate SNPs to provide equivalent evaluations as previous gene-based SNP markers, but less fine-distinctions than with previous microsatellite marker analysis. We did find, however, that the gene-based SNPs in the GoldenGate array had some utility in race structure analysis despite the low polymorphism. Furthermore the SNPs detected high heterozygosity in wild accessions which was probably a reflection of ascertainment bias. The Illumina SNPs were shown to be effective in distinguishing between the genepools, and therefore were most useful in saturation of inter-genepool genetic maps. The implications of these results for breeding in common bean are discussed as well as the advantages and disadvantages of the GoldenGate system for SNP detection.

  7. Identification of a Sex-Linked SNP Marker in the Salmon Louse (Lepeophtheirus salmonis) Using RAD Sequencing

    PubMed Central

    Taggart, John B.; Christie, Hayden R. L.; Bassett, David I.; Bron, James E.; Skuce, Philip J.; Gharbi, Karim; Skern-Mauritzen, Rasmus; Sturm, Armin


    The salmon louse (Lepeophtheirus salmonis (Krøyer, 1837)) is a parasitic copepod that can, if untreated, cause considerable damage to Atlantic salmon (Salmo salar Linnaeus, 1758) and incurs significant costs to the Atlantic salmon mariculture industry. Salmon lice are gonochoristic and normally show sex ratios close to 1:1. While this observation suggests that sex determination in salmon lice is genetic, with only minor environmental influences, the mechanism of sex determination in the salmon louse is unknown. This paper describes the identification of a sex-linked Single Nucleotide Polymorphism (SNP) marker, providing the first evidence for a genetic mechanism of sex determination in the salmon louse. Restriction site-associated DNA sequencing (RAD-seq) was used to isolate SNP markers in a laboratory-maintained salmon louse strain. A total of 85 million raw Illumina 100 base paired-end reads produced 281,838 unique RAD-tags across 24 unrelated individuals. RAD marker Lsa101901 showed complete association with phenotypic sex for all individuals analysed, being heterozygous in females and homozygous in males. Using an allele-specific PCR assay for genotyping, this SNP association pattern was further confirmed for three unrelated salmon louse strains, displaying complete association with phenotypic sex in a total of 96 genotyped individuals. The marker Lsa101901 was located in the coding region of the prohibitin-2 gene, which showed a sex-dependent differential expression, with mRNA levels determined by RT-qPCR about 1.8-fold higher in adult female than adult male salmon lice. This study’s observations of a novel sex-linked SNP marker are consistent with sex determination in the salmon louse being genetic and following a female heterozygous system. Marker Lsa101901 provides a tool to determine the genetic sex of salmon lice, and could be useful in the development of control strategies. PMID:24147087

  8. SNP markers identify widely distributed clonal lineages of Phytophthora colocasiae in Vietnam, Hawaii and Hainan Island, China.


    Shrestha, Sandesh; Hu, Jian; Fryxell, Rebecca Trout; Mudge, Joann; Lamour, Kurt


    Taro (Colocasia esculenta) is an important food crop, and taro leaf blight caused by Phytophthora colocasiae can significantly affect production. Our objectives were to develop single nucleotide polymorphism (SNP) markers for P. colocasiae and characterize populations in Hawaii (HI), Vietnam (VN) and Hainan Island, China (HIC). In total, 379 isolates were analyzed for mating type and multilocus SNP profiles including 214 from HI, 97 from VN and 68 from HIC. A total of 1152 single nucleotide variant (SNV) sites were identified via restriction site-associated DNA (RAD) sequencing of two field isolates. Genotyping with 27 SNPs revealed 41 multilocus SNP genotypes grouped into seven clonal lineages containing 2-232 members. Three clonal lineages were shared among countries. In addition, five SNP markers had a low incidence of loss of heterozygosity (LOH) during asexual laboratory growth. For HI and VN, >95% of isolates were the A2 mating type. On HIC, isolates within single clonal lineages had A1, A2 and A0 (neuter) isolates. The implications for the wide dispersal of clonal lineages are discussed.

  9. SNP markers identify widely distributed clonal lineages of Phytophthora colocasiae in Vietnam, Hawaii and Hainan Island, China.


    Shrestha, Sandesh; Hu, Jian; Fryxell, Rebecca Trout; Mudge, Joann; Lamour, Kurt


    Taro (Colocasia esculenta) is an important food crop, and taro leaf blight caused by Phytophthora colocasiae can significantly affect production. Our objectives were to develop single nucleotide polymorphism (SNP) markers for P. colocasiae and characterize populations in Hawaii (HI), Vietnam (VN) and Hainan Island, China (HIC). In total, 379 isolates were analyzed for mating type and multilocus SNP profiles including 214 from HI, 97 from VN and 68 from HIC. A total of 1152 single nucleotide variant (SNV) sites were identified via restriction site-associated DNA (RAD) sequencing of two field isolates. Genotyping with 27 SNPs revealed 41 multilocus SNP genotypes grouped into seven clonal lineages containing 2-232 members. Three clonal lineages were shared among countries. In addition, five SNP markers had a low incidence of loss of heterozygosity (LOH) during asexual laboratory growth. For HI and VN, >95% of isolates were the A2 mating type. On HIC, isolates within single clonal lineages had A1, A2 and A0 (neuter) isolates. The implications for the wide dispersal of clonal lineages are discussed. PMID:24895424

  10. Association mapping of resistance to leaf rust in emmer wheat using high throughput SNP markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emmer wheat (Triticum turgidum L. subsp. dicoccum) is known to be a useful source of genes for many desirable characters for improvement of modern cultivated wheat. Recently, a panel of 181 emmer wheat accessions has been genotyped with wheat 9K SNP (single nucleotide polymorphism) markers and exte...

  11. Applying SNP marker technology in the cacao breeding program at the Cocoa Research Institute of Ghana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this investigation 45 parental cacao plants and five progeny derived from the parental stock studied were genotyped using six SNP markers to determine off-types or mislabeled clones and to authenticate crosses made in the Cocoa Research Institute of Ghana (CRIG) breeding program. Investigation wa...

  12. A review on SNP and other types of molecular markers and their use in animal genetics

    PubMed Central

    Vignal, Alain; Milan, Denis; SanCristobal, Magali; Eggen, André


    During the last ten years, the use of molecular markers, revealing polymorphism at the DNA level, has been playing an increasing part in animal genetics studies. Amongst others, the microsatellite DNA marker has been the most widely used, due to its easy use by simple PCR, followed by a denaturing gel electrophoresis for allele size determination, and to the high degree of information provided by its large number of alleles per locus. Despite this, a new marker type, named SNP, for Single Nucleotide Polymorphism, is now on the scene and has gained high popularity, even though it is only a bi-allelic type of marker. In this review, we will discuss the reasons for this apparent step backwards, and the pertinence of the use of SNPs in animal genetics, in comparison with other marker types. PMID:12081799

  13. SNP marker discovery, linkage map construction and identification of QTLs for enhanced salinity tolerance in field pea (Pisum sativum L.)

    PubMed Central


    Background Field pea (Pisum sativum L.) is a self-pollinating, diploid, cool-season food legume. Crop production is constrained by multiple biotic and abiotic stress factors, including salinity, that cause reduced growth and yield. Recent advances in genomics have permitted the development of low-cost high-throughput genotyping systems, allowing the construction of saturated genetic linkage maps for identification of quantitative trait loci (QTLs) associated with traits of interest. Genetic markers in close linkage with the relevant genomic regions may then be implemented in varietal improvement programs. Results In this study, single nucleotide polymorphism (SNP) markers associated with expressed sequence tags (ESTs) were developed and used to generate comprehensive linkage maps for field pea. From a set of 36,188 variant nucleotide positions detected through in silico analysis, 768 were selected for genotyping of a recombinant inbred line (RIL) population. A total of 705 SNPs (91.7%) successfully detected segregating polymorphisms. In addition to SNPs, genomic and EST-derived simple sequence repeats (SSRs) were assigned to the genetic map in order to obtain an evenly distributed genome-wide coverage. Sequences associated with the mapped molecular markers were used for comparative genomic analysis with other legume species. Higher levels of conserved synteny were observed with the genomes of Medicago truncatula Gaertn. and chickpea (Cicer arietinum L.) than with soybean (Glycine max [L.] Merr.), Lotus japonicus L. and pigeon pea (Cajanus cajan [L.] Millsp.). Parents and RIL progeny were screened at the seedling growth stage for responses to salinity stress, imposed by addition of NaCl in the watering solution at a concentration of 18 dS m-1. Salinity-induced symptoms showed normal distribution, and the severity of the symptoms increased over time. QTLs for salinity tolerance were identified on linkage groups Ps III and VII, with flanking SNP markers suitable for

  14. Rice chromosome segment substitution line selection utilizing SNP markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome segment substitution lines (CSSLs) are a powerful tool for identifying naturally occurring, favorable alleles in unadapted germplasm. Six CSSL libraries in rice (Oryza sativa) are being developed from crosses between three different accessions of the rice progenitor species, O. rufipogon...

  15. SNP Marker Discovery in Pima Cotton (Gossypium barbadense L.) Leaf Transcriptomes

    PubMed Central

    Kottapalli, Pratibha; Ulloa, Mauricio; Kottapalli, Kameswara Rao; Payton, Paxton; Burke, John


    The objective of this study was to explore the known narrow genetic diversity and discover single-nucleotide polymorphic (SNP) markers for marker-assisted breeding within Pima cotton (Gossypium barbadense L.) leaf transcriptomes. cDNA from 25-day plants of three diverse cotton genotypes [Pima S6 (PS6), Pima S7 (PS7), and Pima 3-79 (P3-79)] was sequenced on Illumina sequencing platform. A total of 28.9 million reads (average read length of 138 bp) were generated by sequencing cDNA libraries of these three genotypes. The de novo assembly of reads generated transcriptome sets of 26,369 contigs for PS6, 25,870 contigs for PS7, and 24,796 contigs for P3-79. A Pima leaf reference transcriptome was generated consisting of 42,695 contigs. More than 10,000 single-nucleotide polymorphisms (SNPs) were identified between the genotypes, with 100% SNP frequency and a minimum of eight sequencing reads. The most prevalent SNP substitutions were C—T and A—G in these cotton genotypes. The putative SNPs identified can be utilized for characterizing genetic diversity, genotyping, and eventually in Pima cotton breeding through marker-assisted selection. PMID:27721653

  16. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.


    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick


    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  17. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    PubMed Central

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick


    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  18. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.


    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick


    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  19. Comparison of SSR and SNP Markers in Estimation of Genetic Diversity and Population Structure of Indian Rice Varieties

    PubMed Central

    Singh, Amit Kumar; Kumar, Sundeep; Srinivasan, Kalyani; Tyagi, R. K.; Singh, N. K.; Singh, Rakesh


    Simple sequence repeat (SSR) and Single Nucleotide Polymorphic (SNP), the two most robust markers for identifying rice varieties were compared for assessment of genetic diversity and population structure. Total 375 varieties of rice from various regions of India archived at the Indian National GeneBank, NBPGR, New Delhi, were analyzed using thirty six genetic markers, each of hypervariable SSR (HvSSR) and SNP which were distributed across 12 rice chromosomes. A total of 80 alleles were amplified with the SSR markers with an average of 2.22 alleles per locus whereas, 72 alleles were amplified with SNP markers. Polymorphic information content (PIC) values for HvSSR ranged from 0.04 to 0.5 with an average of 0.25. In the case of SNP markers, PIC values ranged from 0.03 to 0.37 with an average of 0.23. Genetic relatedness among the varieties was studied; utilizing an unrooted tree all the genotypes were grouped into three major clusters with both SSR and SNP markers. Analysis of molecular variance (AMOVA) indicated that maximum diversity was partitioned between and within individual level but not between populations. Principal coordinate analysis (PCoA) with SSR markers showed that genotypes were uniformly distributed across the two axes with 13.33% of cumulative variation whereas, in case of SNP markers varieties were grouped into three broad groups across two axes with 45.20% of cumulative variation. Population structure were tested using K values from 1 to 20, but there was no clear population structure, therefore Ln(PD) derived Δk was plotted against the K to determine the number of populations. In case of SSR maximum Δk was at K=5 whereas, in case of SNP maximum Δk was found at K=15, suggesting that resolution of population was higher with SNP markers, but SSR were more efficient for diversity analysis. PMID:24367635

  20. Minimal SNP overlap among multiple panels of ancestry informative markers argues for more international collaboration.


    Soundararajan, Usha; Yun, Libing; Shi, Meisen; Kidd, Kenneth K


    The century-old use of genetic markers to determine population relationships has morphed in modern forensics into use of markers to determine the ancestry of an individual from a DNA sample. Researchers have identified sets of SNPs that have frequency differences among populations and many sets of SNPs have been published for the purpose of inferring ancestry. Such inference also requires reference datasets for the particular set of SNPs selected. We have identified 21 largely independent published panels of ancestry informative SNPs (AISNPs) and examined their union of 1397 SNPs. No SNP occurs in more than 6 panels. The 1397 SNPs in 21 panels yield a largely empty matrix that is inhibiting progress on more refined ability to infer ancestry for a forensic sample. The most common set of reference populations is the HGDP set of 52 small population samples totaling a thousand individuals. Only 46 (3%) of the 1397 SNPs occur in three or more panels. We assembled a new dataset for 44 of those SNPs involving 4,559 individuals from 73 populations. Analyses of this dataset provided clear differentiation of only five biogeographic regions: sub-Saharan Africa, Europe and SW Asia, South Asia, East Asia, and the Americas. This is an inadequate level of biogeographic resolution already exceeded by other panels. We conclude that more such AISNP panels are not needed and that the forensic community must collaborate to develop a common set of highly differentiating AISNPs typed on a very large number of population samples. How that can be accomplished will be the subject of future discussion. PMID:26977931

  1. Identification and validation of a SNP marker linked to the gene HsBvm-1 for nematode resistance in sugar beet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The beet-cyst nematode (Heterodera schachtii Schmidt) is one of the major pests of sugar beet. The identification of molecular markers associated with nematode resistance would be helpful for developing resistant varieties. The aim of this study was the identification of SNP (Single Nucleotide Polym...

  2. Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.


    Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K


    Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection. PMID:25332852

  3. Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.


    Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K


    Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection.

  4. Outlier SNP markers reveal fine-scale genetic structuring across European hake populations (Merluccius merluccius).


    Milano, Ilaria; Babbucci, Massimiliano; Cariani, Alessia; Atanassova, Miroslava; Bekkevold, Dorte; Carvalho, Gary R; Espiñeira, Montserrat; Fiorentino, Fabio; Garofalo, Germana; Geffen, Audrey J; Hansen, Jakob H; Helyar, Sarah J; Nielsen, Einar E; Ogden, Rob; Patarnello, Tomaso; Stagioni, Marco; Tinti, Fausto; Bargelloni, Luca


    Shallow population structure is generally reported for most marine fish and explained as a consequence of high dispersal, connectivity and large population size. Targeted gene analyses and more recently genome-wide studies have challenged such view, suggesting that adaptive divergence might occur even when neutral markers provide genetic homogeneity across populations. Here, 381 SNPs located in transcribed regions were used to assess large- and fine-scale population structure in the European hake (Merluccius merluccius), a widely distributed demersal species of high priority for the European fishery. Analysis of 850 individuals from 19 locations across the entire distribution range showed evidence for several outlier loci, with significantly higher resolving power. While 299 putatively neutral SNPs confirmed the genetic break between basins (F(CT) = 0.016) and weak differentiation within basins, outlier loci revealed a dramatic divergence between Atlantic and Mediterranean populations (F(CT) range 0.275-0.705) and fine-scale significant population structure. Outlier loci separated North Sea and Northern Portugal populations from all other Atlantic samples and revealed a strong differentiation among Western, Central and Eastern Mediterranean geographical samples. Significant correlation of allele frequencies at outlier loci with seawater surface temperature and salinity supported the hypothesis that populations might be adapted to local conditions. Such evidence highlights the importance of integrating information from neutral and adaptive evolutionary patterns towards a better assessment of genetic diversity. Accordingly, the generated outlier SNP data could be used for tackling illegal practices in hake fishing and commercialization as well as to develop explicit spatial models for defining management units and stock boundaries.

  5. Development and Characterization of a High Density SNP Genotyping Assay for Cattle

    PubMed Central

    Matukumalli, Lakshmi K.; Lawley, Cynthia T.; Schnabel, Robert D.; Taylor, Jeremy F.; Allan, Mark F.; Heaton, Michael P.; O'Connell, Jeff; Moore, Stephen S.; Smith, Timothy P. L.; Sonstegard, Tad S.; Van Tassell, Curtis P.


    The success of genome-wide association (GWA) studies for the detection of sequence variation affecting complex traits in human has spurred interest in the use of large-scale high-density single nucleotide polymorphism (SNP) genotyping for the identification of quantitative trait loci (QTL) and for marker-assisted selection in model and agricultural species. A cost-effective and efficient approach for the development of a custom genotyping assay interrogating 54,001 SNP loci to support GWA applications in cattle is described. A novel algorithm for achieving a compressed inter-marker interval distribution proved remarkably successful, with median interval of 37 kb and maximum predicted gap of <350 kb. The assay was tested on a panel of 576 animals from 21 cattle breeds and six outgroup species and revealed that from 39,765 to 46,492 SNP are polymorphic within individual breeds (average minor allele frequency (MAF) ranging from 0.24 to 0.27). The assay also identified 79 putative copy number variants in cattle. Utility for GWA was demonstrated by localizing known variation for coat color and the presence/absence of horns to their correct genomic locations. The combination of SNP selection and the novel spacing algorithm allows an efficient approach for the development of high-density genotyping platforms in species having full or even moderate quality draft sequence. Aspects of the approach can be exploited in species which lack an available genome sequence. The BovineSNP50 assay described here is commercially available from Illumina and provides a robust platform for mapping disease genes and QTL in cattle. PMID:19390634

  6. Mixed model methods for genomic prediction and variance component estimation of additive and dominance effects using SNP markers.


    Da, Yang; Wang, Chunkao; Wang, Shengwen; Hu, Guo


    We established a genomic model of quantitative trait with genomic additive and dominance relationships that parallels the traditional quantitative genetics model, which partitions a genotypic value as breeding value plus dominance deviation and calculates additive and dominance relationships using pedigree information. Based on this genomic model, two sets of computationally complementary but mathematically identical mixed model methods were developed for genomic best linear unbiased prediction (GBLUP) and genomic restricted maximum likelihood estimation (GREML) of additive and dominance effects using SNP markers. These two sets are referred to as the CE and QM sets, where the CE set was designed for large numbers of markers and the QM set was designed for large numbers of individuals. GBLUP and associated accuracy formulations for individuals in training and validation data sets were derived for breeding values, dominance deviations and genotypic values. Simulation study showed that GREML and GBLUP generally were able to capture small additive and dominance effects that each accounted for 0.00005-0.0003 of the phenotypic variance and GREML was able to differentiate true additive and dominance heritability levels. GBLUP of the total genetic value as the summation of additive and dominance effects had higher prediction accuracy than either additive or dominance GBLUP, causal variants had the highest accuracy of GREML and GBLUP, and predicted accuracies were in agreement with observed accuracies. Genomic additive and dominance relationship matrices using SNP markers were consistent with theoretical expectations. The GREML and GBLUP methods can be an effective tool for assessing the type and magnitude of genetic effects affecting a phenotype and for predicting the total genetic value at the whole genome level.

  7. Primers to amplify SNP markers in Epichloë canadensis (Clavicipitaceae)1

    PubMed Central

    Sullivan, Terrence J.; Bultman, Thomas L.; Schoolcraft, Jennifer


    Premise of the study: Primers were designed to produce short amplicons containing single-nucleotide polymorphisms (SNPs) in β-tubulin (tubB) and translation elongation factor 1-α (tefA) in Epichloë canadensis (Clavicipitaceae), an endophytic fungus of Elymus canadensis (Poaceae). Methods and Results: Primers to amplify regions of tubB and tefA containing suspected SNPs were designed and tested on individuals from six populations. Two tubB alleles were identified that differed by a single SNP, and three tefA alleles were identified that differed by a combination of two SNPs. All six populations tested were polymorphic for the tefA marker, and three of the populations were also polymorphic for the tubB marker. These primers are also predicted to amplify these regions in 11 additional epichloid species. Conclusions: Primers for short amplicons within tubB and tefA genes can be used to successfully genotype E. canadensis, making them useful markers for population genetic or landscape genomic studies. PMID:27011893

  8. Molecular authentication of Panax ginseng and ginseng products using robust SNP markers in ribosomal external transcribed spacer region.


    Wang, Hongtao; Kim, Min-Kyeoung; Kwon, Woo-Saeng; Jin, Haizhu; Liang, Zhiqi; Yang, Deok-Chun


    Panax ginseng and Panax quinquefolius are the most widely used Panax species, but they are known to have different properties and medicinal values. The aim of this study is to develop a robust and accurate DNA marker for identifying P. ginseng and the origins of ginseng products. Two single nucleotide polymorphism (SNP) sites specific to P. ginseng were exploited from nuclear ribosomal external transcribed spacer (ETS) region. Based on the SNP sites, two specific primers were designed for P. ginseng and P. quinquefolius respectively. P. ginseng can be easily discriminated from P. quinquefolius by amplifying the two specific alleles using multiplex allele-specific PCR. Favorable results can also be obtained from commercial ginseng products. The established method is highly sensitive and can detect 1% of intentional adulteration of P. quinquefolius into P. ginseng down to the 0.1ng level of total DNA. Therefore this study provides a reliable and simple DNA method for authentication of the origins and purities of ginseng products.

  9. Population structure and genetic diversity in a commercial maize breeding program assessed with SSR and SNP markers

    PubMed Central

    Van Inghelandt, Delphine; Melchinger, Albrecht E.; Lebreton, Claude


    Information about the genetic diversity and population structure in elite breeding material is of fundamental importance for the improvement of crops. The objectives of our study were to (a) examine the population structure and the genetic diversity in elite maize germplasm based on simple sequence repeat (SSR) markers, (b) compare these results with those obtained from single nucleotide polymorphism (SNP) markers, and (c) compare the coancestry coefficient calculated from pedigree records with genetic distance estimates calculated from SSR and SNP markers. Our study was based on 1,537 elite maize inbred lines genotyped with 359 SSR and 8,244 SNP markers. The average number of alleles per locus, of group specific alleles, and the gene diversity (D) were higher for SSRs than for SNPs. Modified Roger’s distance (MRD) estimates and membership probabilities of the STRUCTURE matrices were higher for SSR than for SNP markers but the germplasm organization in four heterotic pools was consistent with STRUCTURE results based on SSRs and SNPs. MRD estimates calculated for the two marker systems were highly correlated (0.87). Our results suggested that the same conclusions regarding the structure and the diversity of heterotic pools could be drawn from both markers types. Furthermore, although our results suggested that the ratio of the number of SSRs and SNPs required to obtain MRD or D estimates with similar precision is not constant across the various precision levels, we propose that between 7 and 11 times more SNPs than SSRs should be used for analyzing population structure and genetic diversity. Electronic supplementary material The online version of this article (doi:10.1007/s00122-009-1256-2) contains supplementary material, which is available to authorized users. PMID:20063144

  10. SNP Discovery and Development of a High-Density Genotyping Array for Sunflower

    PubMed Central

    Bachlava, Eleni; Taylor, Christopher A.; Tang, Shunxue; Bowers, John E.; Mandel, Jennifer R.; Burke, John M.; Knapp, Steven J.


    Recent advances in next-generation DNA sequencing technologies have made possible the development of high-throughput SNP genotyping platforms that allow for the simultaneous interrogation of thousands of single-nucleotide polymorphisms (SNPs). Such resources have the potential to facilitate the rapid development of high-density genetic maps, and to enable genome-wide association studies as well as molecular breeding approaches in a variety of taxa. Herein, we describe the development of a SNP genotyping resource for use in sunflower (Helianthus annuus L.). This work involved the development of a reference transcriptome assembly for sunflower, the discovery of thousands of high quality SNPs based on the generation and analysis of ca. 6 Gb of transcriptome re-sequencing data derived from multiple genotypes, the selection of 10,640 SNPs for inclusion in the genotyping array, and the use of the resulting array to screen a diverse panel of sunflower accessions as well as related wild species. The results of this work revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, greater than 95% of successful SNP assays revealed polymorphism, and more than 90% of these assays could be successfully transferred to related wild species. Analysis of the polymorphism data revealed patterns of genetic differentiation that were largely congruent with the evolutionary history of sunflower, though the large number of markers allowed for finer resolution than has previously been possible. PMID:22238659

  11. Ancestry informative marker panels for African Americans based on subsets of commercially available SNP arrays.


    Tandon, Arti; Patterson, Nick; Reich, David


    Admixture mapping is a widely used method for localizing disease genes in African Americans. Most current methods for inferring ancestry at each locus in the genome use a few thousand single nucleotide polymorphisms (SNPs) that are very different in frequency between West Africans and European Americans, and that are required to not be in linkage disequilibrium in the ancestral populations. Modern SNP arrays provide data on hundreds of thousands of SNPs per sample, and to use these to infer ancestry, using many of the standard methods, it is necessary to choose subsets of the SNPs for analysis. Here we present panels of about 4,300 ancestry informative markers (AIMs) that are subsets respectively of SNPs on the Illumina 1 M, Illumina 650, Illumina 610, Affymetrix 6.0 and Affymetrix 5.0 arrays. To validate the usefulness of these panels, we applied them to samples that are different from the ones used to select the SNPs. The panels provide about 80% of the maximum information about African or European ancestry, even with up to 10% missing data.

  12. Accuracy of direct genomic values in Holstein bulls and cows using subsets of SNP markers

    PubMed Central


    Background At the current price, the use of high-density single nucleotide polymorphisms (SNP) genotyping assays in genomic selection of dairy cattle is limited to applications involving elite sires and dams. The objective of this study was to evaluate the use of low-density assays to predict direct genomic value (DGV) on five milk production traits, an overall conformation trait, a survival index, and two profit index traits (APR, ASI). Methods Dense SNP genotypes were available for 42,576 SNP for 2,114 Holstein bulls and 510 cows. A subset of 1,847 bulls born between 1955 and 2004 was used as a training set to fit models with various sets of pre-selected SNP. A group of 297 bulls born between 2001 and 2004 and all cows born between 1992 and 2004 were used to evaluate the accuracy of DGV prediction. Ridge regression (RR) and partial least squares regression (PLSR) were used to derive prediction equations and to rank SNP based on the absolute value of the regression coefficients. Four alternative strategies were applied to select subset of SNP, namely: subsets of the highest ranked SNP for each individual trait, or a single subset of evenly spaced SNP, where SNP were selected based on their rank for ASI, APR or minor allele frequency within intervals of approximately equal length. Results RR and PLSR performed very similarly to predict DGV, with PLSR performing better for low-density assays and RR for higher-density SNP sets. When using all SNP, DGV predictions for production traits, which have a higher heritability, were more accurate (0.52-0.64) than for survival (0.19-0.20), which has a low heritability. The gain in accuracy using subsets that included the highest ranked SNP for each trait was marginal (5-6%) over a common set of evenly spaced SNP when at least 3,000 SNP were used. Subsets containing 3,000 SNP provided more than 90% of the accuracy that could be achieved with a high-density assay for cows, and 80% of the high-density assay for young bulls

  13. The easy road to genome-wide medium density SNP screening in a non-model species: development and application of a 10 K SNP-chip for the house sparrow (Passer domesticus).


    Hagen, Ingerid J; Billing, Anna M; Rønning, Bernt; Pedersen, Sindre A; Pärn, Henrik; Slate, Jon; Jensen, Henrik


    With the advent of next generation sequencing, new avenues have opened to study genomics in wild populations of non-model species. Here, we describe a successful approach to a genome-wide medium density Single Nucleotide Polymorphism (SNP) panel in a non-model species, the house sparrow (Passer domesticus), through the development of a 10 K Illumina iSelect HD BeadChip. Genomic DNA and cDNA derived from six individuals were sequenced on a 454 GS FLX system and generated a total of 1.2 million sequences, in which SNPs were detected. As no reference genome exists for the house sparrow, we used the zebra finch (Taeniopygia guttata) reference genome to determine the most likely position of each SNP. The 10 000 SNPs on the SNP-chip were selected to be distributed evenly across 31 chromosomes, giving on average one SNP per 100 000 bp. The SNP-chip was screened across 1968 individual house sparrows from four island populations. Of the original 10 000 SNPs, 7413 were found to be variable, and 99% of these SNPs were successfully called in at least 93% of all individuals. We used the SNP-chip to demonstrate the ability of such genome-wide marker data to detect population sub-division, and compared these results to similar analyses using microsatellites. The SNP-chip will be used to map Quantitative Trait Loci (QTL) for fitness-related phenotypic traits in natural populations.

  14. Sum statistics for the joint detection of multiple disease loci in case-control association studies with SNP markers.


    Wille, Anja; Hoh, Josephine; Ott, Jurg


    In complex traits, multiple disease loci presumably interact to produce the disease. For this reason, even with high-resolution single nucleotide polymorphism (SNP) marker maps, it has been difficult to map susceptibility loci by conventional locus-by-locus methods. Fine mapping strategies are needed that allow for the simultaneous detection of interacting disease loci while handling large numbers of densely spaced markers. For this purpose, sum statistics were recently proposed as a first-stage analysis method for case-control association studies with SNPs. Via sums of single-marker statistics, information over multiple disease-associated markers is combined and, with a global significance value alpha, a small set of "interesting" markers is selected for further analysis. Here, the statistical properties of such approaches are examined by computer simulation. It is shown that sum statistics can often be successfully applied when marker-by-marker approaches fail to detect association. Compared with Bonferroni or False Discovery Rate (FDR) procedures, sum statistics have greater power, and more disease loci can be detected. However, in studies with tightly linked markers, simple sum statistics can be suboptimal, since the intermarker correlation is ignored. A method is presented that takes the correlation structure among marker loci into account when marker statistics are combined.

  15. SNP Arrays for Species Identification in Salmonids.


    Wenne, Roman; Drywa, Agata; Kent, Matthew; Sundsaasen, Kristil Kindem; Lien, Sigbjørn


    The use of SNP genotyping microarrays, developed in one species to analyze a closely related species for which genomic sequence information is scarce, enables the rapid development of a genomic resource (SNP information) without the need to develop new species-specific markers. Using large numbers of microarray SNPs offers the best chance to detect informative markers in nontarget species, markers that can very often be assayed using a lower throughput platform as is described in this paper. PMID:27460372

  16. Evaluation of the Ion Torrent™ HID SNP 169-plex: A SNP typing assay developed for human identification by second generation sequencing.


    Børsting, Claus; Fordyce, Sarah L; Olofsson, Jill; Mogensen, Helle Smidt; Morling, Niels


    The Ion Torrent™ HID SNP assay amplified 136 autosomal SNPs and 33 Y-chromosome markers in one PCR and the markers were subsequently typed using the Ion PGM™ second generation sequencing platform. A total of 51 of the autosomal SNPs were selected from the SNPforID panel that is routinely used in our ISO 17025 accredited laboratory. Concordance between the Ion Torrent™ HID SNP assay and the SNPforID assay was tested by typing 44 Iraqis twice with the Ion Torrent™ HID SNP assay. The same samples were previously typed with the SNPforID assay and the Y-chromosome haplogroups of the individuals were previously identified by typing 45 Y-chromosome SNPs. Full concordance between the assays were obtained except for the SNP genotypes of two SNPs. These SNPs were among the eight SNPs (rs2399332, rs1029047, rs10776839, rs4530059, rs8037429, rs430046, rs1031825 and rs1523537) with inconsistent allele balance among samples. These SNPs should be excluded from the panel. The optimal amount of DNA in the PCR seemed to be ≥0.5ng. Allele drop-outs were rare and only seen in experiments with <0.5ng input DNA and with a coverage of <50reads. No allele drop-in was observed. The great majority of the heterozygote allele balances were between 0.6 and 1.6, which is comparable to the heterozygote balances of STRs typed with PCR-CE. The number of reads with base calls that differed from the genotype call was typically less than five. This allowed detection of 1:100 mixtures with a high degree of certainty in experiments with a high total depth of coverage. In conclusion, the Ion PGM™ is a very promising platform for forensic genetics. However, the secondary sequence analysis software made wrong genotype calls from correctly sequenced alleles. These types of errors must be corrected before the platform can be used in case work. Furthermore, the sequence analysis software should be further developed and include quality settings for each SNP based on validation studies. PMID

  17. Exploring Germplasm Diversity to Understand the Domestication Process in Cicer spp. Using SNP and DArT Markers

    PubMed Central

    Roorkiwal, Manish; von Wettberg, Eric J.; Upadhyaya, Hari D.; Warschefsky, Emily; Rathore, Abhishek; Varshney, Rajeev K.


    To estimate genetic diversity within and between 10 interfertile Cicer species (94 genotypes) from the primary, secondary and tertiary gene pool, we analysed 5,257 DArT markers and 651 KASPar SNP markers. Based on successful allele calling in the tertiary gene pool, 2,763 DArT and 624 SNP markers that are polymorphic between genotypes from the gene pools were analyzed further. STRUCTURE analyses were consistent with 3 cultivated populations, representing kabuli, desi and pea-shaped seed types, with substantial admixture among these groups, while two wild populations were observed using DArT markers. AMOVA was used to partition variance among hierarchical sets of landraces and wild species at both the geographical and species level, with 61% of the variation found between species, and 39% within species. Molecular variance among the wild species was high (39%) compared to the variation present in cultivated material (10%). Observed heterozygosity was higher in wild species than the cultivated species for each linkage group. Our results support the Fertile Crescent both as the center of domestication and diversification of chickpea. The collection used in the present study covers all the three regions of historical chickpea cultivation, with the highest diversity in the Fertile Crescent region. Shared alleles between different gene pools suggest the possibility of gene flow among these species or incomplete lineage sorting and could indicate complicated patterns of divergence and fusion of wild chickpea taxa in the past. PMID:25010059

  18. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array

    PubMed Central


    Background A whole-genome genotyping array has previously been developed for Malus using SNP data from 28 Malus genotypes. This array offers the prospect of high throughput genotyping and linkage map development for any given Malus progeny. To test the applicability of the array for mapping in diverse Malus genotypes, we applied the array to the construction of a SNP-based linkage map of an apple rootstock progeny. Results Of the 7,867 Malus SNP markers on the array, 1,823 (23.2%) were heterozygous in one of the two parents of the progeny, 1,007 (12.8%) were heterozygous in both parental genotypes, whilst just 2.8% of the 921 Pyrus SNPs were heterozygous. A linkage map spanning 1,282.2 cM was produced comprising 2,272 SNP markers, 306 SSR markers and the S-locus. The length of the M432 linkage map was increased by 52.7 cM with the addition of the SNP markers, whilst marker density increased from 3.8 cM/marker to 0.5 cM/marker. Just three regions in excess of 10 cM remain where no markers were mapped. We compared the positions of the mapped SNP markers on the M432 map with their predicted positions on the ‘Golden Delicious’ genome sequence. A total of 311 markers (13.7% of all mapped markers) mapped to positions that conflicted with their predicted positions on the ‘Golden Delicious’ pseudo-chromosomes, indicating the presence of paralogous genomic regions or mis-assignments of genome sequence contigs during the assembly and anchoring of the genome sequence. Conclusions We incorporated data for the 2,272 SNP markers onto the map of the M432 progeny and have presented the most complete and saturated map of the full 17 linkage groups of M. pumila to date. The data were generated rapidly in a high-throughput semi-automated pipeline, permitting significant savings in time and cost over linkage map construction using microsatellites. The application of the array will permit linkage maps to be developed for QTL analyses in a cost-effective manner, and

  19. Assessment of microsatellite and SNP markers for parentage assignment in ex situ African Penguin (Spheniscus demersus) populations.


    Labuschagne, Christiaan; Nupen, Lisa; Kotzé, Antoinette; Grobler, Paul J; Dalton, Desiré L


    Captive management of ex situ populations of endangered species is traditionally based on pedigree information derived from studbook data. However, molecular methods could provide a powerful set of complementary tools to verify studbook records and also contribute to improving the understanding of the genetic status of captive populations. Here, we compare the utility of single nucleotide polymorphisms (SNPs) and microsatellites (MS) and two analytical methods for assigning parentage in ten families of captive African penguins held in South African facilities. We found that SNPs performed better than microsatellites under both analytical frameworks, but a combination of all markers was most informative. A subset of combined SNP (n = 14) and MS loci (n = 10) provided robust assessments of parentage. Captive or supportive breeding programs will play an important role in future African penguin conservation efforts as a source of individuals for reintroduction. Cooperation among these captive facilities is essential to facilitate this process and improve management. This study provided us with a useful set of SNP and MS markers for parentage and relatedness testing among these captive populations. Further assessment of the utility of these markers over multiple (>3) generations and the incorporation of a larger variety of relationships among individuals (e.g., half-siblings or cousins) is strongly suggested. PMID:26819703

  20. Assessment of microsatellite and SNP markers for parentage assignment in ex situ African Penguin (Spheniscus demersus) populations.


    Labuschagne, Christiaan; Nupen, Lisa; Kotzé, Antoinette; Grobler, Paul J; Dalton, Desiré L


    Captive management of ex situ populations of endangered species is traditionally based on pedigree information derived from studbook data. However, molecular methods could provide a powerful set of complementary tools to verify studbook records and also contribute to improving the understanding of the genetic status of captive populations. Here, we compare the utility of single nucleotide polymorphisms (SNPs) and microsatellites (MS) and two analytical methods for assigning parentage in ten families of captive African penguins held in South African facilities. We found that SNPs performed better than microsatellites under both analytical frameworks, but a combination of all markers was most informative. A subset of combined SNP (n = 14) and MS loci (n = 10) provided robust assessments of parentage. Captive or supportive breeding programs will play an important role in future African penguin conservation efforts as a source of individuals for reintroduction. Cooperation among these captive facilities is essential to facilitate this process and improve management. This study provided us with a useful set of SNP and MS markers for parentage and relatedness testing among these captive populations. Further assessment of the utility of these markers over multiple (>3) generations and the incorporation of a larger variety of relationships among individuals (e.g., half-siblings or cousins) is strongly suggested.

  1. Genetic Variation and Breeding Signature in Mass Selection Lines of the Pacific Oyster (Crassostrea gigas) Assessed by SNP Markers

    PubMed Central

    Zhong, Xiaoxiao; Feng, Dandan; Yu, Hong; Kong, Lingfeng; Li, Qi


    In breeding industries, a challenging problem is how to keep genetic diversity over generations. To investigate genetic variation and identify breeding signatures in mass selected lines of Pacific oyster (Crassostrea gigas), three sixth-generation selected lines and four wild populations were assessed using 103 single nucleotide polymorphism (SNP) markers. The genetic diversity data indicated that the selected lines exhibited a significant reduction in the observed heterozygosity and observed number of alleles per locus compared with the wild populations (P≤0.05), indicating the selected lines tended to lose genetic diversity contrasted with the wild populations. The unweighted pair-group method with arithmetic mean (UPGMA) analysis showed that the wild populations and selected lines were not separated into two groups. Using four outlier tests, a total of 17 loci were found under selection at two levels. The global outlier detection suggested that 4 common outlier loci were subject to selection using both the hierarchical island model and Bayesian likelihood approaches. At regional level, 3 SNPs were detected as outlier using at least two outlier tests and one outlier SNP (CgSNP309) was overlapped in the two wild-selected population comparisons. The candidate outlier SNPs provide valuable resources for future association studies in C. gigas. PMID:26954577

  2. Genetic Variation and Breeding Signature in Mass Selection Lines of the Pacific Oyster (Crassostrea gigas) Assessed by SNP Markers.


    Zhong, Xiaoxiao; Feng, Dandan; Yu, Hong; Kong, Lingfeng; Li, Qi


    In breeding industries, a challenging problem is how to keep genetic diversity over generations. To investigate genetic variation and identify breeding signatures in mass selected lines of Pacific oyster (Crassostrea gigas), three sixth-generation selected lines and four wild populations were assessed using 103 single nucleotide polymorphism (SNP) markers. The genetic diversity data indicated that the selected lines exhibited a significant reduction in the observed heterozygosity and observed number of alleles per locus compared with the wild populations (P≤0.05), indicating the selected lines tended to lose genetic diversity contrasted with the wild populations. The unweighted pair-group method with arithmetic mean (UPGMA) analysis showed that the wild populations and selected lines were not separated into two groups. Using four outlier tests, a total of 17 loci were found under selection at two levels. The global outlier detection suggested that 4 common outlier loci were subject to selection using both the hierarchical island model and Bayesian likelihood approaches. At regional level, 3 SNPs were detected as outlier using at least two outlier tests and one outlier SNP (CgSNP309) was overlapped in the two wild-selected population comparisons. The candidate outlier SNPs provide valuable resources for future association studies in C. gigas.

  3. Identification and Validation of SNP Markers Linked to Dwarf Traits Using SLAF-Seq Technology in Lagerstroemia.


    Ye, Yuanjun; Cai, Ming; Ju, Yiqian; Jiao, Yao; Feng, Lu; Pan, Huitang; Cheng, Tangren; Zhang, Qixiang


    The genetic control of plant architecture is a promising approach to breed desirable cultivars, particularly in ornamental flowers. In this study, the F1 population (142 seedlings) derived from Lagerstroemia fauriei (non-dwarf) × L. indica 'Pocomoke' (dwarf) was phenotyped for six traits (plant height (PH), internode length (IL), internode number, primary lateral branch height (PLBH), secondary lateral branch height and primary branch number), and the IL and PLBH traits were positively correlated with the PH trait and considered representative indexes of PH. Fifty non-dwarf and dwarf seedlings were pooled and subjected to a specific-locus amplified fragment sequencing (SLAF-seq) method, which screened 1221 polymorphic markers. A total of 3 markers segregating between bulks were validated in the F1 population, with the M16337 and M38412 markers highly correlated with the IL trait and the M25207 marker highly correlated with the PLBH trait. These markers provide a predictability of approximately 80% using a single marker (M25207) and a predictability of 90% using marker combinations (M16337 + M25207) in the F1 population, which revealed that the IL and the PLBH traits, especially the PLBH, were the decisive elements for PH in terms of molecular regulation. Further validation was performed in the BC1 population and a set of 28 Lagerstroemia stocks using allele-specific PCR (AS-PCR) technology, and the results showed the stability and reliability of the SNP markers and the co-determination of PH by multiple genes. Our findings provide an important theoretical and practical basis for the early prediction and indirect selection of PH using the IL and the PLBH, and the detected SNPs may be useful for marker-assisted selection (MAS) in crape myrtle. PMID:27404662

  4. Identification and Validation of SNP Markers Linked to Dwarf Traits Using SLAF-Seq Technology in Lagerstroemia

    PubMed Central

    Ju, Yiqian; Jiao, Yao; Feng, Lu; Pan, Huitang; Cheng, Tangren; Zhang, Qixiang


    The genetic control of plant architecture is a promising approach to breed desirable cultivars, particularly in ornamental flowers. In this study, the F1 population (142 seedlings) derived from Lagerstroemia fauriei (non-dwarf) × L. indica ‘Pocomoke’ (dwarf) was phenotyped for six traits (plant height (PH), internode length (IL), internode number, primary lateral branch height (PLBH), secondary lateral branch height and primary branch number), and the IL and PLBH traits were positively correlated with the PH trait and considered representative indexes of PH. Fifty non-dwarf and dwarf seedlings were pooled and subjected to a specific-locus amplified fragment sequencing (SLAF-seq) method, which screened 1221 polymorphic markers. A total of 3 markers segregating between bulks were validated in the F1 population, with the M16337 and M38412 markers highly correlated with the IL trait and the M25207 marker highly correlated with the PLBH trait. These markers provide a predictability of approximately 80% using a single marker (M25207) and a predictability of 90% using marker combinations (M16337 + M25207) in the F1 population, which revealed that the IL and the PLBH traits, especially the PLBH, were the decisive elements for PH in terms of molecular regulation. Further validation was performed in the BC1 population and a set of 28 Lagerstroemia stocks using allele-specific PCR (AS-PCR) technology, and the results showed the stability and reliability of the SNP markers and the co-determination of PH by multiple genes. Our findings provide an important theoretical and practical basis for the early prediction and indirect selection of PH using the IL and the PLBH, and the detected SNPs may be useful for marker-assisted selection (MAS) in crape myrtle. PMID:27404662

  5. High-density SNP assay development for genetic analysis in maritime pine (Pinus pinaster).


    Plomion, C; Bartholomé, J; Lesur, I; Boury, C; Rodríguez-Quilón, I; Lagraulet, H; Ehrenmann, F; Bouffier, L; Gion, J M; Grivet, D; de Miguel, M; de María, N; Cervera, M T; Bagnoli, F; Isik, F; Vendramin, G G; González-Martínez, S C


    Maritime pine provides essential ecosystem services in the south-western Mediterranean basin, where it covers around 4 million ha. Its scattered distribution over a range of environmental conditions makes it an ideal forest tree species for studies of local adaptation and evolutionary responses to climatic change. Highly multiplexed single nucleotide polymorphism (SNP) genotyping arrays are increasingly used to study genetic variation in living organisms and for practical applications in plant and animal breeding and genetic resource conservation. We developed a 9k Illumina Infinium SNP array and genotyped maritime pine trees from (i) a three-generation inbred (F2) pedigree, (ii) the French breeding population and (iii) natural populations from Portugal and the French Atlantic coast. A large proportion of the exploitable SNPs (2052/8410, i.e. 24.4%) segregated in the mapping population and could be mapped, providing the densest ever gene-based linkage map for this species. Based on 5016 SNPs, natural and breeding populations from the French gene pool exhibited similar level of genetic diversity. Population genetics and structure analyses based on 3981 SNP markers common to the Portuguese and French gene pools revealed high levels of differentiation, leading to the identification of a set of highly differentiated SNPs that could be used for seed provenance certification. Finally, we discuss how the validated SNPs could facilitate the identification of ecologically and economically relevant genes in this species, improving our understanding of the demography and selective forces shaping its natural genetic diversity, and providing support for new breeding strategies. PMID:26358548

  6. High-density SNP assay development for genetic analysis in maritime pine (Pinus pinaster).


    Plomion, C; Bartholomé, J; Lesur, I; Boury, C; Rodríguez-Quilón, I; Lagraulet, H; Ehrenmann, F; Bouffier, L; Gion, J M; Grivet, D; de Miguel, M; de María, N; Cervera, M T; Bagnoli, F; Isik, F; Vendramin, G G; González-Martínez, S C


    Maritime pine provides essential ecosystem services in the south-western Mediterranean basin, where it covers around 4 million ha. Its scattered distribution over a range of environmental conditions makes it an ideal forest tree species for studies of local adaptation and evolutionary responses to climatic change. Highly multiplexed single nucleotide polymorphism (SNP) genotyping arrays are increasingly used to study genetic variation in living organisms and for practical applications in plant and animal breeding and genetic resource conservation. We developed a 9k Illumina Infinium SNP array and genotyped maritime pine trees from (i) a three-generation inbred (F2) pedigree, (ii) the French breeding population and (iii) natural populations from Portugal and the French Atlantic coast. A large proportion of the exploitable SNPs (2052/8410, i.e. 24.4%) segregated in the mapping population and could be mapped, providing the densest ever gene-based linkage map for this species. Based on 5016 SNPs, natural and breeding populations from the French gene pool exhibited similar level of genetic diversity. Population genetics and structure analyses based on 3981 SNP markers common to the Portuguese and French gene pools revealed high levels of differentiation, leading to the identification of a set of highly differentiated SNPs that could be used for seed provenance certification. Finally, we discuss how the validated SNPs could facilitate the identification of ecologically and economically relevant genes in this species, improving our understanding of the demography and selective forces shaping its natural genetic diversity, and providing support for new breeding strategies.

  7. Development and Applications of a Bovine 50,000 SNP Chip

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop an Illumina iSelect high density single nucleotide polymorphism (SNP) assay for cattle, the collaborative iBMC (Illumina, USDA ARS Beltsville, University of Missouri, USDA ARS Clay Center) Consortium first performed a de novo SNP discovery project in which genomic reduced representation l...

  8. Development and evaluation of single-nucleotide polymorphism markers in allotetraploid rapeseed (Brassica napus L.).


    Westermeier, Peter; Wenzel, Gerhard; Mohler, Volker


    Single-nucleotide polymorphisms (SNPs) and insertion-deletions (INDELs) are currently the important classes of genetic markers for major crop species. In this study, methods for developing SNP markers in rapeseed (Brassica napus L.) and their in silico mapping and use for genotyping are demonstrated. For the development of SNP and INDEL markers, 181 fragments from 121 different gene sequences spanning 86 kb were examined. A combination of different selection methods (genome-specific amplification, hetero-duplex analysis and sequence analysis) allowed the detection of 18 singular fragments that showed a total of 87 SNPs and 6 INDELs between 6 different rapeseed varieties. The average frequency of sequence polymorphism was estimated to be one SNP every 247 bp and one INDEL every 3,583 bp. Most SNPs and INDELs were found in non-coding regions. Polymorphism information content values for SNP markers ranged between 0.02 and 0.50 in a set of 86 varieties. Using comparative genetics data for B. napus and Arabidopsis thaliana, an allocation of SNP markers to linkage groups in rapeseed was achieved: a unique location was determined for seven gene sequences; two and three possible locations were found for six and four sequences, respectively. The results demonstrate the usefulness of existing genomic resources for SNP discovery in rapeseed.

  9. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ~4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification pr...

  10. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea

    PubMed Central


    Background Pea has a complex genome of 4.3 Gb for which only limited genomic resources are available to date. Although SNP markers are now highly valuable for research and modern breeding, only a few are described and used in pea for genetic diversity and linkage analysis. Results We developed a large resource by cDNA sequencing of 8 genotypes representative of modern breeding material using the Roche 454 technology, combining both long reads (400 bp) and high coverage (3.8 million reads, reaching a total of 1,369 megabases). Sequencing data were assembled and generated a 68 K unigene set, from which 41 K were annotated from their best blast hit against the model species Medicago truncatula. Annotated contigs showed an even distribution along M. truncatula pseudochromosomes, suggesting a good representation of the pea genome. 10 K pea contigs were found to be polymorphic among the genetic material surveyed, corresponding to 35 K SNPs. We validated a subset of 1538 SNPs through the GoldenGate assay, proving their ability to structure a diversity panel of breeding germplasm. Among them, 1340 were genetically mapped and used to build a new consensus map comprising a total of 2070 markers. Based on blast analysis, we could establish 1252 bridges between our pea consensus map and the pseudochromosomes of M. truncatula, which provides new insight on synteny between the two species. Conclusions Our approach created significant new resources in pea, i.e. the most comprehensive genetic map to date tightly linked to the model species M. truncatula and a large SNP resource for both academic research and breeding. PMID:24521263

  11. Candidate SNP Markers of Chronopathologies Are Predicted by a Significant Change in the Affinity of TATA-Binding Protein for Human Gene Promoters

    PubMed Central

    Ponomarenko, Petr; Rasskazov, Dmitry; Suslov, Valentin; Sharypova, Ekaterina; Savinkova, Ludmila; Podkolodnaya, Olga; Podkolodny, Nikolay L.; Tverdokhleb, Natalya N.; Chadaeva, Irina; Kolchanov, Nikolay


    Variations in human genome (e.g., single nucleotide polymorphisms, SNPs) may be associated with hereditary diseases, their complications, comorbidities, and drug responses. Using Web service SNP_TATA_Comparator presented in our previous paper, here we analyzed immediate surroundings of known SNP markers of diseases and identified several candidate SNP markers that can significantly change the affinity of TATA-binding protein for human gene promoters, with circadian consequences. For example, rs572527200 may be related to asthma, where symptoms are circadian (worse at night), and rs367732974 may be associated with heart attacks that are characterized by a circadian preference (early morning). By the same method, we analyzed the 90 bp proximal promoter region of each protein-coding transcript of each human gene of the circadian clock core. This analysis yielded 53 candidate SNP markers, such as rs181985043 (susceptibility to acute Q fever in male patients), rs192518038 (higher risk of a heart attack in patients with diabetes), and rs374778785 (emphysema and lung cancer in smokers). If they are properly validated according to clinical standards, these candidate SNP markers may turn out to be useful for physicians (to select optimal treatment for each patient) and for the general population (to choose a lifestyle preventing possible circadian complications of diseases).

  12. Candidate SNP Markers of Chronopathologies Are Predicted by a Significant Change in the Affinity of TATA-Binding Protein for Human Gene Promoters

    PubMed Central

    Ponomarenko, Petr; Rasskazov, Dmitry; Suslov, Valentin; Sharypova, Ekaterina; Savinkova, Ludmila; Podkolodnaya, Olga; Podkolodny, Nikolay L.; Tverdokhleb, Natalya N.; Chadaeva, Irina; Kolchanov, Nikolay


    Variations in human genome (e.g., single nucleotide polymorphisms, SNPs) may be associated with hereditary diseases, their complications, comorbidities, and drug responses. Using Web service SNP_TATA_Comparator presented in our previous paper, here we analyzed immediate surroundings of known SNP markers of diseases and identified several candidate SNP markers that can significantly change the affinity of TATA-binding protein for human gene promoters, with circadian consequences. For example, rs572527200 may be related to asthma, where symptoms are circadian (worse at night), and rs367732974 may be associated with heart attacks that are characterized by a circadian preference (early morning). By the same method, we analyzed the 90 bp proximal promoter region of each protein-coding transcript of each human gene of the circadian clock core. This analysis yielded 53 candidate SNP markers, such as rs181985043 (susceptibility to acute Q fever in male patients), rs192518038 (higher risk of a heart attack in patients with diabetes), and rs374778785 (emphysema and lung cancer in smokers). If they are properly validated according to clinical standards, these candidate SNP markers may turn out to be useful for physicians (to select optimal treatment for each patient) and for the general population (to choose a lifestyle preventing possible circadian complications of diseases). PMID:27635400

  13. Candidate SNP Markers of Chronopathologies Are Predicted by a Significant Change in the Affinity of TATA-Binding Protein for Human Gene Promoters.


    Ponomarenko, Petr; Rasskazov, Dmitry; Suslov, Valentin; Sharypova, Ekaterina; Savinkova, Ludmila; Podkolodnaya, Olga; Podkolodny, Nikolay L; Tverdokhleb, Natalya N; Chadaeva, Irina; Ponomarenko, Mikhail; Kolchanov, Nikolay


    Variations in human genome (e.g., single nucleotide polymorphisms, SNPs) may be associated with hereditary diseases, their complications, comorbidities, and drug responses. Using Web service SNP_TATA_Comparator presented in our previous paper, here we analyzed immediate surroundings of known SNP markers of diseases and identified several candidate SNP markers that can significantly change the affinity of TATA-binding protein for human gene promoters, with circadian consequences. For example, rs572527200 may be related to asthma, where symptoms are circadian (worse at night), and rs367732974 may be associated with heart attacks that are characterized by a circadian preference (early morning). By the same method, we analyzed the 90 bp proximal promoter region of each protein-coding transcript of each human gene of the circadian clock core. This analysis yielded 53 candidate SNP markers, such as rs181985043 (susceptibility to acute Q fever in male patients), rs192518038 (higher risk of a heart attack in patients with diabetes), and rs374778785 (emphysema and lung cancer in smokers). If they are properly validated according to clinical standards, these candidate SNP markers may turn out to be useful for physicians (to select optimal treatment for each patient) and for the general population (to choose a lifestyle preventing possible circadian complications of diseases). PMID:27635400

  14. Genetic Contribution of Ningmai 9 Wheat to Its Derivatives Evaluated by Using SNP Markers.


    Jiang, Peng; Zhang, Ping-Ping; Zhang, Xu; Ma, Hong-Xiang


    Founder parent usually plays an important role in wheat breeding. Ningmai 9 is a soft wheat variety with good performance in yield, quality, and resistance to wheat disease. Therefore it serves as an important commercial variety and founder parent in middle and lower Yangtze River of China. To date, 20 new cultivars have been developed from Ningmai 9 and released to wheat production in the last 10 years. In this study, the 90K iSELECT ILLUMINA chip was used to analyze the genotype of Ningmai 9 and its 17 derivatives. The genetic similarity coefficients between Ningmai 9 and its derivatives were more than 0.7 except for Yangfumai 4. Neighbor-Joining analysis showed that Yangfumai 4 had the largest genetic distance from Ningmai 9 in all derivatives. There was a great difference for the same allele ratio in either derivatives or chromosomes, though the average values of the same allele ratio in genomes A, B, and D were close to each other. The phenotypic difference in Ningmai 9, Ningmai 13, and Yangfumai 4 was consistent with their difference in genetic background by comparing previous reported QTLs. Some hot chromosome regions were found and might be used for marker assisted selection in wheat breeding. PMID:27652255

  15. Genetic Contribution of Ningmai 9 Wheat to Its Derivatives Evaluated by Using SNP Markers

    PubMed Central

    Jiang, Peng; Zhang, Ping-Ping


    Founder parent usually plays an important role in wheat breeding. Ningmai 9 is a soft wheat variety with good performance in yield, quality, and resistance to wheat disease. Therefore it serves as an important commercial variety and founder parent in middle and lower Yangtze River of China. To date, 20 new cultivars have been developed from Ningmai 9 and released to wheat production in the last 10 years. In this study, the 90K iSELECT ILLUMINA chip was used to analyze the genotype of Ningmai 9 and its 17 derivatives. The genetic similarity coefficients between Ningmai 9 and its derivatives were more than 0.7 except for Yangfumai 4. Neighbor-Joining analysis showed that Yangfumai 4 had the largest genetic distance from Ningmai 9 in all derivatives. There was a great difference for the same allele ratio in either derivatives or chromosomes, though the average values of the same allele ratio in genomes A, B, and D were close to each other. The phenotypic difference in Ningmai 9, Ningmai 13, and Yangfumai 4 was consistent with their difference in genetic background by comparing previous reported QTLs. Some hot chromosome regions were found and might be used for marker assisted selection in wheat breeding. PMID:27652255

  16. Genetic Contribution of Ningmai 9 Wheat to Its Derivatives Evaluated by Using SNP Markers

    PubMed Central

    Jiang, Peng; Zhang, Ping-Ping


    Founder parent usually plays an important role in wheat breeding. Ningmai 9 is a soft wheat variety with good performance in yield, quality, and resistance to wheat disease. Therefore it serves as an important commercial variety and founder parent in middle and lower Yangtze River of China. To date, 20 new cultivars have been developed from Ningmai 9 and released to wheat production in the last 10 years. In this study, the 90K iSELECT ILLUMINA chip was used to analyze the genotype of Ningmai 9 and its 17 derivatives. The genetic similarity coefficients between Ningmai 9 and its derivatives were more than 0.7 except for Yangfumai 4. Neighbor-Joining analysis showed that Yangfumai 4 had the largest genetic distance from Ningmai 9 in all derivatives. There was a great difference for the same allele ratio in either derivatives or chromosomes, though the average values of the same allele ratio in genomes A, B, and D were close to each other. The phenotypic difference in Ningmai 9, Ningmai 13, and Yangfumai 4 was consistent with their difference in genetic background by comparing previous reported QTLs. Some hot chromosome regions were found and might be used for marker assisted selection in wheat breeding.

  17. Identifying Litchi (Litchi chinensis Sonn.) Cultivars and Their Genetic Relationships Using Single Nucleotide Polymorphism (SNP) Markers

    PubMed Central

    Liu, Wei; Xiao, Zhidan; Bao, Xiuli; Yang, Xiaoyan; Fang, Jing; Xiang, Xu


    Litchi is an important fruit tree in tropical and subtropical areas of the world. However, there is widespread confusion regarding litchi cultivar nomenclature and detailed information of genetic relationships among litchi germplasm is unclear. In the present study, the potential of single nucleotide polymorphism (SNP) for the identification of 96 representative litchi accessions and their genetic relationships in China was evaluated using 155 SNPs that were evenly spaced across litchi genome. Ninety SNPs with minor allele frequencies above 0.05 and a good genotyping success rate were used for further analysis. A relatively high level of genetic variation was observed among litchi accessions, as quantified by the expected heterozygosity (He = 0.305). The SNP based multilocus matching identified two synonymous groups, ‘Heiye’ and ‘Wuye’, and ‘Chengtuo’ and ‘Baitangli 1’. A subset of 14 SNPs was sufficient to distinguish all the non-redundant litchi genotypes, and these SNPs were proven to be highly stable by repeated analyses of a selected group of cultivars. Unweighted pair-group method of arithmetic averages (UPGMA) cluster analysis divided the litchi accessions analyzed into four main groups, which corresponded to the traits of extremely early-maturing, early-maturing, middle-maturing, and late-maturing, indicating that the fruit maturation period should be considered as the primary criterion for litchi taxonomy. Two subpopulations were detected among litchi accessions by STRUCTURE analysis, and accessions with extremely early- and late-maturing traits showed membership coefficients above 0.99 for Cluster 1 and Cluster 2, respectively. Accessions with early- and middle-maturing traits were identified as admixture forms with varying levels of membership shared between the two clusters, indicating their hybrid origin during litchi domestication. The results of this study will benefit litchi germplasm conservation programs and facilitate maximum

  18. Genetic Map of Triticale Integrating Microsatellite, DArT and SNP Markers

    PubMed Central

    Tyrka, Mirosław; Tyrka, Dorota; Wędzony, Maria


    Triticale (×Triticosecale Wittm) is an economically important crop for fodder and biomass production. To facilitate the identification of markers for agronomically important traits and for genetic and genomic characteristics of this species, a new high-density genetic linkage map of triticale was constructed using doubled haploid (DH) population derived from a cross between cultivars ‘Hewo’ and ‘Magnat’. The map consists of 1615 bin markers, that represent 50 simple sequence repeat (SSR), 842 diversity array technology (DArT), and 16888 DArTseq markers mapped onto 20 linkage groups assigned to the A, B, and R genomes of triticale. No markers specific to chromosome 7R were found, instead mosaic linkage group composed of 1880 highly distorted markers (116 bins) from 10 wheat chromosomes was identified. The genetic map covers 4907 cM with a mean distance between two bins of 3.0 cM. Comparative analysis in respect to published maps of wheat, rye and triticale revealed possible deletions in chromosomes 4B, 5A, and 6A, as well as inversion in chromosome 7B. The number of bin markers in each chromosome varied from 24 in chromosome 3R to 147 in chromosome 6R. The length of individual chromosomes ranged between 50.7 cM for chromosome 2R and 386.2 cM for chromosome 7B. A total of 512 (31.7%) bin markers showed significant (P < 0.05) segregation distortion across all chromosomes. The number of 8 the segregation distorted regions (SDRs) were identified on 1A, 7A, 1B, 2B, 7B (2 SDRs), 5R and 6R chromosomes. The high-density genetic map of triticale will facilitate fine mapping of quantitative trait loci, the identification of candidate genes and map-based cloning. PMID:26717308

  19. Genetic Map of Triticale Integrating Microsatellite, DArT and SNP Markers.


    Tyrka, Mirosław; Tyrka, Dorota; Wędzony, Maria


    Triticale (×Triticosecale Wittm) is an economically important crop for fodder and biomass production. To facilitate the identification of markers for agronomically important traits and for genetic and genomic characteristics of this species, a new high-density genetic linkage map of triticale was constructed using doubled haploid (DH) population derived from a cross between cultivars 'Hewo' and 'Magnat'. The map consists of 1615 bin markers, that represent 50 simple sequence repeat (SSR), 842 diversity array technology (DArT), and 16888 DArTseq markers mapped onto 20 linkage groups assigned to the A, B, and R genomes of triticale. No markers specific to chromosome 7R were found, instead mosaic linkage group composed of 1880 highly distorted markers (116 bins) from 10 wheat chromosomes was identified. The genetic map covers 4907 cM with a mean distance between two bins of 3.0 cM. Comparative analysis in respect to published maps of wheat, rye and triticale revealed possible deletions in chromosomes 4B, 5A, and 6A, as well as inversion in chromosome 7B. The number of bin markers in each chromosome varied from 24 in chromosome 3R to 147 in chromosome 6R. The length of individual chromosomes ranged between 50.7 cM for chromosome 2R and 386.2 cM for chromosome 7B. A total of 512 (31.7%) bin markers showed significant (P < 0.05) segregation distortion across all chromosomes. The number of 8 the segregation distorted regions (SDRs) were identified on 1A, 7A, 1B, 2B, 7B (2 SDRs), 5R and 6R chromosomes. The high-density genetic map of triticale will facilitate fine mapping of quantitative trait loci, the identification of candidate genes and map-based cloning. PMID:26717308

  20. Obesity-related known and candidate SNP markers can significantly change affinity of TATA-binding protein for human gene promoters

    PubMed Central


    Background Obesity affects quality of life and life expectancy and is associated with cardiovascular disorders, cancer, diabetes, reproductive disorders in women, prostate diseases in men, and congenital anomalies in children. The use of single nucleotide polymorphism (SNP) markers of diseases and drug responses (i.e., significant differences of personal genomes of patients from the reference human genome) can help physicians to improve treatment. Clinical research can validate SNP markers via genotyping of patients and demonstration that SNP alleles are significantly more frequent in patients than in healthy people. The search for biomedical SNP markers of interest can be accelerated by computer-based analysis of hundreds of millions of SNPs in the 1000 Genomes project because of selection of the most meaningful candidate SNP markers and elimination of neutral SNPs. Results We cross-validated the output of two computer-based methods: DNA sequence analysis using Web service SNP_TATA_Comparator and keyword search for articles on comorbidities of obesity. Near the sites binding to TATA-binding protein (TBP) in human gene promoters, we found 22 obesity-related candidate SNP markers, including rs10895068 (male breast cancer in obesity); rs35036378 (reduced risk of obesity after ovariectomy); rs201739205 (reduced risk of obesity-related cancers due to weight loss by diet/exercise in obese postmenopausal women); rs183433761 (obesity resistance during a high-fat diet); rs367732974 and rs549591993 (both: cardiovascular complications in obese patients with type 2 diabetes mellitus); rs200487063 and rs34104384 (both: obesity-caused hypertension); rs35518301, rs72661131, and rs562962093 (all: obesity); and rs397509430, rs33980857, rs34598529, rs33931746, rs33981098, rs34500389, rs63750953, rs281864525, rs35518301, and rs34166473 (all: chronic inflammation in comorbidities of obesity). Using an electrophoretic mobility shift assay under nonequilibrium conditions, we

  1. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intraspecific and Interspecific Populations of Gossypium spp.


    Hulse-Kemp, Amanda M; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L; Kochan, Kelli J; Riggs, Penny K; Scheffler, Jodi A; Udall, Joshua A; Ulloa, Mauricio; Wang, Shirley S; Zhu, Qian-Hao; Bag, Sumit K; Bhardwaj, Archana; Burke, John J; Byers, Robert L; Claverie, Michel; Gore, Michael A; Harker, David B; Islam, Md S; Jenkins, Johnie N; Jones, Don C; Lacape, Jean-Marc; Llewellyn, Danny J; Percy, Richard G; Pepper, Alan E; Poland, Jesse A; Mohan Rai, Krishan; Sawant, Samir V; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M; Wang, Fei; Yourstone, Scott M; Zheng, Xiuting; Lawley, Cindy T; Ganal, Martin W; Van Deynze, Allen; Wilson, Iain W; Stelly, David M


    High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community.

  2. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intraspecific and Interspecific Populations of Gossypium spp.


    Hulse-Kemp, Amanda M; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L; Kochan, Kelli J; Riggs, Penny K; Scheffler, Jodi A; Udall, Joshua A; Ulloa, Mauricio; Wang, Shirley S; Zhu, Qian-Hao; Bag, Sumit K; Bhardwaj, Archana; Burke, John J; Byers, Robert L; Claverie, Michel; Gore, Michael A; Harker, David B; Islam, Md S; Jenkins, Johnie N; Jones, Don C; Lacape, Jean-Marc; Llewellyn, Danny J; Percy, Richard G; Pepper, Alan E; Poland, Jesse A; Mohan Rai, Krishan; Sawant, Samir V; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M; Wang, Fei; Yourstone, Scott M; Zheng, Xiuting; Lawley, Cindy T; Ganal, Martin W; Van Deynze, Allen; Wilson, Iain W; Stelly, David M


    High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community. PMID:25908569

  3. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intraspecific and Interspecific Populations of Gossypium spp.

    PubMed Central

    Hulse-Kemp, Amanda M.; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D.; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L.; Kochan, Kelli J.; Riggs, Penny K.; Scheffler, Jodi A.; Udall, Joshua A.; Ulloa, Mauricio; Wang, Shirley S.; Zhu, Qian-Hao; Bag, Sumit K.; Bhardwaj, Archana; Burke, John J.; Byers, Robert L.; Claverie, Michel; Gore, Michael A.; Harker, David B.; Islam, Md S.; Jenkins, Johnie N.; Jones, Don C.; Lacape, Jean-Marc; Llewellyn, Danny J.; Percy, Richard G.; Pepper, Alan E.; Poland, Jesse A.; Mohan Rai, Krishan; Sawant, Samir V.; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M.; Wang, Fei; Yourstone, Scott M.; Zheng, Xiuting; Lawley, Cindy T.; Ganal, Martin W.; Van Deynze, Allen; Wilson, Iain W.; Stelly, David M.


    High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community. PMID:25908569

  4. The first genetic linkage map of Primulina eburnea (Gesneriaceae) based on EST-derived SNP markers.


    Feng, Chen; Feng, Chao; Kang, Ming


    Primulina eburnea is a promising candidate for domestication and floriculture, since it is easy to culture and has beautiful flowers. An F₂ population of 189 individuals was established for the construction of first-generation linkage maps based on expressed sequence tags-derived single-nucleotide polymorphism markers using the massARRAY genotyping platform. Of the 232 screened markers, 215 were assigned to 18 LG according to the haploid number of chromosomes in the species. The linkage map spanned a total of 3774.7 cM with an average distance of 17.6 cM between adjacent markers. This linkage map provides a framework for identification of important genes in breeding programmes. PMID:27350682

  5. Genome-wide association of 10 horticultural traits with expressed sequence tag-derived SNP markers in a collection of lettuce lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic diversity, population structure, and genome-wide marker-trait association analyses were conducted on a special collection of 298 homozygous lettuce (Lactuca sativa L.) lines. Each of these lines was derived from a single plant that had been genotyped with 384 SNP makers using LSGermOPA. They...

  6. Fine QTL mapping of mandarin (Citrus reticulata) fruit characters using high-throughput SNP markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seedlessness, flavor, and color are top priorities for mandarin (Citrus reticulata Blanco) cultivar improvement. Given long juvenility, large tree size, and high breeding cost, marker-assisted selection (MAS) may be an expeditious and economical approach to these challenges. The objectives of this s...

  7. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.)

    PubMed Central


    Background Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and

  8. Development of an automated SNP analysis method using a paramagnetic beads handling robot.


    Hagiwara, Hiroko; Sawakami-Kobayashi, Kazumi; Yamamoto, Midori; Iwasaki, Shoji; Sugiura, Mika; Abe, Hatsumi; Kunihiro-Ohashi, Sumiko; Takase, Kumiko; Yamane, Noriko; Kato, Kaoru; Son, Renkon; Nakamura, Michihiro; Segawa, Osamu; Yoshida, Mamiko; Yohda, Masafumi; Tajima, Hideji; Kobori, Masato; Takahama, Yousuke; Itakura, Mitsuo; Machida, Masayuki


    Biological and medical importance of the single nucleotide polymorphism (SNP) has led to development of a wide variety of methods for SNP typing. Aiming for establishing highly reliable and fully automated SNP typing, we have developed the adapter ligation method in combination with the paramagnetic beads handling technology, Magtration(R). The method utilizes sequence specific ligation between the fluorescently labeled adapter and the sample DNAs at the cohesive end produced by a type IIS restriction enzyme. Evaluation of the method using human genomic DNA showed clear discrimination of the three genotypes without ambiguity using the same reaction condition for any SNPs examined. The operations following PCR amplification were automatically performed by the Magtration(R)-based robot that we have previously developed. Multiplex typing of two SNPs in a single reaction by using four fluorescent dyes was successfully preformed at the almost same sensitivity and reliability as the single typing. These results demonstrate that the automated paramagnetic beads handling technology, Magtration(R), is highly adaptable to the automated SNP analysis and that our method best fits to an automated in-house SNP typing for laboratory and medical uses.

  9. Development of genome-wide SNP assays for rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With the introduction of new sequencing technologies, single nucleotide polymorphisms (SNPs) are rapidly replacing simple sequence repeats (SSRs) as the DNA marker of choice for applications in plant breeding and genetics because they are more abundant, stable, amenable to automation, efficient, and...

  10. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.


    Livingstone, Donald; Royaert, Stefan; Stack, Conrad; Mockaitis, Keithanne; May, Greg; Farmer, Andrew; Saski, Christopher; Schnell, Ray; Kuhn, David; Motamayor, Juan Carlos


    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ∼4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification project was undertaken using RNAseq data from 16 diverse cacao cultivars. RNA sequences were aligned to the assembled transcriptome of the cultivar Matina 1-6, and 330,000 SNPs within coding regions were identified. From these SNPs, a subset of 6,000 high-quality SNPs were selected for inclusion on an Illumina Infinium SNP array: the Cacao6kSNP array. Using Cacao6KSNP array data from over 1,000 cacao samples, we demonstrate that our custom array produces a saturated genetic map and can be used to distinguish among even closely related genotypes. Our study enhances and expands the genetic resources available to the cacao research community, and provides the genome-scale set of tools that are critical for advancing breeding with molecular markers in an agricultural species with high genetic diversity.

  11. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao

    PubMed Central

    Livingstone, Donald; Royaert, Stefan; Stack, Conrad; Mockaitis, Keithanne; May, Greg; Farmer, Andrew; Saski, Christopher; Schnell, Ray; Kuhn, David; Motamayor, Juan Carlos


    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ∼4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification project was undertaken using RNAseq data from 16 diverse cacao cultivars. RNA sequences were aligned to the assembled transcriptome of the cultivar Matina 1-6, and 330,000 SNPs within coding regions were identified. From these SNPs, a subset of 6,000 high-quality SNPs were selected for inclusion on an Illumina Infinium SNP array: the Cacao6kSNP array. Using Cacao6KSNP array data from over 1,000 cacao samples, we demonstrate that our custom array produces a saturated genetic map and can be used to distinguish among even closely related genotypes. Our study enhances and expands the genetic resources available to the cacao research community, and provides the genome-scale set of tools that are critical for advancing breeding with molecular markers in an agricultural species with high genetic diversity. PMID:26070980

  12. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.


    Livingstone, Donald; Royaert, Stefan; Stack, Conrad; Mockaitis, Keithanne; May, Greg; Farmer, Andrew; Saski, Christopher; Schnell, Ray; Kuhn, David; Motamayor, Juan Carlos


    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ∼4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification project was undertaken using RNAseq data from 16 diverse cacao cultivars. RNA sequences were aligned to the assembled transcriptome of the cultivar Matina 1-6, and 330,000 SNPs within coding regions were identified. From these SNPs, a subset of 6,000 high-quality SNPs were selected for inclusion on an Illumina Infinium SNP array: the Cacao6kSNP array. Using Cacao6KSNP array data from over 1,000 cacao samples, we demonstrate that our custom array produces a saturated genetic map and can be used to distinguish among even closely related genotypes. Our study enhances and expands the genetic resources available to the cacao research community, and provides the genome-scale set of tools that are critical for advancing breeding with molecular markers in an agricultural species with high genetic diversity. PMID:26070980

  13. Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus).


    Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric


    Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization. PMID:25047482

  14. Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus).


    Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric


    Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization.

  15. Development and validation of the Axiom(®) Apple480K SNP genotyping array.


    Bianco, Luca; Cestaro, Alessandro; Linsmith, Gareth; Muranty, Hélène; Denancé, Caroline; Théron, Anthony; Poncet, Charles; Micheletti, Diego; Kerschbamer, Emanuela; Di Pierro, Erica A; Larger, Simone; Pindo, Massimo; Van de Weg, Eric; Davassi, Alessandro; Laurens, François; Velasco, Riccardo; Durel, Charles-Eric; Troggio, Michela


    Cultivated apple (Malus × domestica Borkh.) is one of the most important fruit crops in temperate regions, and has great economic and cultural value. The apple genome is highly heterozygous and has undergone a recent duplication which, combined with a rapid linkage disequilibrium decay, makes it difficult to perform genome-wide association (GWA) studies. Single nucleotide polymorphism arrays offer highly multiplexed assays at a relatively low cost per data point and can be a valid tool for the identification of the markers associated with traits of interest. Here, we describe the development and validation of a 487K SNP Affymetrix Axiom(®) genotyping array for apple and discuss its potential applications. The array has been built from the high-depth resequencing of 63 different cultivars covering most of the genetic diversity in cultivated apple. The SNPs were chosen by applying a focal points approach to enrich genic regions, but also to reach a uniform coverage of non-genic regions. A total of 1324 apple accessions, including the 92 progenies of two mapping populations, have been genotyped with the Axiom(®) Apple480K to assess the effectiveness of the array. A large majority of SNPs (359 994 or 74%) fell in the stringent class of poly high resolution polymorphisms. We also devised a filtering procedure to identify a subset of 275K very robust markers that can be safely used for germplasm surveys in apple. The Axiom(®) Apple480K has now been commercially released both for public and proprietary use and will likely be a reference tool for GWA studies in apple. PMID:26919684

  16. Discovery of a large set of SNP and SSR genetic markers by high-throughput sequencing of pepper (Capsicum annuum).


    Nicolaï, M; Pisani, C; Bouchet, J-P; Vuylsteke, M; Palloix, A


    Genetic markers based on single nucleotide polymorphisms (SNPs) are in increasing demand for genome mapping and fingerprinting of breeding populations in crop plants. Recent advances in high-throughput sequencing provide the opportunity for whole-genome resequencing and identification of allelic variants by mapping the reads to a reference genome. However, for many species, such as pepper (Capsicum annuum), a reference genome sequence is not yet available. To this end, we sequenced the C. annuum cv. "Yolo Wonder" transcriptome using Roche 454 pyrosequencing and assembled de novo 23,748 isotigs and 60,370 singletons. Mapping of 10,886,425 reads obtained by the Illumina GA II sequencing of C. annuum cv. "Criollo de Morelos 334" to the "Yolo Wonder" transcriptome allowed for SNP identification. By setting a threshold value that allows selecting reliable SNPs with minimal loss of information, 11,849 reliable SNPs spread across 5919 isotigs were identified. In addition, 853 single sequence repeats were obtained. This information has been made available online.

  17. Discovery of a large set of SNP and SSR genetic markers by high-throughput sequencing of pepper (Capsicum annuum).


    Nicolaï, M; Pisani, C; Bouchet, J-P; Vuylsteke, M; Palloix, A


    Genetic markers based on single nucleotide polymorphisms (SNPs) are in increasing demand for genome mapping and fingerprinting of breeding populations in crop plants. Recent advances in high-throughput sequencing provide the opportunity for whole-genome resequencing and identification of allelic variants by mapping the reads to a reference genome. However, for many species, such as pepper (Capsicum annuum), a reference genome sequence is not yet available. To this end, we sequenced the C. annuum cv. "Yolo Wonder" transcriptome using Roche 454 pyrosequencing and assembled de novo 23,748 isotigs and 60,370 singletons. Mapping of 10,886,425 reads obtained by the Illumina GA II sequencing of C. annuum cv. "Criollo de Morelos 334" to the "Yolo Wonder" transcriptome allowed for SNP identification. By setting a threshold value that allows selecting reliable SNPs with minimal loss of information, 11,849 reliable SNPs spread across 5919 isotigs were identified. In addition, 853 single sequence repeats were obtained. This information has been made available online. PMID:22911599

  18. Selection of highly informative SNP markers for population affiliation of major US populations.


    Zeng, Xiangpei; Chakraborty, Ranajit; King, Jonathan L; LaRue, Bobby; Moura-Neto, Rodrigo S; Budowle, Bruce


    Ancestry informative markers (AIMs) can be used to detect and adjust for population stratification and predict the ancestry of the source of an evidence sample. Autosomal single nucleotide polymorphisms (SNPs) are the best candidates for AIMs. It is essential to identify the most informative AIM SNPs across relevant populations. Several informativeness measures for ancestry estimation have been used for AIMs selection: absolute allele frequency differences (δ), F statistics (F ST), and informativeness for assignment measure (In). However, their efficacy has not been compared objectively, particularly for determining affiliations of major US populations. In this study, these three measures were directly compared for AIMs selection among four major US populations, i.e., African American, Caucasian, East Asian, and Hispanic American. The results showed that the F ST panel performed slightly better for population resolution based on principal component analysis (PCA) clustering than did the δ panel and both performed better than the In panel. Therefore, the 23 AIMs selected by the F ST measure were used to characterize the four major American populations. Genotype data of nine sample populations were used to evaluate the efficiency of the 23-AIMs panel. The results indicated that individuals could be correctly assigned to the major population categories. Our AIMs panel could contribute to the candidate pool of AIMs for potential forensic identification purposes. PMID:26645290

  19. De Novo Transcriptome Assembly of Pummelo and Molecular Marker Development

    PubMed Central

    Liang, Mei; Yang, Xiaoming; Li, Hang; Su, Shiying; Yi, Hualin; Chai, Lijun; Deng, Xiuxin


    Pummelo (Citrus grandis) is an important fruit crop worldwide because of its nutritional value. To accelerate the pummelo breeding program, it is essential to obtain extensive genetic information and develop relative molecular markers. Here, we obtained a 12-Gb transcriptome dataset of pummelo through a mixture of RNA from seven tissues using Illumina pair-end sequencing, assembled into 57,212 unigenes with an average length of 1010 bp. The annotation and classification results showed that a total of 39,584 unigenes had similar hits to the known proteins of four public databases, and 31,501 were classified into 55 Gene Ontology (GO) functional sub-categories. The search for putative molecular markers among 57,212 unigenes identified 10,276 simple sequence repeats (SSRs) and 64,720 single nucleotide polymorphisms (SNPs). High-quality primers of 1174 SSR loci were designed, of which 88.16% were localized to nine chromosomes of sweet orange. Of 100 SSR primers that were randomly selected for testing, 87 successfully amplified clear banding patterns. Of these primers, 29 with a mean PIC (polymorphic information content) value of 0.52 were effectively applied for phylogenetic analysis. Of the 20 SNP primers, 14 primers, including 54 potential SNPs, yielded target amplifications, and 46 loci were verified via Sanger sequencing. This new dataset will be a valuable resource for molecular biology studies of pummelo and provides reliable information regarding SNP and SSR marker development, thus expediting the breeding program of pummelo. PMID:25799271

  20. High-density genetic linkage map construction and identification of fruit-related QTLs in pear using SNP and SSR markers.


    Wu, Jun; Li, Lei-Ting; Li, Meng; Khan, M Awais; Li, Xiu-Gen; Chen, Hui; Yin, Hao; Zhang, Shao-Ling


    Pear (Pyrus spp) is an important fruit crop, grown in all temperate regions of the world, with global production ranked after grape and apples among deciduous tree crops. A high-density linkage map is a valuable tool for fine mapping quantitative trait loci (QTL) and map-based gene cloning. In this study, we firstly constructed a high-density linkage map of pear using SNPs integrated with SSRs, developed by the rapid and robust technology of restriction-associated DNA sequencing (RADseq). The linkage map consists of 3143 SNP markers and 98 SSRs, 3241 markers in total, spanning 2243.4 cM, with an average marker distance of 0.70 cM. Anchoring SSRs were able to anchor seventeen linkage groups to their corresponding chromosomes. Based on this high-density integrated pear linkage map and two years of fruit phenotyping, a total of 32 potential QTLs for 11 traits, including length of pedicel (LFP), single fruit weight (SFW), soluble solid content (SSC), transverse diameter (TD), vertical diameter (VD), calyx status (CS), flesh colour (FC), juice content (JC), number of seeds (NS), skin colour (SC), and skin smooth (SS), were identified and positioned on the genetic map. Among them, some important fruit-related traits have for the first time been identified, such as calyx status, length of pedicel, and flesh colour, and reliable localization of QTLs were verified repeatable. This high-density linkage map of pear is a worthy reference for mapping important fruit traits, QTL identification, and comparison and combination of different genetic maps.

  1. Quantitative trait loci controlling aluminum tolerance in soybean: candidate gene and SNP marker discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aluminum (Al) toxicity is an important abiotic stress that affects soybean production in acidic soils. Development of Al-tolerant cultivars is an efficient and environmentally friendly solution to the problem. Effective selection of Al-tolerant genotypes in applied breeding requires an understanding...

  2. SNP development from RNA-seq data in a nonmodel fish: how many individuals are needed for accurate allele frequency prediction?


    Schunter, C; Garza, J C; Macpherson, E; Pascual, M


    Single nucleotide polymorphisms (SNPs) are rapidly becoming the marker of choice in population genetics due to a variety of advantages relative to other markers, including higher genomic density, data quality, reproducibility and genotyping efficiency, as well as ease of portability between laboratories. Advances in sequencing technology and methodologies to reduce genomic representation have made the isolation of SNPs feasible for nonmodel organisms. RNA-seq is one such technique for the discovery of SNPs and development of markers for large-scale genotyping. Here, we report the development of 192 validated SNP markers for parentage analysis in Tripterygion delaisi (the black-faced blenny), a small rocky-shore fish from the Mediterranean Sea. RNA-seq data for 15 individual samples were used for SNP discovery by applying a series of selection criteria. Genotypes were then collected from 1599 individuals from the same population with the resulting loci. Differences in heterozygosity and allele frequencies were found between the two data sets. Heterozygosity was lower, on average, in the population sample, and the mean difference between the frequencies of particular alleles in the two data sets was 0.135 ± 0.100. We used bootstrap resampling of the sequence data to predict appropriate sample sizes for SNP discovery. As cDNA library production is time-consuming and expensive, we suggest that using seven individuals for RNA sequencing reduces the probability of discarding highly informative SNP loci, due to lack of observed polymorphism, whereas use of more than 12 samples does not considerably improve prediction of true allele frequencies.

  3. Genetic Diversity, Linkage Disequilibrium and Selection Signatures in Chinese and Western Pigs Revealed by Genome-Wide SNP Markers

    PubMed Central

    Ai, Huashui; Huang, Lusheng; Ren, Jun


    To investigate population structure, linkage disequilibrium (LD) pattern and selection signature at the genome level in Chinese and Western pigs, we genotyped 304 unrelated animals from 18 diverse populations using porcine 60 K SNP chips. We confirmed the divergent evolution between Chinese and Western pigs and showed distinct topological structures of the tested populations. We acquired the evidence for the introgression of Western pigs into two Chinese pig breeds. Analysis of runs of homozygosity revealed that historical inbreeding reduced genetic variability in several Chinese breeds. We found that intrapopulation LD extents are roughly comparable between Chinese and Western pigs. However, interpopulation LD is much longer in Western pigs compared with Chinese pigs with average r20.3 values of 125 kb for Western pigs and only 10.5 kb for Chinese pigs. The finding indicates that higher-density markers are required to capture LD with causal variants in genome-wide association studies and genomic selection on Chinese pigs. Further, we looked across the genome to identify candidate loci under selection using FST outlier tests on two contrast samples: Tibetan pigs versus lowland pigs and belted pigs against non-belted pigs. Interestingly, we highlighted several genes including ADAMTS12, SIM1 and NOS1 that show signatures of natural selection in Tibetan pigs and are likely important for genetic adaptation to high altitude. Comparison of our findings with previous reports indicates that the underlying genetic basis for high-altitude adaptation in Tibetan pigs, Tibetan peoples and yaks is likely distinct from one another. Moreover, we identified the strongest signal of directional selection at the EDNRB loci in Chinese belted pigs, supporting EDNRB as a promising candidate gene for the white belt coat color in Chinese pigs. Altogether, our findings advance the understanding of the genome biology of Chinese and Western pigs. PMID:23409110

  4. RNA-Seq-Mediated Transcriptome Analysis of a Fiberless Mutant Cotton and Its Possible Origin Based on SNP Markers.


    Ma, Qifeng; Wu, Man; Pei, Wenfeng; Wang, Xiaoyan; Zhai, Honghong; Wang, Wenkui; Li, Xingli; Zhang, Jinfa; Yu, Jiwen; Yu, Shuxun


    As the longest known single-celled trichomes, cotton (Gossypium L.) fibers constitute a classic model system to investigate cell initiation and elongation. In this study, we used a high-throughput transcriptome sequencing technology to identify fiber-initiation-related single nucleotide polymorphism (SNP) markers and differentially expressed genes (DEGs) between the wild-type (WT) Upland cotton (G. hirsutum) Xuzhou 142 and its natural fuzzless-lintless mutant Xuzhou 142 fl. Approximately 700 million high-quality cDNA reads representing over 58 Gb of sequences were obtained, resulting in the identification of 28,610 SNPs--of which 17,479 were novel--from 13,960 expressed genes. Of these SNPs, 50% of SNPs in fl were identical to those of G. barbadense, which suggests the likely origin of the fl mutant from an interspecific hybridization between Xuzhou 142 and an unknown G. barbadense genotype. Of all detected SNPs, 15,555, 12,750, and 305 were classified as non-synonymous, synonymous, and pre-terminated ones, respectively. Moreover, 1,352 insertion/deletion polymorphisms (InDels) were also detected. A total of 865 DEGs were identified between the WT and fl in ovules at -3 and 0 days post-anthesis, with 302 candidate SNPs selected from these DEGs for validation by a high-resolution melting analysis and Sanger sequencing in seven cotton genotypes. The number of genotypic pairwise polymorphisms varied from 43 to 302, indicating that the identified SNPs are reliable. These SNPs should serve as good resources for breeding and genetic studies in cotton. PMID:26990639

  5. Development and Validation of a High-Density SNP Genotyping Array for African Oil Palm.


    Kwong, Qi Bin; Teh, Chee Keng; Ong, Ai Ling; Heng, Huey Ying; Lee, Heng Leng; Mohamed, Mohaimi; Low, Joel Zi-Bin; Apparow, Sukganah; Chew, Fook Tim; Mayes, Sean; Kulaveerasingam, Harikrishna; Tammi, Martti; Appleton, David Ross


    High-density single nucleotide polymorphism (SNP) genotyping arrays are powerful tools that can measure the level of genetic polymorphism within a population. To develop a whole-genome SNP array for oil palms, SNP discovery was performed using deep resequencing of eight libraries derived from 132 Elaeis guineensis and Elaeis oleifera palms belonging to 59 origins, resulting in the discovery of >3 million putative SNPs. After SNP filtering, the Illumina OP200K custom array was built with 170 860 successful probes. Phenetic clustering analysis revealed that the array could distinguish between palms of different origins in a way consistent with pedigree records. Genome-wide linkage disequilibrium declined more slowly for the commercial populations (ranging from 120 kb at r(2) = 0.43 to 146 kb at r(2) = 0.50) when compared with the semi-wild populations (19.5 kb at r(2) = 0.22). Genetic fixation mapping comparing the semi-wild and commercial population identified 321 selective sweeps. A genome-wide association study (GWAS) detected a significant peak on chromosome 2 associated with the polygenic component of the shell thickness trait (based on the trait shell-to-fruit; S/F %) in tenera palms. Testing of a genomic selection model on the same trait resulted in good prediction accuracy (r = 0.65) with 42% of the S/F % variation explained. The first high-density SNP genotyping array for oil palm has been developed and shown to be robust for use in genetic studies and with potential for developing early trait prediction to shorten the oil palm breeding cycle.

  6. Development and Validation of a High-Density SNP Genotyping Array for African Oil Palm.


    Kwong, Qi Bin; Teh, Chee Keng; Ong, Ai Ling; Heng, Huey Ying; Lee, Heng Leng; Mohamed, Mohaimi; Low, Joel Zi-Bin; Apparow, Sukganah; Chew, Fook Tim; Mayes, Sean; Kulaveerasingam, Harikrishna; Tammi, Martti; Appleton, David Ross


    High-density single nucleotide polymorphism (SNP) genotyping arrays are powerful tools that can measure the level of genetic polymorphism within a population. To develop a whole-genome SNP array for oil palms, SNP discovery was performed using deep resequencing of eight libraries derived from 132 Elaeis guineensis and Elaeis oleifera palms belonging to 59 origins, resulting in the discovery of >3 million putative SNPs. After SNP filtering, the Illumina OP200K custom array was built with 170 860 successful probes. Phenetic clustering analysis revealed that the array could distinguish between palms of different origins in a way consistent with pedigree records. Genome-wide linkage disequilibrium declined more slowly for the commercial populations (ranging from 120 kb at r(2) = 0.43 to 146 kb at r(2) = 0.50) when compared with the semi-wild populations (19.5 kb at r(2) = 0.22). Genetic fixation mapping comparing the semi-wild and commercial population identified 321 selective sweeps. A genome-wide association study (GWAS) detected a significant peak on chromosome 2 associated with the polygenic component of the shell thickness trait (based on the trait shell-to-fruit; S/F %) in tenera palms. Testing of a genomic selection model on the same trait resulted in good prediction accuracy (r = 0.65) with 42% of the S/F % variation explained. The first high-density SNP genotyping array for oil palm has been developed and shown to be robust for use in genetic studies and with potential for developing early trait prediction to shorten the oil palm breeding cycle. PMID:27112659

  7. High-density genetic linkage mapping in turbot (Scophthalmus maximus L.) based on SNP markers and major sex- and growth-related regions detection.


    Wang, Weiji; Hu, Yulong; Ma, Yu; Xu, Liyong; Guan, Jiantao; Kong, Jie


    This paper describes the development of a high density consensus genetic linkage map of a turbot (Scophthalmus maximus L.) family composed of 149 mapping individuals using Single Nucleotide Polymorphisms (SNP) developed using the restriction-site associated DNA (RAD) sequencing technique with the restriction enzyme, PstI. A total of 6,647 SNPs were assigned to 22 linkage groups, which is equal to the number of chromosome pairs in turbot. For the first time, the average marker interval reached 0.3958 cM, which is equal to approximately 0.1203 Mb of the turbot genome. The observed 99.34% genome coverage indicates that the linkage map was genome-wide. A total of 220 Quantitative Traits Locus (QTLs) associated with two body length traits, two body weight traits in different growth periods and sex determination were detected with an LOD > 5.0 in 12 linkage groups (LGs), which explained the corresponding phenotypic variance (R2), ranging from 14.4-100%. Among them, 175 overlapped with linked SNPs, and the remaining 45 were located in regions between contiguous SNPs. According to the QTLs related to growth trait distribution and the changing of LGs during different growth periods, the growth traits are likely controlled by multi-SNPs distributed on several LGs; the effect of these SNPs changed during different growth periods. Most sex-related QTLs were detected at LG 21 with a linkage span of 70.882 cM. Additionally, a small number of QTLs with high feasibility and a narrow R2 distribution were also observed on LG7 and LG14, suggesting that multi LGs or chromosomes might be involved in sex determination. High homology was recorded between LG21 in Cynoglossus semilaevis and turbot. This high-saturated turbot RAD-Seq linkage map is undoubtedly a promising platform for marker assisted selection (MAS) and flatfish genomics research.

  8. SNP discovery by amplicon sequencing and multiplex SNP genotyping in the allopolyploid species Brassica napus.


    Durstewitz, G; Polley, A; Plieske, J; Luerssen, H; Graner, E M; Wieseke, R; Ganal, M W


    Oilseed rape (Brassica napus) is an allotetraploid species consisting of two genomes, derived from B. rapa (A genome) and B. oleracea (C genome). The presence of these two genomes makes single nucleotide polymorphism (SNP) marker identification and SNP analysis more challenging than in diploid species, as for a given locus usually two versions of a DNA sequence (based on the two ancestral genomes) have to be analyzed simultaneously during SNP identification and analysis. One hundred amplicons derived from expressed sequence tag (ESTs) were analyzed to identify SNPs in a panel of oilseed rape varieties and within two sister species representing the ancestral genomes. A total of 604 SNPs were identified, averaging one SNP in every 42 bp. It was possible to clearly discriminate SNPs that are polymorphic between different plant varieties from SNPs differentiating the two ancestral genomes. To validate the identified SNPs for their use in genetic analysis, we have developed Illumina GoldenGate assays for some of the identified SNPs. Through the analysis of a number of oilseed rape varieties and mapping populations with GoldenGate assays, we were able to identify a number of different segregation patterns in allotetraploid oilseed rape. The majority of the identified SNP markers can be readily used for genetic mapping, showing that amplicon sequencing and Illumina GoldenGate assays can be used to reliably identify SNP markers in tetraploid oilseed rape and to convert them into successful SNP assays that can be used for genetic analysis.

  9. Accuracy of Assignment of Atlantic Salmon (Salmo salar L.) to Rivers and Regions in Scotland and Northeast England Based on Single Nucleotide Polymorphism (SNP) Markers

    PubMed Central

    Gilbey, John; Cauwelier, Eef; Coulson, Mark W.; Stradmeyer, Lee; Sampayo, James N.; Armstrong, Anja; Verspoor, Eric; Corrigan, Laura; Shelley, Jonathan; Middlemas, Stuart


    Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L.), and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP) markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations. PMID:27723810

  10. RAD SNP markers as a tool for conservation of dolphinfish Coryphaena hippurus in the Mediterranean Sea: Identification of subtle genetic structure and assessment of populations sex-ratios.


    Maroso, Francesco; Franch, Rafaella; Dalla Rovere, Giulia; Arculeo, Marco; Bargelloni, Luca


    Dolphinfish is an important fish species for both commercial and sport fishing, but so far limited information is available on genetic variability and pattern of differentiation of dolphinfish populations in the Mediterranean basin. Recently developed techniques allow genome-wide identification of genetic markers for better understanding of population structure in species with limited genome information. Using restriction-site associated DNA analysis we successfully genotyped 140 individuals of dolphinfish from eight locations in the Mediterranean Sea at 3324 SNP loci. We identified 311 sex-related loci that were used to assess sex-ratio in dolphinfish populations. In addition, we identified a weak signature of genetic differentiation of the population closer to Gibraltar Strait in comparison to other Mediterranean populations, which might be related to introgression of individuals from Atlantic. No further genetic differentiation could be detected in the other populations sampled, as expected considering the known highly mobility of the species. The results obtained improve our knowledge of the species and can help managing dolphinfish stock in the future.

  11. RAD SNP markers as a tool for conservation of dolphinfish Coryphaena hippurus in the Mediterranean Sea: Identification of subtle genetic structure and assessment of populations sex-ratios.


    Maroso, Francesco; Franch, Rafaella; Dalla Rovere, Giulia; Arculeo, Marco; Bargelloni, Luca


    Dolphinfish is an important fish species for both commercial and sport fishing, but so far limited information is available on genetic variability and pattern of differentiation of dolphinfish populations in the Mediterranean basin. Recently developed techniques allow genome-wide identification of genetic markers for better understanding of population structure in species with limited genome information. Using restriction-site associated DNA analysis we successfully genotyped 140 individuals of dolphinfish from eight locations in the Mediterranean Sea at 3324 SNP loci. We identified 311 sex-related loci that were used to assess sex-ratio in dolphinfish populations. In addition, we identified a weak signature of genetic differentiation of the population closer to Gibraltar Strait in comparison to other Mediterranean populations, which might be related to introgression of individuals from Atlantic. No further genetic differentiation could be detected in the other populations sampled, as expected considering the known highly mobility of the species. The results obtained improve our knowledge of the species and can help managing dolphinfish stock in the future. PMID:27450636

  12. SNP-VISTA: An interactive SNP visualization tool

    PubMed Central

    Shah, Nameeta; Teplitsky, Michael V; Minovitsky, Simon; Pennacchio, Len A; Hugenholtz, Philip; Hamann, Bernd; Dubchak, Inna L


    Background Recent advances in sequencing technologies promise to provide a better understanding of the genetics of human disease as well as the evolution of microbial populations. Single Nucleotide Polymorphisms (SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it has become possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease in an attempt to identify causative mutations. In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmental samples enables more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at [1]. Results We have developed and present two modifications of an interactive visualization tool, SNP-VISTA, to aid in the analyses of the following types of data: A. Large-scale re-sequence data of disease-related genes for discovery of associated and/or causative alleles (GeneSNP-VISTA). B. Massive amounts of ecogenomics data for studying homologous recombination in microbial populations (EcoSNP-VISTA). The main features and capabilities of SNP-VISTA are: 1) mapping of SNPs to gene structure; 2) classification of SNPs, based on their location in the gene, frequency of occurrence in samples and allele composition; 3) clustering, based on user-defined subsets of SNPs, highlighting haplotypes as well as recombinant sequences; 4) integration of protein evolutionary conservation visualization; and 5) display of automatically calculated recombination points that are user-editable. Conclusion The main strength of SNP-VISTA is its graphical interface and use of visual representations, which support interactive exploration and hence better understanding of large-scale SNP data by the user. PMID

  13. New resources for genetic studies in Populus nigra: genome-wide SNP discovery and development of a 12k Infinium array.


    Faivre-Rampant, P; Zaina, G; Jorge, V; Giacomello, S; Segura, V; Scalabrin, S; Guérin, V; De Paoli, E; Aluome, C; Viger, M; Cattonaro, F; Payne, A; PaulStephenRaj, P; Le Paslier, M C; Berard, A; Allwright, M R; Villar, M; Taylor, G; Bastien, C; Morgante, M


    Whole genome resequencing of 51 Populus nigra (L.) individuals from across Western Europe was performed using Illumina platforms. A total number of 1 878 727 SNPs distributed along the P. nigra reference sequence were identified. The SNP calling accuracy was validated with Sanger sequencing. SNPs were selected within 14 previously identified QTL regions, 2916 expressional candidate genes related to rust resistance, wood properties, water-use efficiency and bud phenology and 1732 genes randomly spread across the genome. Over 10 000 SNPs were selected for the construction of a 12k Infinium Bead-Chip array dedicated to association mapping. The SNP genotyping assay was performed with 888 P. nigra individuals. The genotyping success rate was 91%. Our high success rate was due to the discovery panel design and the stringent parameters applied for SNP calling and selection. In the same set of P. nigra genotypes, linkage disequilibrium throughout the genome decayed on average within 5-7 kb to half of its maximum value. As an application test, ADMIXTURE analysis was performed with a selection of 600 SNPs spread throughout the genome and 706 individuals collected along 12 river basins. The admixture pattern was consistent with genetic diversity revealed by neutral markers and the geographical distribution of the populations. These newly developed SNP resources and genotyping array provide a valuable tool for population genetic studies and identification of QTLs through natural-population based genetic association studies in P. nigra. PMID:26929265

  14. Development and validation of a 20K single nucleotide polymorphism (SNP) whole genome genotyping array for apple (Malus × domestica Borkh).


    Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela


    High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.

  15. A method for selection of restriction enzymes for sdCAPS marker construction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Development of PCR-based markers for SNP detection is prerequisite for various genetic analyses. The use of restriction enzymes following PCR amplification is a common and relatively low cost method for SNP detection. Simple and cost-effective methodologies for SNP marker development that would en...

  16. Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

  17. A Brassica rapa linkage map of EST-based SNP markers for identification of candidate genes controlling flowering time and leaf morphological traits.


    Li, Feng; Kitashiba, Hiroyasu; Inaba, Kiyofumi; Nishio, Takeshi


    For identification of genes responsible for varietal differences in flowering time and leaf morphological traits, we constructed a linkage map of Brassica rapa DNA markers including 170 EST-based markers, 12 SSR markers, and 59 BAC sequence-based markers, of which 151 are single nucleotide polymorphism (SNP) markers. By BLASTN, 223 markers were shown to have homologous regions in Arabidopsis thaliana, and these homologous loci covered nearly the whole genome of A. thaliana. Synteny analysis between B. rapa and A. thaliana revealed 33 large syntenic regions. Three quantitative trait loci (QTLs) for flowering time were detected. BrFLC1 and BrFLC2 were linked to the QTLs for bolting time, budding time, and flowering time. Three SNPs in the promoter, which may be the cause of low expression of BrFLC2 in the early-flowering parental line, were identified. For leaf lobe depth and leaf hairiness, one major QTL corresponding to a syntenic region containing GIBBERELLIN 20 OXIDASE 3 and one major QTL containing BrGL1, respectively, were detected. Analysis of nucleotide sequences and expression of these genes suggested possible involvement of these genes in leaf morphological traits.

  18. A Brassica rapa Linkage Map of EST-based SNP Markers for Identification of Candidate Genes Controlling Flowering Time and Leaf Morphological Traits

    PubMed Central

    Li, Feng; Kitashiba, Hiroyasu; Inaba, Kiyofumi; Nishio, Takeshi


    For identification of genes responsible for varietal differences in flowering time and leaf morphological traits, we constructed a linkage map of Brassica rapa DNA markers including 170 EST-based markers, 12 SSR markers, and 59 BAC sequence-based markers, of which 151 are single nucleotide polymorphism (SNP) markers. By BLASTN, 223 markers were shown to have homologous regions in Arabidopsis thaliana, and these homologous loci covered nearly the whole genome of A. thaliana. Synteny analysis between B. rapa and A. thaliana revealed 33 large syntenic regions. Three quantitative trait loci (QTLs) for flowering time were detected. BrFLC1 and BrFLC2 were linked to the QTLs for bolting time, budding time, and flowering time. Three SNPs in the promoter, which may be the cause of low expression of BrFLC2 in the early-flowering parental line, were identified. For leaf lobe depth and leaf hairiness, one major QTL corresponding to a syntenic region containing GIBBERELLIN 20 OXIDASE 3 and one major QTL containing BrGL1, respectively, were detected. Analysis of nucleotide sequences and expression of these genes suggested possible involvement of these genes in leaf morphological traits. PMID:19884167

  19. SNP ID-info: SNP ID searching and visualization platform.


    Yang, Cheng-Hong; Chuang, Li-Yeh; Cheng, Yu-Huei; Wen, Cheng-Hao; Chang, Phei-Lang; Chang, Hsueh-Wei


    Many association studies provide the relationship between single nucleotide polymorphisms (SNPs), diseases and cancers, without giving a SNP ID, however. Here, we developed the SNP ID-info freeware to provide the SNP IDs within inputting genetic and physical information of genomes. The program provides an "SNP-ePCR" function to generate the full-sequence using primers and template inputs. In "SNPosition," sequence from SNP-ePCR or direct input is fed to match the SNP IDs from SNP fasta-sequence. In "SNP search" and "SNP fasta" function, information of SNPs within the cytogenetic band, contig position, and keyword input are acceptable. Finally, the SNP ID neighboring environment for inputs is completely visualized in the order of contig position and marked with SNP and flanking hits. The SNP identification problems inherent in NCBI SNP BLAST are also avoided. In conclusion, the SNP ID-info provides a visualized SNP ID environment for multiple inputs and assists systematic SNP association studies. The server and user manual are available at

  20. AncestrySNPminer: A bioinformatics tool to retrieve and develop ancestry informative SNP panels

    PubMed Central

    Amirisetty, Sushil; Khurana Hershey, Gurjit K.; Baye, Tesfaye M.


    A wealth of genomic information is available in public and private databases. However, this information is underutilized for uncovering population specific and functionally relevant markers underlying complex human traits. Given the huge amount of SNP data available from the annotation of human genetic variation, data mining is a faster and cost effective approach for investigating the number of SNPs that are informative for ancestry. In this study, we present AncestrySNPminer, the first web-based bioinformatics tool specifically designed to retrieve Ancestry Informative Markers (AIMs) from genomic data sets and link these informative markers to genes and ontological annotation classes. The tool includes an automated and simple “scripting at the click of a button” functionality that enables researchers to perform various population genomics statistical analyses methods with user friendly querying and filtering of data sets across various populations through a single web interface. AncestrySNPminer can be freely accessed at PMID:22584067

  1. Leaf Transcriptome Sequencing for Identifying Genic-SSR Markers and SNP Heterozygosity in Crossbred Mango Variety ‘Amrapali’ (Mangifera indica L.)

    PubMed Central

    Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar


    Mango (Mangifera indica L.) is called “king of fruits” due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties ‘Neelam’, ‘Dashehari’ and their hybrid ‘Amrapali’ using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango. PMID:27736892

  2. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.).


    Koning-Boucoiran, Carole F S; Esselink, G Danny; Vukosavljev, Mirjana; van 't Westende, Wendy P C; Gitonga, Virginia W; Krens, Frans A; Voorrips, Roeland E; van de Weg, W Eric; Schulz, Dietmar; Debener, Thomas; Maliepaard, Chris; Arens, Paul; Smulders, Marinus J M


    In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs) within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array. Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L.) genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.

  3. Mapping a Large Number of QTL for Durable Resistance to Stripe Rust in Winter Wheat Druchamp Using SSR and SNP Markers

    PubMed Central

    Hou, Lu; Chen, Xianming; Wang, Meinan; See, Deven R.; Chao, Shiaoman; Bulli, Peter; Jing, Jinxue


    Winter wheat Druchamp has both high-temperature adult-plant (HTAP) resistance and all-stage resistance to stripe rust caused by Puccinia striiformis f. sp. tritici (Pst). The HTAP resistance in Druchamp is durable as the variety has been resistant in adult-plant stage since it was introduced from France to the United States in late 1940s. To map the quantitative trait loci (QTL) for stripe rust resistance, an F8 recombinant inbred line (RIL) population from cross Druchamp × Michigan Amber was phenotyped for stripe rust response in multiple years in fields under natural infection and with selected Pst races under controlled greenhouse conditions, and genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers. Composite interval mapping (CIM) identified eight HTAP resistance QTL and three all-stage resistance QTL. Among the eight HTAP resistance QTL, QYrdr.wgp-1BL.2 (explaining 2.36-31.04% variation), QYrdr.wgp-2BL (2.81–15.65%), QYrdr.wgp-5AL (2.27–17.22%) and QYrdr.wgp-5BL.2 (2.42–15.13%) were significant in all tests; and QYrdr.wgp-1BL.1 (1.94–10.19%), QYrdr.wgp-1DS (2.04–27.24%), QYrdr.wgp-3AL (1.78–13.85%) and QYrdr.wgp-6BL.2 (1.69–33.71%) were significant in some of the tests. The three all-stage resistance QTL, QYrdr.wgp-5BL.1 (5.47–36.04%), QYrdr.wgp-5DL (9.27–11.94%) and QYrdr.wgp-6BL.1 (13.07-20.36%), were detected based on reactions in the seedlings tested with certain Pst races. Among the eleven QTL detected in Druchamp, at least three (QYrdr.wgp-5DL for race-specific all-stage resistance and QYrdr.wgp-3AL and QYrdr.wgp-6BL.2 for race non-specific HTAP resistance) are new. All these QTL, especially those for durable HTAP resistance, and their closely linked molecular markers could be useful for developing wheat cultivars with durable resistance to stripe rust. PMID:25970329

  4. Mapping a Large Number of QTL for Durable Resistance to Stripe Rust in Winter Wheat Druchamp Using SSR and SNP Markers.


    Hou, Lu; Chen, Xianming; Wang, Meinan; See, Deven R; Chao, Shiaoman; Bulli, Peter; Jing, Jinxue


    Winter wheat Druchamp has both high-temperature adult-plant (HTAP) resistance and all-stage resistance to stripe rust caused by Puccinia striiformis f. sp. tritici (Pst). The HTAP resistance in Druchamp is durable as the variety has been resistant in adult-plant stage since it was introduced from France to the United States in late 1940s. To map the quantitative trait loci (QTL) for stripe rust resistance, an F8 recombinant inbred line (RIL) population from cross Druchamp × Michigan Amber was phenotyped for stripe rust response in multiple years in fields under natural infection and with selected Pst races under controlled greenhouse conditions, and genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers. Composite interval mapping (CIM) identified eight HTAP resistance QTL and three all-stage resistance QTL. Among the eight HTAP resistance QTL, QYrdr.wgp-1BL.2 (explaining 2.36-31.04% variation), QYrdr.wgp-2BL (2.81-15.65%), QYrdr.wgp-5AL (2.27-17.22%) and QYrdr.wgp-5BL.2 (2.42-15.13%) were significant in all tests; and QYrdr.wgp-1BL.1 (1.94-10.19%), QYrdr.wgp-1DS (2.04-27.24%), QYrdr.wgp-3AL (1.78-13.85%) and QYrdr.wgp-6BL.2 (1.69-33.71%) were significant in some of the tests. The three all-stage resistance QTL, QYrdr.wgp-5BL.1 (5.47-36.04%), QYrdr.wgp-5DL (9.27-11.94%) and QYrdr.wgp-6BL.1 (13.07-20.36%), were detected based on reactions in the seedlings tested with certain Pst races. Among the eleven QTL detected in Druchamp, at least three (QYrdr.wgp-5DL for race-specific all-stage resistance and QYrdr.wgp-3AL and QYrdr.wgp-6BL.2 for race non-specific HTAP resistance) are new. All these QTL, especially those for durable HTAP resistance, and their closely linked molecular markers could be useful for developing wheat cultivars with durable resistance to stripe rust.

  5. Development of a RAD-Seq Based DNA Polymorphism Identification Software, AgroMarker Finder, and Its Application in Rice Marker-Assisted Breeding.


    Fan, Wei; Zong, Jie; Luo, Zhijing; Chen, Mingjiao; Zhao, Xiangxiang; Zhang, Dabing; Qi, Yiping; Yuan, Zheng


    Rapid and accurate genome-wide marker detection is essential to the marker-assisted breeding and functional genomics studies. In this work, we developed an integrated software, AgroMarker Finder (AMF:, for providing graphical user interface (GUI) to facilitate the recently developed restriction-site associated DNA (RAD) sequencing data analysis in rice. By application of AMF, a total of 90,743 high-quality markers (82,878 SNPs and 7,865 InDels) were detected between rice varieties JP69 and Jiaoyuan5A. The density of the identified markers is 0.2 per Kb for SNP markers, and 0.02 per Kb for InDel markers. Sequencing validation revealed that the accuracy of genome-wide marker detection by AMF is 93%. In addition, a validated subset of 82 SNPs and 31 InDels were found to be closely linked to 117 important agronomic trait genes, providing a basis for subsequent marker-assisted selection (MAS) and variety identification. Furthermore, we selected 12 markers from 31 validated InDel markers to identify seed authenticity of variety Jiaoyuanyou69, and we also identified 10 markers closely linked to the fragrant gene BADH2 to minimize linkage drag for Wuxiang075 (BADH2 donor)/Jiachang1 recombinants selection. Therefore, this software provides an efficient approach for marker identification from RAD-seq data, and it would be a valuable tool for plant MAS and variety protection. PMID:26799713

  6. Development of a RAD-Seq Based DNA Polymorphism Identification Software, AgroMarker Finder, and Its Application in Rice Marker-Assisted Breeding

    PubMed Central

    Luo, Zhijing; Chen, Mingjiao; Zhao, Xiangxiang; Zhang, Dabing; Qi, Yiping; Yuan, Zheng


    Rapid and accurate genome-wide marker detection is essential to the marker-assisted breeding and functional genomics studies. In this work, we developed an integrated software, AgroMarker Finder (AMF:, for providing graphical user interface (GUI) to facilitate the recently developed restriction-site associated DNA (RAD) sequencing data analysis in rice. By application of AMF, a total of 90,743 high-quality markers (82,878 SNPs and 7,865 InDels) were detected between rice varieties JP69 and Jiaoyuan5A. The density of the identified markers is 0.2 per Kb for SNP markers, and 0.02 per Kb for InDel markers. Sequencing validation revealed that the accuracy of genome-wide marker detection by AMF is 93%. In addition, a validated subset of 82 SNPs and 31 InDels were found to be closely linked to 117 important agronomic trait genes, providing a basis for subsequent marker-assisted selection (MAS) and variety identification. Furthermore, we selected 12 markers from 31 validated InDel markers to identify seed authenticity of variety Jiaoyuanyou69, and we also identified 10 markers closely linked to the fragrant gene BADH2 to minimize linkage drag for Wuxiang075 (BADH2 donor)/Jiachang1 recombinants selection. Therefore, this software provides an efficient approach for marker identification from RAD-seq data, and it would be a valuable tool for plant MAS and variety protection. PMID:26799713

  7. Development and evaluation of a genome-wide 6K SNP array for diploid sweet cherry and tetraploid sour cherry.


    Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C; Bryant, Douglas W; Wilhelm, Larry; Iezzoni, Amy


    High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome

  8. Development and evaluation of a genome-wide 6K SNP array for diploid sweet cherry and tetraploid sour cherry.


    Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C; Bryant, Douglas W; Wilhelm, Larry; Iezzoni, Amy


    High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome

  9. Development and Evaluation of a Genome-Wide 6K SNP Array for Diploid Sweet Cherry and Tetraploid Sour Cherry

    PubMed Central

    Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R.; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Iezzoni, Amy


    High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome

  10. Development of a SNP array and its application to genetic mapping and diversity assessment in pepper (Capsicum spp.).


    Cheng, Jiaowen; Qin, Cheng; Tang, Xin; Zhou, Huangkai; Hu, Yafei; Zhao, Zicheng; Cui, Junjie; Li, Bo; Wu, Zhiming; Yu, Jiping; Hu, Kailin


    The development and application of single nucleotide polymorphisms (SNPs) is in its infancy for pepper. Here, a set of 15,000 SNPs were chosen from the resequencing data to develop an array for pepper with 12,720 loci being ultimately synthesized. Of these, 8,199 (~64.46%) SNPs were found to be scorable and covered ~81.18% of the whole genome. With this array, a high-density interspecific genetic map with 5,569 SNPs was constructed using 297 F2 individuals, and genetic diversity of a panel of 399 pepper elite/landrace lines was successfully characterized. Based on the genetic map, one major QTL, named Up12.1, was detected for the fruit orientation trait. A total of 65 protein-coding genes were predicted within this QTL region based on the current annotation of the Zunla-1 genome. In summary, the thousands of well-validated SNP markers, high-density genetic map and genetic diversity information will be useful for molecular genetics and innovative breeding in pepper. Furthermore, the mapping results lay foundation for isolating the genes underlying variation in fruit orientation of Capsicum. PMID:27623541

  11. Development of a SNP array and its application to genetic mapping and diversity assessment in pepper (Capsicum spp.)

    PubMed Central

    Cheng, Jiaowen; Qin, Cheng; Tang, Xin; Zhou, Huangkai; Hu, Yafei; Zhao, Zicheng; Cui, Junjie; Li, Bo; Wu, Zhiming; Yu, Jiping; Hu, Kailin


    The development and application of single nucleotide polymorphisms (SNPs) is in its infancy for pepper. Here, a set of 15,000 SNPs were chosen from the resequencing data to develop an array for pepper with 12,720 loci being ultimately synthesized. Of these, 8,199 (~64.46%) SNPs were found to be scorable and covered ~81.18% of the whole genome. With this array, a high-density interspecific genetic map with 5,569 SNPs was constructed using 297 F2 individuals, and genetic diversity of a panel of 399 pepper elite/landrace lines was successfully characterized. Based on the genetic map, one major QTL, named Up12.1, was detected for the fruit orientation trait. A total of 65 protein-coding genes were predicted within this QTL region based on the current annotation of the Zunla-1 genome. In summary, the thousands of well-validated SNP markers, high-density genetic map and genetic diversity information will be useful for molecular genetics and innovative breeding in pepper. Furthermore, the mapping results lay foundation for isolating the genes underlying variation in fruit orientation of Capsicum. PMID:27623541

  12. Development of a SNP array and its application to genetic mapping and diversity assessment in pepper (Capsicum spp.).


    Cheng, Jiaowen; Qin, Cheng; Tang, Xin; Zhou, Huangkai; Hu, Yafei; Zhao, Zicheng; Cui, Junjie; Li, Bo; Wu, Zhiming; Yu, Jiping; Hu, Kailin


    The development and application of single nucleotide polymorphisms (SNPs) is in its infancy for pepper. Here, a set of 15,000 SNPs were chosen from the resequencing data to develop an array for pepper with 12,720 loci being ultimately synthesized. Of these, 8,199 (~64.46%) SNPs were found to be scorable and covered ~81.18% of the whole genome. With this array, a high-density interspecific genetic map with 5,569 SNPs was constructed using 297 F2 individuals, and genetic diversity of a panel of 399 pepper elite/landrace lines was successfully characterized. Based on the genetic map, one major QTL, named Up12.1, was detected for the fruit orientation trait. A total of 65 protein-coding genes were predicted within this QTL region based on the current annotation of the Zunla-1 genome. In summary, the thousands of well-validated SNP markers, high-density genetic map and genetic diversity information will be useful for molecular genetics and innovative breeding in pepper. Furthermore, the mapping results lay foundation for isolating the genes underlying variation in fruit orientation of Capsicum.

  13. Linkage mapping bovine EST-based SNP

    PubMed Central

    Snelling, Warren M; Casas, Eduardo; Stone, Roger T; Keele, John W; Harhay, Gregory P; Bennett, Gary L; Smith, Timothy PL


    Background Existing linkage maps of the bovine genome primarily contain anonymous microsatellite markers. These maps have proved valuable for mapping quantitative trait loci (QTL) to broad regions of the genome, but more closely spaced markers are needed to fine-map QTL, and markers associated with genes and annotated sequence are needed to identify genes and sequence variation that may explain QTL. Results Bovine expressed sequence tag (EST) and bacterial artificial chromosome (BAC)sequence data were used to develop 918 single nucleotide polymorphism (SNP) markers to map genes on the bovine linkage map. DNA of sires from the MARC reference population was used to detect SNPs, and progeny and mates of heterozygous sires were genotyped. Chromosome assignments for 861 SNPs were determined by twopoint analysis, and positions for 735 SNPs were established by multipoint analyses. Linkage maps of bovine autosomes with these SNPs represent 4585 markers in 2475 positions spanning 3058 cM . Markers include 3612 microsatellites, 913 SNPs and 60 other markers. Mean separation between marker positions is 1.2 cM. New SNP markers appear in 511 positions, with mean separation of 4.7 cM. Multi-allelic markers, mostly microsatellites, had a mean (maximum) of 216 (366) informative meioses, and a mean 3-lod confidence interval of 3.6 cM Bi-allelic markers, including SNP and other marker types, had a mean (maximum) of 55 (191) informative meioses, and were placed within a mean 8.5 cM 3-lod confidence interval. Homologous human sequences were identified for 1159 markers, including 582 newly developed and mapped SNP. Conclusion Addition of these EST- and BAC-based SNPs to the bovine linkage map not only increases marker density, but provides connections to gene-rich physical maps, including annotated human sequence. The map provides a resource for fine-mapping quantitative trait loci and identification of positional candidate genes, and can be integrated with other data to guide and

  14. A Coordinated Approach to Peach SNP Discovery in RosBREED

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the USDA-funded multi-institutional and trans-disciplinary project, “RosBREED”, crop-specific SNP genome scan platforms are being developed for peach, apple, strawberry, and cherry at a resolution of at least one polymorphic SNP marker every 5 cM in any random cross, for use in Pedigree-Based Ana...

  15. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli


    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  16. The development and characterization of a 60K SNP chip for chicken

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In livestock species like the chicken, high throughput SNP genotyping assays are increasingly being used for whole genome association studies and as a tool in breeding (referred to as genomic selection). We describe the design of a moderate density (60K) Illumina SNP BeadChip in chicken consisting o...

  17. Molecular marker development from transcript sequences and germplasm evaluation for cultivated peanut (Arachis hypogaea L.).


    Peng, Ze; Gallo, Maria; Tillman, Barry L; Rowland, Diane; Wang, Jianping


    Molecular markers are important tools for genotyping in genetic studies and molecular breeding. The SSR and SNP are two commonly used marker systems developed from genomic or transcript sequences. The objectives of this study were to: (1) assemble and annotate the publicly available ESTs in Arachis and the in-house short reads, (2) develop and validate SSR and SNP markers, and (3) investigate the genetic diversity and population structure of the peanut breeding lines and the U.S. peanut mini core collection using developed SSR markers. An NCBI EST dataset with 252,951 sequences and an in-house 454 RNAseq dataset with 288,701 sequences were assembled separately after trimming. Transcript sequence comparison and phylogenetic analysis suggested that peanut is closer to cowpea and scarlet bean than to soybean, common bean and Medicago. From these two datasets, 6455 novel SSRs and 11,902 SNPs were identified. Of the discovered SSRs, 380 representing various SSR types were selected for PCR validation. The amplification rate was 89.2 %. Twenty-two (6.5 %) SSRs were polymorphic between at least one pair of four genotypes. Sanger sequencing of PCR products targeting 110 SNPs revealed 13 true SNPs between tetraploid genotypes and 193 homoeologous SNPs within genotypes. Eight out of the 22 polymorphic SSR markers were selected to evaluate the genetic diversity of Florida peanut breeding lines and the U.S. peanut mini core collection. This marker set demonstrated high discrimination power by displaying an average polymorphism information content value of 0.783, a combined probability of identity of 10(-11), and a combined power of exclusion of 0.99991. The structure analysis revealed four sub-populations among the peanut accessions and lines evaluated. The results of this study enriched the peanut genomic resources, provided over 6000 novel SSR markers and the credentials for true peanut SNP marker development, and demonstrated the power of newly developed SSR markers in

  18. Molecular marker development from transcript sequences and germplasm evaluation for cultivated peanut (Arachis hypogaea L.).


    Peng, Ze; Gallo, Maria; Tillman, Barry L; Rowland, Diane; Wang, Jianping


    Molecular markers are important tools for genotyping in genetic studies and molecular breeding. The SSR and SNP are two commonly used marker systems developed from genomic or transcript sequences. The objectives of this study were to: (1) assemble and annotate the publicly available ESTs in Arachis and the in-house short reads, (2) develop and validate SSR and SNP markers, and (3) investigate the genetic diversity and population structure of the peanut breeding lines and the U.S. peanut mini core collection using developed SSR markers. An NCBI EST dataset with 252,951 sequences and an in-house 454 RNAseq dataset with 288,701 sequences were assembled separately after trimming. Transcript sequence comparison and phylogenetic analysis suggested that peanut is closer to cowpea and scarlet bean than to soybean, common bean and Medicago. From these two datasets, 6455 novel SSRs and 11,902 SNPs were identified. Of the discovered SSRs, 380 representing various SSR types were selected for PCR validation. The amplification rate was 89.2 %. Twenty-two (6.5 %) SSRs were polymorphic between at least one pair of four genotypes. Sanger sequencing of PCR products targeting 110 SNPs revealed 13 true SNPs between tetraploid genotypes and 193 homoeologous SNPs within genotypes. Eight out of the 22 polymorphic SSR markers were selected to evaluate the genetic diversity of Florida peanut breeding lines and the U.S. peanut mini core collection. This marker set demonstrated high discrimination power by displaying an average polymorphism information content value of 0.783, a combined probability of identity of 10(-11), and a combined power of exclusion of 0.99991. The structure analysis revealed four sub-populations among the peanut accessions and lines evaluated. The results of this study enriched the peanut genomic resources, provided over 6000 novel SSR markers and the credentials for true peanut SNP marker development, and demonstrated the power of newly developed SSR markers in

  19. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.


    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza


    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases. PMID:26431031

  20. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean

    PubMed Central

    Burt, Andrew J.; William, H. Manilal; Perry, Gregory; Khanal, Raja; Pauls, K. Peter; Kelly, James D.; Navabi, Alireza


    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co–4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co–4 is localized. Three SCAR markers with known linkage to Co–4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK–4 loci found in previous studies. It is possible that the Co–4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases. PMID:26431031

  1. Development of two major resources for pea genomics: the GenoPea 13.2K SNP Array and a high-density, high-resolution consensus genetic map.


    Tayeh, Nadim; Aluome, Christelle; Falque, Matthieu; Jacquin, Françoise; Klein, Anthony; Chauveau, Aurélie; Bérard, Aurélie; Houtin, Hervé; Rond, Céline; Kreplak, Jonathan; Boucherot, Karen; Martin, Chantal; Baranger, Alain; Pilet-Nayel, Marie-Laure; Warkentin, Thomas D; Brunel, Dominique; Marget, Pascal; Le Paslier, Marie-Christine; Aubert, Grégoire; Burstin, Judith


    Single nucleotide polymorphism (SNP) arrays represent important genotyping tools for innovative strategies in both basic research and applied breeding. Pea is an important food, feed and sustainable crop with a large (about 4.45 Gbp) but not yet available genome sequence. In the present study, 12 pea recombinant inbred line populations were genotyped using the newly developed GenoPea 13.2K SNP Array. Individual and consensus genetic maps were built providing insights into the structure and organization of the pea genome. Largely collinear genetic maps of 3918-8503 SNPs were obtained from all mapping populations, and only two of these exhibited putative chromosomal rearrangement signatures. Similar distortion patterns in different populations were noted. A total of 12 802 transcript-derived SNP markers placed on a 15 079-marker high-density, high-resolution consensus map allowed the identification of ohnologue-rich regions within the pea genome and the localization of local duplicates. Dense syntenic networks with sequenced legume genomes were further established, paving the way for the identification of the molecular bases of important agronomic traits segregating in the mapping populations. The information gained on the structure and organization of the genome from this research will undoubtedly contribute to the understanding of the evolution of the pea genome and to its assembly. The GenoPea 13.2K SNP Array and individual and consensus genetic maps are valuable genomic tools for plant scientists to strengthen pea as a model for genetics and physiology and enhance breeding.

  2. Genomic-assisted phylogenetic analysis and marker development for next generation soybean cyst nematode resistance breeding.


    Kadam, Suhas; Vuong, Tri D; Qiu, Dan; Meinhardt, Clinton G; Song, Li; Deshmukh, Rupesh; Patil, Gunvant; Wan, Jinrong; Valliyodan, Babu; Scaboo, Andrew M; Shannon, J Grover; Nguyen, Henry T


    Soybean cyst nematode (SCN, Heterodera glycines Ichinohe) is a serious soybean pest. The use of resistant cultivars is an effective approach for preventing yield loss. In this study, 19,652 publicly available soybean accessions that were previously genotyped with the SoySNP50K iSelect BeadChip were used to evaluate the phylogenetic diversity of SCN resistance genes Rhg1 and Rhg4 in an attempt to identify novel sources of resistance. The sequence information of soybean lines was utilized to develop KASPar (KBioscience Competitive Allele-Specific PCR) assays from single nucleotide polymorphisms (SNPs) of Rhg1, Rhg4, and other novel quantitative trait loci (QTL). These markers were used to genotype a diverse set of 95 soybean germplasm lines and three recombinant inbred line (RIL) populations. SNP markers from the Rhg1 gene were able to differentiate copy number variation (CNV), such as resistant-high copy (PI 88788-type), low copy (Peking-type), and susceptible-single copy (Williams 82) numbers. Similarly, markers for the Rhg4 gene were able to detect Peking-type (resistance) genotypes. The phylogenetic information of SCN resistance loci from a large set of soybean accessions and the gene/QTL specific markers that were developed in this study will accelerate SCN resistance breeding programs. PMID:26566850

  3. Genomic-assisted phylogenetic analysis and marker development for next generation soybean cyst nematode resistance breeding.


    Kadam, Suhas; Vuong, Tri D; Qiu, Dan; Meinhardt, Clinton G; Song, Li; Deshmukh, Rupesh; Patil, Gunvant; Wan, Jinrong; Valliyodan, Babu; Scaboo, Andrew M; Shannon, J Grover; Nguyen, Henry T


    Soybean cyst nematode (SCN, Heterodera glycines Ichinohe) is a serious soybean pest. The use of resistant cultivars is an effective approach for preventing yield loss. In this study, 19,652 publicly available soybean accessions that were previously genotyped with the SoySNP50K iSelect BeadChip were used to evaluate the phylogenetic diversity of SCN resistance genes Rhg1 and Rhg4 in an attempt to identify novel sources of resistance. The sequence information of soybean lines was utilized to develop KASPar (KBioscience Competitive Allele-Specific PCR) assays from single nucleotide polymorphisms (SNPs) of Rhg1, Rhg4, and other novel quantitative trait loci (QTL). These markers were used to genotype a diverse set of 95 soybean germplasm lines and three recombinant inbred line (RIL) populations. SNP markers from the Rhg1 gene were able to differentiate copy number variation (CNV), such as resistant-high copy (PI 88788-type), low copy (Peking-type), and susceptible-single copy (Williams 82) numbers. Similarly, markers for the Rhg4 gene were able to detect Peking-type (resistance) genotypes. The phylogenetic information of SCN resistance loci from a large set of soybean accessions and the gene/QTL specific markers that were developed in this study will accelerate SCN resistance breeding programs.

  4. Anchoring linkage groups of the Rosa genetic map to physical chromosomes with tyramide-FISH and EST-SNP markers.


    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila


    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb-1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria. PMID:24755945

  5. Anchoring Linkage Groups of the Rosa Genetic Map to Physical Chromosomes with Tyramide-FISH and EST-SNP Markers

    PubMed Central

    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila


    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb–1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria. PMID:24755945

  6. Anchoring linkage groups of the Rosa genetic map to physical chromosomes with tyramide-FISH and EST-SNP markers.


    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila


    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb-1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria.

  7. New softwares for automated microsatellite marker development.


    Martins, Wellington; de Sousa, Daniel; Proite, Karina; Guimarães, Patrícia; Moretzsohn, Marcio; Bertioli, David


    Microsatellites are repeated small sequence motifs that are highly polymorphic and abundant in the genomes of eukaryotes. Often they are the molecular markers of choice. To aid the development of microsatellite markers we have developed a module that integrates a program for the detection of microsatellites (TROLL), with the sequence assembly and analysis software, the Staden Package. The module has easily adjustable parameters for microsatellite lengths and base pair quality control. Starting with large datasets of unassembled sequence data in the form of chromatograms and/or text data, it enables the creation of a compact database consisting of the processed and assembled microsatellite containing sequences. For the final phase of primer design, we developed a program that accepts the multi-sequence 'experiment file' format as input and produces a list of primer pairs for amplification of microsatellite markers. The program can take into account the quality values of consensus bases, improving success rate of primer pairs in PCR. The software is freely available and simple to install in both Windows and Unix-based operating systems. Here we demonstrate the software by developing primer pairs for 427 new candidate markers for peanut. PMID:16493138

  8. [Development of molecular markers linked to the resistant QTL for downy mildew in Brassica rapa L. ssp. pekinensis].


    Li, Hui; Yu, Shuan-Cang; Zhang, Feng-Lan; Yu, Yang-Jun; Zhao, Xiu-Yun; Zhang, De-Shuang; Zhao, Xiang


    Downy mildew, caused by the oomycete Hyaloperonospora parasitica Constant. (Pers. ex Fr.), is one of the most severe diseases in Chinese cabbage, leading to reduction of yield and quality of the harvested products. Therefore, identifying molecular markers linked to the major QTL for downy mildew resistance will be helpful in breeding resistant varieties of Chinese cabbage. Here, one highly susceptible line 91-112, one highly resistant line T12-19, and the derived DH population were employed to develop linked molecular markers for the major QTL, BrDW, for downy mildew. With BLAST and IMap analysis, the RAPD marker K14-1030 linked to BrDW was anchored on KBrB058M10 (on Contig214). On the basis of the BAC and BAC-end sequences around KBrB058M10, a set of PCR primers were designed, and the methods of restriction analysis and HRM analysis were used to develop molecular makers. Finally, five polymorphism markers were developed, containing one Indel marker named Brb062-Indel230, three CAPS markers named Brb094-DraⅠ787, Brb094-AatⅡ666 and Brb043-BglⅡ715, and one SNP marker named Brh019-SNP137. In addition, one SSR marker from Unigene sequence homologous with KBrB058M10 (known as bru1209) was developed. The map distances between the six markers and RAPD marker K14-1030 were 4.3 cM, 1.7 cM, 5.9 cM, 5.9 cM, 4.6 cM, and 0.8 cM, respectively. The percentage of accuracy in selecting for downy mildew-resistant lines from the DH population were 69.7%, 70.9%, 72.4%, 72.4%, 58.3%, and 74.2%. These markers could be used in marker assisted selection to improve downy mildew resistance in Chinese cabbage.

  9. Use of genotyping by sequencing data to develop a high-throughput and multifunctional SNP panel for conservation applications in Pacific lamprey.


    Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R


    Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species.

  10. Use of genotyping by sequencing data to develop a high-throughput and multifunctional SNP panel for conservation applications in Pacific lamprey.


    Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R


    Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species. PMID:24842551

  11. Development and application of a novel genome-wide SNP array reveals domestication history in soybean.


    Wang, Jiao; Chu, Shanshan; Zhang, Huairen; Zhu, Ying; Cheng, Hao; Yu, Deyue


    Domestication of soybeans occurred under the intense human-directed selections aimed at developing high-yielding lines. Tracing the domestication history and identifying the genes underlying soybean domestication require further exploration. Here, we developed a high-throughput NJAU 355 K SoySNP array and used this array to study the genetic variation patterns in 367 soybean accessions, including 105 wild soybeans and 262 cultivated soybeans. The population genetic analysis suggests that cultivated soybeans have tended to originate from northern and central China, from where they spread to other regions, accompanied with a gradual increase in seed weight. Genome-wide scanning for evidence of artificial selection revealed signs of selective sweeps involving genes controlling domestication-related agronomic traits including seed weight. To further identify genomic regions related to seed weight, a genome-wide association study (GWAS) was conducted across multiple environments in wild and cultivated soybeans. As a result, a strong linkage disequilibrium region on chromosome 20 was found to be significantly correlated with seed weight in cultivated soybeans. Collectively, these findings should provide an important basis for genomic-enabled breeding and advance the study of functional genomics in soybean.

  12. Developing Exon-Primed Intron-Crossing (EPIC) markers for population genetic studies in three Aedes disease vectors.


    White, Vanessa Linley; Endersby, Nancy Margaret; Chan, Janice; Hoffmann, Ary Anthony; Weeks, Andrew Raymond


    Aedes aegypti, Aedes notoscriptus, and Aedes albopictus are important vectors of many arboviruses implicated in human disease such as dengue fever. Genetic markers applied across vector species can provide important information on population structure, gene flow, insecticide resistance, and taxonomy, however, robust microsatellite markers have proven difficult to develop in these species and mosquitoes generally. Here we consider the utility and transferability of 15 Ribosome protein (Rp) Exon-Primed Intron-Crossing (EPIC) markers for population genetic studies in these 3 Aedes species. Rp EPIC markers designed for Ae. aegypti also successfully amplified populations of the sister species, Ae. albopictus, as well as the distantly related species, Ae. notoscriptus. High SNP and good indel diversity in sequenced alleles plus support for amplification of the same regions across populations and species were additional benefits of these markers. These findings point to the general value of EPIC markers in mosquito population studies.

  13. MALDI-TOF mass spectrometry-based SNP genotyping.


    Pusch, Wolfgang; Wurmbach, Jan-Henner; Thiele, Herbert; Kostrzewa, Markus


    In recent years a growing demand for simple and robust SNP genotyping platforms has arisen from the widespread use of SNPs in industrial and public research. The resulting knowledge about genotype/phenotype correlations is of special interest for the identification of potential new drug targets and in the field of pharmacogenomics. However, full exploitation of the available genomic information requires vast numbers of SNP analyses, as large cohorts of patients have to be screened for a large number of markers. Only very few of the current SNP genotyping techniques can cope with the resulting demands concerning sample throughput, automation, accuracy and cost-effectiveness. MALDI-TOF mass spectrometry has the potential to develop into a 'Gold Standard' for high-throughput SNP genotyping - if it has not already done so. This review will focus on the latest developments of this technology.

  14. Candidate SNP Markers of Gender-Biased Autoimmune Complications of Monogenic Diseases Are Predicted by a Significant Change in the Affinity of TATA-Binding Protein for Human Gene Promoters

    PubMed Central

    Ponomarenko, Mikhail P.; Arkova, Olga; Rasskazov, Dmitry; Ponomarenko, Petr; Savinkova, Ludmila; Kolchanov, Nikolay


    Some variations of human genome [for example, single nucleotide polymorphisms (SNPs)] are markers of hereditary diseases and drug responses. Analysis of them can help to improve treatment. Computer-based analysis of millions of SNPs in the 1000 Genomes project makes a search for SNP markers more targeted. Here, we combined two computer-based approaches: DNA sequence analysis and keyword search in databases. In the binding sites for TATA-binding protein (TBP) in human gene promoters, we found candidate SNP markers of gender-biased autoimmune diseases, including rs1143627 [cachexia in rheumatoid arthritis (double prevalence among women)]; rs11557611 [demyelinating diseases (thrice more prevalent among young white women than among non-white individuals)]; rs17231520 and rs569033466 [both: atherosclerosis comorbid with related diseases (double prevalence among women)]; rs563763767 [Hughes syndrome-related thrombosis (lethal during pregnancy)]; rs2814778 [autoimmune diseases (excluding multiple sclerosis and rheumatoid arthritis) underlying hypergammaglobulinemia in women]; rs72661131 and rs562962093 (both: preterm delivery in pregnant diabetic women); and rs35518301, rs34166473, rs34500389, rs33981098, rs33980857, rs397509430, rs34598529, rs33931746, rs281864525, and rs63750953 (all: autoimmune diseases underlying hypergammaglobulinemia in women). Validation of these predicted candidate SNP markers using the clinical standards may advance personalized medicine. PMID:27092142

  15. Development and use of genic molecular markers (GMMs) for construction of a transcript map of chickpea (Cicer arietinum L.).


    Gujaria, Neha; Kumar, Ashish; Dauthal, Preeti; Dubey, Anuja; Hiremath, Pavana; Bhanu Prakash, A; Farmer, Andrew; Bhide, Mangla; Shah, Trushar; Gaur, Pooran M; Upadhyaya, Hari D; Bhatia, Sabhyata; Cook, Douglas R; May, Greg D; Varshney, Rajeev K


    A transcript map has been constructed by the development and integration of genic molecular markers (GMMs) including single nucleotide polymorphism (SNP), genic microsatellite or simple sequence repeat (SSR) and intron spanning region (ISR)-based markers, on an inter-specific mapping population of chickpea, the third food legume crop of the world and the first food legume crop of India. For SNP discovery through allele re-sequencing, primer pairs were designed for 688 genes/expressed sequence tags (ESTs) of chickpea and 657 genes/ESTs of closely related species of chickpea. High-quality sequence data obtained for 220 candidate genic regions on 2-20 genotypes representing 9 Cicer species provided 1,893 SNPs with an average frequency of 1/35.83 bp and 0.34 PIC (polymorphism information content) value. On an average 2.9 haplotypes were present in 220 candidate genic regions with an average haplotype diversity of 0.6326. SNP2CAPS analysis of 220 sequence alignments, as mentioned above, provided a total of 192 CAPS candidates. Experimental analysis of these 192 CAPS candidates together with 87 CAPS candidates identified earlier through in silico mining of ESTs provided scorable amplification in 173 (62.01%) cases of which predicted assays were validated in 143 (82.66%) cases (CGMM). Alignments of chickpea unigenes with Medicago truncatula genome were used to develop 121 intron spanning region (CISR) markers of which 87 yielded scorable products. In addition, optimization of 77 EST-derived SSR (ICCeM) markers provided 51 scorable markers. Screening of easily assayable 281 markers including 143 CGMMs, 87 CISRs and 51 ICCeMs on 5 parental genotypes of three mapping populations identified 104 polymorphic markers including 90 markers on the inter-specific mapping population. Sixty-two of these GMMs together with 218 earlier published markers (including 64 GMM loci) and 20 other unpublished markers could be integrated into this genetic map. A genetic map developed here

  16. 1 + 1 = 3: Development and validation of a SNP-based algorithm to identify genetic contributions from three distinct inbred mouse strains.


    Gorham, James D; Ranson, Matthew S; Smith, Janebeth C; Gorham, Beverly J; Muirhead, Kristen-Ashley


    State-of-the-art, genome-wide assessment of mouse genetic background uses single nucleotide polymorphism (SNP) PCR. As SNP analysis can use multiplex testing, it is amenable to high-throughput analysis and is the preferred method for shared resource facilities that offer genetic background assessment of mouse genomes. However, a typical individual SNP query yields only two alleles (A vs. B), limiting the application of this methodology to distinguishing contributions from no more than two inbred mouse strains. By contrast, simple sequence length polymorphism (SSLP) analysis yields multiple alleles but is not amenable to high-throughput testing. We sought to devise a SNP-based technique to identify donor strain origins when three distinct mouse strains potentially contribute to the genetic makeup of an individual mouse. A computational approach was used to devise a three-strain analysis (3SA) algorithm that would permit identification of three genetic backgrounds while still using a binary-output SNP platform. A panel of 15 mosaic mice with contributions from BALB/c, C57Bl/6, and DBA/2 genetic backgrounds was bred and analyzed using a genome-wide SNP panel using 1449 markers. The 3SA algorithm was applied and then validated using SSLP. The 3SA algorithm assigned 85% of 1449 SNPs as informative for the C57Bl/6, BALB/c, or DBA/2 backgrounds, respectively. Testing the panel of 15 F2 mice, the 3SA algorithm predicted donor strain origins genome-wide. Donor strain origins predicted by the 3SA algorithm correlated perfectly with results from individual SSLP markers located on five different chromosomes (n=70 tests). We have established and validated an analysis algorithm based on binary SNP data that can successfully identify the donor strain origins of chromosomal regions in mice that are bred from three distinct inbred mouse strains. PMID:23204929

  17. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  18. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.


    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  19. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.


    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  20. Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress.


    Rostoks, Nils; Mudie, Sharon; Cardle, Linda; Russell, Joanne; Ramsay, Luke; Booth, Allan; Svensson, Jan T; Wanamaker, Steve I; Walia, Harkamal; Rodriguez, Edmundo M; Hedley, Peter E; Liu, Hui; Morris, Jenny; Close, Timothy J; Marshall, David F; Waugh, Robbie


    More than 2,000 genome-wide barley single nucleotide polymorphisms (SNPs) were developed by resequencing unigene fragments from eight diverse accessions. The average genome-wide SNP frequency observed in 877 unigenes was 1 SNP per 200 bp. However, SNP frequency was highly variable with the least number of SNP and SNP haplotypes observed within European cultivated germplasm reflecting effects of breeding history on genetic diversity. More than 300 SNP loci were mapped genetically in three experimental mapping populations which allowed the construction of an integrated SNP map incorporating a large number of RFLP, AFLP and SSR markers (1,237 loci in total). The genes used for SNP discovery were selected based on their transcriptional response to a variety of abiotic stresses. A set of known barley abiotic stress QTL was positioned on the linkage map, while the available sequence and gene expression information facilitated the identification of genes potentially associated with these traits. Comparison of the sequenced SNP loci to the rice genome sequence identified several regions of highly conserved gene order providing a framework for marker saturation in barley genomic regions of interest. The integration of genome-wide SNP and expression data with available genetic and phenotypic information will facilitate the identification of gene function in barley and other non-model organisms. PMID:16244872

  1. SNP discovery in complex allotetraploid genomes (Gossypium spp., Malvaceae) using genotyping by sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dramatic decreases in the cost of DNA sequencing have enabled the development of very large numbers of markers based on single nucleotide polymorphism (SNP) for phylogenetic studies, population genetics, linkage mapping, marker-assisted breeding and other applications. Using Illumina next-generatio...

  2. Transferring automation for large-scale development and production of Invader SNP assays

    NASA Astrophysics Data System (ADS)

    Neri, Bruce P.; Ganske, R.; Isaczyszyn, W.; Beaty, Edward L.


    The Human Genome Project has led to the discovery of hundreds of thousands of single nucleotide polymorphisms (SNPs). SNPs can act as genetic markers to create high- density maps of the human genome for large-scale genetic analysis for evaluating links between genetic mutations and human diseases and for performing association studies. To create those maps, assays capable of detecting many different SNPs must be developed rapidly, as additional SNPs are discovered. When both the design of and the technology used in the assays can be partially or fully automated, the development process and the time to results can be accomplished quickly and efficiently. InvaderTM technology offers a highly sensitive signal amplification system that detects and quantifies mutations and SNPs from unamplified human genomic DNA in two sequential steps.

  3. Development of a cassava core collection based on single nucleotide polymorphism markers.


    Oliveira, E J; Ferreira, C F; Santos, V S; Oliveira, G A F


    Single nucleotide polymorphism (SNP) markers were used in the largest cassava (Manihot esculenta Crantz) germplasm collection from Brazil to develop core collections based on the maximization strategy. Subsets with 61, 64, 84, 128, 256, and 384 cassava accessions were selected and named PoHEU, MST64, PoRAN, MST128, MST256, and MST384, respectively. All the 798 alleles identified by 402 SNP markers in the entire collection were captured in all core collections. Only small alterations in the diversity parameters were observed for the different core collections compared with the complete collection. Because of the optimal adjustment of the validation parameters representative of the complete collection, the absence of genotypes with high genetic similarity and the maximization of the genetic distances between accessions of the PoHEU core collection, which contained 4.7% of the accessions of the complete collection, maximized the genetic conservation of this important cassava collection. Furthermore, the development of this core collection will allow concentrated efforts toward future characterization and agronomic evaluation of accessions to maximize the diversity and genetic gains in cassava breeding programs.

  4. The coding region of the UFGT gene is a source of diagnostic SNP markers that allow single-locus DNA genotyping for the assessment of cultivar identity and ancestry in grapevine (Vitis vinifera L.)

    PubMed Central


    Background Vitis vinifera L. is one of society’s most important agricultural crops with a broad genetic variability. The difficulty in recognizing grapevine genotypes based on ampelographic traits and secondary metabolites prompted the development of molecular markers suitable for achieving variety genetic identification. Findings Here, we propose a comparison between a multi-locus barcoding approach based on six chloroplast markers and a single-copy nuclear gene sequencing method using five coding regions combined with a character-based system with the aim of reconstructing cultivar-specific haplotypes and genotypes to be exploited for the molecular characterization of 157 V. vinifera accessions. The analysis of the chloroplast target regions proved the inadequacy of the DNA barcoding approach at the subspecies level, and hence further DNA genotyping analyses were targeted on the sequences of five nuclear single-copy genes amplified across all of the accessions. The sequencing of the coding region of the UFGT nuclear gene (UDP-glucose: flavonoid 3-0-glucosyltransferase, the key enzyme for the accumulation of anthocyanins in berry skins) enabled the discovery of discriminant SNPs (1/34 bp) and the reconstruction of 130 V. vinifera distinct genotypes. Most of the genotypes proved to be cultivar-specific, and only few genotypes were shared by more, although strictly related, cultivars. Conclusion On the whole, this technique was successful for inferring SNP-based genotypes of grapevine accessions suitable for assessing the genetic identity and ancestry of international cultivars and also useful for corroborating some hypotheses regarding the origin of local varieties, suggesting several issues of misidentification (synonymy/homonymy). PMID:24298902

  5. Developing Single Nucleotide Polymorphism (SNP) markers for the identification of pineapple (Ananas comosus) germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango and a major agricultural commodity in Hawaii. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using E...

  6. Development and characterization of 96 microsatellite markers suitable for QTL mapping and accession control in an Arabidopsis core collection

    PubMed Central


    Background To identify plant genes involved in various key traits, QTL mapping is a powerful approach. This approach is based on the use of mapped molecular markers to identify genomic regions controlling quantitative traits followed by a fine mapping and eventually positional cloning of candidate genes. Mapping technologies using SNP markers are still rather expensive and not feasible in every laboratory. In contrast, microsatellite (also called SSR for Simple Sequence Repeat) markers are technologically less demanding and less costly for any laboratory interested in genetic mapping. Results In this study, we present the development and the characterization of a panel of 96 highly polymorphic SSR markers along the Arabidopsis thaliana genome allowing QTL mapping among accessions of the Versailles 24 core collection that covers a high percentage of the A. thaliana genetic diversity. These markers can be used for any QTL mapping analysis involving any of these accessions. We optimized the use of these markers in order to reveal polymorphism using standard PCR conditions and agarose gel electrophoresis. In addition, we showed that the use of only three of these markers allows differentiating all 24 accessions which makes this set of markers a powerful tool to control accession identity or any cross between any of these accessions. Conclusion The set of SSR markers developed in this study provides a simple and efficient tool for any laboratory focusing on QTL mapping in A. thaliana and a simple means to control seed stock or crosses between accessions. PMID:24447639

  7. Development of marker sets useful in the early selection of Ren4 powdery mildew resistance and seedlessness for table and raisin grape breeding.


    Mahanil, Siraprapa; Ramming, David; Cadle-Davidson, Molly; Owens, Christopher; Garris, Amanda; Myles, Sean; Cadle-Davidson, Lance


    The single, dominant powdery mildew resistance locus Ren4 from Vitis romanetii prevents hyphal growth by Erysiphe necator. Previously, we showed that when introgressed into V. vinifera in the modified BC(2) population 03-3004, Ren4 was linked with the simple sequence repeat marker VMC7f2 on chromosome 18-a marker that is associated with multiple disease resistance and seedlessness. However, in the current study, this marker was monomorphic in related breeding populations 05-3010 and 07-3553. To enhance marker-assisted selection at this locus, we developed multiplexed SNP markers using three approaches: conversion of bulked segregant analysis AFLP markers, sequencing of candidate genes and regions flanking known V. vinifera SNPs, and hybridization to the Vitis9KSNP genotyping array. The Vitis9KSNP array was more cost-efficient than all other approaches tested for marker discovery and genotyping, enabling the genotyping of 1317 informative SNPs within the span of 1 week and at a cost of 11 cents per SNP. From a total of 1,446 high quality, informative markers segregating in 03-3004, we developed a haplotype signature of 15 multiplexed SNP markers linked with Ren4 in 03-3004, 5 of which were linked in 05-3010, and 6 of which were linked in 07-3553. Two of these populations segregated for seedlessness, which was tightly linked with Ren4 in 03-3004 (2 cM) but not in 05-3010 (22 cM). Chromosomal rearrangements were detected among these three populations and the reference genome PN40024. Since this is the first application of the Vitis9KSNP array in a breeding program, some suggestions are provided for application of genotyping arrays. Our results provide novel markers for tracking and pyramiding this unique resistance gene and for further functional characterization of this region on chromosome 18 encoding multiple disease resistance and seedlessness. PMID:21904846

  8. Development of Single Nucleotide Polymorphism markers in Theobroma cacao and comparison to Simple Sequence Repeat markers for genotyping of Cameroon clones.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single Nucleotide Polymorphism (SNP) markers are increasingly being used in crop breeding programs, slowly replacing Simple Sequence Repeats (SSR) and other markers. SNPs provide many benefits over SSRs, including ease of analysis and unambiguous results across various platforms. We have identifie...

  9. Genome Wide Sampling Sequencing for SNP Genotyping: Methods, Challenges and Future Development.


    Jiang, Zhihua; Wang, Hongyang; Michal, Jennifer J; Zhou, Xiang; Liu, Bang; Woods, Leah C Solberg; Fuchs, Rita A


    Genetic polymorphisms, particularly single nucleotide polymorphisms (SNPs), have been widely used to advance quantitative, functional and evolutionary genomics. Ideally, all genetic variants among individuals should be discovered when next generation sequencing (NGS) technologies and platforms are used for whole genome sequencing or resequencing. In order to improve the cost-effectiveness of the process, however, the research community has mainly focused on developing genome-wide sampling sequencing (GWSS) methods, a collection of reduced genome complexity sequencing, reduced genome representation sequencing and selective genome target sequencing. Here we review the major steps involved in library preparation, the types of adapters used for ligation and the primers designed for amplification of ligated products for sequencing. Unfortunately, currently available GWSS methods have their drawbacks, such as inconsistency in the number of reads per sample library, the number of sites/targets per individual, and the number of reads per site/target, all of which result in missing data. Suggestions are proposed here to improve library construction, genotype calling accuracy, genome-wide marker density and read mapping rate. In brief, optimized GWSS library preparation should generate a unique set of target sites with dense distribution along chromosomes and even coverage per site across all individuals. PMID:26722221

  10. Genome Wide Sampling Sequencing for SNP Genotyping: Methods, Challenges and Future Development

    PubMed Central

    Jiang, Zhihua; Wang, Hongyang; Michal, Jennifer J.; Zhou, Xiang; Liu, Bang; Woods, Leah C. Solberg; Fuchs, Rita A.


    Genetic polymorphisms, particularly single nucleotide polymorphisms (SNPs), have been widely used to advance quantitative, functional and evolutionary genomics. Ideally, all genetic variants among individuals should be discovered when next generation sequencing (NGS) technologies and platforms are used for whole genome sequencing or resequencing. In order to improve the cost-effectiveness of the process, however, the research community has mainly focused on developing genome-wide sampling sequencing (GWSS) methods, a collection of reduced genome complexity sequencing, reduced genome representation sequencing and selective genome target sequencing. Here we review the major steps involved in library preparation, the types of adapters used for ligation and the primers designed for amplification of ligated products for sequencing. Unfortunately, currently available GWSS methods have their drawbacks, such as inconsistency in the number of reads per sample library, the number of sites/targets per individual, and the number of reads per site/target, all of which result in missing data. Suggestions are proposed here to improve library construction, genotype calling accuracy, genome-wide marker density and read mapping rate. In brief, optimized GWSS library preparation should generate a unique set of target sites with dense distribution along chromosomes and even coverage per site across all individuals. PMID:26722221

  11. De novo Transcriptome Analysis and Molecular Marker Development of Two Hemarthria Species

    PubMed Central

    Huang, Xiu; Yan, Hai-Dong; Zhang, Xin-Quan; Zhang, Jian; Frazier, Taylor P.; Huang, De-Jun; Lu, Lu; Huang, Lin-Kai; Liu, Wei; Peng, Yan; Ma, Xiao; Yan, Yan-Hong


    Hemarthria R. Br. is an important genus of perennial forage grasses that is widely used in subtropical and tropical regions. Hemarthria grasses have made remarkable contributions to the development of animal husbandry and agro-ecosystem maintenance; however, there is currently a lack of comprehensive genomic data available for these species. In this study, we used Illumina high-throughput deep sequencing to characterize of two agriculturally important Hemarthria materials, H. compressa “Yaan” and H. altissima “1110.” Sequencing runs that used each of four normalized RNA samples from the leaves or roots of the two materials yielded more than 24 million high-quality reads. After de novo assembly, 137,142 and 77,150 unigenes were obtained for “Yaan” and “1110,” respectively. In addition, a total of 86,731 “Yaan” and 48,645 “1110” unigenes were successfully annotated. After consolidating the unigenes for both materials, 42,646 high-quality SNPs were identified in 10,880 unigenes and 10,888 SSRs were identified in 8330 unigenes. To validate the identified markers, high quality PCR primers were designed for both SNPs and SSRs. We randomly tested 16 of the SNP primers and 54 of the SSR primers and found that the majority of these primers successfully amplified the desired PCR product. In addition, high cross-species transferability (61.11–87.04%) of SSR markers was achieved for four other Poaceae species. The amount of RNA sequencing data that was generated for these two Hemarthria species greatly increases the amount of genomic information available for Hemarthria and the SSR and SNP markers identified in this study will facilitate further advancements in genetic and molecular studies of the Hemarthria genus. PMID:27148320

  12. SNP-based high density genetic map and mapping of btwd1 dwarfing gene in barley

    PubMed Central

    Ren, Xifeng; Wang, Jibin; Liu, Lipan; Sun, Genlou; Li, Chengdao; Luo, Hong; Sun, Dongfa


    A high-density linkage map is a valuable tool for functional genomics and breeding. A newly developed sequence-based marker technology, restriction site associated DNA (RAD) sequencing, has been proven to be powerful for the rapid discovery and genotyping of genome-wide single nucleotide polymorphism (SNP) markers and for the high-density genetic map construction. The objective of this research was to construct a high-density genetic map of barley using RAD sequencing. 1894 high-quality SNP markers were developed and mapped onto all seven chromosomes together with 68 SSR markers. These 1962 markers constituted a total genetic length of 1375.8 cM and an average of 0.7 cM between adjacent loci. The number of markers within each linkage group ranged from 209 to 396. The new recessive dwarfing gene btwd1 in Huaai 11 was mapped onto the high density linkage maps. The result showed that the btwd1 is positioned between SNP marks 7HL_6335336 and 7_249275418 with a genetic distance of 0.9 cM and 0.7 cM on chromosome 7H, respectively. The SNP-based high-density genetic map developed and the dwarfing gene btwd1 mapped in this study provide critical information for position cloning of the btwd1 gene and molecular breeding of barley. PMID:27530597

  13. SNP-based high density genetic map and mapping of btwd1 dwarfing gene in barley.


    Ren, Xifeng; Wang, Jibin; Liu, Lipan; Sun, Genlou; Li, Chengdao; Luo, Hong; Sun, Dongfa


    A high-density linkage map is a valuable tool for functional genomics and breeding. A newly developed sequence-based marker technology, restriction site associated DNA (RAD) sequencing, has been proven to be powerful for the rapid discovery and genotyping of genome-wide single nucleotide polymorphism (SNP) markers and for the high-density genetic map construction. The objective of this research was to construct a high-density genetic map of barley using RAD sequencing. 1894 high-quality SNP markers were developed and mapped onto all seven chromosomes together with 68 SSR markers. These 1962 markers constituted a total genetic length of 1375.8 cM and an average of 0.7 cM between adjacent loci. The number of markers within each linkage group ranged from 209 to 396. The new recessive dwarfing gene btwd1 in Huaai 11 was mapped onto the high density linkage maps. The result showed that the btwd1 is positioned between SNP marks 7HL_6335336 and 7_249275418 with a genetic distance of 0.9 cM and 0.7 cM on chromosome 7H, respectively. The SNP-based high-density genetic map developed and the dwarfing gene btwd1 mapped in this study provide critical information for position cloning of the btwd1 gene and molecular breeding of barley.

  14. SNP-based high density genetic map and mapping of btwd1 dwarfing gene in barley.


    Ren, Xifeng; Wang, Jibin; Liu, Lipan; Sun, Genlou; Li, Chengdao; Luo, Hong; Sun, Dongfa


    A high-density linkage map is a valuable tool for functional genomics and breeding. A newly developed sequence-based marker technology, restriction site associated DNA (RAD) sequencing, has been proven to be powerful for the rapid discovery and genotyping of genome-wide single nucleotide polymorphism (SNP) markers and for the high-density genetic map construction. The objective of this research was to construct a high-density genetic map of barley using RAD sequencing. 1894 high-quality SNP markers were developed and mapped onto all seven chromosomes together with 68 SSR markers. These 1962 markers constituted a total genetic length of 1375.8 cM and an average of 0.7 cM between adjacent loci. The number of markers within each linkage group ranged from 209 to 396. The new recessive dwarfing gene btwd1 in Huaai 11 was mapped onto the high density linkage maps. The result showed that the btwd1 is positioned between SNP marks 7HL_6335336 and 7_249275418 with a genetic distance of 0.9 cM and 0.7 cM on chromosome 7H, respectively. The SNP-based high-density genetic map developed and the dwarfing gene btwd1 mapped in this study provide critical information for position cloning of the btwd1 gene and molecular breeding of barley. PMID:27530597

  15. Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Among SNP markers that become increasingly valuable in molecular breeding of crop plants are the CAP and dCAP markers derived from the genes of interest. To date, the number of such gene-based markers is small in polyploid crop plants such as tetraploid cotton that has A and D subgenomes. The obje...

  16. Development of a SNP resource and a genetic linkage map for Atlantic cod (Gadus morhua)

    PubMed Central


    Background Atlantic cod (Gadus morhua) is a species with increasing economic significance for the aquaculture industry. The genetic improvement of cod will play a critical role in achieving successful large-scale aquaculture. While many microsatellite markers have been developed in cod, the number of single nucleotide polymorphisms (SNPs) is currently limited. Here we report the identification of SNPs from sequence data generated by a large-scale expressed sequence tag (EST) program, focusing on fish originating from Canadian waters. Results A total of 97976 ESTs were assembled to generate 13448 contigs. We detected 4753 SNPs that met our selection criteria (depth of coverage ≥ 4 reads; minor allele frequency > 25%). 3072 SNPs were selected for testing. The percentage of successful assays was 75%, with 2291 SNPs amplifying correctly. Of these, 607 (26%) SNPs were monomorphic for all populations tested. In total, 64 (4%) of SNPs are likely to represent duplicated genes or highly similar members of gene families, rather than alternative alleles of the same gene, since they showed a high frequency of heterozygosity. The remaining polymorphic SNPs (1620) were categorised as validated SNPs. The mean minor allele frequency of the validated loci was 0.258 (± 0.141). Of the 1514 contigs from which validated SNPs were selected, 31% have a significant blast hit. For the SNPs predicted to occur in coding regions (141), we determined that 36% (51) are non-synonymous. Many loci (1033 SNPs; 64%) are polymorphic in all populations tested. However a small number of SNPs (184) that are polymorphic in the Western Atlantic were monomorphic in fish tested from three European populations. A preliminary linkage map has been constructed with 23 major linkage groups and 924 mapped SNPs. Conclusions These SNPs represent powerful tools to accelerate the genetic improvement of cod aquaculture. They have been used to build a genetic linkage map that can be applied to quantitative trait

  17. A Study of Applicability of SNP Chips Developed for Bovine and Ovine Species to Whole-Genome Analysis of Reindeer Rangifer tarandus.


    Kharzinova, Veronika R; Sermyagin, Alexander A; Gladyr, Elena A; Okhlopkov, Innokentiy M; Brem, Gottfried; Zinovieva, Natalia A


    Two sets of commercially available single nucleotide polymorphisms (SNPs) developed for cattle (BovineSNP50 BeadChip) and sheep (OvineSNP50 BeadChip) have been trialed for whole-genome analysis of 4 female samples of Rangifer tarandus inhabiting Russia. We found out that 43.0% of bovine and 47.0% of Ovine SNPs could be genotyped, while only 5.3% and 2.03% of them were respectively polymorphic. The scored and the polymorphic SNPs were identified on each bovine and each ovine chromosome, but their distribution was not unique. The maximal value of runs of homozygosity (ROH) was 30.93Mb (for SNPs corresponding to bovine chromosome 8) and 80.32Mb (for SNPs corresponding to ovine chromosome 7). Thus, the SNP chips developed for bovine and ovine species can be used as a powerful tool for genome analysis in reindeer R. tarandus.

  18. A Study of Applicability of SNP Chips Developed for Bovine and Ovine Species to Whole-Genome Analysis of Reindeer Rangifer tarandus.


    Kharzinova, Veronika R; Sermyagin, Alexander A; Gladyr, Elena A; Okhlopkov, Innokentiy M; Brem, Gottfried; Zinovieva, Natalia A


    Two sets of commercially available single nucleotide polymorphisms (SNPs) developed for cattle (BovineSNP50 BeadChip) and sheep (OvineSNP50 BeadChip) have been trialed for whole-genome analysis of 4 female samples of Rangifer tarandus inhabiting Russia. We found out that 43.0% of bovine and 47.0% of Ovine SNPs could be genotyped, while only 5.3% and 2.03% of them were respectively polymorphic. The scored and the polymorphic SNPs were identified on each bovine and each ovine chromosome, but their distribution was not unique. The maximal value of runs of homozygosity (ROH) was 30.93Mb (for SNPs corresponding to bovine chromosome 8) and 80.32Mb (for SNPs corresponding to ovine chromosome 7). Thus, the SNP chips developed for bovine and ovine species can be used as a powerful tool for genome analysis in reindeer R. tarandus. PMID:26447215

  19. A flexible multi-species genome-wide 60K SNP chip developed from pooled resequencing of 240 Eucalyptus tree genomes across 12 species.


    Silva-Junior, Orzenil B; Faria, Danielle A; Grattapaglia, Dario


    We used whole genome resequencing of pooled individuals to develop a high-density single-nucleotide polymorphism (SNP) chip for Eucalyptus. Genomes of 240 trees of 12 species were sequenced at 3.5× each, and 46 997 586 raw SNP variants were subject to multivariable filtering metrics toward a multispecies, genome-wide distributed chip content. Of the 60 904 SNPs on the chip, 59 222 were genotyped and 51 204 were polymorphic across 14 Eucalyptus species, providing a 96% genome-wide coverage with 1 SNP/12-20 kb, and 47 069 SNPs at ≤ 10 kb from 30 444 of the 33 917 genes in the Eucalyptus genome. Given the EUChip60K multi-species genotyping flexibility, we show that both the sample size and taxonomic composition of cluster files impact heterozygous call specificity and sensitivity by benchmarking against 'gold standard' genotypes derived from deeply sequenced individual tree genomes. Thousands of SNPs were shared across species, likely representing ancient variants arisen before the split of these taxa, hinting to a recent eucalypt radiation. We show that the variable SNP filtering constraints allowed coverage of the entire site frequency spectrum, mitigating SNP ascertainment bias. The EUChip60K represents an outstanding tool with which to address population genomics questions in Eucalyptus and to empower genomic selection, GWAS and the broader study of complex trait variation in eucalypts.

  20. Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants.


    Montes-Borrego, Miguel; Lopes, Joao R S; Jiménez-Díaz, Rafael M; Landa, Blanca B


    Two haplotypes of Xylella fastidiosa subsp. pauca (Xfp) that correlated with their host of origin were identified in a collection of 90 isolates infecting citrus and coffee plants in Brazil, based on a single-nucleotide polymorphism in the gyrB sequence. A new single-nucleotide primer extension (SNuPE) protocol was designed for rapid identification of Xfp according to the host source. The protocol proved to be robust for the prediction of the Xfp host source in blind tests using DNA from cultures of the bacterium, infected plants, and insect vectors allowed to feed on Xfp-infected citrus plants. AMOVA and STRUCTURE analyses of microsatellite data separated most Xfp populations on the basis of their host source, indicating that they were genetically distinct. The combined use of the SNaPshot protocol and three previously developed multilocus SSR markers showed that two haplotypes and distinct isolates of Xfp infect citrus and coffee in Brazil and that multiple, genetically different isolates can be present in a single orchard or infect a single tree. This combined approach will be very useful in studies of the epidemiology of Xfp-induced diseases, host specificity of bacterial genotypes, the occurrence of Xfp host jumping, vector feeding habits, etc., in economically important cultivated plants or weed host reservoirs of Xfp in Brazil and elsewhere.

  1. Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants.


    Montes-Borrego, Miguel; Lopes, Joao R S; Jiménez-Díaz, Rafael M; Landa, Blanca B


    Two haplotypes of Xylella fastidiosa subsp. pauca (Xfp) that correlated with their host of origin were identified in a collection of 90 isolates infecting citrus and coffee plants in Brazil, based on a single-nucleotide polymorphism in the gyrB sequence. A new single-nucleotide primer extension (SNuPE) protocol was designed for rapid identification of Xfp according to the host source. The protocol proved to be robust for the prediction of the Xfp host source in blind tests using DNA from cultures of the bacterium, infected plants, and insect vectors allowed to feed on Xfp-infected citrus plants. AMOVA and STRUCTURE analyses of microsatellite data separated most Xfp populations on the basis of their host source, indicating that they were genetically distinct. The combined use of the SNaPshot protocol and three previously developed multilocus SSR markers showed that two haplotypes and distinct isolates of Xfp infect citrus and coffee in Brazil and that multiple, genetically different isolates can be present in a single orchard or infect a single tree. This combined approach will be very useful in studies of the epidemiology of Xfp-induced diseases, host specificity of bacterial genotypes, the occurrence of Xfp host jumping, vector feeding habits, etc., in economically important cultivated plants or weed host reservoirs of Xfp in Brazil and elsewhere. PMID:26415663

  2. A SNP-Based Molecular Barcode for Characterization of Common Wheat

    PubMed Central

    Gao, LiFeng; Jia, JiZeng; Kong, XiuYing


    Wheat is grown as a staple crop worldwide. It is important to develop an effective genotyping tool for this cereal grain both to identify germplasm diversity and to protect the rights of breeders. Single-nucleotide polymorphism (SNP) genotyping provides a means for developing a practical, rapid, inexpensive and high-throughput assay. Here, we investigated SNPs as robust markers of genetic variation for typing wheat cultivars. We identified SNPs from an array of 9000 across a collection of 429 well-known wheat cultivars grown in China, of which 43 SNP markers with high minor allele frequency and variations discriminated the selected wheat varieties and their wild ancestors. This SNP-based barcode will allow for the rapid and precise identification of wheat germplasm resources and newly released varieties and will further assist in the wheat breeding program. PMID:26985664

  3. An SNP marker at the STAT6 locus can identify the hybrids between rhesus (Macaca mulatta) and long-tailed macaques (M. fascicularis) in Thailand: a rapid and simple screening method and its application.


    Jadejaroen, Janya; Kawamoto, Yoshi; Hamada, Yuzuru; Malaivijitnond, Suchinda


    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay was developed to genetically discriminate rhesus (Macaca mulatta) macaques from long-tailed (M. fascicularis) macaques. The 745 bp PCR amplicon of the STAT6 locus that spans a potentially species-diagnostic single nucleotide polymorphism (SNP) marker was digested with ApaI and gel electrophoresed to give (1) two (234 and 511 bp), (2) one (745 bp) and (3) three (234, 511 and 745 bp) band patterns that correspond to the genotypes G/G (long-tailed macaque specific homozygote), A/A (rhesus macaque specific homozygote) and A/G (hybrid specific heterozygote), respectively. The diagnostic robustness and efficiency of this PCR-RFLP assay was tested on wild rhesus and long-tailed macaques inhabiting Thailand and a known hybrid population. The Indochinese and Sundaic long-tailed macaque samples (n = 18) all showed a homozygous G/G pattern, while the Indochinese rhesus macaques (n = 10) all showed a homozygous A/A pattern. The rhesus/long-tailed hybrid population at Khao Khieow Open Zoo, which resulted from an introduced group of rhesus macaques that hybridized with the indigenous long-tailed macaques about 20 years ago, revealed 47% (56/118 samples analyzed) with the heterogenous A/G genotype. In addition, the frequency of the rhesus-specific allele A significantly decreased in the hybrid population during 2006-2014, where a strong association between the STAT6 genotype and the morphology of the individuals was detected. In conclusion, a robust PCR-RFLP assay allows a simple, effective and inexpensive approach, in particular for field studies, to assess hybrid individuals between rhesus and long-tailed macaques. Although this assay cannot conclusively identify all the hybrids over two or more generations, it at least can allow the evaluation of the process of hybridization, and so it is applicable to the assessment of the status of natural or anthropogenic hybridization between the two


    EPA Science Inventory

    Herein we describe a simple method for developing species-diagnostic markers that would permit the rapid identification of hybrid individuals. Our method relies on amplified length polymorphism (AFLP) and single strand conformation polymorphism (SSCP) technologies, both of which...

  5. Markers

    ERIC Educational Resources Information Center

    Healthy Schools Network, Inc., 2011


    Dry erase whiteboards come with toxic dry erase markers and toxic cleaning products. Dry erase markers labeled "nontoxic" are not free of toxic chemicals and can cause health problems. Children are especially vulnerable to environmental health hazards; moreover, schools commonly have problems with indoor air pollution, as they are more densely…

  6. Development of microsatellite markers for Crepis mollis (Asteraceae)1

    PubMed Central

    Duwe, Virginia K.; Muller, Ludo A. H.; Borsch, Thomas; Ismail, Sascha A.


    Premise of the study: Polymorphic microsatellite markers were developed for the threatened species Crepis mollis (Asteraceae) to investigate population and conservation genetics. Methods and Results: Illumina sequencing was conducted on pooled genomic DNA from 10 individuals of two populations. Ten polymorphic and 10 monomorphic microsatellite loci with di-, tri-, tetra-, penta-, and hexanucleotide repeat motifs were developed and characterized in C. mollis. In the polymorphic markers, up to 17 alleles per locus were detected with an observed and expected heterozygosity ranging from 0.120 to 0.780 and 0.102 to 0.834, respectively. Furthermore, the polymorphic markers were tested for cross-amplification in three congeneric species (C. biennis, C. foetida, and C. sancta) and amplified in up to three loci. Conclusions: The markers developed in this study are the first microsatellites tested on C. mollis and will be useful for performing population and conservation genetic studies in this threatened species. PMID:27437177

  7. Analysis of DNA polymorphisms in sugar beet (Beta vulgaris L.) and development of an SNP-based map of expressed genes.


    Schneider, Katharina; Kulosa, Dagmar; Soerensen, Thomas Rosleff; Möhring, Silke; Heine, Martin; Durstewitz, Gregor; Polley, Andreas; Weber, Eberhard; Jamsari; Lein, Jens; Hohmann, Uwe; Tahiro, Emma; Weisshaar, Bernd; Schulz, Britta; Koch, Georg; Jung, Christian; Ganal, Martin


    A panel of 13 sugar beet lines and one genotype each of the Beta vulgaris cultivars red beet and Swiss chard, and B. vulgaris ssp. maritima were used to identify polymorphisms in alignments of genomic DNA sequences derived from 315 EST- and 43 non-coding RFLP-derived loci. In sugar beet lines, loci of expressed genes showed an average SNP frequency of 1/72 bp, 1 in 58 bp in non-coding sequences, increasing to 1/47 bp upon the addition of the remaining genotypes. Within analysed DNA fragments, alleles at different SNP positions displayed linkage disequilibrium indicative of haplotype structures. On average 2.7 haplotypes were found in sugar beet lines, and haplotype conservation in expressed genes appeared to exceed 500 bp in length. Seven different genotyping techniques including SNP detection by MALDI-TOF mass spectrometry, pyrosequencing and fluorescence scanning of labelled nucleotides were employed to perform 712 segregation analyses for 538 markers in three F(2) populations. Functions were predicted for 492 mapped sequences. Genetic maps comprised 305 loci covering 599.8 cM in population K1, 241 loci distributed over 636.6 cM in population D2, and 166 loci over 507.1 cM in population K2, respectively. Based on 156 markers common to more than one population an integrated map was constructed with 524 loci covering 664.3 cM. For 377 loci the genome positions of the most similar sequences from A. thaliana were identified, but little evidence for previously presented ancestral genome structures was found.

  8. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  9. Development Of Interspecific Cssls In Rice Using SNP-Based Selection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Six libraries of chromosome segment substitution lines (CSSLs) are being developed based on crosses between three diverse accessions of O. rufipogon (from China, Laos and Indonesia) and two O. sativa recurrent parents, IR64, an indica variety (from the Philippines), and Cybonnet, a tropical japonica...

  10. Development and implementation of a highly-multiplexed SNP array for genetic mapping in maritime pine and comparative mapping with loblolly pine

    PubMed Central


    Background Single nucleotide polymorphisms (SNPs) are the most abundant source of genetic variation among individuals of a species. New genotyping technologies allow examining hundreds to thousands of SNPs in a single reaction for a wide range of applications such as genetic diversity analysis, linkage mapping, fine QTL mapping, association studies, marker-assisted or genome-wide selection. In this paper, we evaluated the potential of highly-multiplexed SNP genotyping for genetic mapping in maritime pine (Pinus pinaster Ait.), the main conifer used for commercial plantation in southwestern Europe. Results We designed a custom GoldenGate assay for 1,536 SNPs detected through the resequencing of gene fragments (707 in vitro SNPs/Indels) and from Sanger-derived Expressed Sequenced Tags assembled into a unigene set (829 in silico SNPs/Indels). Offspring from three-generation outbred (G2) and inbred (F2) pedigrees were genotyped. The success rate of the assay was 63.6% and 74.8% for in silico and in vitro SNPs, respectively. A genotyping error rate of 0.4% was further estimated from segregating data of SNPs belonging to the same gene. Overall, 394 SNPs were available for mapping. A total of 287 SNPs were integrated with previously mapped markers in the G2 parental maps, while 179 SNPs were localized on the map generated from the analysis of the F2 progeny. Based on 98 markers segregating in both pedigrees, we were able to generate a consensus map comprising 357 SNPs from 292 different loci. Finally, the analysis of sequence homology between mapped markers and their orthologs in a Pinus taeda linkage map, made it possible to align the 12 linkage groups of both species. Conclusions Our results show that the GoldenGate assay can be used successfully for high-throughput SNP genotyping in maritime pine, a conifer species that has a genome seven times the size of the human genome. This SNP-array will be extended thanks to recent sequencing effort using new generation

  11. QTL scanning for rice yield using a whole genome SNP array.


    Tan, Cong; Han, Zhongmin; Yu, Huihui; Zhan, Wei; Xie, Weibo; Chen, Xun; Zhao, Hu; Zhou, Fasong; Xing, Yongzhong


    High-throughput SNP genotyping is widely used for plant genetic studies. Recently, a RICE6K SNP array has been developed based on the Illumina Bead Array platform and Infinium SNP assay technology for genome-wide evaluation of allelic variations and breeding applications. In this study, the RICE6K SNP array was used to genotype a recombinant inbred line (RIL) population derived from the cross between the indica variety, Zhenshan 97, and the japonica variety, Xizang 2. A total of 3324 SNP markers of high quality were identified and were grouped into 1495 recombination bins in the RIL population. A high-density linkage map, consisting of the 1495 bins, was developed, covering 1591.2 cM and with average length of 1.1 cM per bin. Segregation distortions were observed in 24 regions of the 11 chromosomes in the RILs. One half of the distorted regions contained fertility genes that had been previously reported. A total of 23 QTLs were identified for yield. Seven QTLs were firstly detected in this study. The positive alleles from about half of the identified QTLs came from Zhenshan 97 and they had lower phenotypic values than Xizang 2. This indicated that favorable alleles for breeding were dispersed in both parents and pyramiding favorable alleles could develop elite lines. The size of the mapping population for QTL analysis using high throughput SNP genotyping platform is also discussed.

  12. Parentage Reconstruction in Eucalyptus nitens Using SNPs and Microsatellite Markers: A Comparative Analysis of Marker Data Power and Robustness

    PubMed Central

    Telfer, Emily J.; Stovold, Grahame T.; Li, Yongjun; Silva-Junior, Orzenil B.; Grattapaglia, Dario G.; Dungey, Heidi S.


    Pedigree reconstruction using molecular markers enables efficient management of inbreeding in open-pollinated breeding strategies, replacing expensive and time-consuming controlled pollination. This is particularly useful in preferentially outcrossed, insect pollinated Eucalypts known to suffer considerable inbreeding depression from related matings. A single nucleotide polymorphism (SNP) marker panel consisting of 106 markers was selected for pedigree reconstruction from the recently developed high-density Eucalyptus Infinium SNP chip (EuCHIP60K). The performance of this SNP panel for pedigree reconstruction in open-pollinated progenies of two Eucalyptus nitens seed orchards was compared with that of two microsatellite panels with 13 and 16 markers respectively. The SNP marker panel out-performed one of the microsatellite panels in the resolution power to reconstruct pedigrees and out-performed both panels with respect to data quality. Parentage of all but one offspring in each clonal seed orchard was correctly matched to the expected seed parent using the SNP marker panel, whereas parentage assignment to less than a third of the expected seed parents were supported using the 13-microsatellite panel. The 16-microsatellite panel supported all but one of the recorded seed parents, one better than the SNP panel, although there was still a considerable level of missing and inconsistent data. SNP marker data was considerably superior to microsatellite data in accuracy, reproducibility and robustness. Although microsatellites and SNPs data provide equivalent resolution for pedigree reconstruction, microsatellite analysis requires more time and experience to deal with the uncertainties of allele calling and faces challenges for data transferability across labs and over time. While microsatellite analysis will continue to be useful for some breeding tasks due to the high information content, existing infrastructure and low operating costs, the multi-species SNP resource

  13. Markers of tolerance development to food allergens.


    Ponce, M; Diesner, S C; Szépfalusi, Z; Eiwegger, T


    IgE-mediated reactions to food allergens are the most common cause of anaphylaxis in childhood. Although allergies to cow's milk, egg, or soy proteins, in contrast to peanut and tree nut allergens, resolve within the first 6 years of life in up to 60% due to natural tolerance development, this process is not well understood. At present, there is no cure or treatment for food allergy that would result in an induction of tolerance to the symptom-eliciting food. Avoidance, providing an emergency plan and education, is the standard of treatment. Oral immunotherapeutic approaches have been proven reasonable efficacy; however, they are associated with high rates of side-effects and low numbers of patients achieving tolerance. Nevertheless, mechanisms that take place during oral immunotherapy may help to understand tolerance development. On the basis of these therapeutic interventions, events like loss of basophil activation and induction of regulatory lymphocyte subsets and of blocking antibodies have been described. Their functional importance at a clinical level, however, remains to be investigated in detail. Consequently, there is eminent need to understand the process of tolerance development to food allergens and define biomarkers to develop and monitor new treatment strategies for food allergy. PMID:27286276

  14. SNP Discovery through Next-Generation Sequencing and Its Applications

    PubMed Central

    Kumar, Santosh; Banks, Travis W.; Cloutier, Sylvie


    The decreasing cost along with rapid progress in next-generation sequencing and related bioinformatics computing resources has facilitated large-scale discovery of SNPs in various model and nonmodel plant species. Large numbers and genome-wide availability of SNPs make them the marker of choice in partially or completely sequenced genomes. Although excellent reviews have been published on next-generation sequencing, its associated bioinformatics challenges, and the applications of SNPs in genetic studies, a comprehensive review connecting these three intertwined research areas is needed. This paper touches upon various aspects of SNP discovery, highlighting key points in availability and selection of appropriate sequencing platforms, bioinformatics pipelines, SNP filtering criteria, and applications of SNPs in genetic analyses. The use of next-generation sequencing methodologies in many non-model crops leading to discovery and implementation of SNPs in various genetic studies is discussed. Development and improvement of bioinformatics software that are open source and freely available have accelerated the SNP discovery while reducing the associated cost. Key considerations for SNP filtering and associated pipelines are discussed in specific topics. A list of commonly used software and their sources is compiled for easy access and reference. PMID:23227038

  15. Genome-Wide Identification of SSR and SNP Markers Based on Whole-Genome Re-Sequencing of a Thailand Wild Sacred Lotus (Nelumbo nucifera)

    PubMed Central

    Zhu, Zhixuan; Wang, Xiaolei; Ke, Weidong; Ding, Yi


    Genomic resources such as single nucleotide polymorphism (SNPs), insertions and deletions (InDels) and SSRs (simple sequence repeats) are essential for crop improvement and better utilization in genetic breeding. However, the resources for the sacred lotus (Nelumbo nucifera Gaertn.) are still limited. In the present study, to dissect large-scale genomic molecular marker resources for sacred lotus, we re-sequenced a Thailand sacred lotus cultivar ‘Chiang Mai wild lotus’ and compared with the reported lotus genome ‘Middle lake wild lotus’. A total of 3,180,059 SNPs, 328, 251 InDels and 14,191 SVs were found between the two genomes. The functional impact analyses of these SNPs indicated that they may be involved in metabolic processes, binding, catalytic activity, etc. Mining the genome sequences for SSRs showed that 191,657 SSRs were identified with a frequency of one SSR per 4.23 kb and 103,656 SSR primer pairs were designed. Furthermore, 14, 502 EST-SSRs were also indentified using the available RNA-seq data in the NCBI. A subset of 150 SSRs (genomic and EST-SSRs) was randomly selected for validation and genetic diversity analysis. The genotypes could be easily distinguished using these SSR markers and the ‘Chiang Mai wild lotus’ was obviously differentiated from the other Chinese accessions. This study provides considerable amounts of genomic resources and markers for the quantitative trait locus (QTL) identification and molecular selection of the species, which could have a potential role in various applications in sacred lotus breeding. PMID:26606530

  16. A Large Maize (Zea mays L.) SNP Genotyping Array: Development and Germplasm Genotyping, and Genetic Mapping to Compare with the B73 Reference Genome

    PubMed Central

    Ganal, Martin W.; Durstewitz, Gregor; Polley, Andreas; Bérard, Aurélie; Buckler, Edward S.; Charcosset, Alain; Clarke, Joseph D.; Graner, Eva-Maria; Hansen, Mark; Joets, Johann; Le Paslier, Marie-Christine; McMullen, Michael D.; Montalent, Pierre; Rose, Mark; Schön, Chris-Carolin; Sun, Qi; Walter, Hildrun; Martin, Olivier C.; Falque, Matthieu


    SNP genotyping arrays have been useful for many applications that require a large number of molecular markers such as high-density genetic mapping, genome-wide association studies (GWAS), and genomic selection. We report the establishment of a large maize SNP array and its use for diversity analysis and high density linkage mapping. The markers, taken from more than 800,000 SNPs, were selected to be preferentially located in genes and evenly distributed across the genome. The array was tested with a set of maize germplasm including North American and European inbred lines, parent/F1 combinations, and distantly related teosinte material. A total of 49,585 markers, including 33,417 within 17,520 different genes and 16,168 outside genes, were of good quality for genotyping, with an average failure rate of 4% and rates up to 8% in specific germplasm. To demonstrate this array's use in genetic mapping and for the independent validation of the B73 sequence assembly, two intermated maize recombinant inbred line populations – IBM (B73×Mo17) and LHRF (F2×F252) – were genotyped to establish two high density linkage maps with 20,913 and 14,524 markers respectively. 172 mapped markers were absent in the current B73 assembly and their placement can be used for future improvements of the B73 reference sequence. Colinearity of the genetic and physical maps was mostly conserved with some exceptions that suggest errors in the B73 assembly. Five major regions containing non-colinearities were identified on chromosomes 2, 3, 6, 7 and 9, and are supported by both independent genetic maps. Four additional non-colinear regions were found on the LHRF map only; they may be due to a lower density of IBM markers in those regions or to true structural rearrangements between lines. Given the array's high quality, it will be a valuable resource for maize genetics and many aspects of maize breeding. PMID:22174790

  17. A large maize (Zea mays L.) SNP genotyping array: development and germplasm genotyping, and genetic mapping to compare with the B73 reference genome.


    Ganal, Martin W; Durstewitz, Gregor; Polley, Andreas; Bérard, Aurélie; Buckler, Edward S; Charcosset, Alain; Clarke, Joseph D; Graner, Eva-Maria; Hansen, Mark; Joets, Johann; Le Paslier, Marie-Christine; McMullen, Michael D; Montalent, Pierre; Rose, Mark; Schön, Chris-Carolin; Sun, Qi; Walter, Hildrun; Martin, Olivier C; Falque, Matthieu


    SNP genotyping arrays have been useful for many applications that require a large number of molecular markers such as high-density genetic mapping, genome-wide association studies (GWAS), and genomic selection. We report the establishment of a large maize SNP array and its use for diversity analysis and high density linkage mapping. The markers, taken from more than 800,000 SNPs, were selected to be preferentially located in genes and evenly distributed across the genome. The array was tested with a set of maize germplasm including North American and European inbred lines, parent/F1 combinations, and distantly related teosinte material. A total of 49,585 markers, including 33,417 within 17,520 different genes and 16,168 outside genes, were of good quality for genotyping, with an average failure rate of 4% and rates up to 8% in specific germplasm. To demonstrate this array's use in genetic mapping and for the independent validation of the B73 sequence assembly, two intermated maize recombinant inbred line populations - IBM (B73×Mo17) and LHRF (F2×F252) - were genotyped to establish two high density linkage maps with 20,913 and 14,524 markers respectively. 172 mapped markers were absent in the current B73 assembly and their placement can be used for future improvements of the B73 reference sequence. Colinearity of the genetic and physical maps was mostly conserved with some exceptions that suggest errors in the B73 assembly. Five major regions containing non-colinearities were identified on chromosomes 2, 3, 6, 7 and 9, and are supported by both independent genetic maps. Four additional non-colinear regions were found on the LHRF map only; they may be due to a lower density of IBM markers in those regions or to true structural rearrangements between lines. Given the array's high quality, it will be a valuable resource for maize genetics and many aspects of maize breeding.

  18. Early Markers of Vulnerable Language Skill Development in Galactosaemia

    ERIC Educational Resources Information Center

    Lewis, Fiona M.; Coman, David J.; Syrmis, Maryanne


    There are no known biomedical or genetic markers to identify which infants with galactosaemia (GAL) are most at risk of poor language skill development, yet pre-linguistic communicative "red flag" behaviours are recognised as early identifiers of heightened vulnerability to impaired language development. We report on pre-linguistic…

  19. SNP Discovery Using Next Generation Transcriptomic Sequencing.


    De Wit, Pierre


    In this chapter, I will guide the user through methods to find new SNP markers from expressed sequence (RNA-Seq) data, focusing on the sample preparation and also on the bioinformatic analyses needed to sort through the immense flood of data from high-throughput sequencing machines. The general steps included are as follows: sample preparation, sequencing, quality control of data, assembly, mapping, SNP discovery, filtering, validation. The first few steps are traditional laboratory protocols, whereas steps following the sequencing are of bioinformatic nature. The bioinformatics described herein are by no means exhaustive, rather they serve as one example of a simple way of analyzing high-throughput sequence data to find SNP markers. Ideally, one would like to run through this protocol several times with a new dataset, while varying software parameters slightly, in order to determine the robustness of the results. The final validation step, although not described in much detail here, is also quite critical as that will be the final test of the accuracy of the assumptions made in silico.There is a plethora of downstream applications of a SNP dataset, not covered in this chapter. For an example of a more thorough protocol also including differential gene expression and functional enrichment analyses, BLAST annotation and downstream applications of SNP markers, a good starting point could be the "Simple Fool's Guide to population genomics via RNA-Seq," which is available at . PMID:27460371

  20. Development of a high-throughput SNP resource to advance genomic, genetic and breeding research in carrot (Daucus carota L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rapid advancement in high-throughput SNP genotyping technologies along with next generation sequencing (NGS) platforms has decreased the cost, improved the quality of large-scale genome surveys, and allowed specialty crops with limited genomic resources such as carrot (Daucus carota) to access t...

  1. SNP-SNP Interaction Analysis on Soybean Oil Content under Multi-Environments

    PubMed Central

    Yin, Zhengong; Leng, Yue; Yu, Hongxiao; Jia, Huiying; Jiang, Shanshan; Ni, Zhongqiu; Jiang, Hongwei; Han, Xue; Liu, Chunyan; Hu, Zhenbang; Wu, Xiaoxia; Hu, Guohua; Xin, Dawei; Qi, Zhaoming


    Soybean oil content is one of main quality traits. In this study, we used the multifactor dimensionality reduction (MDR) method and a soybean high-density genetic map including 5,308 markers to identify stable single nucleotide polymorphism (SNP)—SNP interactions controlling oil content in soybean across 23 environments. In total, 36,442,756 SNP-SNP interaction pairs were detected, 1865 of all interaction pairs associated with soybean oil content were identified under multiple environments by the Bonferroni correction with p <3.55×10−11. Two and 1863 SNP-SNP interaction pairs detected stable across 12 and 11 environments, respectively, which account around 50% of total environments. Epistasis values and contribution rates of stable interaction (the SNP interaction pairs were detected in more than 2 environments) pairs were detected by the two way ANOVA test, the available interaction pairs were ranged 0.01 to 0.89 and from 0.01 to 0.85, respectively. Some of one side of the interaction pairs were identified with previously research as a major QTL without epistasis effects. The results of this study provide insights into the genetic architecture of soybean oil content and can serve as a basis for marker-assisted selection breeding. PMID:27668866

  2. Development of DArT Marker Platforms and Genetic Diversity Assessment of the U.S. Collection of the New Oilseed Crop Lesquerella and Related Species

    PubMed Central

    Cruz, Von Mark V.; Kilian, Andrzej; Dierig, David A.


    The advantages of using molecular markers in modern genebanks are well documented. They are commonly used to understand the distribution of genetic diversity in populations and among species which is crucial for efficient management and effective utilization of germplasm collections. We describe the development of two types of DArT molecular marker platforms for the new oilseed crop lesquerella (Physaria spp.), a member of the Brassicaceae family, to characterize a collection in the National Plant Germplasm System (NPGS) with relatively little known in regards to the genetic diversity and traits. The two types of platforms were developed using a subset of the germplasm conserved ex situ consisting of 87 Physaria and 2 Paysonia accessions. The microarray DArT revealed a total of 2,833 polymorphic markers with an average genotype call rate of 98.4% and a scoring reproducibility of 99.7%. On the other hand, the DArTseq platform developed for SNP and DArT markers from short sequence reads showed a total of 27,748 high quality markers. Cluster analysis and principal coordinate analysis indicated that the different accessions were successfully classified by both systems based on species, by geographical source, and breeding status. In the germplasm set analyzed, which represented more than 80% of the P. fendleri collection, we observed that a substantial amount of variation exists in the species collection. These markers will be valuable in germplasm management studies and lesquerella breeding, and augment the microsatellite markers previously developed on the taxa. PMID:23724020

  3. A technical platform for PCR-based SNP screening in cereals and other crops.


    Wang, Zining


    With the rapid development of sequencing technologies and sequenced genomes, single-nucleotide polymorphisms (SNPs) have become a common genomic tool in the study of biological diversity, genome variation, gene mapping, cloning, and marker-assisted selection. In this chapter, PCR-based SNP screening is discussed in detail. This includes preparation of solutions and buffers, designing of tetra-primers, PCR for DNA amplification, gel electrophoresis, and SNP screening. By grasping the techniques and experience from the wet laboratories, researchers can quickly use this genomic tool to tackle problems in their research.

  4. Development of molecular markers and preliminary investigation of the population structure and mating system in one lineage of black morel (Morchella elata) in the Pacific Northwestern USA.


    Pagliaccia, Deborah; Douhan, Greg W; Douhan, LeAnn; Peever, Tobin L; Carris, Lori M; Kerrigan, Julia L


    Phylogenetic analysis of LSU/ITS sequence data revealed two distinct lineages among 44 morphologically similar fruiting bodies of natural black morels (Morchella elata group) sampled at three non-burn locations in the St Joe and Kanisku National Forests in northern Idaho. Most of the sampled isolates (n = 34) represented a dominant LSU/ITS haplotype present at all three sites and identical to the Mel-12 phylogenetic lineage (GU551425) identified in a previous study. Variation at 1-3 nucleotide sites was detected among a small number of isolates (n = 6) within this well supported clade (94%). Four isolates sampled from a single location were in a well supported clade (97%) distinct from the dominant haplotypes and may represent a previously un-sampled, cryptic phylogenetic species. Species-specific SNP and SCAR markers were developed for Mel-12 lineage isolates by cloning and sequencing AFLP amplicons, and segregation of AFLP markers were studied from single ascospore isolates from individual fruiting bodies. Based on the segregation of AFLP markers within single fruiting bodies, split decomposition analyses of two SCAR markers, and population genetic analyses of SNP, SCAR, and AFLP markers, it appears that members of the Morchella sp. Mel-12 phylogenetic lineage are heterothallic and outcross in nature similar to yellow morels. This is the first set of locus-specific molecular markers that has been developed for any Morchella species, to our knowledge. These markers will prove to be valuable tools to study mating system, gene flow and genetic structure of black morels at various spatial scales with field-collected fruiting bodies and eliminate the need to culture samples in vitro. PMID:21642339

  5. Development of SSR markers for the genus Patellifolia (Chenopodiaceae)1

    PubMed Central

    Nachtigall, Marion; Bülow, Lorenz; Schubert, Jörg; Frese, Lothar


    Premise of the study: Microsatellite primers were developed to promote studies on the patterns of genetic diversity within Patellifolia patellaris (Chenopodiaceae) and the relationship between the three species of the genus Patellifolia. Methods and Results: The genomic sequence from P. procumbens was screened for simple sequence repeats (SSRs), and 3648 SSRs were identified. A subset of 53 SSR markers was validated, of which 25 proved to be polymorphic in the three species except for the P. webbiana–specific marker JKIPat16. The number of alleles ranged from 85 in P. patellaris, 187 in P. procumbens, and 202 in P. webbiana. Conclusions: The set of 25 new markers will facilitate studies of the relationships between the three Patellifolia species and of the spatial and temporal distribution of genetic diversity within the species. PMID:27610279

  6. Development of SSR markers for the genus Patellifolia (Chenopodiaceae)1

    PubMed Central

    Nachtigall, Marion; Bülow, Lorenz; Schubert, Jörg; Frese, Lothar


    Premise of the study: Microsatellite primers were developed to promote studies on the patterns of genetic diversity within Patellifolia patellaris (Chenopodiaceae) and the relationship between the three species of the genus Patellifolia. Methods and Results: The genomic sequence from P. procumbens was screened for simple sequence repeats (SSRs), and 3648 SSRs were identified. A subset of 53 SSR markers was validated, of which 25 proved to be polymorphic in the three species except for the P. webbiana–specific marker JKIPat16. The number of alleles ranged from 85 in P. patellaris, 187 in P. procumbens, and 202 in P. webbiana. Conclusions: The set of 25 new markers will facilitate studies of the relationships between the three Patellifolia species and of the spatial and temporal distribution of genetic diversity within the species.

  7. Development of high-density SNP genotyping arrays for white spruce (Picea glauca) and transferability to subtropical and nordic congeners.


    Pavy, Nathalie; Gagnon, France; Rigault, Philippe; Blais, Sylvie; Deschênes, Astrid; Boyle, Brian; Pelgas, Betty; Deslauriers, Marie; Clément, Sébastien; Lavigne, Patricia; Lamothe, Manuel; Cooke, Janice E K; Jaramillo-Correa, Juan P; Beaulieu, Jean; Isabel, Nathalie; Mackay, John; Bousquet, Jean


    High-density SNP genotyping arrays can be designed for any species given sufficient sequence information of high quality. Two high-density SNP arrays relying on the Infinium iSelect technology (Illumina) were designed for use in the conifer white spruce (Picea glauca). One array contained 7338 segregating SNPs representative of 2814 genes of various molecular functional classes for main uses in genetic association and population genetics studies. The other one contained 9559 segregating SNPs representative of 9543 genes for main uses in population genetics, linkage mapping of the genome and genomic prediction. The SNPs assayed were discovered from various sources of gene resequencing data. SNPs predicted from high-quality sequences derived from genomic DNA reached a genotyping success rate of 64.7%. Nonsingleton in silico SNPs (i.e. a sequence polymorphism present in at least two reads) predicted from expressed sequenced tags obtained with the Roche 454 technology and Illumina GAII analyser resulted in a similar genotyping success rate of 71.6% when the deepest alignment was used and the most favourable SNP probe per gene was selected. A variable proportion of these SNPs was shared by other nordic and subtropical spruce species from North America and Europe. The number of shared SNPs was inversely proportional to phylogenetic divergence and standing genetic variation in the recipient species, but positively related to allele frequency in P. glauca natural populations. These validated SNP resources should open up new avenues for population genetics and comparative genetic mapping at a genomic scale in spruce species.

  8. Identification of genetic markers for fat deposition and meat tenderness on bovine chromosome 5: development of a low-density single nucleotide polymorphism map.


    Stone, R T; Casas, E; Smith, T P L; Keele, J W; Harhay, G; Bennett, G L; Koohmaraie, M; Wheeler, T L; Shackelford, S D; Snelling, W M


    As genetic markers, SNP are well suited for the development of genetic tests for production traits in livestock. They are stable through many generations and can provide direct assessment of individual animal's genetic merit if they are in linkage disequilibrium and phase with functional genetic variation. Bovine chromosome 5 has been shown to harbor genetic variation affecting production traits in multiple cattle populations; thus, this chromosome was targeted for SNP-based marker development and subsequent association analysis with carcass and growth phenotypes. Discovery of SNP was performed in a panel of 16 sires representing two sires from each of seven beef breeds and two Holstein sires by PCR amplification and sequencing using primers designed from genomic sequence obtained by low-coverage sequencing of bacterial artificial chromosome (BAC) clones. From 550 SNP, 296 (54%) were tentatively identified as having a minor allele frequency >10%. Forty-five SNP derived from 15 BAC were chosen based on minor allele frequency and were genotyped in 564 steers and their sires. Production and carcass data were collected on the steers as a part of the Germplasm Evaluation (GPE), Cycle VII Project at the U.S. Meat Animal Research Center (Clay Center, NE), which involves of the evaluation of sires from seven of the most popular U.S. breeds. Haplotypes based on seven SNP derived from a BAC containing the bovine genes HEM1 and PDE1B were associated with traits related to carcass fat. Steers homozygous for the major haplotype had 0.15 +/- 0.04 cm less subcutaneous fat, 0.57 +/- 0.18 kg less rib fat, 0.18 +/- 0.07 lower yield grade, 1.11 +/- 0.35% less predicted fat yield, and 0.79 +/- 0.3% greater predicted retail product yield than heterozygotes. The frequency of the major haplotype was 0.70 in the steers, and it ranged from 0.44 (Limousin) to 0.98 (Simmental and Gelbvieh) in a panel consisting of an average of 20 purebred sires from each of the seven breeds. A second set of


    SciTech Connect

    Shah, Nameeta; Teplitsky, Michael; Minovitsky, Simon; Dubchak, Inna


    SNP-VISTA aids in analyses of the following types of data: A. Large-scale re-sequence data of disease-related genes for discovery of associated and/or causative alleles (GeneSNP-VISTA). B. Massive amounts of ecogenomics data for studying homologous recombination in microbial populations (EcoSNP-VISTA). The main features and capabilities of SNP-VISTA are: 1) Mapping of SNPs to gene structure; 2) classification of SNPs, based on their location in the gene, frequency of occurrence in samples and allele composition; 3) clustering, based on user-defined subsets of SNPs, highlighting haplotypes as well as recombinant sequences; 4) integration of protein conservation visualization; and 5) display of automatically calculated recombination points that are user-editable. The main strength of SNP-VISTA is its graphical interface and use of visual representations, which support interactive exploration and hence better understanding of large-scale SNPs data.

  10. Characterization of the Miiuy Croaker (Miichthys miiuy) Transcriptome and Development of Immune-Relevant Genes and Molecular Markers

    PubMed Central

    Che, Rongbo; Sun, Yueyan; Sun, Dianqiao; Xu, Tianjun


    Background The miiuy croaker (Miichthys miiuy) is an important species of marine fish that supports capture fisheries and aquaculture. At present commercial scale aquaculture of this species is limited due to diseases caused by pathogens and parasites which restrict production and limit commercial value. The lack of transcriptomic and genomic information for the miiuy croaker limits the ability of researchers to study the pathogenesis and immune system of this species. In this study we constructed a cDNA library from liver, spleen and kidney which was sequenced using Illumina paired-end sequencing to enable gene discovery and molecular marker development. Principal Findings In our study, a total of 69,071 unigenes with an average length of 572 bp were obtained. Of these, 45,676 (66.13%) were successfully annotated in public databases. The unigenes were also annotated with Gene Ontology, Clusters of Orthologous Groups and KEGG pathways. Additionally, 498 immune-relevant genes were identified and classified. Furthermore, 14,885 putative simple sequence repeats (cSSRs) and 8,510 putative single nucleotide polymorphisms (SNPs) were identified from the 69,071 unigenes. Conclusion The miiuy croaker (Miichthys miiuy) transcriptome data provides a large resource to identify new genes involved in many processes including those involved in the response to pathogens and diseases. Furthermore, the thousands of potential cSSR and SNP markers found in this study are important resources with respect to future development of molecular marker assisted breeding programs for the miiuy croaker. PMID:24714210

  11. Identification and authentication of Rosa species through development of species-specific SCAR marker(s).


    Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M


    Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

  12. HapRice, an SNP haplotype database and a web tool for rice.


    Yonemaru, Jun-ichi; Ebana, Kaworu; Yano, Masahiro


    Genome-wide single nucleotide polymorphism (SNP) analysis is a promising tool to examine the genetic diversity of rice populations and genetic traits of scientific and economic importance. Next-generation sequencing technology has accelerated the re-sequencing of diverse rice varieties and the discovery of genome-wide SNPs. Notably, validation of these SNPs by a high-throughput genotyping system, such as an SNP array, could provide a manageable and highly accurate SNP set. To enhance the potential utility of genome-wide SNPs for geneticists and breeders, analysis tools need to be developed. Here, we constructed an SNP haplotype database, which allows visualization of the allele frequency of all SNPs in the genome browser. We calculated the allele frequencies of 3,334 SNPs in 76 accessions from the world rice collection and 3,252 SNPs in 177 Japanese rice accessions; all these SNPs have been validated in our previous studies. The SNP haplotypes were defined by the allele frequency in each cultivar group (aus, indica, tropical japonica and temperate japonica) for the world rice accessions, and in non-irrigated and three irrigated groups (three variety registration periods) for Japanese rice accessions. We also developed web tools for finding polymorphic SNPs between any two rice accessions and for the primer design to develop cleaved amplified polymorphic sequence markers at any SNP. The 'HapRice' database and the web tools can be accessed at In addition, we established a core SNP set consisting of 768 SNPs uniformly distributed in the rice genome; this set is of a practically appropriate size for use in rice genetic analysis.

  13. Development of Molecular Markers for Determining Continental Origin of Wood from White Oaks (Quercus L. sect. Quercus).


    Schroeder, Hilke; Cronn, Richard; Yanbaev, Yulai; Jennings, Tara; Mader, Malte; Degen, Bernd; Kersten, Birgit


    To detect and avoid illegal logging of valuable tree species, identification methods for the origin of timber are necessary. We used next-generation sequencing to identify chloroplast genome regions that differentiate the origin of white oaks from the three continents; Asia, Europe, and North America. By using the chloroplast genome of Asian Q. mongolica as a reference, we identified 861 variant sites (672 single nucleotide polymorphisms (SNPs); 189 insertion/deletion (indel) polymorphism) from representative species of three continents (Q. mongolica from Asia; Q. petraea and Q. robur from Europe; Q. alba from North America), and we identified additional chloroplast polymorphisms in pools of 20 individuals each from Q. mongolica (789 variant sites) and Q. robur (346 variant sites). Genome sequences were screened for indels to develop markers that identify continental origin of oak species, and that can be easily evaluated using a variety of detection methods. We identified five indels and one SNP that reliably identify continent-of-origin, based on evaluations of up to 1078 individuals representing 13 white oak species and three continents. Due to the size of length polymorphisms revealed, this marker set can be visualized using capillary electrophoresis or high resolution gel (acrylamide or agarose) electrophoresis. With these markers, we provide the wood trading market with an instrument to comply with the U.S. and European laws that require timber companies to avoid the trade of illegally harvested timber. PMID:27352242

  14. Development of Molecular Markers for Determining Continental Origin of Wood from White Oaks (Quercus L. sect. Quercus)

    PubMed Central

    Schroeder, Hilke; Cronn, Richard; Yanbaev, Yulai; Jennings, Tara; Mader, Malte; Degen, Bernd; Kersten, Birgit


    To detect and avoid illegal logging of valuable tree species, identification methods for the origin of timber are necessary. We used next-generation sequencing to identify chloroplast genome regions that differentiate the origin of white oaks from the three continents; Asia, Europe, and North America. By using the chloroplast genome of Asian Q. mongolica as a reference, we identified 861 variant sites (672 single nucleotide polymorphisms (SNPs); 189 insertion/deletion (indel) polymorphism) from representative species of three continents (Q. mongolica from Asia; Q. petraea and Q. robur from Europe; Q. alba from North America), and we identified additional chloroplast polymorphisms in pools of 20 individuals each from Q. mongolica (789 variant sites) and Q. robur (346 variant sites). Genome sequences were screened for indels to develop markers that identify continental origin of oak species, and that can be easily evaluated using a variety of detection methods. We identified five indels and one SNP that reliably identify continent-of-origin, based on evaluations of up to 1078 individuals representing 13 white oak species and three continents. Due to the size of length polymorphisms revealed, this marker set can be visualized using capillary electrophoresis or high resolution gel (acrylamide or agarose) electrophoresis. With these markers, we provide the wood trading market with an instrument to comply with the U.S. and European laws that require timber companies to avoid the trade of illegally harvested timber. PMID:27352242

  15. SNPMeta: SNP annotation and SNP metadata collection without a reference genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The increase in availability of resequencing data is greatly accelerating SNP discovery and has facilitated the development of SNP genotyping assays. This, in turn, is increasing interest in annotation of individual SNPs. Currently, these data are only available through curation, or comparison to a ...

  16. Development and annotation of perennial Triticeae ESTs and SSR markers.


    Bushman, B Shaun; Larson, Steve R; Mott, Ivan W; Cliften, Paul F; Wang, Richard R-C; Chatterton, N Jerry; Hernandez, Alvaro G; Ali, Shahjahan; Kim, Ryan W; Thimmapuram, Jyothi; Gong, George; Liu, Lei; Mikel, Mark A


    Triticeae contains hundreds of species of both annual and perennial types. Although substantial genomic tools are available for annual Triticeae cereals such as wheat and barley, the perennial Triticeae lack sufficient genomic resources for genetic mapping or diversity research. To increase the amount of sequence information available in the perennial Triticeae, three expressed sequence tag (EST) libraries were developed and annotated for Pseudoroegneria spicata, a mixture of both Elymus wawawaiensis and E. lanceolatus, and a Leymus cinereus x L. triticoides interspecific hybrid. The ESTs were combined into unigene sets of 8 780 unigenes for P. spicata, 11 281 unigenes for Leymus, and 7 212 unigenes for Elymus. Unigenes were annotated based on putative orthology to genes from rice, wheat, barley, other Poaceae, Arabidopsis, and the non-redundant database of the NCBI. Simple sequence repeat (SSR) markers were developed, tested for amplification and polymorphism, and aligned to the rice genome. Leymus EST markers homologous to rice chromosome 2 genes were syntenous on Leymus homeologous groups 6a and 6b (previously 1b), demonstrating promise for in silico comparative mapping. All ESTs and SSR markers are available on an EST information management and annotation database ( PMID:18923529

  17. Transcriptome sequencing, and rapid development and application of SNP markers for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The legume pod borer, Maruca vitrata (Lepidoptera: Crambidae), is an insect pest species that is destructive to crops grown by subsistence farmers in tropical regions of West Africa. We present the de novo assembly of 3729 contigs from 454- and Sanger-derived sequencing reads for midgut, salivary, ...

  18. Development of a high throughput SNP assay for marker-assisted breeding of Theobroma cacao in cacao producing countries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two commercially important diseases of Theobroma cacao are witches' broom (Moniliophthora perniciosa) and frosty pod (Moniliophthora roreri). Dr. Raymond Schnell is coordinating a major international breeding program for disease resistance in cacao in countries such as Ecuador and Ghana where labora...

  19. Using Next Generation Sequencing for Multiplexed Trait-Linked Markers in Wheat

    PubMed Central

    Bernardo, Amy; Wang, Shan; St. Amand, Paul; Bai, Guihua


    With the advent of next generation sequencing (NGS) technologies, single nucleotide polymorphisms (SNPs) have become the major type of marker for genotyping in many crops. However, the availability of SNP markers for important traits of bread wheat (Triticum aestivum L.) that can be effectively used in marker-assisted selection (MAS) is still limited and SNP assays for MAS are usually uniplex. A shift from uniplex to multiplex assays will allow the simultaneous analysis of multiple markers and increase MAS efficiency. We designed 33 locus-specific markers from SNP or indel-based marker sequences that linked to 20 different quantitative trait loci (QTL) or genes of agronomic importance in wheat and analyzed the amplicon sequences using an Ion Torrent Proton Sequencer and a custom allele detection pipeline to determine the genotypes of 24 selected germplasm accessions. Among the 33 markers, 27 were successfully multiplexed and 23 had 100% SNP call rates. Results from analysis of "kompetitive allele-specific PCR" (KASP) and sequence tagged site (STS) markers developed from the same loci fully verified the genotype calls of 23 markers. The NGS-based multiplexed assay developed in this study is suitable for rapid and high-throughput screening of SNPs and some indel-based markers in wheat. PMID:26625271

  20. Supervised learning-based tagSNP selection for genome-wide disease classifications

    PubMed Central

    Liu, Qingzhong; Yang, Jack; Chen, Zhongxue; Yang, Mary Qu; Sung, Andrew H; Huang, Xudong


    Background Comprehensive evaluation of common genetic variations through association of single nucleotide polymorphisms (SNPs) with complex human diseases on the genome-wide scale is an active area in human genome research. One of the fundamental questions in a SNP-disease association study is to find an optimal subset of SNPs with predicting power for disease status. To find that subset while reducing study burden in terms of time and costs, one can potentially reconcile information redundancy from associations between SNP markers. Results We have developed a feature selection method named Supervised Recursive Feature Addition (SRFA). This method combines supervised learning and statistical measures for the chosen candidate features/SNPs to reconcile the redundancy information and, in doing so, improve the classification performance in association studies. Additionally, we have proposed a Support Vector based Recursive Feature Addition (SVRFA) scheme in SNP-disease association analysis. Conclusions We have proposed using SRFA with different statistical learning classifiers and SVRFA for both SNP selection and disease classification and then applying them to two complex disease data sets. In general, our approaches outperform the well-known feature selection method of Support Vector Machine Recursive Feature Elimination and logic regression-based SNP selection for disease classification in genetic association studies. Our study further indicates that both genetic and environmental variables should be taken into account when doing disease predictions and classifications for the most complex human diseases that have gene-environment interactions. PMID:18366619

  1. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    PubMed Central

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun


    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  2. Comparative analysis of disease-linked single nucleotide polymorphic markers from Brassica rapa for their applicability to Brassica oleracea.


    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun


    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH--developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP--based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS--derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species.

  3. A collection of ordered tetranucleotide-repeat markers from the human genome. The Utah Marker Development Group.

    PubMed Central


    A collection of 1,069 human PCR-based genetic markers has been developed, and their distribution over the 22 autosomes and the X chromosome has been determined. Each marker was developed around a short-tandem-repeat DNA sequence. The majority (85%) of the markers described here were selected to contain tetranucleotide repeats, because these repeats show better stability during PCR than do dinucleotide repeats. Linkage maps constructed from genotypes collected with these markers in four CEPH pedigrees (1331, 1332, 1362, and 884) covered 3,417 cM of the human genome. More than 600 of the loci revealed heterozygosities > .70. Overall, 444 loci were ordered, with odds > 100:1 against inversion of adjacent loci. The average distance between markers was 7.4 cM on the autosomes and 24.8 cM on the X chromosome. Likely locations (100:1 odds intervals) were assigned for the remaining 621 short-tandem-repeat polymorphisms, as well as for 160 other markers that are present on the framework maps published by the Cooperative Human Linkage Center. Four markers specific to the Y chromosome are also reported here. From our maps, 347 markers were chosen to define "index" maps for each of the 22 autosomes. The index markers detect loci with an average heterozygosity of .85 and cover 3,169 cM of the autosomes, with an average distance between markers of 9.2 cM. These polymorphic short tandem repeats will be highly useful as reagents for the ongoing genetic and physical mapping of the human genome and for characterization of genetic changes in cancer. PMID:7668290

  4. SNP Discovery and Chromosome Anchoring Provide the First Physically-Anchored Hexaploid Oat Map and Reveal Synteny with Model Species

    PubMed Central

    Chao, Shiaoman; Jellen, Eric N.; Carson, Martin L.; Rines, Howard W.; Obert, Donald E.; Lutz, Joseph D.; Shackelford, Irene; Korol, Abraham B.; Wight, Charlene P.; Gardner, Kyle M.; Hattori, Jiro; Beattie, Aaron D.; Bjørnstad, Åsmund; Bonman, J. Michael; Jannink, Jean-Luc; Sorrells, Mark E.; Brown-Guedira, Gina L.; Mitchell Fetch, Jennifer W.; Harrison, Stephen A.; Howarth, Catherine J.; Ibrahim, Amir; Kolb, Frederic L.; McMullen, Michael S.; Murphy, J. Paul; Ohm, Herbert W.; Rossnagel, Brian G.; Yan, Weikai; Miclaus, Kelci J.; Hiller, Jordan; Maughan, Peter J.; Redman Hulse, Rachel R.; Anderson, Joseph M.; Islamovic, Emir


    A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42) has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources. PMID:23533580

  5. SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species.


    Oliver, Rebekah E; Tinker, Nicholas A; Lazo, Gerard R; Chao, Shiaoman; Jellen, Eric N; Carson, Martin L; Rines, Howard W; Obert, Donald E; Lutz, Joseph D; Shackelford, Irene; Korol, Abraham B; Wight, Charlene P; Gardner, Kyle M; Hattori, Jiro; Beattie, Aaron D; Bjørnstad, Åsmund; Bonman, J Michael; Jannink, Jean-Luc; Sorrells, Mark E; Brown-Guedira, Gina L; Mitchell Fetch, Jennifer W; Harrison, Stephen A; Howarth, Catherine J; Ibrahim, Amir; Kolb, Frederic L; McMullen, Michael S; Murphy, J Paul; Ohm, Herbert W; Rossnagel, Brian G; Yan, Weikai; Miclaus, Kelci J; Hiller, Jordan; Maughan, Peter J; Redman Hulse, Rachel R; Anderson, Joseph M; Islamovic, Emir; Jackson, Eric W


    A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42) has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources. PMID:23533580



    SNP-VISTA aids in analyses of the following types of data: A. Large-scale re-sequence data of disease-related genes for discovery of associated and/or causative alleles (GeneSNP-VISTA). B. Massive amounts of ecogenomics data for studying homologous recombination in microbial populations (EcoSNP-VISTA). The main features and capabilities of SNP-VISTA are: 1) Mapping of SNPs to gene structure; 2) classification of SNPs, based on their location in the gene, frequency of occurrence in samples and allele composition; 3) clustering,more » based on user-defined subsets of SNPs, highlighting haplotypes as well as recombinant sequences; 4) integration of protein conservation visualization; and 5) display of automatically calculated recombination points that are user-editable. The main strength of SNP-VISTA is its graphical interface and use of visual representations, which support interactive exploration and hence better understanding of large-scale SNPs data.« less

  7. Development of simple sequence repeat markers in cymbopogon species.


    Kumar, Jitendra; Verma, Vijeshwar; Shahi, Ashok Kumar; Qazi, Gulam Nab; Balyan, Harindra Singh


    The genus Cymbopogon comprises about 140 species, which produce characteristic aromatic essential oils. However, the phenotypic identification of species of Cymbopogon has been difficult as a result of widespread occurrence of natural variants, which differ in ploidy levels and chemotaxonomic complexities. Therefore, we have developed a set of simple sequence repeat markers from a genomic library of Cymbopogon jwarancusa to help in the precise identification of the species (including accessions) of Cymbopogon. For this purpose, we isolated 16 simple sequence repeat containing genomic deoxyribonucleic acid clones of C. jwarancusa, which contained a total of 32 simple sequence repeats with a range of 1 to 3 simple sequence repeats per clone. The majority (68.8%) of the 32 simple sequence repeats comprised dinucleotide repeat motifs followed by simple sequence repeats with trinucleotide (21.8%) and other higher order repeat motifs. Eighteen (81.8%) of the 22 designed primers for the above simple sequence repeats amplified products of expected sizes, when tried with genomic DNA of C. jwarancusa, the source species. Thirteen (72.2%) of the 18 functional primers detected polymorphism among the three species of Cymbopogon (C. flexuosus, C. pendulus and C. jwarancusa) and amplified a total of 95 alleles (range 1-18 alleles) with a PIC value of 0.44 to 0.96 per simple sequence repeat. Thus, the higher allelic range and high level of polymorphism demonstrated by the newly developed simple sequence repeat markers are likely to have many applications such as in improvement of essential oil quality by authentication of Cymbopogon species and varieties and mapping or tagging the genes controlling agronomically important traits of essential oils, which can further be utilized in marker assisted breeding.

  8. An integrated SNP mining and utilization (ISMU) pipeline for next generation sequencing data.


    Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A V S K; Varshney, Rajeev K


    Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at as a standalone

  9. High-density SNP-based genetic maps for the parents of an outcrossed and a selfed tetraploid garden rose cross, inferred from admixed progeny using the 68k rose SNP array

    PubMed Central

    Vukosavljev, Mirjana; Arens, Paul; Voorrips, Roeland E; van ‘t Westende, Wendy PC; Esselink, GD; Bourke, Peter M; Cox, Peter; van de Weg, W Eric; Visser, Richard GF; Maliepaard, Chris; Smulders, Marinus JM


    Dense genetic maps create a base for QTL analysis of important traits and future implementation of marker-assisted breeding. In tetraploid rose, the existing linkage maps include <300 markers to cover 28 linkage groups (4 homologous sets of 7 chromosomes). Here we used the 68k WagRhSNP Axiom single-nucleotide polymorphism (SNP) array for rose, in combination with SNP dosage calling at the tetraploid level, to genotype offspring from the garden rose cultivar ‘Red New Dawn’. The offspring proved to be not from a single bi-parental cross. In rose breeding, crosses with unintended parents occur regularly. We developed a strategy to separate progeny into putative populations, even while one of the parents was unknown, using principle component analysis on pairwise genetic distances based on sets of selected SNP markers that were homozygous, and therefore uninformative for one parent. One of the inferred populations was consistent with self-fertilization of ‘Red New Dawn’. Subsequently, linkage maps were generated for a bi-parental and a self-pollinated population with ‘Red New Dawn’ as the common maternal parent. The densest map, for the selfed parent, had 1929 SNP markers on 25 linkage groups, covering 1765.5 cM at an average marker distance of 0.9 cM. Synteny with the strawberry (Fragaria vesca) genome was extensive. Rose ICM1 corresponded to F. vesca pseudochromosome 7 (Fv7), ICM4 to Fv4, ICM5 to Fv3, ICM6 to Fv2 and ICM7 to Fv5. Rose ICM2 corresponded to parts of F. vesca pseudochromosomes 1 and 6, whereas ICM3 is syntenic to the remainder of Fv6.

  10. Transcriptome Characterization and Functional Marker Development in Sorghum Sudanense

    PubMed Central

    Zhan, Qiuwen; Liu, Yanlong; Yang, Xiaocui


    Sudangrass, Sorghum sudanense, is an important forage in warm regions. But little is known about its genome. In this study, the transcriptomes of sudangrass S722 and sorghum Tx623B were sequenced by Illumina sequencing. More than 4Gb bases were sequenced for each library. For Tx623B and S722, 88.79% and 83.88% reads, respectively were matched to the Sorghum bicolor genome. A total of 2,397 differentially expressed genes (DEGs) were detected by RNA-Seq between the two libraries, including 849 up-regulated genes and 1,548 down-regulated genes. These DEGs could be divided into three groups by annotation analysis. A total of 44,495 single nucleotide polymorphisms (SNPs) were discovered by aligning S722 reads to the sorghum reference genome. Of these SNPs, 61.37% were transition, and this value did not differ much between different chromosomes. In addition, 16,928 insertion and deletion (indel) loci were identified between the two genomes. A total of 5,344 indel markers were designed, 15 of which were selected to construct the genetic map derived from the cross of Tx623A and Sa. It was indicated that the indel markers were useful and versatile between sorghum and sudangrass. Comparison of synonymous base substitutions (Ks) and non-synonymous base substitutions (Ka) between the two libraries showed that 95% orthologous pairs exhibited Ka/Ks<1.0, indicating that these genes were influenced by purifying selection. The results from this study provide important information for molecular genetic research and a rich resource for marker development in sudangrass and other Sorghum species. PMID:27152648

  11. A 48 SNP set for grapevine cultivar identification

    PubMed Central


    Background Rapid and consistent genotyping is an important requirement for cultivar identification in many crop species. Among them grapevine cultivars have been the subject of multiple studies given the large number of synonyms and homonyms generated during many centuries of vegetative multiplication and exchange. Simple sequence repeat (SSR) markers have been preferred until now because of their high level of polymorphism, their codominant nature and their high profile repeatability. However, the rapid application of partial or complete genome sequencing approaches is identifying thousands of single nucleotide polymorphisms (SNP) that can be very useful for such purposes. Although SNP markers are bi-allelic, and therefore not as polymorphic as microsatellites, the high number of loci that can be multiplexed and the possibilities of automation as well as their highly repeatable results under any analytical procedure make them the future markers of choice for any type of genetic identification. Results We analyzed over 300 SNP in the genome of grapevine using a re-sequencing strategy in a selection of 11 genotypes. Among the identified polymorphisms, we selected 48 SNP spread across all grapevine chromosomes with allele frequencies balanced enough as to provide sufficient information content for genetic identification in grapevine allowing for good genotyping success rate. Marker stability was tested in repeated analyses of a selected group of cultivars obtained worldwide to demonstrate their usefulness in genetic identification. Conclusions We have selected a set of 48 stable SNP markers with a high discrimination power and a uniform genome distribution (2-3 markers/chromosome), which is proposed as a standard set for grapevine (Vitis vinifera L.) genotyping. Any previous problems derived from microsatellite allele confusion between labs or the need to run reference cultivars to identify allele sizes disappear using this type of marker. Furthermore, because SNP

  12. Developing SCAR markers to study predation on Trialeurodes vaporariorum.


    Agustí, N; de Vicente, M C; Gabarra, R


    DNA markers of Trialeurodes vaporariorum were developed to detect remains of these whitefly in the gut of the predator Dicyphus tamaninii. A 2400-bp DNA fragment of T. vaporariorum, absent in other closely related prey species and in the predator banding pattern, was identified by random amplified polymorphic DNA (RAPD) analysis. After cloning and sequencing this fragment, two pairs of sequence-characterized amplified region (SCAR) primers were developed, amplifying single bands of 2100 bp and 310 bp, respectively. Detection of T. vaporariorum DNA in the predator gut was only possible using the primers that amplified the shortest fragment. Specificity tests performed with this pair of primers showed the presence of the 310-bp band for T. vaporariorum in all stages.

  13. Development of RGA-CAPS markers and genetic mapping of candidate genes for sugarcane mosaic virus resistance in maize.


    Quint, M.; Mihaljevic, R.; Dussle, M.; Xu, L.; Melchinger, E.; Lübberstedt, T.


    Three previously published resistance gene analogues (RGAs), pic13, pic21 and pic19, were mapped in relation to sugarcane mosaic virus (SCMV) resistance genes ( Scmv1, Scmv2) in maize. We cloned these RGAs from six inbreds including three SCMV-resistant lines (D21, D32, FAP1360A) and three SCMV-susceptible lines (D145, D408, F7). Pairwise sequence alignments among the six inbreds revealed a frequency of one single nucleotide polymorphism (SNP) per 33 bp for the three RGAs, indicating a high degree of polymorphism and a high probability of success in converting RGAs into codominant cleaved amplified polymorphic sequence (CAPS) markers compared to other sequences. SNPs were used to develop CAPS markers for mapping of the three RGAs in relation to Scmv1 (chromosome 6) and Scmv2 (chromosome 3), and for pedigree analyses of resistant inbred lines. By genetic mapping pic21 was shown to be different from Scmv2, whereas pic19 and pic13 are still candidates for Scmv1 and Scmv2, respectively, due to genetic mapping and consistent restriction patterns of ancestral lines.

  14. Development of pineapple microsatellite markers and germplasm genetic diversity analysis.


    Feng, Suping; Tong, Helin; Chen, You; Wang, Jingyi; Chen, Yeyuan; Sun, Guangming; He, Junhu; Wu, Yaoting


    Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8%) of the 94 Simple Sequence Repeat (SSR) loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp.), and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus). Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region.

  15. SNPConvert: SNP Array Standardization and Integration in Livestock Species

    PubMed Central

    Nicolazzi, Ezequiel Luis; Marras, Gabriele; Stella, Alessandra


    One of the main advantages of single nucleotide polymorphism (SNP) array technology is providing genotype calls for a specific number of SNP markers at a relatively low cost. Since its first application in animal genetics, the number of available SNP arrays for each species has been constantly increasing. However, conversely to that observed in whole genome sequence data analysis, SNP array data does not have a common set of file formats or coding conventions for allele calling. Therefore, the standardization and integration of SNP array data from multiple sources have become an obstacle, especially for users with basic or no programming skills. Here, we describe the difficulties related to handling SNP array data, focusing on file formats, SNP allele coding, and mapping. We also present SNPConvert suite, a multi-platform, open-source, and user-friendly set of tools to overcome these issues. This tool, which can be integrated with open-source and open-access tools already available, is a first step towards an integrated system to standardize and integrate any type of raw SNP array data. The tool is available at: https://github. com/nicolazzie/SNPConvert.git.

  16. SNPConvert: SNP Array Standardization and Integration in Livestock Species

    PubMed Central

    Nicolazzi, Ezequiel Luis; Marras, Gabriele; Stella, Alessandra


    One of the main advantages of single nucleotide polymorphism (SNP) array technology is providing genotype calls for a specific number of SNP markers at a relatively low cost. Since its first application in animal genetics, the number of available SNP arrays for each species has been constantly increasing. However, conversely to that observed in whole genome sequence data analysis, SNP array data does not have a common set of file formats or coding conventions for allele calling. Therefore, the standardization and integration of SNP array data from multiple sources have become an obstacle, especially for users with basic or no programming skills. Here, we describe the difficulties related to handling SNP array data, focusing on file formats, SNP allele coding, and mapping. We also present SNPConvert suite, a multi-platform, open-source, and user-friendly set of tools to overcome these issues. This tool, which can be integrated with open-source and open-access tools already available, is a first step towards an integrated system to standardize and integrate any type of raw SNP array data. The tool is available at: https://github. com/nicolazzie/SNPConvert.git. PMID:27600083

  17. SNPConvert: SNP Array Standardization and Integration in Livestock Species.


    Nicolazzi, Ezequiel Luis; Marras, Gabriele; Stella, Alessandra


    One of the main advantages of single nucleotide polymorphism (SNP) array technology is providing genotype calls for a specific number of SNP markers at a relatively low cost. Since its first application in animal genetics, the number of available SNP arrays for each species has been constantly increasing. However, conversely to that observed in whole genome sequence data analysis, SNP array data does not have a common set of file formats or coding conventions for allele calling. Therefore, the standardization and integration of SNP array data from multiple sources have become an obstacle, especially for users with basic or no programming skills. Here, we describe the difficulties related to handling SNP array data, focusing on file formats, SNP allele coding, and mapping. We also present SNPConvert suite, a multi-platform, open-source, and user-friendly set of tools to overcome these issues. This tool, which can be integrated with open-source and open-access tools already available, is a first step towards an integrated system to standardize and integrate any type of raw SNP array data. The tool is available at: https://github. com/nicolazzie/SNPConvert.git. PMID:27600083

  18. High-Throughput SNP Discovery through Deep Resequencing of a Reduced Representation Library to Anchor and Orient Scaffolds in the Soybean Whole Genome Sequence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The soybean Consensus Map 4.0 facilitated the anchoring of 95.6% of the soybean whole genome sequence developed by the Joint Genome Institute, Department of Energy but only properly oriented 66% of the sequence scaffolds. To find additional single nucleotide polymorphism (SNP) markers for additiona...

  19. A whole-genome SNP array (RICE6K) for genomic breeding in rice.


    Yu, Huihui; Xie, Weibo; Li, Jing; Zhou, Fasong; Zhang, Qifa


    The advances in genotyping technology provide an opportunity to use genomic tools in crop breeding. As compared to field selections performed in conventional breeding programmes, genomics-based genotype screen can potentially reduce number of breeding cycles and more precisely integrate target genes for particular traits into an ideal genetic background. We developed a whole-genome single nucleotide polymorphism (SNP) array, RICE6K, based on Infinium technology, using representative SNPs selected from more than four million SNPs identified from resequencing data of more than 500 rice landraces. RICE6K contains 5102 SNP and insertion-deletion (InDel) markers, about 4500 of which were of high quality in the tested rice lines producing highly repeatable results. Forty-five functional markers that are located inside 28 characterized genes of important traits can be detected using RICE6K. The SNP markers are evenly distributed on the 12 chromosomes of rice with the average density of 12 SNPs per 1 Mb and can provide information for polymorphisms between indica and japonica subspecies as well as varieties within indica and japonica groups. Application tests of RICE6K showed that the array is suitable for rice germplasm fingerprinting, genotyping bulked segregating pools, seed authenticity check and genetic background selection. These results suggest that RICE6K provides an efficient and reliable genotyping tool for rice genomic breeding.

  20. Methodological issues associated with tumor marker development. Biostatistical aspects.


    Faraggi; Kramar


    The search for markers as potential prognostic factors for different stages of disease is becoming a major task in clinical research. Enormous amounts of information on the effectiveness of tumor markers are being published, and many of these results are conflicting and thus adding confusion to the area. In this paper we discuss the problem of multiplicity that we believe is one of the major statistical reasons for the conflicting results. We further review the ROC curve and the area under it as a popular statistical tool for evaluating the ability of a marker to distinguish between two populations. Finally we provide an extension to the ROC analysis when several markers are available.

  1. PCR amplification of SNP loci from crude DNA for large-scale genotyping of oomycetes.


    Hu, Jian; Lyon, Rebecca; Zhou, Yuxin; Lamour, Kurt


    Similar to other eukaryotes, single nucleotide polymorphism (SNP) markers are abundant in many oomycete plant pathogen genomes. High resolution DNA melting analysis (HR-DMA) is a cost-effective method for SNP genotyping, but like many SNP marker technologies, is limited by the amount and quality of template DNA. We describe PCR preamplification of Phytophthora and Peronospora SNP loci from crude DNA extracted from a small amount of mycelium and/or infected plant tissue to produce sufficient template to genotype at least 10 000 SNPs. The approach is fast, inexpensive, requires minimal biological material and should be useful for many organisms in a variety of contexts. PMID:24871597

  2. Combination of RNAseq and SNP nanofluidic array reveals the center of genetic diversity of cacao pathogen Moniliophthora roreri in the upper Magdalena Valley of Colombia and its clonality

    PubMed Central

    Ali, Shahin S.; Shao, Jonathan; Strem, Mary D.; Phillips-Mora, Wilberth; Zhang, Dapeng; Meinhardt, Lyndel W.; Bailey, Bryan A.


    Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR) disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed single nucleotide polymorphism (SNP) markers from RNASeq results for 13 M. roreri isolates and validated the markers for their ability to reveal genetic diversity in an international M. roreri collection. The SNP resources reported herein represent the first study of RNA sequencing (RNASeq)-derived SNP validation in M. roreri and demonstrates the utility of RNASeq as an approach for de novo SNP identification in M. roreri. A total of 88 polymorphic SNPs were used to evaluate the genetic diversity of 172 M. roreri cacao isolates resulting in 37 distinct genotypes (including 14 synonymous groups). Absence of heterozygosity for the 88 SNP markers indicates reproduction in M. roreri is clonal and likely due to a homothallic life style. The upper Magdalena Valley of Colombia showed the highest levels of genetic diversity with 20 distinct genotypes of which 13 were limited to this region, and indicates this region as the possible center of origin for M. roreri. PMID:26379633

  3. Combination of RNAseq and SNP nanofluidic array reveals the center of genetic diversity of cacao pathogen Moniliophthora roreri in the upper Magdalena Valley of Colombia and its clonality.


    Ali, Shahin S; Shao, Jonathan; Strem, Mary D; Phillips-Mora, Wilberth; Zhang, Dapeng; Meinhardt, Lyndel W; Bailey, Bryan A


    Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR) disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed single nucleotide polymorphism (SNP) markers from RNASeq results for 13 M. roreri isolates and validated the markers for their ability to reveal genetic diversity in an international M. roreri collection. The SNP resources reported herein represent the first study of RNA sequencing (RNASeq)-derived SNP validation in M. roreri and demonstrates the utility of RNASeq as an approach for de novo SNP identification in M. roreri. A total of 88 polymorphic SNPs were used to evaluate the genetic diversity of 172 M. roreri cacao isolates resulting in 37 distinct genotypes (including 14 synonymous groups). Absence of heterozygosity for the 88 SNP markers indicates reproduction in M. roreri is clonal and likely due to a homothallic life style. The upper Magdalena Valley of Colombia showed the highest levels of genetic diversity with 20 distinct genotypes of which 13 were limited to this region, and indicates this region as the possible center of origin for M. roreri.

  4. Towards the Development of a Molecular Map in Switchgrass: I. Microsatellite Marker Development

    SciTech Connect

    Gunter, L.E.


    The long-term goal of the switchgrass breeding program is to improve regionally adapted varieties and increase biomass yield and feedstock quality. Although, to some extent, biomass yields are dependent on environmental constraints, increased yield can be achieved through the development of genotypes with improved seasonal adaptation, tolerance to unfavorable environmental conditions, and improved resistance to pest and disease. To date, improvement in switchgrass has relied on recurrent breeding strategies based on phenotypic or genotypic selection. Yield improvements have been modest by this method. If we expect to make significant increase in yields, we need tools that will allow us to map complex traits and uncover the genes that influence them. A genetic linkage map could be a powerful tool for accelerating switchgrass development through marker-assisted selection, breeding and recombination. This type of mapping requires the development of markers that can be associated with phenotypic traits in a population of known pedigree. The most commonly used markers for mapping include restriction fragment length polymorphisms (RFLP) and simple sequence repeats (SSR). At ORNL, we have been concentrating on the development of SSR markers, while our colleagues at the University of Georgia are developing RFLP markers in order to select parents to produce a mapping population and from there to create a framework map from {approx}100 F1 progeny.

  5. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina).


    Ferber, Steven; Reusch, Thorsten B H; Stam, Wytze T; Olsen, Jeanine L


    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database (V1.2.1). SNP loci were genotyped using a single-base-extension approach which facilitated high-throughput genotyping with minimal optimization time. These markers show a wide range of variability among 25 eelgrass populations and will be useful for population genetic studies including evaluation of population structure, historical demography, and phylogeography. Potential applications include haplotype inference of physically linked SNPs and identification of genes under selection for temperature and desiccation stress.

  6. Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography

    PubMed Central

    Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi


    New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined ‘elimination’ status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of M. leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. PMID:23291420

  7. Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography.


    Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi


    New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined 'elimination' status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of Mycobacterium leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. PMID:23291420

  8. Sturgeon conservation genomics: SNP discovery and validation using RAD sequencing.


    Ogden, R; Gharbi, K; Mugue, N; Martinsohn, J; Senn, H; Davey, J W; Pourkazemi, M; McEwing, R; Eland, C; Vidotto, M; Sergeev, A; Congiu, L


    Caviar-producing sturgeons belonging to the genus Acipenser are considered to be one of the most endangered species groups in the world. Continued overfishing in spite of increasing legislation, zero catch quotas and extensive aquaculture production have led to the collapse of wild stocks across Europe and Asia. The evolutionary relationships among Adriatic, Russian, Persian and Siberian sturgeons are complex because of past introgression events and remain poorly understood. Conservation management, traceability and enforcement suffer a lack of appropriate DNA markers for the genetic identification of sturgeon at the species, population and individual level. This study employed RAD sequencing to discover and characterize single nucleotide polymorphism (SNP) DNA markers for use in sturgeon conservation in these four tetraploid species over three biological levels, using a single sequencing lane. Four population meta-samples and eight individual samples from one family were barcoded separately before sequencing. Analysis of 14.4 Gb of paired-end RAD data focused on the identification of SNPs in the paired-end contig, with subsequent in silico and empirical validation of candidate markers. Thousands of putatively informative markers were identified including, for the first time, SNPs that show population-wide differentiation between Russian and Persian sturgeons, representing an important advance in our ability to manage these cryptic species. The results highlight the challenges of genotyping-by-sequencing in polyploid taxa, while establishing the potential genetic resources for developing a new range of caviar traceability and enforcement tools. PMID:23473098

  9. Sturgeon conservation genomics: SNP discovery and validation using RAD sequencing.


    Ogden, R; Gharbi, K; Mugue, N; Martinsohn, J; Senn, H; Davey, J W; Pourkazemi, M; McEwing, R; Eland, C; Vidotto, M; Sergeev, A; Congiu, L


    Caviar-producing sturgeons belonging to the genus Acipenser are considered to be one of the most endangered species groups in the world. Continued overfishing in spite of increasing legislation, zero catch quotas and extensive aquaculture production have led to the collapse of wild stocks across Europe and Asia. The evolutionary relationships among Adriatic, Russian, Persian and Siberian sturgeons are complex because of past introgression events and remain poorly understood. Conservation management, traceability and enforcement suffer a lack of appropriate DNA markers for the genetic identification of sturgeon at the species, population and individual level. This study employed RAD sequencing to discover and characterize single nucleotide polymorphism (SNP) DNA markers for use in sturgeon conservation in these four tetraploid species over three biological levels, using a single sequencing lane. Four population meta-samples and eight individual samples from one family were barcoded separately before sequencing. Analysis of 14.4 Gb of paired-end RAD data focused on the identification of SNPs in the paired-end contig, with subsequent in silico and empirical validation of candidate markers. Thousands of putatively informative markers were identified including, for the first time, SNPs that show population-wide differentiation between Russian and Persian sturgeons, representing an important advance in our ability to manage these cryptic species. The results highlight the challenges of genotyping-by-sequencing in polyploid taxa, while establishing the potential genetic resources for developing a new range of caviar traceability and enforcement tools.

  10. Construction of a genetic linkage map for cultivated peanut and development of QTLs/markers for marker-assisted breeding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several genetic maps based on recombinant inbred line (RIL) and backcross (BC) populations have been developed for tetraploid peanut recently. The marker density, however, is still very low especially in context of large genome size (2,800Mb/1C) and 20 linkage groups (LGs). Therefore, improvement of...

  11. Utilization of a whole genome SNP panel for efficient genetic mapping in the mouse

    PubMed Central

    Moran, Jennifer L.; Bolton, Andrew D.; Tran, Pamela V.; Brown, Alison; Dwyer, Noelle D.; Manning, Danielle K.; Bjork, Bryan C.; Li, Cheng; Montgomery, Kate; Siepka, Sandra M.; Vitaterna, Martha Hotz; Takahashi, Joseph S.; Wiltshire, Tim; Kwiatkowski, David J.; Kucherlapati, Raju; Beier, David R.


    Phenotype-driven genetics can be used to create mouse models of human disease and birth defects. However, the utility of these mutant models is limited without identification of the causal gene. To facilitate genetic mapping, we developed a fixed single nucleotide polymorphism (SNP) panel of 394 SNPs as an alternative to analyses using simple sequence length polymorphism (SSLP) marker mapping. With the SNP panel, chromosomal locations for 22 monogenic mutants were identified. The average number of affected progeny genotyped for mapped monogenic mutations is nine. Map locations for several mutants have been obtained with as few as four affected progeny. The average size of genetic intervals obtained for these mutants is 43 Mb, with a range of 17–83 Mb. Thus, our SNP panel allows for identification of moderate resolution map position with small numbers of mice in a high-throughput manner. Importantly, the panel is suitable for mapping crosses from many inbred and wild-derived inbred strain combinations. The chromosomal localizations obtained with the SNP panel allow one to quickly distinguish between potentially novel loci or remutations in known genes, and facilitates fine mapping and positional cloning. By using this approach, we identified DNA sequence changes in two ethylnitrosourea-induced mutants. PMID:16461637

  12. Developing Urinary Metabolomic Signatures as Early Bladder Cancer Diagnostic Markers

    PubMed Central

    Shen, Chong; Sun, Zeyu; Chen, Deying; Su, Xiaoling; Jiang, Jing; Li, Gonghui; Lin, Biaoyang


    Abstract Early detection is vital to improve the overall survival rate of bladder cancer (BCa) patients, yet there is a lack of a reliable urine-based assay for early detection of BCa. Urine metabolites represented a potential rich source of biomarkers for BCa. This study aimed to develop a metabolomics approach for high coverage discovery and identification of metabolites in urine samples. Urine samples from 23 early stage BCa patients and 21 healthy volunteers with minimum sample preparations were analyzed by a short 30 min UPLC-HRMS method. We detected and quantified over 9000 unique UPLC-HRMS features, which is more than four times than about 2000 features detected in previous urine metabolomic studies. Furthermore, multivariate OPLS-DA classification models were established to differentiate urine samples from bladder cancer cohort and normal health cohort. We identified three BCa-upregulated metabolites: nicotinuric acid, trehalose, AspAspGlyTrp, and three BCa-downregulated metabolites: inosinic acid, ureidosuccinic acid, GlyCysAlaLys. Finally, analysis of six post-surgery BCa urine samples showed that these BCa-metabolomic features reverted to normal state after tumor removal, suggesting that they reflected metabolomic features associated with BCa. ROC analyses using two linear regression models to combine the identified markers showed a high diagnostic performance for detecting BCa with AUC (area under the ROC curve) values of 0.919 to 0.934. In summary, we developed a high coverage metabolomic approach that has potential for biomarker discovery in cancers. PMID:25562196

  13. A single base substitution in BADH/AMADH is responsible for fragrance in cucumber (Cucumis sativus L.), and development of SNAP markers for the fragrance.


    Yundaeng, Chutintorn; Somta, Prakit; Tangphatsornruang, Sithichoke; Chankaew, Sompong; Srinives, Peerasak


    Sequence analysis revealed that an SNP (A1855G) in CsBADH of cucumber accession PK2011T202 causes amino acid change in a highly conserved motif, Y163C. Gene mapping showed association between the SNP and the fragrance. Pandan-like fragrance is a value-added trait in several food crops such as rice, vegetable soybean and sorghum. The fragrance is caused by the volatile chemical 2-acetyl-1-pyrroline (2AP). Mutation(s) in betaine aldehyde dehydrogenase 2 (BADH2; also known as aminoaldehyde dehydrogenase 2) gene causes defective BADH2 and results in biosynthesis of 2AP. Recently, cucumber cultivars possessing pandan-like fragrance were discovered in Thailand. In this study, we report an association between CsBADH and the fragrance in cucumber accession "PK2011T202". Gene expression analysis of CsBADH in leaves of PK2011T202 and "301176" (non-fragrant) at various growth stages revealed that CsBADH was expressed in both accessions. Sequence comparison of CsBADH showed that PK2011T202 possesses a single base substitution (A1855G) in exon 5 which causes an amino acid change in a highly conserved motif of BADH, Y163C. Single nucleotide-amplified polymorphism markers were developed to detect the SNP polymorphism between the wild-type and fragrance alleles. Since CsBADH is located on chromosome 1, quantitative trait locus (QTL) mapping was conducted for this chromosome using an F2 and a backcross populations developed from the cross between PK2011T202 and 301176. QTL analysis in both populations showed that the major QTL for fragrance, qFgr, was co-localized with the CsBADH. We concluded that the defect function of CsBADH is responsible for fragrance in cucumber PK2011T202. PMID:26081947

  14. A single base substitution in BADH/AMADH is responsible for fragrance in cucumber (Cucumis sativus L.), and development of SNAP markers for the fragrance.


    Yundaeng, Chutintorn; Somta, Prakit; Tangphatsornruang, Sithichoke; Chankaew, Sompong; Srinives, Peerasak


    Sequence analysis revealed that an SNP (A1855G) in CsBADH of cucumber accession PK2011T202 causes amino acid change in a highly conserved motif, Y163C. Gene mapping showed association between the SNP and the fragrance. Pandan-like fragrance is a value-added trait in several food crops such as rice, vegetable soybean and sorghum. The fragrance is caused by the volatile chemical 2-acetyl-1-pyrroline (2AP). Mutation(s) in betaine aldehyde dehydrogenase 2 (BADH2; also known as aminoaldehyde dehydrogenase 2) gene causes defective BADH2 and results in biosynthesis of 2AP. Recently, cucumber cultivars possessing pandan-like fragrance were discovered in Thailand. In this study, we report an association between CsBADH and the fragrance in cucumber accession "PK2011T202". Gene expression analysis of CsBADH in leaves of PK2011T202 and "301176" (non-fragrant) at various growth stages revealed that CsBADH was expressed in both accessions. Sequence comparison of CsBADH showed that PK2011T202 possesses a single base substitution (A1855G) in exon 5 which causes an amino acid change in a highly conserved motif of BADH, Y163C. Single nucleotide-amplified polymorphism markers were developed to detect the SNP polymorphism between the wild-type and fragrance alleles. Since CsBADH is located on chromosome 1, quantitative trait locus (QTL) mapping was conducted for this chromosome using an F2 and a backcross populations developed from the cross between PK2011T202 and 301176. QTL analysis in both populations showed that the major QTL for fragrance, qFgr, was co-localized with the CsBADH. We concluded that the defect function of CsBADH is responsible for fragrance in cucumber PK2011T202.

  15. RAD sequencing yields a high success rate for westslope cutthroat and rainbow trout species-diagnostic SNP assays

    USGS Publications Warehouse

    Stephen J. Amish,; Paul A. Hohenlohe,; Sally Painter,; Robb F. Leary,; Muhlfeld, Clint C.; Fred W. Allendorf,; Luikart, Gordon


    Hybridization with introduced rainbow trout threatens most native westslope cutthroat trout populations. Understanding the genetic effects of hybridization and introgression requires a large set of high-throughput, diagnostic genetic markers to inform conservation and management. Recently, we identified several thousand candidate single-nucleotide polymorphism (SNP) markers based on RAD sequencing of 11 westslope cutthroat trout and 13 rainbow trout individuals. Here, we used flanking sequence for 56 of these candidate SNP markers to design high-throughput genotyping assays. We validated the assays on a total of 92 individuals from 22 populations and seven hatchery strains. Forty-six assays (82%) amplified consistently and allowed easy identification of westslope cutthroat and rainbow trout alleles as well as heterozygote controls. The 46 SNPs will provide high power for early detection of population admixture and improved identification of hybrid and nonhybridized individuals. This technique shows promise as a very low-cost, reliable and relatively rapid method for developing and testing SNP markers for nonmodel organisms with limited genomic resources.

  16. Development of highly reliable in silico SNP resource and genotyping assay from exome capture and sequencing: an example from black spruce (Picea mariana).


    Pavy, Nathalie; Gagnon, France; Deschênes, Astrid; Boyle, Brian; Beaulieu, Jean; Bousquet, Jean


    Picea mariana is a widely distributed boreal conifer across Canada and the subject of advanced breeding programmes for which population genomics and genomic selection approaches are being developed. Targeted sequencing was achieved after capturing P. mariana exome with probes designed from the sequenced transcriptome of Picea glauca, a distant relative. A high capture efficiency of 75.9% was reached although spruce has a complex and large genome including gene sequences interspersed by some long introns. The results confirmed the relevance of using probes from congeneric species to perform successfully interspecific exome capture in the genus Picea. A bioinformatics pipeline was developed including stringent criteria that helped detect a set of 97,075 highly reliable in silico SNPs. These SNPs were distributed across 14,909 genes. Part of an Infinium iSelect array was used to estimate the rate of true positives by validating 4267 of the predicted in silico SNPs by genotyping trees from P. mariana populations. The true positive rate was 96.2% for in silico SNPs, compared to a genotyping success rate of 96.7% for a set 1115 P. mariana control SNPs recycled from previous genotyping arrays. These results indicate the high success rate of the genotyping array and the relevance of the selection criteria used to delineate the new P. mariana in silico SNP resource. Furthermore, in silico SNPs were generally of medium to high frequency in natural populations, thus providing high informative value for future population genomics applications.

  17. Development of genomic SSR markers for fingerprinting lettuce (Lactuca sativa L.) cultivars and mapping genes

    PubMed Central


    Background Lettuce (Lactuca sativa L.) is the major crop from the group of leafy vegetables. Several types of molecular markers were developed that are effectively used in lettuce breeding and genetic studies. However only a very limited number of microsattelite-based markers are publicly available. We have employed the method of enriched microsatellite libraries to develop 97 genomic SSR markers. Results Testing of newly developed markers on a set of 36 Lactuca accession (33 L. sativa, and one of each L. serriola L., L. saligna L., and L. virosa L.) revealed that both the genetic heterozygosity (UHe = 0.56) and the number of loci per SSR (Na = 5.50) are significantly higher for genomic SSR markers than for previously developed EST-based SSR markers (UHe = 0.32, Na = 3.56). Fifty-four genomic SSR markers were placed on the molecular linkage map of lettuce. Distribution of markers in the genome appeared to be random, with the exception of possible cluster on linkage group 6. Any combination of 32 genomic SSRs was able to distinguish genotypes of all 36 accessions. Fourteen of newly developed SSR markers originate from fragments with high sequence similarity to resistance gene candidates (RGCs) and RGC pseudogenes. Analysis of molecular variance (AMOVA) of L. sativa accessions showed that approximately 3% of genetic diversity was within accessions, 79% among accessions, and 18% among horticultural types. Conclusions The newly developed genomic SSR markers were added to the pool of previously developed EST-SSRs markers. These two types of SSR-based markers provide useful tools for lettuce cultivar fingerprinting, development of integrated molecular linkage maps, and mapping of genes. PMID:23339733

  18. High-throughput SNP-genotyping analysis of the relationships among Ponto-Caspian sturgeon species

    PubMed Central

    Rastorguev, Sergey M; Nedoluzhko, Artem V; Mazur, Alexander M; Gruzdeva, Natalia M; Volkov, Alexander A; Barmintseva, Anna E; Mugue, Nikolai S; Prokhortchouk, Egor B


    Abstract Legally certified sturgeon fisheries require population protection and conservation methods, including DNA tests to identify the source of valuable sturgeon roe. However, the available genetic data are insufficient to distinguish between different sturgeon populations, and are even unable to distinguish between some species. We performed high-throughput single-nucleotide polymorphism (SNP)-genotyping analysis on different populations of Russian (Acipenser gueldenstaedtii), Persian (A. persicus), and Siberian (A. baerii) sturgeon species from the Caspian Sea region (Volga and Ural Rivers), the Azov Sea, and two Siberian rivers. We found that Russian sturgeons from the Volga and Ural Rivers were essentially indistinguishable, but they differed from Russian sturgeons in the Azov Sea, and from Persian and Siberian sturgeons. We identified eight SNPs that were sufficient to distinguish these sturgeon populations with 80% confidence, and allowed the development of markers to distinguish sturgeon species. Finally, on the basis of our SNP data, we propose that the A. baerii-like mitochondrial DNA found in some Russian sturgeons from the Caspian Sea arose via an introgression event during the Pleistocene glaciation. In the present study, the high-throughput genotyping analysis of several sturgeon populations was performed. SNP markers for species identification were defined. The possible explanation of the baerii-like mitotype presence in some Russian sturgeons in the Caspian Sea was suggested. PMID:24567827

  19. SNP discovery using Next Generation Transcriptomic Sequencing in Atlantic herring (Clupea harengus).


    Helyar, Sarah J; Limborg, Morten T; Bekkevold, Dorte; Babbucci, Massimiliano; van Houdt, Jeroen; Maes, Gregory E; Bargelloni, Luca; Nielsen, Rasmus O; Taylor, Martin I; Ogden, Rob; Cariani, Alessia; Carvalho, Gary R; Panitz, Frank


    The introduction of Next Generation Sequencing (NGS) has revolutionised population genetics, providing studies of non-model species with unprecedented genomic coverage, allowing evolutionary biologists to address questions previously far beyond the reach of available resources. Furthermore, the simple mutation model of Single Nucleotide Polymorphisms (SNPs) permits cost-effective high-throughput genotyping in thousands of individuals simultaneously. Genomic resources are scarce for the Atlantic herring (Clupea harengus), a small pelagic species that sustains high revenue fisheries. This paper details the development of 578 SNPs using a combined NGS and high-throughput genotyping approach. Eight individuals covering the species distribution in the eastern Atlantic were bar-coded and multiplexed into a single cDNA library and sequenced using the 454 GS FLX platform. SNP discovery was performed by de novo sequence clustering and contig assembly, followed by the mapping of reads against consensus contig sequences. Selection of candidate SNPs for genotyping was conducted using an in silico approach. SNP validation and genotyping were performed simultaneously using an Illumina 1,536 GoldenGate assay. Although the conversion rate of candidate SNPs in the genotyping assay cannot be predicted in advance, this approach has the potential to maximise cost and time efficiencies by avoiding expensive and time-consuming laboratory stages of SNP validation. Additionally, the in silico approach leads to lower ascertainment bias in the resulting SNP panel as marker selection is based only on the ability to design primers and the predicted presence of intron-exon boundaries. Consequently SNPs with a wider spectrum of minor allele frequencies (MAFs) will be genotyped in the final panel. The genomic resources presented here represent a valuable multi-purpose resource for developing informative marker panels for population discrimination, microarray development and for population

  20. SNP Discovery Using Next Generation Transcriptomic Sequencing in Atlantic Herring (Clupea harengus)

    PubMed Central

    Bekkevold, Dorte; Babbucci, Massimiliano; van Houdt, Jeroen; Maes, Gregory E.; Bargelloni, Luca; Nielsen, Rasmus O.; Taylor, Martin I.; Ogden, Rob; Cariani, Alessia; Carvalho, Gary R.; Consortium, FishPopTrace; Panitz, Frank


    The introduction of Next Generation Sequencing (NGS) has revolutionised population genetics, providing studies of non-model species with unprecedented genomic coverage, allowing evolutionary biologists to address questions previously far beyond the reach of available resources. Furthermore, the simple mutation model of Single Nucleotide Polymorphisms (SNPs) permits cost-effective high-throughput genotyping in thousands of individuals simultaneously. Genomic resources are scarce for the Atlantic herring (Clupea harengus), a small pelagic species that sustains high revenue fisheries. This paper details the development of 578 SNPs using a combined NGS and high-throughput genotyping approach. Eight individuals covering the species distribution in the eastern Atlantic were bar-coded and multiplexed into a single cDNA library and sequenced using the 454 GS FLX platform. SNP discovery was performed by de novo sequence clustering and contig assembly, followed by the mapping of reads against consensus contig sequences. Selection of candidate SNPs for genotyping was conducted using an in silico approach. SNP validation and genotyping were performed simultaneously using an Illumina 1,536 GoldenGate assay. Although the conversion rate of candidate SNPs in the genotyping assay cannot be predicted in advance, this approach has the potential to maximise cost and time efficiencies by avoiding expensive and time-consuming laboratory stages of SNP validation. Additionally, the in silico approach leads to lower ascertainment bias in the resulting SNP panel as marker selection is based only on the ability to design primers and the predicted presence of intron-exon boundaries. Consequently SNPs with a wider spectrum of minor allele frequencies (MAFs) will be genotyped in the final panel. The genomic resources presented here represent a valuable multi-purpose resource for developing informative marker panels for population discrimination, microarray development and for population

  1. Development and transferability of black and red raspberry microsatellite markers from short-read sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The advent of next-generation sequencing technologies has been a boon to the cost-effective development of molecular markers, particularly in non-model species. Here, we demonstrate the efficiency of microsatellite or simple sequence repeat (SSR) marker development from short-read sequences using th...

  2. Development of nuclear and chloroplast microsatellite markers for the endangered conifer Callitris sulcata (Cupressaceae)1

    PubMed Central

    Sakaguchi, Shota; Lannuzel, Guillaume; Fogliani, Bruno; Wulff, Adrien S.; L’Huillier, Laurent; Kurata, Seikan; Ueno, Saneyoshi; Isagi, Yuji; Tsumura, Yoshihiko; Ito, Motomi


    Premise of the study: Microsatellite markers were developed for Callitris sulcata (Cupressaceae), an endangered conifer species in New Caledonia. Methods and Results: Using sequencing by synthesis (SBS) of an RNA-Seq library, 15 polymorphic nuclear and chloroplast microsatellite markers were developed. When evaluated with 48 individuals, these markers showed genetic variations ranging from two to 15 alleles and expected heterozygosity ranging from 0 to 0.881. Conclusions: These markers will be useful for examining the genetic diversity and structure of remaining wild populations and improving the genetic status of ex situ populations. PMID:26312198

  3. MarkerMiner 1.0: A new application for phylogenetic marker development using angiosperm transcriptomes1

    PubMed Central

    Chamala, Srikar; García, Nicolás; Godden, Grant T.; Krishnakumar, Vivek; Jordon-Thaden, Ingrid E.; De Smet, Riet; Barbazuk, W. Brad; Soltis, Douglas E.; Soltis, Pamela S.


    Premise of the study: Targeted sequencing using next-generation sequencing (NGS) platforms offers enormous potential for plant systematics by enabling economical acquisition of multilocus data sets that can resolve difficult phylogenetic problems. However, because discovery of single-copy nuclear (SCN) loci from NGS data requires both bioinformatics skills and access to high-performance computing resources, the application of NGS data has been limited. Methods and Results: We developed MarkerMiner 1.0, a fully automated, open-access bioinformatic workflow and application for discovery of SCN loci in angiosperms. Our new tool identified as many as 1993 SCN loci from transcriptomic data sampled as part of four independent test cases representing marker development projects at different phylogenetic scales. Conclusions: MarkerMiner is an easy-to-use and effective tool for discovery of putative SCN loci. It can be run locally or via the Web, and its tabular and alignment outputs facilitate efficient downstream assessments of phylogenetic utility, locus selection, intron-exon boundary prediction, and primer or probe development. PMID:25909041

  4. Identifying differentially expressed genes under heat stress and developing molecular markers in orchardgrass (Dactylis glomerata L.) through transcriptome analysis.


    Huang, L K; Yan, H D; Zhao, X X; Zhang, X Q; Wang, J; Frazier, T; Yin, G; Huang, X; Yan, D F; Zang, W J; Ma, X; Peng, Y; Yan, Y H; Liu, W


    Orchardgrass (Dactylis glomerata L.) is a long-lived, cool-season forage grass that is commonly used for hay production. Despite its economic importance, orchardgrass genome remains relatively unexplored. In this study, we used Illumina RNA sequencing to identify gene-associated molecular markers, including simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs), as well as heat stress-induced differentially expressed genes (DEGs) in two orchardgrass genotypes, 'Baoxing' (heat resistant) and '01998' (heat susceptible). Approximately 163 million high-quality trimmed reads were generated from 207 million raw reads using the Illumina HiSeq 2000 platform. A total of 126,846 unigenes were obtained after de novo assembly of the trimmed reads, and 40,078 unigenes were identified as coding sequences (CDSs). Based on the assembled unigenes, 669,300 high-quality SNPs, including 416,099 transitions and 257,736 transversions, were contained in 75,875 unigenes. In addition, a total of 8475 microsatellites were detected in 7764 unigenes. When placed under heat stress, the total number of DEGs in 'Baoxing' (3527) was higher than in '01998' (2649), indicating that in comparison with heat-susceptible '01998', heat-resistant 'Baoxing' seems to have more unigenes that respond to heat stress. The high-throughput transcriptome sequencing of orchardgrass under heat stress provides useful information for gene identification and for the development of SNP and SSR molecular markers. The comparison of DEGs under different periods of heat stress allowed us to identify a wealth of candidate DEGs that can be further analysed in order to determine the genetic mechanisms underlying heat tolerance in orchardgrass.

  5. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data.


    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu


    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon. PMID:27162496

  6. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data

    PubMed Central

    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R.; Wang, Xiaolu


    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon. PMID:27162496

  7. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data.


    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu


    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon.

  8. Development of novel chloroplast microsatellite markers for Ginkgo biloba.


    Xu, M; Xu, L A; Cao, F L; Zhang, H J; Yu, F X


    Ginkgo biloba is considered to be a living fossil that can be used to understand the ancient evolutionary history of gymnosperms, but little attention has been given to the study of its population genetics, molecular phylogeography, and genetic resources assessment. Chloroplast simple sequence repeat (cpSSR) markers are powerful tools for genetic studies of plants. In this study, a total of 30 perfect cpSSRs of Ginkgo were identified and characterized, including di-, tri, tetra-, penta-, and hexanucleotide repeats. Fifteen of 21 designed primer pairs were successfully amplified to yield specific polymerase chain reaction products from 16 Ginkgo cultivars. Polymorphic cpSSRs were further applied to determine the genetic variation of 116 individuals in 5 populations of G. biloba. The results showed that 24 and 76% genetic variation existed within and among populations of this species, respectively. These polymorphic and monomorphic cpSSR markers can be used to trace the origin and evolutionary history of Ginkgo.

  9. Nineteen polymorphic microsatellite markers developed for Trachinotus ovatus.


    Xie, Z Z; Huang, M W; Xu, W; Peng, C; He, J N; Meng, Z N; Zhang, Y; Li, S S; Lin, H R


    To evaluate the population genetic diversity of the ovate pompano, we isolated and characterized 19 microsatellite markers using a (CA)13-enriched genomic library. Polymorphism was assessed in 30 individuals from a single population collected from the Daya Bay Aquaculture Center, Guangdong, China. The number of alleles per locus ranged from 2 to 18 with an average of 7.8. The observed and expected heterozygosities varied from 0.2667 to 1.000 and from 0.3960 to 0.9435, respectively. Sixteen of 19 loci conformed to Hardy-Weinberg equilibrium, and no significant linkage disequilibrium was detected between any locus pairs. Our study supplies candidate microsatellite markers that can be useful for studying the population genetic structure of ovate pompano.

  10. Transcriptome sequencing and marker development for four underutilized legumes1

    PubMed Central

    Chapman, Mark A.


    • Premise of the study: Combating threats to food and nutrition security in the context of climate change and global population increase is one of the highest priorities of major international organizations. Hundreds of species are grown on a small scale in some of the most drought/flood-prone regions of the world and as such may harbor some of the most environmentally tolerant crops (and alleles). • Methods and Results: In this study, transcriptomes were sequenced, assembled, and annotated for four underutilized legume crops. Microsatellite markers were identified in each species, as well as a conserved orthologous set of markers for cross-family phylogenetics and comparative mapping, which were ground-truthed on a panel of diverse legume germplasm. • Conclusions: An understanding of these underutilized legumes will inform crop selection and breeding by allowing the investigation of genetic variation and the genetic basis of adaptive traits to be established. PMID:25699221

  11. Developing diagnostic SNP panels for the identification of true fruit flies (Diptera: Tephritidae) within the limits of COI-based species delimitation

    PubMed Central


    Background Rapid and reliable identification of quarantine pests is essential for plant inspection services to prevent introduction of invasive species. For insects, this may be a serious problem when dealing with morphologically similar cryptic species complexes and early developmental stages that lack distinctive characters useful for taxonomic identification. DNA based barcoding could solve many of these problems. The standard barcode fragment, an approx. 650 base pairs long sequence of the 5′end of the mitochondrial cytochrome oxidase I (COI), enables differentiation of a very wide range of arthropods. However, problems remain in some taxa, such as Tephritidae, where recent genetic differentiation among some of the described species hinders accurate molecular discrimination. Results In order to explore the full species discrimination potential of COI, we sequenced the barcoding region of the COI gene of a range of economically important Tephritid species and complemented these data with all GenBank and BOLD entries for the systematic group available as of January 2012. We explored the limits of species delimitation of this barcode fragment among 193 putative Tephritid species and established operational taxonomic units (OTUs), between which discrimination is reliably possible. Furthermore, to enable future development of rapid diagnostic assays based on this sequence information, we characterized all single nucleotide polymorphisms (SNPs) and established “near-minimal” sets of SNPs that differentiate among all included OTUs with at least three and four SNPs, respectively. Conclusions We found that although several species cannot be differentiated based on the genetic diversity observed in COI and hence form composite OTUs, 85% of all OTUs correspond to described species. Because our SNP panels are developed based on all currently available sequence information and rely on a minimal pairwise difference of three SNPs, they are highly reliable and hence

  12. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate.


    Roffler, Gretchen H; Amish, Stephen J; Smith, Seth; Cosart, Ted; Kardos, Marty; Schwartz, Michael K; Luikart, Gordon


    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5' and 3' untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species. PMID:27327375

  13. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate.


    Roffler, Gretchen H; Amish, Stephen J; Smith, Seth; Cosart, Ted; Kardos, Marty; Schwartz, Michael K; Luikart, Gordon


    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5' and 3' untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

  14. Large-Scale SNP Discovery through RNA Sequencing and SNP Genotyping by Targeted Enrichment Sequencing in Cassava (Manihot esculenta Crantz)

    PubMed Central

    Pootakham, Wirulda; Shearman, Jeremy R.; Ruang-areerate, Panthita; Sonthirod, Chutima; Sangsrakru, Duangjai; Jomchai, Nukoon; Yoocha, Thippawan; Triwitayakorn, Kanokporn; Tragoonrung, Somvong; Tangphatsornruang, Sithichoke


    Cassava (Manihot esculenta Crantz) is one of the most important crop species being the main source of dietary energy in several countries. Marker-assisted selection has become an essential tool in plant breeding. Single nucleotide polymorphism (SNP) discovery via transcriptome sequencing is an attractive strategy for genome complexity reduction in organisms with large genomes. We sequenced the transcriptome of 16 cassava accessions using the Illumina HiSeq platform and identified 675,559 EST-derived SNP markers. A subset of those markers was subsequently genotyped by capture-based targeted enrichment sequencing in 100 F1 progeny segregating for starch viscosity phenotypes. A total of 2,110 non-redundant SNP markers were used to construct a genetic map. This map encompasses 1,785 cM and consists of 19 linkage groups. A major quantitative trait locus (QTL) controlling starch pasting properties was identified and shown to coincide with the QTL previously reported for this trait. With a high-density SNP-based linkage map presented here, we also uncovered a novel QTL associated with starch pasting time on LG 10. PMID:25551642

  15. Large-scale SNP discovery through RNA sequencing and SNP genotyping by targeted enrichment sequencing in cassava (Manihot esculenta Crantz).


    Pootakham, Wirulda; Shearman, Jeremy R; Ruang-Areerate, Panthita; Sonthirod, Chutima; Sangsrakru, Duangjai; Jomchai, Nukoon; Yoocha, Thippawan; Triwitayakorn, Kanokporn; Tragoonrung, Somvong; Tangphatsornruang, Sithichoke


    Cassava (Manihot esculenta Crantz) is one of the most important crop species being the main source of dietary energy in several countries. Marker-assisted selection has become an essential tool in plant breeding. Single nucleotide polymorphism (SNP) discovery via transcriptome sequencing is an attractive strategy for genome complexity reduction in organisms with large genomes. We sequenced the transcriptome of 16 cassava accessions using the Illumina HiSeq platform and identified 675,559 EST-derived SNP markers. A subset of those markers was subsequently genotyped by capture-based targeted enrichment sequencing in 100 F1 progeny segregating for starch viscosity phenotypes. A total of 2,110 non-redundant SNP markers were used to construct a genetic map. This map encompasses 1,785 cM and consists of 19 linkage groups. A major quantitative trait locus (QTL) controlling starch pasting properties was identified and shown to coincide with the QTL previously reported for this trait. With a high-density SNP-based linkage map presented here, we also uncovered a novel QTL associated with starch pasting time on LG 10.

  16. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.


    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong


    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

  17. Genome-Wide Microsatellite Characterization and Marker Development in the Sequenced Brassica Crop Species

    PubMed Central

    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong


    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species. PMID:24130371

  18. Transcriptome Profiling Analysis on Whole Bodies of Microbial Challenged Eriocheir sinensis Larvae for Immune Gene Identification and SNP Development

    PubMed Central

    Cui, Zhaoxia; Li, Xihong; Liu, Yuan; Song, Chengwen; Hui, Min; Shi, Guohui; Luo, Danli; Li, Yingdong


    To study crab immunogenetics of individuals, newly hatched Eriocheir sinensis larvae were stimulated with a mixture of three pathogen strains (Gram-positive bacteria Micrococcus luteus, Gram-negative bacteria Vibrio alginolyticus and fungi Pichia pastoris; 108 cfu·mL-1). A total of 44,767,566 Illumina clean reads corresponding to 4.52 Gb nucleotides were generated and assembled into 100,252 unigenes (average length: 1,042 bp; range: 201-19,357 bp). 17,097 (26.09%) of 65,535 non-redundant unigenes were annotated in NCBI non-redundant protein (Nr) database. Moreover, 23,188 (35.38%) unigenes were assigned to three Gene Ontology (GO) categories, 15,071 (23.00%) to twenty-six Clusters of orthologous Groups (COG) and 8,574 (13.08%) to six Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. Numerous genes were further identified to be associated with multiple immune pathways, including Toll, immune deficiency (IMD), janus kinase (JAK)-signal transducers and activators of transcription (STAT) and mitogen-activated protein kinase (MAPK) pathways. Some of them, such as tumor necrosis factor receptor associated factor 6 (TRAF6), fibroblast growth factor (FGF), protein-tyrosine phosphatase (PTP), JNK-interacting protein 1 (JIP1), were first identified in E. sinensis. TRAF6 was even first discovered in crabs. Additionally, 49,555 single nucleotide polymorphisms (SNPs) were developed from over 13,309 unigenes. This is the first transcriptome report of whole bodies of E. sinensis larvae after immune challenge. Data generated here not only provide detail information to identify novel genes in genome reference-free E. sinensis, but also facilitate our understanding on host immunity and defense mechanism of the crab at whole transcriptome level. PMID:24324760

  19. Translating teamwork behaviours from aviation to healthcare: development of behavioural markers for neonatal resuscitation

    PubMed Central

    Thomas, E; Sexton, J; Helmreich, R


    Improving teamwork in healthcare may help reduce and manage errors. This paper takes a step toward that goal by (1) proposing a set of teamwork behaviours, or behavioural markers, for neonatal resuscitation; (2) presenting a data form for recording observations about these markers; and (3) comparing and contrasting different sets of teamwork behaviours that have been developed for healthcare. Data from focus groups of neonatal providers, surveys, and video recordings of neonatal resuscitations were used to identify some new teamwork behaviours, to translate existing aviation team behaviours to this setting, and to develop a data collection form. This behavioural marker audit form for neonatal resuscitation lists and defines 10 markers that describe specific, observable behaviours seen during the resuscitation of newborn infants. These markers are compared with those developed by other groups. Future research should determine the relations among these behaviours and errors, and test their usefulness in measuring the impact of team training interventions. PMID:15465957

  20. Development of genomic SSR markers for fingerprinting lettuce (Lactuca sativa L.) cultivars and mapping genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Lettuce (Lactuca sativa L.) is the major vegetable from the group of leafy vegetables. Several types of molecular markers were developed that are effictively used in lettuce breeding and genetic studies. However only a very limited number of microsattelite-based markers are publicly avai...

  1. Identification of novel single nucleotide polymorphisms (SNPs) in deer (Odocoileus spp.) using the BovineSNP50 BeadChip.


    Haynes, Gwilym D; Latch, Emily K


    Single nucleotide polymorphisms (SNPs) are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus) for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer) and O. virginianus (white-tailed deer) in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068) were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878) and loci under selection (n = 190) were identified with the F(ST)-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present).

  2. Development of PCR‐Based Markers to Determine the Sex of Kelps

    PubMed Central

    Lipinska, Agnieszka P.; Ahmed, Sophia; Peters, Akira F.; Faugeron, Sylvain; Cock, J. Mark; Coelho, Susana M.


    Sex discriminating genetic markers are commonly used to facilitate breeding programs in economically and ecologically important animal and plant species. However, despite their considerable economic and ecological value, the development of sex markers for kelp species has been very limited. In this study, we used the recently described sequence of the sex determining region (SDR) of the brown algal model Ectocarpus to develop novel DNA-based sex-markers for three commercially relevant kelps: Laminaria digitata, Undaria pinnatifida and Macrocystis pyrifera. Markers were designed within nine protein coding genes of Ectocarpus male and female (U/V) sex chromosomes and tested on gametophytes of the three kelp species. Seven primer pairs corresponding to three loci in the Ectocarpus SDR amplified sex-specific bands in the three kelp species, yielding at least one male and one female marker for each species. Our work has generated the first male sex-specific markers for L. digitata and U. pinnatifida, as well as the first sex markers developed for the genus Macrocystis. The markers and methodology presented here will not only facilitate seaweed breeding programs but also represent useful tools for population and demography studies and provide a means to investigate the evolution of sex determination across this largely understudied eukaryotic group. PMID:26496392

  3. Microsatellite marker development and Mendelian analysis in the Matschie's tree kangaroo (Dendrolagus matschiei).


    McGreevy, Thomas J; Dabek, Lisa; Husband, Thomas P


    Matschie's tree kangaroo (Dendrolagus matschiei) is an endangered arboreal macropodid endemic to the Huon Peninsula, Papua New Guinea (PNG). We developed 5 microsatellite markers for D. matschiei, which are the first markers developed for Dendrolagus. We screened 17 additional markers that were developed for other marsupial taxa and identified 3 that were polymorphic in D. matschiei. We estimated allelic and genetic diversity with the set of 8 markers by analyzing 22 D. matschiei from Wasaunon on the Huon Peninsula, PNG. The number of alleles ranged from 2 to 9 and expected heterozygosity ranged from 0.440 to 0.794. We tested for null alleles and Mendelian inheritance by analyzing 19 pairs of D. matschiei parents and offspring from Association of Zoos and Aquariums institutions. Null alleles were not detected and Mendelian inheritance was followed for all 8 markers. We also evaluated the reliability of using the markers to amplify DNA extracted from D. matschiei fecal samples and the ability of the markers to amplify DNA samples from Goodfellow's tree kangaroo (Dendrolagus goodfellowi ssp.), Doria's tree kangaroo (Dendrolagus dorianus ssp.), and Grizzled tree kangaroo (Dendrolagus inustus ssp.). Microsatellite markers can be used to inform management decisions to conserve D. matschiei in captivity and the wild.

  4. Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.).


    Nunome, Tsukasa; Negoro, Satomi; Kono, Izumi; Kanamori, Hiroyuki; Miyatake, Koji; Yamaguchi, Hirotaka; Ohyama, Akio; Fukuoka, Hiroyuki


    Eggplant (Solanum melongena L.), also known as aubergine or brinjal, is an important vegetable in many countries. Few useful molecular markers have been reported for eggplant. We constructed simple sequence repeat (SSR)-enriched genomic libraries in order to develop SSR markers, and sequenced more than 14,000 clones. From these sequences, we designed 2,265 primer pairs to flank SSR motifs. We identified 1,054 SSR markers from amplification of 1,399 randomly selected primer pairs. The markers have an average polymorphic information content of 0.27 among eight lines of S. melongena. Of the 1,054 SSR markers, 214 segregated in an intraspecific mapping population. We constructed cDNA libraries from several eggplant tissues and obtained 6,144 expressed sequence tag (EST) sequences. From these sequences, we designed 209 primer pairs, 7 of which segregated in the mapping population. On the basis of the segregation data, we constructed a linkage map, and mapped the 236 segregating markers to 14 linkage groups. The linkage map spans a total length of 959.1 cM, with an average marker distance of 4.3 cM. The markers should be a useful resource for qualitative and quantitative trait mapping and for marker-assisted selection in eggplant breeding.

  5. EST-SNP discovery and dense genetic mapping in lentil (Lens culinaris Medik.) enable candidate gene selection for boron tolerance.


    Kaur, Sukhjiwan; Cogan, Noel O I; Stephens, Amber; Noy, Dianne; Butsch, Mirella; Forster, John W; Materne, Michael


    Large-scale SNP discovery and dense genetic mapping in a lentil intraspecific cross permitted identification of a single chromosomal region controlling tolerance to boron toxicity, an important breeding objective. Lentil (Lens culinaris Medik.) is a highly nutritious food legume crop that is cultivated world-wide. Until recently, lentil has been considered a genomic 'orphan' crop, limiting the feasibility of marker-assisted selection strategies in breeding programs. The present study reports on the identification of single-nucleotide polymorphisms (SNPs) from transcriptome sequencing data, utilisation of expressed sequence tag (EST)-derived simple sequence repeat (SSR) and SNP markers for construction of a gene-based genetic linkage map, and identification of markers in close linkage to major QTLs for tolerance to boron (B) toxicity. A total of 2,956 high-quality SNP markers were identified from a lentil EST database. Sub-sets of 546 SSRs and 768 SNPs were further used for genetic mapping of an intraspecific mapping population (Cassab × ILL2024) that exhibits segregation for B tolerance. Comparative analysis of the lentil linkage map with the sequenced genomes of Medicago truncatula Gaertn., soybean (Glycine max [L.] Merr.) and Lotus japonicus L. indicated blocks of conserved macrosynteny, as well as a number of rearrangements. A single genomic region was found to be associated with variation for B tolerance in lentil, based on evaluation performed over 2 years. Comparison of flanking markers to genome sequences of model species (M. truncatula, soybean and Arabidopsis thaliana) identified candidate genes that are functionally associated with B tolerance, and could potentially be used for diagnostic marker development in lentil.

  6. Development of a chloroplast DNA marker for monitoring of transgene introgression in Brassica napus L.


    Woo, Hee-Jong; Lim, Myung-Ho; Shin, Kong-Sik; Martins, Bianca; Lee, Bum-Kyu; Cho, Hyun-Suk; Mallory-Smith, Carol A


    Chloroplast molecular markers can provide useful information for high-resolution analysis of inter- and intra-specific variation in Brassicaceae and for differentiation between its species. Combining data generated from nuclear and chloroplast markers enables the study of seed and pollen movement, and assists in the assessment of gene-flow from genetically modified (GM) plants through hybridization studies. To develop chloroplast DNA markers for monitoring of transgene introgression in Brassica napus L., we searched for sequence variations in the chloroplast (cp) genome, and developed a simple cpDNA marker that is reliable, time-saving, and easily discriminates among 4 species (B. napus, B. rapa, Raphanus sativus, and Sinapis alba) based on PCR-product length polymorphism. This marker will be useful to identify maternal lineages and to estimate transgene movement of GM canola.

  7. Development of microsatellite markers for the apomictic triploid fern Myriopteris lindheimeri (Pteridaceae)1

    PubMed Central

    Grusz, Amanda L.; Pryer, Kathleen M.


    Premise of the study: Microsatellite markers were developed for investigating the population dynamics of Myriopteris lindheimeri (Pteridaceae), an apomictic triploid fern endemic to deserts of the southwestern United States and Mexico. Methods and Results: Using 454 sequencing, 21 microsatellite markers were developed. Of these, 14 were polymorphic with up to five alleles per locus and eight markers amplified in one or more congeneric close relatives (M. covillei, M. fendleri, M. aurea, and M. rufa). To demonstrate marker utility, M. lindheimeri samples from three Arizona populations were genotyped at nine loci. For each population, diversity measures including percent polymorphic loci, frequency of heterozygotes across all loci, and genotypic diversity were calculated. Across the three populations, on average, 63% of loci were polymorphic, the average frequency of heterozygotes (across all loci) was 0.32, and average genotypic diversity was 0.34. Conclusions: These markers provide a foundation for future studies exploring polyploidy and apomixis in myriopterid ferns. PMID:26649266

  8. Development of microsatellite markers for the clonal shrub Orixa japonica (Rutaceae) using 454 sequencing1

    PubMed Central

    Tamaki, Ichiro; Setsuko, Suzuki; Sugai, Kyoko; Yanagisawa, Nao


    Premise of the study: Microsatellite markers were developed for a dioecious shrub, Orixa japonica (Rutaceae). Because O. japonica vigorously propagates by vegetative growth, microsatellite markers can be used to identify clonal relationships among its ramets. Methods and Results: Sixteen polymorphic microsatellite markers were identified by 454 next-generation sequencing. The number of alleles and expected heterozygosity for each locus among four populations ranged from two to 10 and from 0.140 to 0.875, respectively. Five of the 16 loci showed a low null allele frequency. Because Orixa is a monotypic genus, cross-amplification in a consubfamilial species, Skimmia japonica, was tested, and only one locus showed polymorphism. Conclusions: These microsatellite markers developed for O. japonica contribute to clone identification for studies examining the clonal structure and true sex ratio in the wild. Moreover, five markers that have a low null allele frequency can also be used for estimating mating systems or performing parentage analysis. PMID:27785383

  9. Development and Utilization of InDel Markers to Identify Peanut (Arachis hypogaea) Disease Resistance.


    Liu, Lifeng; Dang, Phat M; Chen, Charles Y


    Peanut diseases, such as leaf spot and spotted wilt caused by Tomato Spotted Wilt Virus, can significantly reduce yield and quality. Application of marker assisted plant breeding requires the development and validation of different types of DNA molecular markers. Nearly 10,000 SSR-based molecular markers have been identified by various research groups around the world, but less than 14.5% showed polymorphism in peanut and only 6.4% have been mapped. Low levels of polymorphism limit the application of marker assisted selection (MAS) in peanut breeding programs. Insertion/deletion (InDel) markers have been reported to be more polymorphic than SSRs in some crops. The goals of this study were to identify novel InDel markers and to evaluate the potential use in peanut breeding. Forty-eight InDel markers were developed from conserved sequences of functional genes and tested in a diverse panel of 118 accessions covering six botanical types of cultivated peanut, of which 104 were from the U.S. mini-core. Results showed that 16 InDel markers were polymorphic with polymorphic information content (PIC) among InDels ranged from 0.017 to 0.660. With respect to botanical types, PICs varied from 0.176 for fastigiata var., 0.181 for hypogaea var., 0.306 for vulgaris var., 0.534 for aequatoriana var., 0.556 for peruviana var., to 0.660 for hirsuta var., implying that aequatoriana var., peruviana var., and hirsuta var. have higher genetic diversity than the other types and provide a basis for gene functional studies. Single marker analysis was conducted to associate specific marker to disease resistant traits. Five InDels from functional genes were identified to be significantly correlated to tomato spotted wilt virus (TSWV) infection and leaf spot, and these novel markers will be utilized to identify disease resistant genotype in breeding populations.

  10. Development and Utilization of InDel Markers to Identify Peanut (Arachis hypogaea) Disease Resistance

    PubMed Central

    Liu, Lifeng; Dang, Phat M.; Chen, Charles Y.


    Peanut diseases, such as leaf spot and spotted wilt caused by Tomato Spotted Wilt Virus, can significantly reduce yield and quality. Application of marker assisted plant breeding requires the development and validation of different types of DNA molecular markers. Nearly 10,000 SSR-based molecular markers have been identified by various research groups around the world, but less than 14.5% showed polymorphism in peanut and only 6.4% have been mapped. Low levels of polymorphism limit the application of marker assisted selection (MAS) in peanut breeding programs. Insertion/deletion (InDel) markers have been reported to be more polymorphic than SSRs in some crops. The goals of this study were to identify novel InDel markers and to evaluate the potential use in peanut breeding. Forty-eight InDel markers were developed from conserved sequences of functional genes and tested in a diverse panel of 118 accessions covering six botanical types of cultivated peanut, of which 104 were from the U.S. mini-core. Results showed that 16 InDel markers were polymorphic with polymorphic information content (PIC) among InDels ranged from 0.017 to 0.660. With respect to botanical types, PICs varied from 0.176 for fastigiata var., 0.181 for hypogaea var., 0.306 for vulgaris var., 0.534 for aequatoriana var., 0.556 for peruviana var., to 0.660 for hirsuta var., implying that aequatoriana var., peruviana var., and hirsuta var. have higher genetic diversity than the other types and provide a basis for gene functional studies. Single marker analysis was conducted to associate specific marker to disease resistant traits. Five InDels from functional genes were identified to be significantly correlated to tomato spotted wilt virus (TSWV) infection and leaf spot, and these novel markers will be utilized to identify disease resistant genotype in breeding populations. PMID:26617627

  11. Development of marker-based tracking methods for augmented reality applied to NPP maintenance work support and its experimental evaluation

    SciTech Connect

    Ishii, H.; Fujino, H.; Bian, Z.; Sekiyama, T.; Shimoda, H.; Yoshikawa, H.


    In this study, two types of marker-based tracking methods for Augmented Reality have been developed. One is a method which employs line-shaped markers and the other is a method which employs circular-shaped markers. These two methods recognize the markers by means of image processing and calculate the relative position and orientation between the markers and the camera in real time. The line-shaped markers are suitable to be pasted in the buildings such as NPPs where many pipes and tanks exist. The circular-shaped markers are suitable for the case that there are many obstacles and it is difficult to use line-shaped markers because the obstacles hide the part of the line-shaped markers. Both methods can extend the maximum distance between the markers and the camera compared to the legacy marker-based tracking methods. (authors)

  12. Wheat in the Mediterranean revisited – tetraploid wheat landraces assessed with elite bread wheat Single Nucleotide Polymorphism markers

    PubMed Central


    Background Single Nucleotide Polymorphism (SNP) panels recently developed for the assessment of genetic diversity in wheat are primarily based on elite varieties, mostly those of bread wheat. The usefulness of such SNP panels for studying wheat evolution and domestication has not yet been fully explored and ascertainment bias issues can potentially affect their applicability when studying landraces and tetraploid ancestors of bread wheat. We here evaluate whether population structure and evolutionary history can be assessed in tetraploid landrace wheats using SNP markers previously developed for the analysis of elite cultivars of hexaploid wheat. Results We genotyped more than 100 tetraploid wheat landraces and wild emmer wheat accessions, some of which had previously been screened with SSR markers, for an existing SNP panel and obtained publically available genotypes for the same SNPs for hexaploid wheat varieties and landraces. Results showed that quantification of genetic diversity can be affected by ascertainment bias but that the effects of ascertainment bias can at least partly be alleviated by merging SNPs to haplotypes. Analyses of population structure and genetic differentiation show strong subdivision between the tetraploid wheat subspecies, except for durum and rivet that are not separable. A more detailed population structure of durum landraces could be obtained than with SSR markers. The results also suggest an emmer, rather than durum, ancestry of bread wheat and with gene flow from wild emmer. Conclusions SNP markers developed for elite cultivars show great potential for inferring population structure and can address evolutionary questions in landrace wheat. Issues of marker genome specificity and mapping need, however, to be addressed. Ascertainment bias does not seem to interfere with the ability of a SNP marker system developed for elite bread wheat accessions to detect population structure in other types of wheat. PMID:24885044

  13. Development of Genetic Markers for Triploid Verification of the Pacific Oyster, Crassostrea gigas

    PubMed Central

    Kang, Jung-Ha; Lim, Hyun Jeong; Kang, Hyun-Soek; Lee, Jung-Mee; Baby, Sumy; Kim, Jong-Joo


    The triploid Pacific oyster, which is produced by mating tetraploid and diploid oysters, is favored by the aquaculture industry because of its better flavor and firmer texture, particularly during the summer. However, tetraploid oyster production is not feasible in all oysters; the development of tetraploid oysters is ongoing in some oyster species. Thus, a method for ploidy verification is necessary for this endeavor, in addition to ploidy verification in aquaculture farms and in the natural environment. In this study, a method for ploidy verification of triploid and diploid oysters was developed using multiplex polymerase chain reaction (PCR) panels containing primers for molecular microsatellite markers. Two microsatellite multiplex PCR panels consisting of three markers each were developed using previously developed microsatellite markers that were optimized for performance. Both panels were able to verify the ploidy levels of 30 triploid oysters with 100% accuracy, illustrating the utility of microsatellite markers as a tool for verifying the ploidy of individual oysters. PMID:25049868

  14. Large-Scale SNP Discovery and Genotyping for Constructing a High-Density Genetic Map of Tea Plant Using Specific-Locus Amplified Fragment Sequencing (SLAF-seq).


    Ma, Jian-Qiang; Huang, Long; Ma, Chun-Lei; Jin, Ji-Qiang; Li, Chun-Fang; Wang, Rong-Kai; Zheng, Hong-Kun; Yao, Ming-Zhe; Chen, Liang


    Genetic maps are important tools in plant genomics and breeding. The present study reports the large-scale discovery of single nucleotide polymorphisms (SNPs) for genetic map construction in tea plant. We developed a total of 6,042 valid SNP markers using specific-locus amplified fragment sequencing (SLAF-seq), and subsequently mapped them into the previous framework map. The final map contained 6,448 molecular markers, distributing on fifteen linkage groups corresponding to the number of tea plant chromosomes. The total map length was 3,965 cM, with an average inter-locus distance of 1.0 cM. This map is the first SNP-based reference map of tea plant, as well as the most saturated one developed to date. The SNP markers and map resources generated in this study provide a wealth of genetic information that can serve as a foundation for downstream genetic analyses, such as the fine mapping of quantitative trait loci (QTL), map-based cloning, marker-assisted selection, and anchoring of scaffolds to facilitate the process of whole genome sequencing projects for tea plant.

  15. Multiple SNP Set Analysis for Genome-Wide Association Studies Through Bayesian Latent Variable Selection.


    Lu, Zhao-Hua; Zhu, Hongtu; Knickmeyer, Rebecca C; Sullivan, Patrick F; Williams, Stephanie N; Zou, Fei


    The power of genome-wide association studies (GWAS) for mapping complex traits with single-SNP analysis (where SNP is single-nucleotide polymorphism) may be undermined by modest SNP effect sizes, unobserved causal SNPs, correlation among adjacent SNPs, and SNP-SNP interactions. Alternative approaches for testing the association between a single SNP set and individual phenotypes have been shown to be promising for improving the power of GWAS. We propose a Bayesian latent variable selection (BLVS) method to simultaneously model the joint association mapping between a large number of SNP sets and complex traits. Compared with single SNP set analysis, such joint association mapping not only accounts for the correlation among SNP sets but also is capable of detecting causal SNP sets that are marginally uncorrelated with traits. The spike-and-slab prior assigned to the effects of SNP sets can greatly reduce the dimension of effective SNP sets, while speeding up computation. An efficient Markov chain Monte Carlo algorithm is developed. Simulations demonstrate that BLVS outperforms several competing variable selection methods in some important scenarios. PMID:26515609

  16. Development and validation of a D-loop mtDNA SNP assay for the screening of specimens in forensic casework.


    Chemale, Gustavo; Paneto, Greiciane Gaburro; Menezes, Meiga Aurea Mendes; de Freitas, Jorge Marcelo; Jacques, Guilherme Silveira; Cicarelli, Regina Maria Barretto; Fagundes, Paulo Roberto


    Mitochondrial DNA (mtDNA) analysis is usually a last resort in routine forensic DNA casework. However, it has become a powerful tool for the analysis of highly degraded samples or samples containing too little or no nuclear DNA, such as old bones and hair shafts. The gold standard methodology still constitutes the direct sequencing of polymerase chain reaction (PCR) products or cloned amplicons from the HVS-1 and HVS-2 (hypervariable segment) control region segments. Identifications using mtDNA are time consuming, expensive and can be very complex, depending on the amount and nature of the material being tested. The main goal of this work is to develop a less labour-intensive and less expensive screening method for mtDNA analysis, in order to aid in the exclusion of non-matching samples and as a presumptive test prior to final confirmatory DNA sequencing. We have selected 14 highly discriminatory single nucleotide polymorphisms (SNPs) based on simulations performed by Salas and Amigo (2010) to be typed using SNaPShot(TM) (Applied Biosystems, Foster City, CA, USA). The assay was validated by typing more than 100 HVS-1/HVS-2 sequenced samples. No differences were observed between the SNP typing and DNA sequencing when results were compared, with the exception of allelic dropouts observed in a few haplotypes. Haplotype diversity simulations were performed using 172 mtDNA sequences representative of the Brazilian population and a score of 0.9794 was obtained when the 14 SNPs were used, showing that the theoretical prediction approach for the selection of highly discriminatory SNPs suggested by Salas and Amigo (2010) was confirmed in the population studied. As the main goal of the work is to develop a screening assay to skip the sequencing of all samples in a particular case, a pair-wise comparison of the sequences was done using the selected SNPs. When both HVS-1/HVS-2 SNPs were used for simulations, at least two differences were observed in 93.2% of the comparisons

  17. Development and validation of a D-loop mtDNA SNP assay for the screening of specimens in forensic casework.


    Chemale, Gustavo; Paneto, Greiciane Gaburro; Menezes, Meiga Aurea Mendes; de Freitas, Jorge Marcelo; Jacques, Guilherme Silveira; Cicarelli, Regina Maria Barretto; Fagundes, Paulo Roberto


    Mitochondrial DNA (mtDNA) analysis is usually a last resort in routine forensic DNA casework. However, it has become a powerful tool for the analysis of highly degraded samples or samples containing too little or no nuclear DNA, such as old bones and hair shafts. The gold standard methodology still constitutes the direct sequencing of polymerase chain reaction (PCR) products or cloned amplicons from the HVS-1 and HVS-2 (hypervariable segment) control region segments. Identifications using mtDNA are time consuming, expensive and can be very complex, depending on the amount and nature of the material being tested. The main goal of this work is to develop a less labour-intensive and less expensive screening method for mtDNA analysis, in order to aid in the exclusion of non-matching samples and as a presumptive test prior to final confirmatory DNA sequencing. We have selected 14 highly discriminatory single nucleotide polymorphisms (SNPs) based on simulations performed by Salas and Amigo (2010) to be typed using SNaPShot(TM) (Applied Biosystems, Foster City, CA, USA). The assay was validated by typing more than 100 HVS-1/HVS-2 sequenced samples. No differences were observed between the SNP typing and DNA sequencing when results were compared, with the exception of allelic dropouts observed in a few haplotypes. Haplotype diversity simulations were performed using 172 mtDNA sequences representative of the Brazilian population and a score of 0.9794 was obtained when the 14 SNPs were used, showing that the theoretical prediction approach for the selection of highly discriminatory SNPs suggested by Salas and Amigo (2010) was confirmed in the population studied. As the main goal of the work is to develop a screening assay to skip the sequencing of all samples in a particular case, a pair-wise comparison of the sequences was done using the selected SNPs. When both HVS-1/HVS-2 SNPs were used for simulations, at least two differences were observed in 93.2% of the comparisons

  18. A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking

    PubMed Central

    Daniels, Rachel; Volkman, Sarah K; Milner, Danny A; Mahesh, Nira; Neafsey, Daniel E; Park, Daniel J; Rosen, David; Angelino, Elaine; Sabeti, Pardis C; Wirth, Dyann F; Wiegand, Roger C


    Background Single nucleotide polymorphism (SNP) genotyping provides the means to develop a practical, rapid, inexpensive assay that will uniquely identify any Plasmodium falciparum parasite using a small amount of DNA. Such an assay could be used to distinguish recrudescence from re-infection in drug trials, to monitor the frequency and distribution of specific parasites in a patient population undergoing drug treatment or vaccine challenge, or for tracking samples and determining purity of isolates in the laboratory during culture adaptation and sub-cloning, as well as routine passage. Methods A panel of twenty-four SNP markers has been identified that exhibit a high minor allele frequency (average MAF > 35%), for which robust TaqMan genotyping assays were constructed. All SNPs were identified through whole genome sequencing and MAF was estimated through Affymetrix array-based genotyping of a worldwide collection of parasites. These assays create a "molecular barcode" to uniquely identify a parasite genome. Results Using 24 such markers no two parasites known to be of independent origin have yet been found to have the same allele signature. The TaqMan genotyping assays can be performed on a variety of samples including cultured parasites, frozen whole blood, or whole blood spotted onto filter paper with a success rate > 99%. Less than 5 ng of parasite DNA is needed to complete a panel of 24 markers. The ability of this SNP panel to detect and identify parasites was compared to the standard molecular methods, MSP-1 and MSP-2 typing. Conclusion This work provides a facile field-deployable genotyping tool that can be used without special skills with standard lab equipment, and at reasonable cost that will unambiguously identify and track P. falciparum parasites both from patient samples and in the laboratory. PMID:18959790

  19. Development and characterization of 14 microsatellite markers for Buergeria japonica (Amphibia, Anura, Rhacophoridae).


    Komaki, Shohei; Igawa, Takeshi; Nozawa, Masafumi; Lin, Si-Min; Oumi, Shohei; Sumida, Masayuki


    Buergeria japonica is a common frog species distributed throughout almost all islands in Ryukyu Archipelago. Because of their exceptionally wide distribution and higher physiological tolerance comparing to the other anurans, their demographic history and formation of distribution are intrinsic topics in the herpetological fauna of Ryukyu. Microsatellite marker is ideal genetic marker for such studies at inter- and intra-population level. We therefore developed microsatellite markers of B. japonica utilizing Ion PGM™ sequencing. As a result of the screening, we developed a total of 14 polymorphic markers. To test availabilities of these markers, we genotyped four island populations. The total number of alleles and expected hetelozygosities per locus ranged from 4 to 21 and 0.00 to 0.864, respectively. The phylogenetic relationship among the four populations based on the genetic distances of these markers was congruent with general divergence pattern of amphibians and reptiles in Ryukyu area. These markers developed in this study are considered to be useful for future studies about phylogeography and demography of this species. PMID:24817760

  20. Development of novel polymorphic microsatellite markers in Siganus fuscescens.


    Mao, X Q; Li, Z B; Ning, Y F; Shangguan, J B; Yuan, Y; Huang, Y S; Li, B B


    Rabbitfish, Siganus fuscescens, is widely distributed in the Indo-Pacific regions and eastern Mediterranean. Its dwelling place includes reef flats, coral reef regions, and seagrass meadows in tropical area and reef areas or shallow waters in locations at high latitudes. In the present study, 10 new polymorphic microsatellite markers were screened from 30 wild S. fuscescens individuals, using a method of fast isolation protocol and amplified fragment length polymorphism of sequences containing repeats. The number of polymorphic alleles per locus was 3 to 5 with a mean of 4.3, while the value of polymorphic information content ranged from 0.283 to 0.680. The values of the observed and expected heterozygosities were in the range 0.3333-0.8462 and 0.3011-0.7424, respectively. Deviation from Hardy-Weinberg equilibrium was not observed in this study. These polymorphic loci are expected to be effective in evaluating the genetic diversity, population structure, and gene flow and in determining the paternity in S. fuscescens, as well as for conservation management.

  1. Development of novel polymorphic microsatellite markers in Siganus fuscescens.


    Mao, X Q; Li, Z B; Ning, Y F; Shangguan, J B; Yuan, Y; Huang, Y S; Li, B B


    Rabbitfish, Siganus fuscescens, is widely distributed in the Indo-Pacific regions and eastern Mediterranean. Its dwelling place includes reef flats, coral reef regions, and seagrass meadows in tropical area and reef areas or shallow waters in locations at high latitudes. In the present study, 10 new polymorphic microsatellite markers were screened from 30 wild S. fuscescens individuals, using a method of fast isolation protocol and amplified fragment length polymorphism of sequences containing repeats. The number of polymorphic alleles per locus was 3 to 5 with a mean of 4.3, while the value of polymorphic information content ranged from 0.283 to 0.680. The values of the observed and expected heterozygosities were in the range 0.3333-0.8462 and 0.3011-0.7424, respectively. Deviation from Hardy-Weinberg equilibrium was not observed in this study. These polymorphic loci are expected to be effective in evaluating the genetic diversity, population structure, and gene flow and in determining the paternity in S. fuscescens, as well as for conservation management. PMID:27525874

  2. Effect of ANXA2 gene single nucleotide polymorphism (SNP) on the development of osteonecrosis in Indian sickle cell patient: a PCR-RFLP approach.


    Pandey, Sanjay; Ranjan, Ravi; Pandey, Sweta; Mishra, Rahasya Mani; Seth, Tulika; Saxena, Renu


    Osteonecrosis is a serious complication in sickle cell patients. The common sites of the necrosis are femoral head, head of the humerus and acetabulam. Annexin A2 (ANXA2) protein mainly functions in bone formation and bone resorption. Alteration of ANXA2 gene may affect the manifestations of osteonecrosis in the patients. PCR-RFLP is a common applicable technique for the detection of known mutation/polymorphisms. Here we are presenting application of the PCR-RFLP technique for determination of the ANXA2 gene single nucleotide polymorphism frequency and their clinical association among Indian sickle cell patients. Five known SNPs of ANXA2 gene (rs7170178, rs73435133, rs73418020, rs72746635 and rs73418025) were determined using the HpyCH4V, DdeI, HpyCH4III and Sau 961 restriction enzyme respectively. Restriction enzyme DdeI was common for rs73435133 and rs72746635 SNP. Only the rs7170178 SNP was detected among patient and control and the other four SNPs were absent in the studied groups. The frequency of ANXA2 gene rs7170178 SNP (A/G, G/G) was comparatively higher in sickle cell patients than controls and it was clinically associated with sickle cell osteonecrosis. The P value of heterozygotes (A/G) and homozygotes (G/G) genotypes were <0.001 and 0.001 respectively, which were highly significant. This study established the application of PCR-RFLP in detection of ANXA2 SNPs in sickle cell patients.

  3. Development of new PCR-based markers specific for chromosome arms of rye (Secale cereale L.).


    Qiu, Ling; Tang, Zong-xiang; Li, Meng; Fu, Shu-lan


    PCR-based rye (Secale cereale L.) chromosome-specific markers can contribute to the effective utilization of elite genes of rye in wheat (Triticum aestivum L.) breeding programs. In the present study, 578 new PCR-based rye-specific markers have been developed by using specific length amplified fragment sequencing (SLAF-seq) technology, and 76 markers displayed different polymorphism among rye Kustro, Imperial, and King II. A total of 427 and 387 markers were, respectively, located on individual chromosomes and chromosome arms of Kustro by using a set of wheat-rye monosomic addition lines and 13 monotelosomic addition lines, which were derived from T. aestivum L. 'Mianyang11' × S. cereale L. 'Kustro'. In addition, two sets of wheat-rye disomic addition lines, which were derived from T. aestivum L. var. Chinese Spring × S. cereale L. var. Imperial and T. aestivum L. 'Holdfast' × S. cereale L. var. King II, were used to test the chromosomal specificity of the 427 markers. The chromosomal locations of 281 markers were consistent among the three sets of wheat-rye addition lines. The markers developed in this study can be used to identify a given segment of rye chromosomes in wheat background and accelerate the utilization of elite genes on rye chromosomes in wheat breeding programs.

  4. Rapid Detection of Rare Deleterious Variants by Next Generation Sequencing with Optional Microarray SNP Genotype Data

    PubMed Central

    Watson, Christopher M.; Crinnion, Laura A.; Gurgel‐Gianetti, Juliana; Harrison, Sally M.; Daly, Catherine; Antanavicuite, Agne; Lascelles, Carolina; Markham, Alexander F.; Pena, Sergio D. J.; Bonthron, David T.


    ABSTRACT Autozygosity mapping is a powerful technique for the identification of rare, autosomal recessive, disease‐causing genes. The ease with which this category of disease gene can be identified has greatly increased through the availability of genome‐wide SNP genotyping microarrays and subsequently of exome sequencing. Although these methods have simplified the generation of experimental data, its analysis, particularly when disparate data types must be integrated, remains time consuming. Moreover, the huge volume of sequence variant data generated from next generation sequencing experiments opens up the possibility of using these data instead of microarray genotype data to identify disease loci. To allow these two types of data to be used in an integrated fashion, we have developed AgileVCFMapper, a program that performs both the mapping of disease loci by SNP genotyping and the analysis of potentially deleterious variants using exome sequence variant data, in a single step. This method does not require microarray SNP genotype data, although analysis with a combination of microarray and exome genotype data enables more precise delineation of disease loci, due to superior marker density and distribution. PMID:26037133

  5. Evaluation of Y chromosomal SNP haplogrouping in the HID-Ion AmpliSeq™ Identity Panel.


    Ochiai, Eriko; Minaguchi, Kiyoshi; Nambiar, Phrabhakaran; Kakimoto, Yu; Satoh, Fumiko; Nakatome, Masato; Miyashita, Keiko; Osawa, Motoki


    The Y chromosomal haplogroup determined from single nucleotide polymorphism (SNP) combinations is a valuable genetic marker to study ancestral male lineage and ethical distribution. Next-generation sequencing has been developed for widely diverse genetics fields. For this study, we demonstrate 34 Y-SNP typing employing the Ion PGM™ system to perform haplogrouping. DNA libraries were constructed using the HID-Ion AmpliSeq™ Identity Panel. Emulsion PCR was performed, then DNA sequences were analyzed on the Ion 314 and 316 Chip Kit v2. Some difficulties became apparent during the analytic processes. No-call was reported at rs2032599 and M479 in six samples, in which the least coverage was observed at M479. A minor misreading occurred at rs2032631 and M479. A real time PCR experiment using other pairs of oligonucleotide primers showed that these events might result from the flanking sequence. Finally, Y haplogroup was determined completely for 81 unrelated males including Japanese (n=59) and Malay (n=22) subjects. The allelic divergence differed between the two populations. In comparison with the conventional Sanger method, next-generation sequencing provides a comprehensive SNP analysis with convenient procedures, but further system improvement is necessary. PMID:27591541

  6. Development of chloroplast microsatellite markers for the endangered Maianthemum bicolor (Asparagaceae s.l.)1

    PubMed Central

    Park, Hana; Kim, Changkyun; Lee, You-Mi; Kim, Joo-Hwan


    Premise of the study: Ten polymorphic chloroplast microsatellite (cpSSR) markers were developed and characterized in an endemic and endangered herb, Maianthemum bicolor (Asparagaceae s.l.), for use in conservation genetics. Methods and Results: Primer sets flanking each of the 10 cpSSR loci in noncoding regions of the chloroplast genome of M. bicolor were designed. These cpSSR markers were tested on a total of 33 adult individuals from three natural populations in South Korea. The number of alleles per locus ranged from two to three. The unbiased haplotype diversity per locus ranged from 0.061 to 0.682. All markers were successfully transferred to the congeneric species M. japonicum, M. bifolium, and M. dilatatum with polymorphisms among the species. Conclusions: The developed cpSSR markers will be useful in assessing the genetic diversity and population structure of M. bicolor and will help to infer its molecular identification, thereby providing a basis for conservation.

  7. HaploSNP affinities and linkage map positions illuminate subgenome composition in the octoploid, cultivated strawberry (Fragaria×ananassa).


    Sargent, D J; Yang, Y; Šurbanovski, N; Bianco, L; Buti, M; Velasco, R; Giongo, L; Davis, T M


    The cultivated strawberry, Fragaria×ananassa possesses a genetically complex allo-octoploid genome. Advances in genomics research in Fragaria, including the release of a genome sequence for F. vesca, have permitted the development of a high throughput whole genome genotyping array for strawberry, which promises to facilitate genetics and genomics research. In this investigation, we used the Axiom® IStraw90®)array for linkage map development, and produced a linkage map containing 8,407 SNP markers spanning 1,820cM. Whilst the linkage map provides good coverage of the genome of both parental genotypes, the map of 'Monterey' contained significantly fewer mapped markers than did that of 'Darselect'. The array contains a novel marker class known as haploSNPs, which exploit homoeologous sequence variants as probe destabilization sites to effectively reduce marker ploidy. We examined these sites as potential indicators of subgenomic identities by using comparisons to allele states in two ancestral diploids. On this basis, haploSNP loci could be inferred to be derived from F. vesca, F. iinumae, or from an unknown source. When the identity classifications of haploSNPs were considered in conjunction with their respective linkage map positions, it was possible to define two discrete subgenomes, while the remaining homoeologues of each chromosome could not be partitioned into two discrete subgenomic groupings. These findings suggested a novel hypothesis regarding octoploid strawberry subgenome structure and evolutionary origins.

  8. PERMANENT GENETIC RESOURCES: Development of polymorphic microsatellite markers in Acer mono Maxim.


    Kikuchi, S; Shibata, M


    Thirteen polymorphic microsatellite markers were developed for Acer mono Maxim., one of the major components of deciduous forests in Japan. An average of 13.8 alleles were found, with expected heterozygosity ranging from 0.140 to 0.945 in 34 A. mono individuals from the Ogawa Forest Reserve in Ibaraki Prefecture, Japan. This set of microsatellite markers can be used to analyse mating patterns and gene flow in A. mono populations.

  9. RNA sequencing to study gene expression and SNP variations associated with growth in zebrafish fed a plant protein-based diet.


    Ulloa, Pilar E; Rincón, Gonzalo; Islas-Trejo, Alma; Araneda, Cristian; Iturra, Patricia; Neira, Roberto; Medrano, Juan F


    The objectives of this study were to measure gene expression in zebrafish and then identify SNP to be used as potential markers in a growth association study. We developed an approach where muscle samples collected from low- and high-growth fish were analyzed using RNA-Sequencing (RNA-seq), and SNP were chosen from the genes that were differentially expressed between the low and high groups. A population of 24 families was fed a plant protein-based diet from the larval to adult stages. From a total of 440 males, 5 % of the fish from both tails of the weight gain distribution were selected. Total RNA was extracted from individual muscle of 8 low-growth and 8 high-growth fish. Two pooled RNA-Seq libraries were prepared for each phenotype using 4 fish per library. Libraries were sequenced using the Illumina GAII Sequencer and analyzed using the CLCBio genomic workbench software. One hundred and twenty-four genes were differentially expressed between phenotypes (p value < 0.05 and FDR < 0.2). From these genes, 164 SNP were selected and genotyped in 240 fish samples. Marker-trait analysis revealed 5 SNP associated with growth in key genes (Nars, Lmod2b, Cuzd1, Acta1b, and Plac8l1). These genes are good candidates for further growth studies in fish and to consider for identification of potential SNPs associated with different growth rates in response to a plant protein-based diet.

  10. RiceCAP: Development of molecular markers associated with long grain milling yield

    Technology Transfer Automated Retrieval System (TEKTRAN)

    U.S. rice breeders are focused on developing new cultivars that have high yield and high milling quality. Using traditional breeding methods, it takes approximately ten years to develop a new cultivar. Development of molecular markers that are closely linked to traits of economic value will increase...

  11. Development of microsatellite markers for six Tetranychus species by transfer from Tetranychus urticae genome.


    Zhang, Jia; Sun, Jing-Tao; Jin, Peng-Yu; Hong, Xiao-Yue


    Microsatellite markers are frequently used to explore the population genetic structure of organisms. Spider mites (genus Tetranychus) are important agricultural pests. Several markers have been developed for T. urticae, but for other spider mites, few such markers are available, hampering studies of their population genetics. In this study, we developed and characterized microsatellite markers for six non-model spider mite species (T. truncatus, T. kanzawai, T. ludeni, T. piercei, T. phaselus and T. pueraricola) by cross-species amplification of markers in the T. urticae genome, in order to better understand the population structure of Tetranychus species. Among 228 screened loci, many were polymorphic, including 13 loci in T. urticae, 11 loci in T. truncatus, 15 loci in T. pueraricola, 23 loci in T. kanzawai, 19 loci in T. piercei, 11 loci in T. phaselus and 9 loci in T. ludeni. Sequence analysis determined that the fragment length variations of the transferred microsatellites were mainly due to the variations of the numbers of repeats. These new microsatellite markers should be useful for studying the population genetics of the seven Tetranychus species. PMID:27380501

  12. Development and characterization of genomic SSR markers in Cynodon transvaalensis Burtt-Davy.


    Tan, Chengcheng; Wu, Yanqi; Taliaferro, Charles M; Bell, Greg E; Martin, Dennis L; Smith, Mike W


    Simple sequence repeat (SSR) markers are a major molecular tool for genetic and genomic research that have been extensively developed and used in major crops. However, few are available in African bermudagrass (Cynodon transvaalensis Burtt-Davy), an economically important warm-season turfgrass species. African bermudagrass is mainly used for hybridizations with common bermudagrass [C. dactylon var. dactylon (L.) Pers.] in the development of superior interspecific hybrid turfgrass cultivars. Accordingly, the major objective of this study was to develop and characterize a large set of SSR markers. Genomic DNA of C. transvaalensis '4200TN 24-2' from an Oklahoma State University (OSU) turf nursery was extracted for construction of four SSR genomic libraries enriched with [CA](n), [GA](n), [AAG](n), and [AAT](n) as core repeat motifs. A total of 3,064 clones were sequenced at the OSU core facility. The sequences were categorized into singletons and contiguous sequences to exclude redundancy. From the two sequence categories, 1,795 SSR loci were identified. After excluding duplicate SSRs by comparison with previously developed SSR markers using a nucleotide basic local alignment tool, 1,426 unique primer pairs (PPs) were designed. Out of the 1,426 designed PPs, 981 (68.8 %) amplified alleles of the expected size in the donor DNA. Polymorphisms of the SSR PPs tested in eight C. transvaalensis plants were 93 % polymorphic with 544 markers effective in all genotypes. Inheritance of the SSRs was examined in six F(1) progeny of African parents 'T577' × 'Uganda', indicating 917 markers amplified heritable alleles. The SSR markers developed in the study are the first large set of co-dominant markers in African bermudagrass and should be highly valuable for molecular and traditional breeding research.

  13. SNP genotyping by heteroduplex analysis.


    Paniego, Norma; Fusari, Corina; Lia, Verónica; Puebla, Andrea


    Heteroduplex-based genotyping methods have proven to be technologically effective and economically efficient for low- to medium-range throughput single-nucleotide polymorphism (SNP) determination. In this chapter we describe two protocols that were successfully applied for SNP detection and haplotype analysis of candidate genes in association studies. The protocols involve (1) enzymatic mismatch cleavage with endonuclease CEL1 from celery, associated with fragment separation using capillary electrophoresis (CEL1 cleavage), and (2) differential retention of the homo/heteroduplex DNA molecules under partial denaturing conditions on ion pair reversed-phase liquid chromatography (dHPLC). Both methods are complementary since dHPLC is more versatile than CEL1 cleavage for identifying multiple SNP per target region, and the latter is easily optimized for sequences with fewer SNPs or small insertion/deletion polymorphisms. Besides, CEL1 cleavage is a powerful method to localize the position of the mutation when fragment resolution is done using capillary electrophoresis.

  14. A Bayesian Framework for SNP Identification

    SciTech Connect

    Webb-Robertson, Bobbie-Jo M.; Havre, Susan L.; Payne, Deborah A.


    Current proteomics techniques, such as mass spectrometry, focus on protein identification, usually ignoring most types of modifications beyond post-translational modifications, with the assumption that only a small number of peptides have to be matched to a protein for a positive identification. However, not all proteins are being identified with current techniques and improved methods to locate points of mutation are becoming a necessity. In the case when single-nucleotide polymorphisms (SNPs) are observed, brute force is the most common method to locate them, quickly becoming computationally unattractive as the size of the database associated with the model organism grows. We have developed a Bayesian model for SNPs, BSNP, incorporating evolutionary information at both the nucleotide and amino acid levels. Formulating SNPs as a Bayesian inference problem allows probabilities of interest to be easily obtained, for example the probability of a specific SNP or specific type of mutation over a gene or entire genome. Three SNP databases were observed in the evaluation of the BSNP model; the first SNP database is a disease specific gene in human, hemoglobin, the second is also a disease specific gene in human, p53, and the third is a more general SNP database for multiple genes in mouse. We validate that the BSNP model assigns higher posterior probabilities to the SNPs defined in all three separate databases than can be attributed to chance under specific evolutionary information, for example the amino acid model described by Majewski and Ott in conjunction with either the four-parameter nucleotide model by Bulmer or seven-parameter nucleotide model by Majewski and Ott.

  15. Development of dense microsatellite markers in the entire SLA region and evaluation of their polymorphisms in porcine breeds.


    Tanaka, Maiko; Ando, Asako; Renard, Christine; Chardon, Patrick; Domukai, Michiko; Okumura, Naohiko; Awata, Takashi; Uenishi, Hirohide


    We developed 40 microsatellite markers in the entire swine leukocyte antigen (SLA) region, spanning over 2.35 Mb. The average span between markers was 59 kb, and the largest interval between markers was 127 kb. We also evaluated polymorphisms of length for the markers using 97 pigs derived from 12 breeds, including representative commercial breeds. All of the markers were successfully amplified in genomic DNA and shown to be polymorphic. These markers will provide an alternative method for determining the SLA haplotypes instead of direct typing of SLA genes per se. They will be valuable for transplantation studies and for association studies between immunological traits such as disease susceptibility and tumor rejection.

  16. Development of microsatellite markers for the semi-natural grassland herb Veronicastrum japonicum (Plantaginaceae)1

    PubMed Central

    Nakahama, Naoyuki; Izuno, Ayako; Arima, Kurumi; Isagi, Yuji


    Premise of the study: Veronicastrum japonicum (Plantaginaceae) grows in grasslands on Honshu Island, Japan, and is threatened by habitat loss because of rapid land development over recent decades. For the genetic characterization of the remaining populations, microsatellite markers were developed. Methods and Results: Twelve polymorphic microsatellite loci were developed using next-generation sequencing. The number of alleles per locus ranged from two to 24 (mean 7.7), and the expected heterozygosity per locus ranged from 0.35 to 0.94 (mean 0.68). Conclusions: These markers can be used for genetic studies in conservation, such as the evaluation of genetic diversity and genetic structure. PMID:26949575

  17. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants.


    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki


    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase ( This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  18. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants.


    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki


    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase ( This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops.

  19. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants

    PubMed Central

    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki


    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase ( This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  20. Development and Validation of EST-SSR Markers from the Transcriptome of Adzuki Bean (Vigna angularis).


    Chen, Honglin; Liu, Liping; Wang, Lixia; Wang, Suhua; Somta, Prakit; Cheng, Xuzhen


    The adzuki bean (Vigna angularis (Ohwi) Ohwi and Ohashi) is an important grain legume of Asia. It is cultivated mainly in China, Japan and Korea. Despite its importance, few genomic resources are available for molecular genetic research of adzuki bean. In this study, we developed EST-SSR markers for the adzuki bean through next-generation sequencing. More than 112 million high-quality cDNA sequence reads were obtained from adzuki bean using Illumina paired-end sequencing technology, and the sequences were de novo assembled into 65,950 unigenes. The average length of the unigenes was 1,213 bp. Among the unigenes, 14,547 sequences contained a unique simple sequence repeat (SSR) and 3,350 sequences contained more than one SSR. A total of 7,947 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats (99.0%) as the most abundant motif class, followed by AG/CT (68.4%), AAG/CTT (30.0%), AAAG/CTTT (26.2%), AAAAG/CTTTT (16.1%), and AACGGG/CCCGTT (6.0%). A total of 500 SSR markers were randomly selected for validation, of which 296 markers produced reproducible amplicons with 38 polymorphic markers among the 32 adzuki bean genotypes selected from diverse geographical locations across China. The large number of SSR-containing sequences and EST-SSR markers will be valuable for genetic analysis of the adzuki bean and related Vigna species.

  1. Large-scale development of PIP and SSR markers and their complementary applied in Nicotiana.


    Huang, L; Cao, H; Yang, L; Yu, Yu; Wang, Yu


    PIP (Potential Intron Polymorphism) and SSR (Simple Sequence Repeats) were used in many species, but large-scale development and combined use of these two markers have not been reported in tobacco. In this study, a total of 12,388 PIP and 76,848 SSR markers were designed and uploaded to a web-accessible database ( E-PCR analysis showed that PIP and SSR rarely overlapped and were strongly complementary in the tobacco genome. The density was 3.07 PIP and 1.72 SSR markers per 10 kb of the known sequences. A total of 153 and 166 alleles were detectedby 22 PIP and 22 SSR markers in 64 Nicotiana accessions. SSR produced higher PIC (polymorphism information content) values and identified more alleles than PIP, whereas PIP could identify larger numbers of rare alleles. Mantel testing demonstrated a high correlation coefficient (r = 0.949, P < 0.001) between PIP and SSR. The UPGMA dendrogram created from the combined PIP and SSR markers was clearer and more reliable than the individual PIP or SSR dendrograms. It suggested that PIP and SSR can make up the deficiency of molecular markers not only in tobacco but other plant.

  2. Genetic mapping and marker development for resistance of wheat against the root lesion nematode Pratylenchus neglectus

    PubMed Central


    Background The Rlnn1 locus, which resides on chromosome 7A of bread wheat (Triticum aestivum L.) confers moderate resistance against the root lesion nematode Pratylenchus neglectus. Prior to this research, the exact linkage relationships of Rlnn1 with other loci on chromosome 7A were not clear and there were no simple codominant markers available for selection of Rlnn1 in wheat breeding. The objectives of the research reported here were to (1) develop an improved genetic map of the Rlnn1 region of chromosome 7A and (2) develop molecular markers that could be used in marker-assisted selection to improve resistance of wheat against P. neglectus. Results A large-effect quantitative trait locus (QTL) for resistance against P. neglectus was genetically mapped using a population of Excalibur/Kukri doubled haploid lines. This QTL coincides in position with the rust resistance gene(s) Lr20/Sr15, the phytoene synthase gene Psy-A1 and 10 molecular markers, including five new markers designed using wheat-rice comparative genomics and wheat expressed sequence tags. Two of the new markers are suitable for use as molecular diagnostic tools to distinguish plants that carry Rlnn1 and Lr20/Sr15 from those that do not carry these resistance genes. Conclusions The genomic location of Rlnn1 was confirmed to be in the terminal region of the long arm of chromosome 7A. Molecular markers were developed that provide simple alternatives to costly phenotypic assessment of resistance against P. neglectus in wheat breeding. In Excalibur, genetic recombination seems to be completely suppressed in the Rlnn1 region. PMID:24377498

  3. Developing genome-wide microsatellite markers of bamboo and their applications on molecular marker assisted taxonomy for accessions in the genus Phyllostachys

    PubMed Central

    Zhao, Hansheng; Yang, Li; Peng, Zhenhua; Sun, Huayu; Yue, Xianghua; Lou, Yongfeng; Dong, Lili; Wang, Lili; Gao, Zhimin


    Morphology-based taxonomy via exiguously reproductive organ has severely limitation on bamboo taxonomy, mainly owing to infrequent and unpredictable flowering events of bamboo. Here, we present the first genome-wide analysis and application of microsatellites based on the genome of moso bamboo (Phyllostachys edulis) to assist bamboo taxonomy. Of identified 127,593 microsatellite repeat-motifs, the primers of 1,451 microsatellites were designed and 1,098 markers were physically mapped on the genome of moso bamboo. A total of 917 markers were successfully validated in 9 accessions with ~39.8% polymorphic potential. Retrieved from validated microsatellite markers, 23 markers were selected for polymorphic analysis among 78 accessions and 64 alleles were detected with an average of 2.78 alleles per primers. The cluster result indicated the majority of the accessions were consistent with their current taxonomic classification, confirming the suitability and effectiveness of the developed microsatellite markers. The variations of microsatellite marker in different species were confirmed by sequencing and in silico comparative genome mapping were investigated. Lastly, a bamboo microsatellites database ( was implemented to browse and search large information of bamboo microsatellites. Consequently, our results of microsatellite marker development are valuable for assisting bamboo taxonomy and investigating genomic studies in bamboo and related grass species. PMID:25620112

  4. Developing genome-wide microsatellite markers of bamboo and their applications on molecular marker assisted taxonomy for accessions in the genus Phyllostachys.


    Zhao, Hansheng; Yang, Li; Peng, Zhenhua; Sun, Huayu; Yue, Xianghua; Lou, Yongfeng; Dong, Lili; Wang, Lili; Gao, Zhimin


    Morphology-based taxonomy via exiguously reproductive organ has severely limitation on bamboo taxonomy, mainly owing to infrequent and unpredictable flowering events of bamboo. Here, we present the first genome-wide analysis and application of microsatellites based on the genome of moso bamboo (Phyllostachys edulis) to assist bamboo taxonomy. Of identified 127,593 microsatellite repeat-motifs, the primers of 1,451 microsatellites were designed and 1,098 markers were physically mapped on the genome of moso bamboo. A total of 917 markers were successfully validated in 9 accessions with ~39.8% polymorphic potential. Retrieved from validated microsatellite markers, 23 markers were selected for polymorphic analysis among 78 accessions and 64 alleles were detected with an average of 2.78 alleles per primers. The cluster result indicated the majority of the accessions were consistent with their current taxonomic classification, confirming the suitability and effectiveness of the developed microsatellite markers. The variations of microsatellite marker in different species were confirmed by sequencing and in silico comparative genome mapping were investigated. Lastly, a bamboo microsatellites database ( was implemented to browse and search large information of bamboo microsatellites. Consequently, our results of microsatellite marker development are valuable for assisting bamboo taxonomy and investigating genomic studies in bamboo and related grass species.

  5. SNP diversity within and among Brassica rapa accessions reveals no geographic differentiation.


    Tanhuanpää, P; Erkkilä, M; Tenhola-Roininen, T; Tanskanen, J; Manninen, O


    Genetic diversity was studied in a collection of 61 accessions of Brassica rapa, which were mostly oil-type turnip rapes but also included two oil-type subsp. dichotoma and five subsp. trilocularis accessions, as well as three leaf-type subspecies (subsp. japonica, pekinensis, and chinensis) and five turnip cultivars (subsp. rapa). Two-hundred and nine SNP markers, which had been discovered by amplicon resequencing, were used to genotype 893 plants from the B. rapa collection using Illumina BeadXpress. There was great variation in the diversity indices between accessions. With STRUCTURE analysis, the plant collection could be divided into three groups that seemed to correspond to morphotype and flowering habit but not to geography. According to AMOVA analysis, 65% of the variation was due to variation within accessions, 25% among accessions, and 10% among groups. A smaller subset of the plant collection, 12 accessions, was also studied with 5727 GBS-SNPs. Diversity indices obtained with GBS-SNPs correlated well with those obtained with Illumina BeadXpress SNPs. The developed SNP markers have already been used and will be used in future plant breeding programs as well as in mapping and diversity studies.

  6. Single nucleotide polymorphism (SNP) at the GHR gene and its associations with chicken growth and fat deposition traits.


    Ouyang, J H; Xie, L; Nie, Q; Luo, C; Liang, Y; Zeng, H; Zhang, X


    1. The growth hormone receptor (GHR) plays crucial roles on chicken growth and metabolism. 2. The full cDNA of the chicken GHR gene was scanned for single nucleotide polymorphisms (SNP) by means of denaturing high-performance liquid chromatography (DHPLC). Three SNP, C6540334T, C6542011T and G6631778A, were genotyped in a F(2) designed full-sib resource population to analyse their associations with chicken growth and fat deposition traits. 3. Fifty-five SNP and two other variations were identified in the 8908 bp region of the GHR gene. Among the 55 SNP, 10 were located in coding exons (6 resulted in changes of amino acids) and 45 were in non-coding regions (introns, 5'UTR and 3'UTR). The nucleotide diversity (theta), corrected for sample size of chicken GHR gene, is 1.45 x 10(-3). Fourteen PCR-RFLP markers were developed in the chicken GHR gene. 4. The G6631778A was associated with body weight at 63 d (BW63), dressed weight (DW) and subcutaneous fat thickness (SFT), BW35 and BW49 (P < 0.01) as well as hatch weight (HW) and BW42 in the male population. However, G6631778A was only associated with BW28 in the female population. G rather than A was dominant for chicken growth and fat deposition. Haplotypes based on the three SNP were associated with BW21, BW70, BW77 and SFT, BW7, BW35, BW42, BW49 and BW56 in males, and associated with BW7 and BW14 in females. For growth in males, the H2 and H6 haplotypes had positive and negative effects, respectively; meanwhile H6 was predominant for fat deposition.

  7. Assessment of the functionality of genome-wide canine SNP arrays and implications for canine disease association studies.


    Ke, X; Kennedy, L J; Short, A D; Seppälä, E H; Barnes, A; Clements, D N; Wood, S H; Carter, S D; Happ, G M; Lohi, H; Ollier, W E R


    Domestic dogs share a wide range of important disease conditions with humans, including cancers, diabetes and epilepsy. Many of these conditions have similar or identical underlying pathologies to their human counterparts and thus dogs represent physiologically relevant natural models of human disorders. Comparative genomic approaches whereby disease genes can be identified in dog diseases and then mapped onto the human genome are now recognized as a valid method and are increasing in popularity. The majority of dog breeds have been created over the past few hundred years and, as a consequence, the dog genome is characterized by extensive linkage disequilibrium (LD), extending usually from hundreds of kilobases to several megabases within a breed, rather than tens of kilobases observed in the human genome. Genome-wide canine SNP arrays have been developed, and increasing success of using these arrays to map disease loci in dogs is emerging. No equivalent of the human HapMap currently exists for different canine breeds, and the LD structure for such breeds is far less understood than for humans. This study is a dedicated large-scale assessment of the functionalities (LD and SNP tagging performance) of canine genome-wide SNP arrays in multiple domestic dog breeds. We have used genotype data from 18 breeds as well as wolves and coyotes genotyped by the Illumina 22K canine SNP array and Affymetrix 50K canine SNP array. As expected, high tagging performance was observed with most of the breeds using both Illumina and Affymetrix arrays when multi-marker tagging was applied. In contrast, however, large differences in population structure, LD coverage and pairwise tagging performance were found between breeds, suggesting that study designs should be carefully assessed for individual breeds before undertaking genome-wide association studies (GWAS).

  8. A Toolkit for bulk PCR-based marker design from next-generation sequence data: application for development of a framework linkage map in bulb onion (Allium cepa L.)

    PubMed Central


    Background Although modern sequencing technologies permit the ready detection of numerous DNA sequence variants in any organisms, converting such information to PCR-based genetic markers is hampered by a lack of simple, scalable tools. Onion is an example of an under-researched crop with a complex, heterozygous genome where genome-based research has previously been hindered by limited sequence resources and genetic markers. Results We report the development of generic tools for large-scale web-based PCR-based marker design in the Galaxy bioinformatics framework, and their application for development of next-generation genetics resources in a wide cross of bulb onion (Allium cepa L.). Transcriptome sequence resources were developed for the homozygous doubled-haploid bulb onion line ‘CUDH2150’ and the genetically distant Indian landrace ‘Nasik Red’, using 454™ sequencing of normalised cDNA libraries of leaf and shoot. Read mapping of ‘Nasik Red’ reads onto ‘CUDH2150’ assemblies revealed 16836 indel and SNP polymorphisms that were mined for portable PCR-based marker development. Tools for detection of restriction polymorphisms and primer set design were developed in BioPython and adapted for use in the Galaxy workflow environment, enabling large-scale and targeted assay design. Using PCR-based markers designed with these tools, a framework genetic linkage map of over 800cM spanning all chromosomes was developed in a subset of 93 F2 progeny from a very large F2 family developed from the ‘Nasik Red’ x ‘CUDH2150’ inter-cross. The utility of tools and genetic resources developed was tested by designing markers to transcription factor-like polymorphic sequences. Bin mapping these markers using a subset of 10 progeny confirmed the ability to place markers within 10 cM bins, enabling increased efficiency in marker assignment and targeted map refinement. The major genetic loci conditioning red bulb colour (R) and fructan content (Frc) were located on

  9. Self-(in)compatibility inheritance and allele-specific marker development in yellow mustard (Sinapis alba).


    Zeng, Fangqin; Cheng, Bifang


    Yellow mustard (Sinapis alba) has a sporophytic self-incompatibility reproduction system. Genetically stable self-incompatible (SI) and self-compatible (SC) inbred lines have recently been developed in this crop. Understanding the S haplotype of different inbred lines and the inheritance of the self-(in)compatibility (SI/SC) trait is very important for breeding purposes. In this study, we used the S-locus gene-specific primers in Brassica rapa and Brassica oleracea to clone yellow mustard S-locus genes of SI lines Y514 and Y1130 and SC lines Y1499 and Y1501. The PCR amplification results and DNA sequences of the S-locus genes revealed that Y514 carried the class I S haplotype, while Y1130, Y1499, and Y1501 had the class II S haplotype. The results of our genetic studies indicated that self-incompatibility was dominant over self-compatibility and controlled by a one-gene locus in the two crosses of Y514 × Y1499 and Y1130 × Y1501. Of the five S-locus gene polymorphic primer pairs, Sal-SLGI and Sal-SRKI each generated one dominant marker for the SI phenotype of Y514; Sal-SLGII and Sal-SRKII produced dominant marker(s) for the SC phenotype of Y1501 and Y1499; Sal-SP11II generated one dominant marker for Y1130. These markers co-segregated with the SI/SC phenotype in the F2 populations of the two crosses. In addition, co-dominant markers were developed by mixing the two polymorphic primer pairs specific for each parent in the multiplex PCR, which allowed zygosity to be determined in the F2 populations. The SI/SC allele-specific markers have proven to be very useful for the selection of the desirable SC genotypes in our yellow mustard breeding program.

  10. Molecular characterization of diverse CIMMYT maize inbred lines from eastern and southern Africa using single nucleotide polymorphic markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Knowledge of germplasm diversity and relationships among elite breeding materials is fundamentally important in crop improvement. We genotyped 450 maize lines developed and/or widely used by CIMMYT breeding programs both in Kenya and Zimbabwe using 1065 SNP markers to (i) investigate population stru...

  11. Development of microsatellite markers for Sargentodoxa cuneata (Lardizabalaceae) using next-generation sequencing technology1

    PubMed Central

    Sun, Zhi-Xia; Ye, Lin-Jiang; Zhang, Fei; Hu, Wan; Fan, Deng-Mei; Zhang, Zhi-Yong


    Premise of the study: Microsatellite loci were developed for a woody deciduous liana, Sargentodoxa cuneata (Lardizabalaceae), to help infer the evolutionary histories of ancient monotypic genera in subtropical China. Methods and Results: Using next-generation sequencing (Illumina MiSeq) technology, 21 polymorphic primer sets were identified in three wild populations. The number of alleles per locus ranged from one to seven. The expected and observed heterozygosities varied from 0 to 0.788 and 0 to 0.917, respectively. Transferability analyses were performed in Stauntonia chinensis, Akebia trifoliata, and A. quinata. Eighteen (85.7%), 18 (85.7%), and 17 (81.0%) markers were successfully amplified, respectively. Conclusions: The newly developed markers will facilitate further studies on genetic diversity and phylogeographic patterns throughout the distributional range of S. cuneata. This set of microsatellite primers represents the second report on molecular markers in Lardizabalaceae. PMID:27213128

  12. Development and characterization of SSR markers for Aster savatieri (Asteraceae)1

    PubMed Central

    Ishikawa, Naoko; Sakaguchi, Shota; Ito, Motomi


    Premise of the study: Simple sequence repeat (SSR) markers were developed for Aster savatieri (Asteraceae) and the serpentine variety A. savatieri var. pygmaeus to re-evaluate their taxonomic status. Methods and Results: Using RNA-Seq data, 22 expressed sequence tag (EST)–SSR markers were developed. Polymorphisms were assessed in A. savatieri and in A. savatieri var. pygmaeus. The average number of alleles ranged from four to 15, and expected heterozygosity ranged from 0.417 to 0.870. Transferability was examined in six representative species of Japanese Aster and in Solidago virgaurea subsp. asiatica var. asiatica, a member of the tribe Astereae (Asteraceae); most of the loci were transferable to these examined species. Conclusions: These markers will be useful for genetic studies of variation in A. savatieri and other Aster species that occur in Japan. PMID:27347451

  13. Development and characterization of novel EST-SSR markers for Speranskia tuberculata (Euphorbiaceae)1

    PubMed Central

    Fu, Yi; Ju, Miao-Miao; Ma, Huan-Cheng; Xin, Pei-Yao; He, Cheng-Zhong; Jia, Dong-Rui; Tian, Bin


    Premise of the study: The first set of expressed sequence tag–simple sequence repeat (EST-SSR) markers were developed and characterized for Speranskia tuberculata (Euphorbiaceae), a traditional medicinal plant endemic to northern China, to explore the effects of recent habitat fragmentation on the genetic diversity and structure of this species. Methods and Results: In this study, a total of 18 novel polymorphic microsatellite (EST-SSR) markers were developed for S. tuberculata using high-throughput transcriptome sequencing. Analysis of 24 individuals of S. tuberculata from four natural populations revealed their robust polymorphic reliability. The number of alleles per locus ranged from two to 11, while the expected and observed heterozygosity per marker varied from 0.187 to 0.827 and 0.042 to 0.917, respectively. Of these markers, 13 showed good amplification results in the closely related species S. cantonensis. Conclusions: These newly generated SSR markers are expected to provide novel tools for genetic studies of S. tuberculata, which will contribute to the conservation and sustainable use of the species’ wild genetic resources. PMID:27785384

  14. Development of surface enhanced Raman scattering (SERS) spectroscopy monitoring of fuel markers to prevent fraud

    NASA Astrophysics Data System (ADS)

    Wilkinson, Timothy; Clarkson, John; White, Peter C.; Meakin, Nicholas; McDonald, Ken


    Governments often tax fuel products to generate revenues to support and stimulate their economies. They also subsidize the cost of essential fuel products. Fuel taxation and subsidization practices are both subject to fraud. Oil marketing companies also suffer from fuel fraud with loss of legitimate sales and additional quality and liability issues. The use of an advanced marking system to identify and control fraud has been shown to be effective in controlling illegal activity. DeCipher has developed surface enhanced Raman scattering (SERS) spectroscopy as its lead technology for measuring markers in fuel to identify and control malpractice. SERS has many advantages that make it highly suitable for this purpose. The SERS instruments are portable and can be used to monitor fuel at any point in the supply chain. SERS shows high specificity for the marker, with no false positives. Multiple markers can also be detected in a single SERS analysis allowing, for example, specific regional monitoring of fuel. The SERS analysis from fuel is also quick, clear and decisive, with a measurement time of less than 5 minutes. We will present results highlighting our development of the use of a highly stable silver colloid as a SERS substrate to measure the markers at ppb levels. Preliminary results from the use of a solid state SERS substrate to measure fuel markers will also be presented.

  15. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing

    PubMed Central

    Wang, Xuewen; Wang, Le


    Simple sequence repeats (SSRs), also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA) integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at

  16. Development of INDEL Markers for Genetic Mapping Based on Whole Genome Resequencing in Soybean

    PubMed Central

    Song, Xiaofeng; Wei, Haichao; Cheng, Wen; Yang, Suxin; Zhao, Yanxiu; Li, Xuan; Luo, Da; Zhang, Hui; Feng, Xianzhong


    Soybean [Glycine max (L.) Merrill] is an important crop worldwide. In this study, a Chinese local soybean cultivar, Hedou 12, was resequenced by next generation sequencing technology to develop INsertion/DELetion (INDEL) markers for genetic mapping. 49,276 INDEL polymorphisms and 242,059 single nucleotide polymorphisms were detected between Hedou 12 and the Williams 82 reference sequence. Of these, 243 candidate INDEL markers ranging from 5–50 bp in length were chosen for validation, and 165 (68%) of them revealed polymorphisms between Hedou 12 and Williams 82. The validated INDEL markers were also tested in 12 other soybean cultivars. The number of polymorphisms in the pairwise comparisons of 14 soybean cultivars varied from 27 to 165. To test the utility of these INDEL markers, they were used to perform genetic mapping of a crinkly leaf mutant, and the CRINKLY LEAF locus was successfully mapped to a 360 kb region on chromosome 7. This research shows that high-throughput sequencing technologies can facilitate the development of genome-wide molecular markers for genetic mapping in soybean. PMID:26483012

  17. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing.


    Wang, Xuewen; Wang, Le


    Simple sequence repeats (SSRs), also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA) integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at

  18. Development of INDEL Markers for Genetic Mapping Based on Whole Genome Resequencing in Soybean.


    Song, Xiaofeng; Wei, Haichao; Cheng, Wen; Yang, Suxin; Zhao, Yanxiu; Li, Xuan; Luo, Da; Zhang, Hui; Feng, Xianzhong


    Soybean [Glycine max (L.) Merrill] is an important crop worldwide. In this study, a Chinese local soybean cultivar, Hedou 12, was resequenced by next generation sequencing technology to develop INsertion/DELetion (INDEL) markers for genetic mapping. 49,276 INDEL polymorphisms and 242,059 single nucleotide polymorphisms were detected between Hedou 12 and the Williams 82 reference sequence. Of these, 243 candidate INDEL markers ranging from 5-50 bp in length were chosen for validation, and 165 (68%) of them revealed polymorphisms between Hedou 12 and Williams 82. The validated INDEL markers were also tested in 12 other soybean cultivars. The number of polymorphisms in the pairwise comparisons of 14 soybean cultivars varied from 27 to 165. To test the utility of these INDEL markers, they were used to perform genetic mapping of a crinkly leaf mutant, and the CRINKLY LEAF locus was successfully mapped to a 360 kb region on chromosome 7. This research shows that high-throughput sequencing technologies can facilitate the development of genome-wide molecular markers for genetic mapping in soybean.

  19. A single-tube 27-plex SNP assay for estimating individual ancestry and admixture from three continents.


    Wei, Yi-Liang; Wei, Li; Zhao, Lei; Sun, Qi-Fan; Jiang, Li; Zhang, Tao; Liu, Hai-Bo; Chen, Jian-Gang; Ye, Jian; Hu, Lan; Li, Cai-Xia


    A single-tube multiplex assay of a small set of ancestry-informative markers (AIMs) for effectively estimating individual ancestry and admixture is an ideal forensic tool to trace the population origin of an unknown DNA sample. We present a newly developed 27-plex single nucleotide polymorphism (SNP) panel with highly robust and balanced differential power to perfectly assign individuals to African, European, and East Asian ancestries. Evaluating 968 previously described intercontinental AIMs from three HapMap population genotyping datasets (Yoruban in Ibadan, Nigeria (YRI); Utah residents with Northern and Western European ancestry from the Centre de'Etude du Polymorphism Humain (CEPH) collection (CEU); and Han Chinese in Beijing, China (CHB)), the best set of markers was selected on the basis of Hardy-Weinberg equilibrium (p > 0.00001), population-specific allele frequency (two of three δ values >0.5), according to linkage disequilibrium (r (2) < 0.2), and capable of being multiplexed in one tube and detected by capillary electrophoresis. The 27-SNP panel was first validated by assigning the ancestry of the 11 populations in the HapMap project. Then, we tested the 27-plex SNP assay with 1164 individuals from 17 additional populations. The results demonstrated that the SNP panel was successful for ancestry inference of individuals with African, European, and East Asian ancestry. Furthermore, the system performed well when inferring the admixture of Eurasians (EUR/EAS) after analyzing admixed populations from Xinjiang (Central Asian) as follows: Tajik (68:27), Uyghur (49:46), Kirgiz (40:57), and Kazak (36:60). For individual analyses, we interpreted each sample with a three-ancestry component percentage and a population match probability sequence. This multiplex assay is a convenient and cost-effective tool to assist in criminal investigations, as well as to correct for the effects of population stratification for case-control studies.

  20. Suitability of non-lethal marker and marker-free systems for development of transgenic crop plants: present status and future prospects.


    Manimaran, P; Ramkumar, G; Sakthivel, K; Sundaram, R M; Madhav, M S; Balachandran, S M


    Genetically modified crops are one of the prudent options for enhancing the production and productivity of crop plants by safeguarding from the losses due to biotic and abiotic stresses. Agrobacterium-mediated and biolistic transformation methods are used to develop transgenic crop plants in which selectable marker genes (SMG) are generally deployed to identify 'true' transformants. The commonly used SMG obtained from prokaryotic sources when employed in transgenic plants pose risks due to their lethal nature during selection process. In the recent past, some non-lethal SMGs have been identified and used for selection of transformants with increased precision and high selection efficiency. Considering the concerns related to bio-safety of the environment, it is desirable to remove the SMG in order to maximize the commercial success through wide adoption and public acceptance of genetically modified (GM) food crops. In this review, we examine the availability, and the suitability of wide range of non-lethal selection markers and elimination of SMG methods to develop marker-free transgenics for achieving global food security. As the strategies for marker-free plants are still in proof-of-concept stage, adaptation of new genomics tools for identification of novel non-lethal marker systems and its application for developing marker-free transgenics would further strengthen the crop improvement program. PMID:21672619

  1. Suitability of non-lethal marker and marker-free systems for development of transgenic crop plants: present status and future prospects.


    Manimaran, P; Ramkumar, G; Sakthivel, K; Sundaram, R M; Madhav, M S; Balachandran, S M


    Genetically modified crops are one of the prudent options for enhancing the production and productivity of crop plants by safeguarding from the losses due to biotic and abiotic stresses. Agrobacterium-mediated and biolistic transformation methods are used to develop transgenic crop plants in which selectable marker genes (SMG) are generally deployed to identify 'true' transformants. The commonly used SMG obtained from prokaryotic sources when employed in transgenic plants pose risks due to their lethal nature during selection process. In the recent past, some non-lethal SMGs have been identified and used for selection of transformants with increased precision and high selection efficiency. Considering the concerns related to bio-safety of the environment, it is desirable to remove the SMG in order to maximize the commercial success through wide adoption and public acceptance of genetically modified (GM) food crops. In this review, we examine the availability, and the suitability of wide range of non-lethal selection markers and elimination of SMG methods to develop marker-free transgenics for achieving global food security. As the strategies for marker-free plants are still in proof-of-concept stage, adaptation of new genomics tools for identification of novel non-lethal marker systems and its application for developing marker-free transgenics would further strengthen the crop improvement program.

  2. Construction of a versatile SNP array for pyramiding useful genes of rice.


    Kurokawa, Yusuke; Noda, Tomonori; Yamagata, Yoshiyuki; Angeles-Shim, Rosalyn; Sunohara, Hidehiko; Uehara, Kanako; Furuta, Tomoyuki; Nagai, Keisuke; Jena, Kshirod Kumar; Yasui, Hideshi; Yoshimura, Atsushi; Ashikari, Motoyuki; Doi, Kazuyuki


    DNA marker-assisted selection (MAS) has become an indispensable component of breeding. Single nucleotide polymorphisms (SNP) are the most frequent polymorphism in the rice genome. However, SNP markers are not readily employed in MAS because of limitations in genotyping platforms. Here the authors report a Golden Gate SNP array that targets specific genes controlling yield-related traits and biotic stress resistance in rice. As a first step, the SNP genotypes were surveyed in 31 parental varieties using the Affymetrix Rice 44K SNP microarray. The haplotype information for 16 target genes was then converted to the Golden Gate platform with 143-plex markers. Haplotypes for the 14 useful allele are unique and can discriminate among all other varieties. The genotyping consistency between the Affymetrix microarray and the Golden Gate array was 92.8%, and the accuracy of the Golden Gate array was confirmed in 3 F2 segregating populations. The concept of the haplotype-based selection by using the constructed SNP array was proofed. PMID:26566831

  3. How to Use SNP_TATA_Comparator to Find a Significant Change in Gene Expression Caused by the Regulatory SNP of This Gene's Promoter via a Change in Affinity of the TATA-Binding Protein for This Promoter

    PubMed Central

    Ponomarenko, Mikhail; Rasskazov, Dmitry; Arkova, Olga; Ponomarenko, Petr; Suslov, Valentin; Savinkova, Ludmila; Kolchanov, Nikolay


    The use of biomedical SNP markers of diseases can improve effectiveness of treatment. Genotyping of patients with subsequent searching for SNPs more frequent than in norm is the only commonly accepted method for identification of SNP markers within the framework of translational research. The bioinformatics applications aimed at millions of unannotated SNPs of the “1000 Genomes” can make this search for SNP markers more focused and less expensive. We used our Web service involving Fisher's Z-score for candidate SNP markers to find a significant change in a gene's expression. Here we analyzed the change caused by SNPs in the gene's promoter via a change in affinity of the TATA-binding protein for this promoter. We provide examples and discuss how to use this bioinformatics application in the course of practical analysis of unannotated SNPs from the “1000 Genomes” project. Using known biomedical SNP markers, we identified 17 novel candidate SNP markers nearby: rs549858786 (rheumatoid arthritis); rs72661131 (cardiovascular events in rheumatoid arthritis); rs562962093 (stroke); rs563558831 (cyclophosphamide bioactivation); rs55878706 (malaria resistance, leukopenia), rs572527200 (asthma, systemic sclerosis, and psoriasis), rs371045754 (hemophilia B), rs587745372 (cardiovascular events); rs372329931, rs200209906, rs367732974, and rs549591993 (all four: cancer); rs17231520 and rs569033466 (both: atherosclerosis); rs63750953, rs281864525, and rs34166473 (all three: malaria resistance, thalassemia). PMID:26516624

  4. Molecular marker development and genetic diversity exploration by RNA-seq in Platycodon grandiflorum.


    Kim, Hyun Jung; Jung, Jungsu; Kim, Myung-Shin; Lee, Je Min; Choi, Doil; Yeam, Inhwa


    Platycodon grandiflorum, generally known as the bellflower or balloon flower, is the only species in the genus Platycodon of the family Campanulaceae. Platycodon plants have been traditionally used as a medicinal crop in East Asia for their antiphlogistic, antitussive, and expectorant properties. Despite these practical uses, marker-assisted selection and molecular breeding in platycodons have lagged due to the lack of genetic information on this genus. In this study, we performed RNA-seq analysis of three platycodon accessions to develop molecular markers and explore genetic diversity. First, genic simple sequence repeats (SSRs) were retrieved and compared; dinucleotide motifs were the most abundant repeats (39%-40%) followed by trinucleotide (25%-31%), tetranucleotide (1.5%-1.9%), and pentanucleotide (0.3%-1.0%) repeats. The result of in silico SSR analysis, three SSR markers were detected and showed possibility to distinguish three platycodon accessions. After several filtering procedures, 180 single nucleotide polymorphisms (SNPs) were used to design 40 cleaved amplified polymorphic sequence (CAPS) markers. Twelve of these PCR-based markers were validated as highly polymorphic and utilized to investigate genetic diversity in 21 platycodon accessions collected from various regions of South Korea. Collectively, the 12 markers yielded 35 alleles, with an average of 3 alleles per locus. Polymorphism information content (PIC) values ranged from 0.087 to 0.693, averaging 0.373 per locus. Since platycodon genetics have not been actively studied, the sequence information and the DNA markers generated from our research have the potential to contribute to further genetic improvements, genomic studies, and gene discovery in this genus.

  5. Development of COS-SNP and HRM markers for cost efficient and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...

  6. Map saturation and SNP marker development for the rust resistance genes (R4, R5, R13a, and R13b) in sunflower (Helianthus annuus L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sunflower rust, which is incited by the fungus Puccinia helianthi Schwein., is the most common disease in Australia, Argentina, South Africa, and North America. Three independent genes, R5, R4, and R13 with two alleles R13a and R13b, were discovered in sunflower and are promising sources of resistan...

  7. Development of microsatellite markers from an enriched genomic library for genetic analysis of melon (Cucumis melo L.)

    PubMed Central

    Ritschel, Patricia Silva; Lins, Tulio Cesar de Lima; Tristan, Rodrigo Lourenço; Buso, Gláucia Salles Cortopassi; Buso, José Amauri; Ferreira, Márcio Elias


    Background Despite the great advances in genomic technology observed in several crop species, the availability of molecular tools such as microsatellite markers has been limited in melon (Cucumis melo L.) and cucurbit species. The development of microsatellite markers will have a major impact on genetic analysis and breeding of melon, especially on the generation of marker saturated genetic maps and implementation of marker assisted breeding programs. Genomic microsatellite enriched libraries can be an efficient alternative for marker development in such species. Results Seven hundred clones containing microsatellite sequences from a Tsp-AG/TC microsatellite enriched library were identified and one-hundred and forty-four primer pairs designed and synthesized. When 67 microsatellite markers were tested on a panel of melon and other cucurbit accessions, 65 revealed DNA polymorphisms among the melon accessions. For some cucurbit species, such as Cucumis sativus, up to 50% of the melon microsatellite markers could be readily used for DNA polymophism assessment, representing a significant reduction of marker development costs. A random sample of 25 microsatellite markers was extracted from the new microsatellite marker set and characterized on 40 accessions of melon, generating an allelic frequency database for the species. The average expected heterozygosity was 0.52, varying from 0.45 to 0.70, indicating that a small set of selected markers should be sufficient to solve questions regarding genotype identity and variety protection. Genetic distances based on microsatellite polymorphism were congruent with data obtained from RAPD marker analysis. Mapping analysis was initiated with 55 newly developed markers and most primers showed segregation according to Mendelian expectations. Linkage analysis detected linkage between 56% of the markers, distributed in nine linkage groups. Conclusions Genomic library microsatellite enrichment is an efficient procedure for marker


    EPA Science Inventory

    Herbicide drift (unintentional physical movement from target to off-target plants) is a cause of crop loss in US. Low-dose, high-potency herbicides that have short environmental persistence times constrain efforts to develop or identify metabolite or biochemical markers of exposu...

  9. Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh

    PubMed Central


    Background Pigeonpea [Cajanus cajan (L.) Millspaugh], one of the most important food legumes of semi-arid tropical and subtropical regions, has limited genomic resources, particularly expressed sequence based (genic) markers. We report a comprehensive set of validated genic simple sequence repeat (SSR) markers using deep transcriptome sequencing, and its application in genetic diversity analysis and mapping. Results In this study, 43,324 transcriptome shotgun assembly unigene contigs were assembled from 1.696 million 454 GS-FLX sequence reads of separate pooled cDNA libraries prepared from leaf, root, stem and immature seed of two pigeonpea varieties, Asha and UPAS 120. A total of 3,771 genic-SSR loci, excluding homopolymeric and compound repeats, were identified; of which 2,877 PCR primer pairs were designed for marker development. Dinucleotide was the most common repeat motif with a frequency of 60.41%, followed by tri- (34.52%), hexa- (2.62%), tetra- (1.67%) and pentanucleotide (0.76%) repeat motifs. Primers were synthesized and tested for 772 of these loci with repeat lengths of ≥18 bp. Of these, 550 markers were validated for consistent amplification in eight diverse pigeonpea varieties; 71 were found to be polymorphic on agarose gel electrophoresis. Genetic diversity analysis was done on 22 pigeonpea varieties and eight wild species using 20 highly polymorphic genic-SSR markers. The number of alleles at these loci ranged from 4-10 and the polymorphism information content values ranged from 0.46 to 0.72. Neighbor-joining dendrogram showed distinct separation of the different groups of pigeonpea cultivars and wild species. Deep transcriptome sequencing of the two parental lines helped in silico identification of polymorphic genic-SSR loci to facilitate the rapid development of an intra-species reference genetic map, a subset of which was validated for expected allelic segregation in the reference mapping population. Conclusion We developed 550 validated genic

  10. Isolation and development of microsatellite markers for the Japanese dormouse, Glirulus japonicus.


    Yasuda, S P; Nakayama, A A; Iwabuchi, M; Minato, S; Tsuchiya, K; Suzuki, H


    Eight microsatellite markers were developed for the Japanese dormouse (Glirulus japonicus), a natural monument and near-threatened species in Japan. The markers amplify in individuals from all of the mitochondrial lineages detected in a previous study. Numerous polymorphisms were detected in specimens from a local population in central Honshu (11-21 alleles per locus; n = 31) and from the entire distribution range of the species (19-41 alleles per locus; n = 152). These microsatellites will be useful in conservation genetic studies of G. japonicus.

  11. SNP Discovery with EST and NextGen Sequencing in Switchgrass (Panicum virgatum L.)

    PubMed Central

    Ersoz, Elhan S.; Wright, Mark H.; Pangilinan, Jasmyn L.; Sheehan, Moira J.; Tobias, Christian; Casler, Michael D.; Buckler, Edward S.; Costich, Denise E.


    Although yield trials for switchgrass (Panicum virgatum L.), a potentially high value biofuel feedstock crop, are currently underway throughout North America, the genetic tools for crop improvement in this species are still in the early stages of development. Identification of high-density molecular markers, such as single nucleotide polymorphisms (SNPs), that are amenable to high-throughput genotyping approaches, is the first step in a quantitative genetics study of this model biofuel crop species. We generated and sequenced expressed sequence tag (EST) libraries from thirteen diverse switchgrass cultivars representing both upland and lowland ecotypes, as well as tetraploid and octoploid genomes. We followed this with reduced genomic library preparation and massively parallel sequencing of the same samples using the Illumina Genome Analyzer technology platform. EST libraries were used to generate unigene clusters and establish a gene-space reference sequence, thus providing a framework for assembly of the short sequence reads. SNPs were identified utilizing these scaffolds. We used a custom software program for alignment and SNP detection and identified over 149,000 SNPs across the 13 short-read sequencing libraries (SRSLs). Approximately 25,000 additional SNPs were identified from the entire EST collection available for the species. This sequencing effort generated data that are suitable for marker development and for estimation of population genetic parameters, such as nucleotide diversity and linkage disequilibrium. Based on these data, we assessed the feasibility of genome wide association mapping and genomic selection applications in switchgrass. Overall, the SNP markers discovered in this study will help facilitate quantitative genetics experiments and greatly enhance breeding efforts that target improvement of key biofuel traits and development of new switchgrass cultivars. PMID:23049744

  12. Development of retrotransposon-based markers IRAP and REMAP for cassava (Manihot esculenta).


    Kuhn, B C; Mangolin, C A; Souto, E R; Vicient, C M; Machado, M F P S


    Retrotransposons are abundant in the genomes of plants. In the present study, inter-retrotransposon amplified polymorphism (IRAP) and retrotransposon-microsatellite amplified polymorphism (REMAP) markers were developed for the cassava genome (Manihot esculenta Crantz). Four cassava cultivars (Fécula Branca, IPR-União, Olho Junto, and Tamboara, two samples per cultivar) were used to obtain IRAP and REMAP fingerprints. Twelve designed primers were amplified alone and in combinations. The 42 IRAP/REMAP primer combinations amplified 431 DNA segments (bands; markers) of which 36 (8.36%) were polymorphic. The largest number of informative markers (16) was detected using the primers AYF2 and AYF2xAYF4. The number of bands for each primer varied from 3 to 16, with an average of 10.26 amplified segments per primer. The size of the amplified products ranged between 100 and 7000 bp. The AYF2 primer generated the highest number of amplified segments and showed the highest number of polymorphic bands (68.75%). Two samples of each cassava cultivar were used to illustrate the usefulness and the polymorphism of IRAP/REMAP markers. IRAP and REMAP markers produced a high number of reproducible bands, and might be informative and reliable for investigation of genetic diversity and relationships among cassava cultivars. PMID:27173210

  13. Development of retrotransposon-based markers IRAP and REMAP for cassava (Manihot esculenta).


    Kuhn, B C; Mangolin, C A; Souto, E R; Vicient, C M; Machado, M F P S


    Retrotransposons are abundant in the genomes of plants. In the present study, inter-retrotransposon amplified polymorphism (IRAP) and retrotransposon-microsatellite amplified polymorphism (REMAP) markers were developed for the cassava genome (Manihot esculenta Crantz). Four cassava cultivars (Fécula Branca, IPR-União, Olho Junto, and Tamboara, two samples per cultivar) were used to obtain IRAP and REMAP fingerprints. Twelve designed primers were amplified alone and in combinations. The 42 IRAP/REMAP primer combinations amplified 431 DNA segments (bands; markers) of which 36 (8.36%) were polymorphic. The largest number of informative markers (16) was detected using the primers AYF2 and AYF2xAYF4. The number of bands for each primer varied from 3 to 16, with an average of 10.26 amplified segments per primer. The size of the amplified products ranged between 100 and 7000 bp. The AYF2 primer generated the highest number of amplified segments and showed the highest number of polymorphic bands (68.75%). Two samples of each cassava cultivar were used to illustrate the usefulness and the polymorphism of IRAP/REMAP markers. IRAP and REMAP markers produced a high number of reproducible bands, and might be informative and reliable for investigation of genetic diversity and relationships among cassava cultivars.

  14. Development of EST-SSR and TRAP markers from transcriptome sequencing data of the mango.


    Luo, C; Wu, H X; Yao, Q S; Wang, S B; Xu, W T


    Mango is one of the most commercially important fruit crops in tropical and subtropical regions. To increase the efficiency of breeding strategies, two EST-derived marker systems were developed in the present study using information from the mango fruit transcriptome. Using simple sequence repeats, 218 of 230 primer pairs showed stable amplification for 7 mango genotypes with amplicons ranging from 84 to 160 bp; 93 of the primer pairs yielded polymorphic products. The proportion of polymorphic bands ranged from 16.67 to 100%, with a mean of 55.64%. In contrast, 86 primer pairs exhibited good amplification with clear bands for target region amplification polymorphism analysis, and a total of 66 primer combinations were polymorphic. These two novel sets of EST-derived markers will be of use in future studies of genetic diversity, genetic map construction, and marker-assisted selection in mango. PMID:26214472

  15. [Development of new SSR markers from EST of SSH cDNA libraries on rose fragrance].


    Yan, Hui-Jun; Zhang, Hao; Xie, Ji-Rong; Li, Shu-Fa; Jian, Hong-Ying; Qiu, Xian-Qin; Wang, Qi-Gang; Wang, Ji-Hua; Tang, Kai-Xue


    The new SSR markers of rose related fragrance were developed based on the SSH cDNA libraries of rose floral scent mutant. In this study, 10 EST-SSRs (2.6%) from 391 ESTs in the libraries were identified. Six EST-SSRs primers were designed to sequence flanking SSRs. The primer pairs designed were screened on the wild-type Jinyindao, which has flowers full of pleasant scent, and the mutant-type Wangriqinghuai without perceivable floral scent. Five primer pairs were amplified effectively in Jinyindao and Wangriqinghuai, and 3 were polymorphic between Jinyindao and Wangriqinghuai. Eighteen rose cultivars including fragrant roses and nonfragrant roses were identified by the five prime pairs. These results proved that EST-SSR markers are effective markers to identify the polymorphism of the rose.

  16. Development of a Ribosomal DNA ITS2 Marker for the Identification of the Thrips, Scirtothrips dorsalis

    PubMed Central

    Farris, R E; Ruiz-Arce, R; Ciomperlik, M; Vasquez, J D; DeLeón, R


    The thrips Scirtothrips dorsalis Hood (Thysanoptera: Thripidae) is an invasive pest that poses a significant economical threat to U.S. agriculture and trade. In this study, DNA sequence data and polymerase chain reaction (PCR) were utilized to develop a molecular diagnostic marker for S. dorsalis. The DNA sequence variation from the internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA (rDNA) was analyzed from various thrips species, including S. dorsalis. A primer set and polymerase chain reaction cycling parameters were designed for the amplification of a single marker fragment of S. dorsalis ITS2 rDNA. Specificity tests performed on ten thrips species, efficacy tests performed on fifteen S. dorsalis populations, and tests on primer sensitivity and robustness all demonstrated the diagnostic utility of this marker. This diagnostic PCR assay provides a quick, simple, and reliable molecular technique to be used in the identification of S. dorsalis. PMID:20578948

  17. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.


    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma


    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants.

  18. Development of EST-SSR and TRAP markers from transcriptome sequencing data of the mango.


    Luo, C; Wu, H X; Yao, Q S; Wang, S B; Xu, W T


    Mango is one of the most commercially important fruit crops in tropical and subtropical regions. To increase the efficiency of breeding strategies, two EST-derived marker systems were developed in the present study using information from the mango fruit transcriptome. Using simple sequence repeats, 218 of 230 primer pairs showed stable amplification for 7 mango genotypes with amplicons ranging from 84 to 160 bp; 93 of the primer pairs yielded polymorphic products. The proportion of polymorphic bands ranged from 16.67 to 100%, with a mean of 55.64%. In contrast, 86 primer pairs exhibited good amplification with clear bands for target region amplification polymorphism analysis, and a total of 66 primer combinations were polymorphic. These two novel sets of EST-derived markers will be of use in future studies of genetic diversity, genetic map construction, and marker-assisted selection in mango.

  19. The somatic marker theory in the context of addiction: contributions to understanding development and maintenance

    PubMed Central

    Olsen, Vegard V; Lugo, Ricardo G; Sütterlin, Stefan


    Recent theoretical accounts of addiction have acknowledged that addiction to substances and behaviors share inherent similarities (eg, insensitivity to future consequences and self-regulatory deficits). This recognition is corroborated by inquiries into the neurobiological correlates of addiction, which has indicated that different manifestations of addictive pathology share common neural mechanisms. This review of the literature will explore the feasibility of the somatic marker hypothesis as a unifying explanatory framework of the decision-making deficits that are believed to be involved in addiction development and maintenance. The somatic marker hypothesis provides a neuroanatomical and cognitive framework of decision making, which posits that decisional processes are biased toward long-term prospects by emotional marker signals engendered by a neuronal architecture comprising both cortical and subcortical circuits. Addicts display markedly impulsive and compulsive behavioral patterns that might be understood as manifestations of decision-making processes that fail to take into account the long-term consequences of actions. Evidence demonstrates that substance dependence, pathological gambling, and Internet addiction are characterized by structural and functional abnormalities in neural regions, as outlined by the somatic marker hypothesis. Furthermore, both substance dependents and behavioral addicts show similar impairments on a measure of decision making that is sensitive to somatic marker functioning. The decision-making deficits that characterize addiction might exist a priori to addiction development; however, they may be worsened by ingestion of substances with neurotoxic properties. It is concluded that the somatic marker model of addiction contributes a plausible account of the underlying neurobiology of decision-making deficits in addictive disorders that is supported by the current neuroimaging and behavioral evidence. Implications for future

  20. Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers.


    Hayden, M J; Sharp, P J


    We describe a technique, sequence-tagged microsatellite profiling (STMP), to rapidly generate large numbers of simple sequence repeat (SSR) markers from genomic or cDNA. This technique eliminates the need for library screening to identify SSR-containing clones and provides an approximately 25-fold increase in sequencing throughput compared to traditional methods. STMP generates short but characteristic nucleotide sequence tags for fragments that are present within a pool of SSR amplicons. These tags are then ligated together to form concatemers for cloning and sequencing. The analysis of thousands of tags gives rise to a representational profile of the abundance and frequency of SSRs within the DNA pool, from which low copy sequences can be identified. As each tag contains sufficient nucleotide sequence for primer design, their conversion into PCR primers allows the amplification of corresponding full-length fragments from the pool of SSR amplicons. These fragments permit the full characterisation of a SSR locus and provide flanking sequence for the development of a microsatellite marker. Alternatively, sequence tag primers can be used to directly amplify corresponding SSR loci from genomic DNA, thereby reducing the cost of developing a microsatellite marker to the synthesis of just one sequence-specific primer. We demonstrate the utility of STMP by the development of SSR markers in bread wheat. PMID:11292857

  1. Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers

    PubMed Central

    Hayden, M. J.; Sharp, P. J.


    We describe a technique, sequence-tagged microsatellite profiling (STMP), to rapidly generate large numbers of simple sequence repeat (SSR) markers from genomic or cDNA. This technique eliminates the need for library screening to identify SSR-containing clones and provides an ∼25-fold increase in sequencing throughput compared to traditional methods. STMP generates short but characteristic nucleotide sequence tags for fragments that are present within a pool of SSR amplicons. These tags are then ligated together to form concatemers for cloning and sequencing. The analysis of thousands of tags gives rise to a representational profile of the abundance and frequency of SSRs within the DNA pool, from which low copy sequences can be identified. As each tag contains sufficient nucleotide sequence for primer design, their conversion into PCR primers allows the amplification of corresponding full-length fragments from the pool of SSR amplicons. These fragments permit the full characterisation of a SSR locus and provide flanking sequence for the development of a microsatellite marker. Alternatively, sequence tag primers can be used to directly amplify corresponding SSR loci from genomic DNA, thereby reducing the cost of developing a microsatellite marker to the synthesis of just one sequence-specific primer. We demonstrate the utility of STMP by the development of SSR markers in bread wheat. PMID:11292857

  2. Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae)

    PubMed Central


    Background Amorphophallus is a genus of perennial plants widely distributed in the tropics or subtropics of West Africa and South Asia. Its corms contain a high level of water-soluble glucomannan; therefore, it has long been used as a medicinal herb and food source. Genetic studies of Amorphophallus have been hindered by a lack of genetic markers. A large number of molecular markers are required for genetic diversity study and improving disease resistance in Amorphophallus. Here, we report large scale of transcriptome sequencing of two species: Amorphophallus konjac and Amorphophallus bulbifer using deep sequencing technology, and microsatellite (SSR) markers were identified based on these transcriptome sequences. Results cDNAs of A. konjac and A. bulbifer were sequenced using Illumina HiSeq™ 2000 sequencing technology. A total of 135,822 non-redundant unigenes were assembled from about 9.66 gigabases, and 19,596 SSRs were identified in 16,027 non-redundant unigenes. Di-nucleotide SSRs were the most abundant motif (61.6%), followed by tri- (30.3%), tetra- (5.6%), penta- (1.5%), and hexa-nucleotides (1%) repeats. The top di- and tri-nucleotide repeat motifs included AG/CT (45.2%) and AGG/CCT (7.1%), respectively. A total of 10,754 primer pairs were designed for marker development. Of these, 320 primers were synthesized and used for validation of amplification and assessment of polymorphisms in 25 individual plants. The total of 275 primer pairs yielded PCR amplification products, of which 205 were polymorphic. The number of alleles ranged from 2 to 14 and the polymorphism information content valued ranged from 0.10 to 0.90. Genetic diversity analysis was done using 177 highly polymorphic SSR markers. A phenogram based on Jaccard’s similarity coefficients was constructed, which showed a distinct cluster of 25 Amorphophallus individuals. Conclusion A total of 10,754 SSR markers have been identified in Amorphophallus using transcriptome sequencing. One hundred and

  3. Development of chloroplast microsatellite markers for the endangered Maianthemum bicolor (Asparagaceae s.l.)1

    PubMed Central

    Park, Hana; Kim, Changkyun; Lee, You-Mi; Kim, Joo-Hwan


    Premise of the study: Ten polymorphic chloroplast microsatellite (cpSSR) markers were developed and characterized in an endemic and endangered herb, Maianthemum bicolor (Asparagaceae s.l.), for use in conservation genetics. Methods and Results: Primer sets flanking each of the 10 cpSSR loci in noncoding regions of the chloroplast genome of M. bicolor were designed. These cpSSR markers were tested on a total of 33 adult individuals from three natural populations in South Korea. The number of alleles per locus ranged from two to three. The unbiased haplotype diversity per locus ranged from 0.061 to 0.682. All markers were successfully transferred to the congeneric species M. japonicum, M. bifolium, and M. dilatatum with polymorphisms among the species. Conclusions: The developed cpSSR markers will be useful in assessing the genetic diversity and population structure of M. bicolor and will help to infer its molecular identification, thereby providing a basis for conservation. PMID:27610276

  4. Development of polymorphic microsatellite markers issued from pyrosequencing technology for the medicinal mushroom Agaricus subrufescens.


    Foulongne-Oriol, Marie; Spataro, Cathy; Moinard, Magalie; Cabannes, Delphine; Callac, Philippe; Savoie, Jean-Michel


    The recently described procedure of microsatellite-enriched library pyrosequencing was used to isolate microsatellite loci in the gourmet and medicinal mushroom Agaricus subrufescens. Three hundred and five candidate loci containing at least one simple sequence repeats (SSR) locus and for which primers design was successful, were obtained. From a subset of 95 loci, 35 operational and polymorphic SSR markers were developed and characterized on a sample of 14 A. subrufescens genotypes from diverse origins. These SubSSR markers each displayed from two to 10 alleles with an average of 4.66 alleles per locus. The observed heterozygosity ranged from 0 to 0.71. Several multiplex combinations can be set up, making it possible to genotype up to six markers easily and simultaneously. Cross-amplification in some closely congeneric species was successful for a subset of loci. The 35 microsatellite markers developed here provide a highly valuable molecular tool to study genetic diversity and reproductive biology of A. subrufescens.

  5. Development of genic SSR markers from transcriptome sequencing of pear buds.


    Yue, Xiao-yan; Liu, Guo-qin; Zong, Yu; Teng, Yuan-wen; Cai, Dan-ying


    A total of 8375 genic simple sequence repeat (SSR) loci were discovered from a unigene set assembled from 116282 transcriptomic unigenes in this study. Dinucleotide repeat motifs were the most common with a frequency of 65.11%, followed by trinucleotide (32.81%). A total of 4100 primer pairs were designed from the SSR loci. Of these, 343 primer pairs (repeat length ≥15 bp) were synthesized with an M13 tail and tested for stable amplification and polymorphism in four Pyrus accessions. After the preliminary test, 104 polymorphic genic SSR markers were developed; dinucleotide and trinucleotide repeats represented 97.11% (101) of these. Twenty-eight polymorphic genic SSR markers were selected randomly to further validate genetic diversity among 28 Pyrus accessions. These markers displayed a high level of polymorphism. The number of alleles at these SSR loci ranged from 2 to 17, with a mean of 9.43 alleles per locus, and the polymorphism information content (PIC) values ranged from 0.26 to 0.91. The UPGMA (unweighted pair-group method with arithmetic average) cluster analysis grouped the 28 Pyrus accessions into two groups: Oriental pears and Occidental pears, which are congruent to the traditional taxonomy, demonstrating their effectiveness in analyzing Pyrus phylogenetic relationships, enriching rare Pyrus EST-SSR resources, and confirming the potential value of a pear transcriptome database for the development of new SSR markers.

  6. Development of microsatellite markers in Cratylia mollis and their transferability to C. argentea (Fabaceae)1

    PubMed Central

    López-Roberts, M. Cristina; de Queiroz, Luciano Paganucci; van den Berg, Cássio


    • Premise of the study: This work aimed to develop microsatellite markers for Cratylia mollis as tools to assess its genetic diversity and structure and to evaluate their potential cross-amplification in related species. • Methods and Results: Microsatellite markers were developed using a microsatellite-enriched library and an intersimple sequence repeat library. From a set of 19 markers, 12 microsatellite loci were polymorphic and presented considerable variation in allele number (2–11), expected heterozygosity (0.226–0.883), and polymorphism information content per locus (0.212–0.870). Cross-amplification in C. argentea was successful in 16 loci, 12 of which were polymorphic (2–10 alleles). • Conclusions: The polymorphism of this set of microsatellite markers for C. mollis, as well as their successful cross-amplification in C. intermedia and C. bahiensis and their transferability to C. argentea, supports their use in future comparative studies to understand the mechanism involved in population divergence and speciation in the genus. PMID:25202484

  7. Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.


    Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing


    KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( ).

  8. An integrated approach to gene discovery and marker development in Atlantic cod (Gadus morhua).


    Bowman, Sharen; Hubert, Sophie; Higgins, Brent; Stone, Cynthia; Kimball, Jennifer; Borza, Tudor; Bussey, Jillian Tarrant; Simpson, Gary; Kozera, Catherine; Curtis, Bruce A; Hall, Jennifer R; Hori, Tiago S; Feng, Charles Y; Rise, Marlies; Booman, Marije; Gamperl, A Kurt; Trippel, Edward; Symonds, Jane; Johnson, Stewart C; Rise, Matthew L


    Atlantic cod is a species that has been overexploited by the capture fishery. Programs to domesticate this species are underway in several countries, including Canada, to provide an alternative route for production. Selective breeding programs have been successfully applied in the domestication of other species, with genomics-based approaches used to augment conventional methods of animal production in recent years. Genomics tools, such as gene sequences and sets of variable markers, also have the potential to enhance and accelerate selective breeding programs in aquaculture, and to provide better monitoring tools to ensure that wild cod populations are well managed. We describe the generation of significant genomics resources for Atlantic cod through an integrated genomics/selective breeding approach. These include 158,877 expressed sequence tags (ESTs), a set of annotated putative transcripts and several thousand single nucleotide polymorphism markers that were developed from, and have been shown to be highly variable in, fish enrolled in two selective breeding programs. Our EST collection was generated from various tissues and life cycle stages. In some cases, tissues from which libraries were generated were isolated from fish exposed to stressors, including elevated temperature, or antigen stimulation (bacterial and viral) to enrich for transcripts that are involved in these response pathways. The genomics resources described here support the developing aquaculture industry, enabling the application of molecular markers within selective breeding programs. Marker sets should also find widespread application in fisheries management.

  9. Design and characterization of a 52K SNP chip for goats.


    Tosser-Klopp, Gwenola; Bardou, Philippe; Bouchez, Olivier; Cabau, Cédric; Crooijmans, Richard; Dong, Yang; Donnadieu-Tonon, Cécile; Eggen, André; Heuven, Henri C M; Jamli, Saadiah; Jiken, Abdullah Johari; Klopp, Christophe; Lawley, Cynthia T; McEwan, John; Martin, Patrice; Moreno, Carole R; Mulsant, Philippe; Nabihoudine, Ibouniyamine; Pailhoux, Eric; Palhière, Isabelle; Rupp, Rachel; Sarry, Julien; Sayre, Brian L; Tircazes, Aurélie; Jun Wang; Wang, Wen; Zhang, Wenguang


    The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a 50-60,000 SNP chip for goats. The success of a moderate density SNP assay depends on reliable bioinformatic SNP detection procedures, the technological success rate of the SNP design, even spacing of SNPs on the genome and selection of Minor Allele Frequencies (MAF) suitable to use in diverse breeds. Through the federation of three SNP discovery projects consolidated as the International Goat Genome Consortium, we have identified approximately twelve million high quality SNP variants in the goat genome stored in a database together with their biological and technical characteristics. These SNPs were identified within and between six breeds (meat, milk and mixed): Alpine, Boer, Creole, Katjang, Saanen and Savanna, comprising a total of 97 animals. Whole genome and Reduced Representation Library sequences were aligned on >10 kb scaffolds of the de novo goat genome assembly. The 60,000 selected SNPs, evenly spaced on the goat genome, were submitted for oligo manufacturing (Illumina, Inc) and published in dbSNP along with flanking sequences and map position on goat assemblies (i.e. scaffolds and pseudo-chromosomes), sheep genome V2 and cattle UMD3.1 assembly. Ten breeds were then used to validate the SNP content and 52,295 loci could be successfully genotyped and used to generate a final cluster file. The combined strategy of using mainly whole genome Next Generation Sequencing and mapping on a contig genome assembly, complemented with Illumina design tools proved to be efficient in producing this GoatSNP50 chip. Advances in use of molecular markers are expected to accelerate goat genomic studies in coming years.

  10. Development and preliminary evaluation of a 90K Axiom® SNP array for the allo-octoploid cultivated strawberry Fragaria ×ananassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high-throughput genotyping platform is needed to enable marker-assisted breeding in the allo-octoploid cultivated strawberry Fragaria ×ananassa. Short-read sequences from one diploid and 19 octoploid accessions were aligned to the diploid Fragaria vesca ‘Hawaii 4’ reference genome to identify sing...

  11. Development of a 63K SNP array for Gossypium and high-density mapping of intra- and inter-specific populations of cotton (G. hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput genotyping arrays provide a standardized resource for crop research communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), candidate marker and quantitative trait loci (QTL) ide...

  12. Genic Microsatellite Markers in Brassica rapa: Development, Characterization, Mapping, and Their Utility in Other Cultivated and Wild Brassica Relatives

    PubMed Central

    Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo


    Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species. PMID:21768136

  13. Genic microsatellite markers in Brassica rapa: development, characterization, mapping, and their utility in other cultivated and wild Brassica relatives.


    Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo


    Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species.

  14. Sequence-based marker development in wheat: advances and applications to breeding.


    Paux, Etienne; Sourdille, Pierre; Mackay, Ian; Feuillet, Catherine


    In the past two decades, the wheat community has made remarkable progress in developing molecular resources for breeding. A wide variety of molecular tools has been established to accelerate genetic and physical mapping for facilitating the efficient identification of molecular markers linked to genes and QTL of agronomic interest. Already, wheat breeders are benefiting from a wide range of techniques to follow the introgression of the most favorable alleles in elite material and develop improved varieties. Breeders soon will be able to take advantage of new technological developments based on Next Generation Sequencing. In this paper, we review the molecular toolbox available to wheat scientists and breeders for performing fundamental genomic studies and breeding. Special emphasis is given on the production and detection of single nucleotide polymorphisms (SNPs) that should enable a step change in saturating the wheat genome for more efficient genetic studies and for the development of new selection methods. The perspectives offered by the access to an ordered full genome sequence for further marker development and enhanced precision breeding is also discussed. Finally, we discuss the advantages and limitations of marker-assisted selection for supporting wheat improvement.

  15. Development of SSR Markers Linked to Low Hydrocyanic Acid Content in Sorghum-Sudan Grass Hybrid Based on BSA Method.


    Xiao-Xia, Yu; Zhi-Hua, Liu; Zhuo, Yu; Yue, Shi; Xiao-Yu, Li


    Sorghum-Sudan grass hybrid containing high hydrocyanic acid content can cause hydrocyanic acid poisoning to the livestock and limit the popularization of this forage crop. Molecular markers associated with low hydrocyanic acid content can speed up the process of identification of genotypes with low hydrocyanic acid content. In the present study, 11 polymorphic SSR primers were screened and used for bulked segregant analysis and single marker analysis. Three SSR markers Xtxp7230, Xtxp7375 and Bnlg667960 associated with low hydrocyanic acid content were rapidly identified by BSA. In single marker analysis, six markers Xtxp7230, Xtxp7375, Bnlg667960, Xtxp67-11, Xtxp295-7 and Xtxp12-9 were linked to low hydrocyanic acid content, which explained the proportion of phenotypic variation from 7.6 % to 41.2 %. The markers identified by BSA were also verified by single marker analysis. The three SSR marker bands were then cloned and sequenced for sequence homology analysis in NCBI. It is the first report on the development of molecular markers associated with low hydrocyanic acid content in sorghum- Sudan grass hybrid. These markers will be useful for genetic improvement of low hydrocyanic acid sorghum-Sudan grass hybrid by marker-assisted breeding. PMID:27001403

  16. Development of SSR Markers Linked to Low Hydrocyanic Acid Content in Sorghum-Sudan Grass Hybrid Based on BSA Method.


    Xiao-Xia, Yu; Zhi-Hua, Liu; Zhuo, Yu; Yue, Shi; Xiao-Yu, Li


    Sorghum-Sudan grass hybrid containing high hydrocyanic acid content can cause hydrocyanic acid poisoning to the livestock and limit the popularization of this forage crop. Molecular markers associated with low hydrocyanic acid content can speed up the process of identification of genotypes with low hydrocyanic acid content. In the present study, 11 polymorphic SSR primers were screened and used for bulked segregant analysis and single marker analysis. Three SSR markers Xtxp7230, Xtxp7375 and Bnlg667960 associated with low hydrocyanic acid content were rapidly identified by BSA. In single marker analysis, six markers Xtxp7230, Xtxp7375, Bnlg667960, Xtxp67-11, Xtxp295-7 and Xtxp12-9 were linked to low hydrocyanic acid content, which explained the proportion of phenotypic variation from 7.6 % to 41.2 %. The markers identified by BSA were also verified by single marker analysis. The three SSR marker bands were then cloned and sequenced for sequence homology analysis in NCBI. It is the first report on the development of molecular markers associated with low hydrocyanic acid content in sorghum- Sudan grass hybrid. These markers will be useful for genetic improvement of low hydrocyanic acid sorghum-Sudan grass hybrid by marker-assisted breeding.

  17. Development and Characterization of Genic SSR Markers from Indian Mulberry Transcriptome and Their Transferability to Related Species of Moraceae

    PubMed Central

    Biradar, Jyoti; Madhuri, T.; N. Nataraja, Karaba; Sreeman, Sheshshayee M.


    Improving mulberry leaf production with enhanced leaf quality holds the key to sustain the ever increasing demand for silk. Adoption of modern genomic approaches for crop improvement is severely constrained by the lack of sufficient molecular markers in mulberry. Here, we report development and validation of 206 EST derived SSR markers using transcriptome data generated from leaf tissue of a drought tolerant mulberry genotype, Dudia white. Analysis of transcriptome data containing 10169 EST sequences, revealed 1469 sequences with microsatellite repeat motifs. We designed a total of 264 primers to the most appropriate repeat regions, of which 206 were locus specific. These markers were validated with 25 diverse mulberry accessions and their transferability to closely related species belonging to family Moraceae was examined. Of these markers, 189 revealed polymorphism with up to 8 allelic forms across mulberry species, genotypes and varieties with a mean of 3.5 alleles per locus. The markers also revealed higher polymorphic information content of 0.824 among the accessions. These markers effectively segregated the species and genotypes and hence, can be used for both diversity analysis and in breeding applications. Around 40% of these markers were transferable to other closely related species. Along with the other genic and genomic markers, we report a set of over 750 co-dominant markers. Using these markers we constructed the first genetic linkage map of mulberry exclusively with co-dominant markers. PMID:27669004

  18. The SNP at −592 of human IL-10 gene is associated with serum IL-10 levels and increased risk for human papillomavirus cervical lesion development

    PubMed Central


    Background Women with Human Papilloma Virus (HPV) persistence are characterized by high levels of IL-10 at cervix. We have determined whether polymorphisms of IL-10 gene promoter might be associated with increased risk of squamous intraepithelial cervical lesions (SICL) and whether exist significative differences of IL-10 mRNA expression at cervix and systemic and serum IL-10 protein between SICL cases and non-Cervical Lesions (NCL). Methods Peripheral blood samples from SICL (n = 204) and NCL (n = 166) were used to detect IL-10 promoter polymorphisms at loci -592A/C (rs1800872), -819C/T (rs1800871), -1082A/G (rs1800896), -1352A/G (rs1800893), by allelic discrimination and to evaluate serum IL-10 protein. Cervical epithelial scrapings from NCL and biopsies from SICLs were used for HPV-typing and to evaluate IL-10 mRNA expression level. The systemic and local IL-10 mRNA expression levels were measured by real time-PCR. Genotypic and allelic frequencies of the selected polymorphisms were analyzed by logistic regression, adjusting by age and HPV-genotype, to determine the association with SICL. Results No significant differences were found between genotype frequencies at loci −819, -1082, and −1352. Individuals carrying at least one copy of risk allele A of polymorphism −592 had a two-fold increased risk of developing SICL [adjusted odds ratio (OR), 2.02 (95% CI, 1.26-3.25), p = 0.003], compared to NCL. The IL-10 mRNA expression and serum IL-10 protein, were significantly higher in SICL cases (p < 0.01), being higher in patients carrying the risk allele A. Conclusions The −592 polymorphism is associated with increased risk of SICL and can serve as a marker of genetic susceptibility to SICL among Mexican women. According to IL-10 levels found in SICL, IL-10 can be relevant factor for viral persistence and progression disease. PMID:23148667

  19. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing.


    Wang, Xuewen; Wang, Le


    Simple sequence repeats (SSRs), also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA) integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at PMID:27679641

  20. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing

    PubMed Central

    Wang, Xuewen; Wang, Le


    Simple sequence repeats (SSRs), also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA) integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at PMID:27679641

  1. Expression of Synaptic and Phototransduction Markers During Photoreceptor Development in the Marmoset Monkey Callithrix jacchus

    PubMed Central



    Marmoset photoreceptor development was studied to determine the expression sequence for synaptic, opsin, and phototransduction proteins. All markers appear first in cones within the incipient foveal center or in rods at the foveal edge. Recoverin appears in cones across 70% of the retina at fetal day (Fd) 88, indicating that it is expressed shortly after photoreceptors are generated. Synaptic markers synaptophysin, SV2, glutamate vesicular transporter 1, and CTBP2 label foveal cones at Fd 88 and cones at the retinal edge around birth. Cones and rods have distinctly different patterns of synaptic protein and opsin expression. Synaptic markers are expressed first in cones, with a considerable delay before they appear in rods at the same eccentricity. Cones express synaptic markers 2–3 weeks before they express opsin, but rods express opsin 2–4 weeks before rod synaptic marker labeling is detected. Medium/long-wavelength-selective (M&L) opsin appears in foveal cones and rod opsin in rods around the fovea at Fd 100. Very few cones expressing short-wavelength-selective (S) opsin are found in the Fd 105 fovea. Across peripheral retina, opsin appears first in rods, followed about 1 week later by M&L cone opsin. S cone opsin appears last, and all opsins reach the retinal edge by 1 week after birth. Cone transducin and rod arrestin are expressed concurrently with opsin, but cone arrestin appears slightly later. Marmoset photoreceptor development differs from that in Macaca and humans. It starts relatively late, at 56% gestation, compared with Macaca at 32% gestation. The marmoset opsin expression sequence is also different from that of either Macaca or human. PMID:19003975



    Sekan, A S; Isaenkov, S V; Blume, Ya B


    To produce transgenic plants in current biotechnology selectable marker genes are used that lead to the selectivity.of transformants from non-transformed organisms. However, after the transgenic event has been occurred, the presence of these genes in transformed genome in general is uselless. Moreover, the continued presence of this kind of genes in transgenic plants with their further commercialization may raise certain public concern. Therefore, various techniques have been developed in recent years to obtain marker free transgenic plants. In the present review the main strategies for removal of selective marker DNA sequences that are used in genetic engineering are described. The most popular among them is site-specific recombination technology. The particular attention is paid to site-specific recombinase system Cre/loxP. The using of a new approach with site-specific recombinase system Cre/loxP under the control of 35S promoter to generate marker-free genetically modified plants is described. PMID:26841495

  3. Development of polymorphic SSR markers in the razor clam (Sinonovacula constricta) and cross-species amplification.


    Dong, Y H; Yao, H H; Sun, C S; Lv, D M; Li, M Q; Lin, Z H


    Next-generation sequencing provides large-scale sequencing data with relative ease and at a reasonable cost, making it possible to identify a large amount of SSR markers in a timely and cost-effective manner. On the basis of the transcriptome database of Sinonovacula constricta obtained by Illumina/Solexa pyrosequencing, 60 polymorphic SSR markers were developed and characterized in 30 individuals. The number of alleles per polymorphic locus ranged from 2 to 7 with an average of 3.75 alleles. The observed and expected heterozygosities varied from 0.050 to 1.000 and from 0.050 to 0.836, respectively. Nineteen loci significantly deviated from Hardy-Weinberg equilibrium (P < 0.01) after Bonferroni's correction for multiple tests. In addition, interspecific transferability revealed that 20 polymorphic loci in Solen linearis were first characterized in this study. To the best of our knowledge, this is the highest number of SSRs in S. constricta and the first report of cross-species amplification. These novel polymorphic SSR markers will be particularly useful for conservation genetics, evolutionary studies, genetic trait mapping, and marker assisted selection in the species. PMID:26909924

  4. Bulk development and stringent selection of microsatellite markers in the western flower thrips Frankliniella occidentalis

    PubMed Central

    Cao, Li-Jun; Li, Ze-Min; Wang, Ze-Hua; Zhu, Liang; Gong, Ya-Jun; Chen, Min; Wei, Shu-Jun


    Recent improvements in next-generation sequencing technologies have enabled investigation of microsatellites on a genome-wide scale. Faced with a huge amount of candidates, the use of appropriate marker selection criteria is crucial. Here, we used the western flower thrips Frankliniella occidentalis for an empirical microsatellite survey and validation; 132,251 candidate microsatellites were identified, 92,102 of which were perfect. Dinucleotides were the most abundant category, while (AG)n was the most abundant motif. Sixty primer pairs were designed and validated in two natural populations, of which 30 loci were polymorphic, stable, and repeatable, but not all in Hardy–Weinberg equilibrium (HWE) and linkage equilibrium. Four marker panels were constructed to understand effect of marker selection on population genetic analyses: (i) only accept loci with single nucleotide insertions (SNI); (ii) only accept the most polymorphic loci (MP); (iii) only accept loci that did not deviate from HWE, did not show SNIs, and had unambiguous peaks (SS) and (iv) all developed markers (ALL). Although the MP panel resulted in microsatellites of highest genetic diversity followed by the SNI, the SS performed best in individual assignment. Our study proposes stringent criteria for selection of microsatellites from a large-scale number of genomic candidates for population genetic studies. PMID:27197749

  5. Leaf transcriptome analysis and development of SSR markers in water chestnut (Eleocharis dulcis).


    Liu, H B; You, Y N; Zhu, Z X; Zheng, X F; Huang, J B; Hu, Z L; Diao, Y


    Water chestnut (Eleocharis dulcis) is an important aquatic crop in China; however, transcriptomic and genomic data in public databases are limited. To identify genes and development molecular markers, high-throughput transcriptome sequencing was applied to generate transcript sequences from water chestnut leaf. More than 24 million reads were obtained, trimmed, and assembled into 40,796 contigs with an average length of 616.6 bp. Sequence similarity analyses against 4 public databases (NR, GO, KEGG, KOG) revealed 17,628 contigs that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Among the important metabolic pathways, 27 genes were related to starch synthesis and 13 genes were in the steroid synthetic pathway. In addition, 2570 cDNA simple sequence repeats were identified as potential molecular markers in our contigs. One hundred pairs of polymerase chain reaction primers were designed and used for validation of the amplification. The results revealed that 87 primer pairs were successfully amplified in initial screening tests. Overall, this transcriptome dataset and these markers can serve as a platform for further gene expression studies, functional genomic studies, and marker-assisted selection in E. dulcis. PMID:26345758

  6. Development of polymorphic SSR markers in the razor clam (Sinonovacula constricta) and cross-species amplification.


    Dong, Y H; Yao, H H; Sun, C S; Lv, D M; Li, M Q; Lin, Z H


    Next-generation sequencing provides large-scale sequencing data with relative ease and at a reasonable cost, making it possible to identify a large amount of SSR markers in a timely and cost-effective manner. On the basis of the transcriptome database of Sinonovacula constricta obtained by Illumina/Solexa pyrosequencing, 60 polymorphic SSR markers were developed and characterized in 30 individuals. The number of alleles per polymorphic locus ranged from 2 to 7 with an average of 3.75 alleles. The observed and expected heterozygosities varied from 0.050 to 1.000 and from 0.050 to 0.836, respectively. Nineteen loci significantly deviated from Hardy-Weinberg equilibrium (P < 0.01) after Bonferroni's correction for multiple tests. In addition, interspecific transferability revealed that 20 polymorphic loci in Solen linearis were first characterized in this study. To the best of our knowledge, this is the highest number of SSRs in S. constricta and the first report of cross-species amplification. These novel polymorphic SSR markers will be particularly useful for conservation genetics, evolutionary studies, genetic trait mapping, and marker assisted selection in the species.

  7. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat.


    Aggarwal, R; Gupta, S; Banerjee, S; Singh, V B


    Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

  8. Identification of a Pi9-Containing Rice Germplasm with a Newly Developed Robust Marker.


    Scheuermann, Klaus Konrad; Jia, Yulin


    The Pi9 gene in rice, originating from Oryza minuta, is an effective resistance gene for controlling rice blast disease. However, currently available linked DNA markers do not accurately identify the function of Pi9, thus hindering its efficient incorporation into new cultivars through marker-assisted selection (MAS). In addition, no known Pi9-containing rice germplasm is available to breeders. In the present study, DNA sequence variation of Pi9 alleles and their family members was analyzed in 40 diverse rice germplasm accessions from the AA genome to develop a robust Pi9 marker. In total, 29 DNA primers of 20 to 23 nucleotides were designed and each possible combination of primer pairs was used to detect Pi9. Only one combination of DNA primers, KS28/KS6, was identified to specifically detect Pi9 in the monogenic line IRBL9-W. The presence of Pi9 was verified with the predicted Pi9-specific blast reaction. Subsequently, 201 genetically diverse mini-core rice accessions from 114 countries were screened with KS28/KS6. One germplasm, IR 9660-48-1-1-2, was identified to carry Pi9 and the function of Pi9 was verified with pathogenicity assays. This robust Pi9 marker and a rice germplasm, IR9660-48-1-1-2 (GSOR310687), carrying Pi9 can be used to improve blast resistance with a MAS approach. PMID:27050577

  9. Message development for surface markers at the Hanford Radwaste Disposal sites

    SciTech Connect

    Kaplan, M.F.


    At the Hanford Reservation in Washington, there are sites which received liquid and solid transuranic wastes from the late 1940`s until 1970. Rockwell Hanford Operations (Rockwell) is investigating the feasibility of several options for the permanent disposal of these wastes. One option is to stabilize the wastes in their present locations and to add barriers to minimize water infiltration and root penetration into the wastes. This report forms part of the project to develop a marking system for transuranic wastes on the Hanford Reservation. The focus of this report is the development of the message system to appear on the surface markers. A logical framework is developed to deduce what is required by the message system. Alternatives for each message component are evaluated and justification is provided for the choice of each component. The components are then laid out on the surface marker to provide a legible, comprehensible message system. The surface markers are tall, standing monoliths which ring the perimeter of each disposal area. Based on the logical framework, it is recommended that three domains of representation -- symbols, pictures, and language -- be used in the message system. The warning symbol chosen for the message system is the radiation trefoil. Two other options were considered, including the warning symbol developed by the Human Interference Task Force for a high-level waste repository. The trefoil was preferred because of the widespread usage and international acceptance which is already enjoys.

  10. Genome-scale DNA variant analysis and functional validation of a SNP underlying yellow fruit color in wild strawberry

    PubMed Central

    Hawkins, Charles; Caruana, Julie; Schiksnis, Erin; Liu, Zhongchi


    Fragaria vesca is a species of diploid strawberry being developed as a model for the octoploid garden strawberry. This work sequenced and compared the genomes of three F. vesca accessions: ‘Hawaii 4′, ‘Rügen’, and ‘Yellow Wonder’. Genome-scale analyses of shared and distinct SNPs among these three accessions have revealed that ‘Rügen’ and ‘Yellow Wonder’ are more similar to each other than they are to ‘Hawaii 4’. Though all three accessions are inbred seven generations, each accession still possesses extensive heterozygosity, highlighting the inherent differences between individual plants even of the same accession. The identification of the impact of each SNP as well as the large number of Indel markers provides a foundation for locating candidate mutations underlying phenotypic variations among these F. vesca accessions and for mapping new mutations generated through forward genetics screens. Through systematic analysis of SNP variants affecting genes in anthocyanin biosynthesis and regulation, a candidate SNP in FveMYB10 was identified and then functionally confirmed to be responsible for the yellow color fruits made by many F. vesca accessions. As a whole, this study provides further resources for F. vesca and establishes a foundation for linking traits of economic importance to specific genes and variants. PMID:27377763

  11. Genome-scale DNA variant analysis and functional validation of a SNP underlying yellow fruit color in wild strawberry.


    Hawkins, Charles; Caruana, Julie; Schiksnis, Erin; Liu, Zhongchi


    Fragaria vesca is a species of diploid strawberry being developed as a model for the octoploid garden strawberry. This work sequenced and compared the genomes of three F. vesca accessions: 'Hawaii 4', 'Rügen', and 'Yellow Wonder'. Genome-scale analyses of shared and distinct SNPs among these three accessions have revealed that 'Rügen' and 'Yellow Wonder' are more similar to each other than they are to 'Hawaii 4'. Though all three accessions are inbred seven generations, each accession still possesses extensive heterozygosity, highlighting the inherent differences between individual plants even of the same accession. The identification of the impact of each SNP as well as the large number of Indel markers provides a foundation for locating candidate mutations underlying phenotypic variations among these F. vesca accessions and for mapping new mutations generated through forward genetics screens. Through systematic analysis of SNP variants affecting genes in anthocyanin biosynthesis and regulation, a candidate SNP in FveMYB10 was identified and then functionally confirmed to be responsible for the yellow color fruits made by many F. vesca accessions. As a whole, this study provides further resources for F. vesca and establishes a foundation for linking traits of economic importance to specific genes and variants. PMID:27377763

  12. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant.


    Mutlu, Nedim; Boyaci, Filiz Hatice; Göçmen, Münevver; Abak, Kazim


    Fusarium wilt (Fusarium oxysporum Schlecht. f. sp. melongenae) is a vascular disease of eggplant (Solanum melongena L.). The objectives of this work were (1) to confirm the monogenic inheritance of fusarium wilt resistance in eggplant, (2) to identify molecular markers linked to this resistance, and (3) to develop SCAR markers from most informative markers. We report the tagging of the gene for resistance to fusarium wilt (FOM) in eggplant using SRAP, RGA, SRAP-RGA and RAPD markers. Analysis of segregation data confirmed the monogenic inheritance of resistance. DNA from F(2) and BC(1) populations of eggplant segregating for fusarium wilt resistance was screened with 2,316 primer combinations to detect polymorphism. Three markers were linked within 2.6 cM of the gene. The codominant SRAP marker Me8/Em5 and dominant SRAP-RGA marker Em12/GLPL2 were tightly linked to each other and mapped 1.2 cM from the resistance gene, whereas RAPD marker H12 mapped 2.6 cM from the gene and on the same side as the other two markers. The SRAP marker was converted into two dominant SCAR markers that were confirmed to be linked to the resistance gene in the F(2,) BC(1) and F(2) of BC(3) generations of the same cross. These markers provide a starting point for mapping the eggplant FOM resistance gene in eggplant and for exploring the synteny between solanaceous crops for fusarium wilt resistance genes. The SCAR markers will be useful for identifying fusarium wilt-resistant genotypes in marker-assisted selection breeding programs using segregating progenies of the resistant eggplant progenitor used in this study.

  13. RASSF1A and the rs2073498 Cancer Associated SNP

    PubMed Central

    Donninger, Howard; Barnoud, Thibaut; Nelson, Nick; Kassler, Suzanna; Clark, Jennifer; Cummins, Timothy D.; Powell, David W.; Nyante, Sarah; Millikan, Robert C.; Clark, Geoffrey J.


    RASSF1A is one of the most frequently inactivated tumor suppressors yet identified in human cancer. It is pro-apoptotic and appears to function as a scaffolding protein that interacts with a variety of other tumor suppressors to modulate their function. It can also complex with the Ras oncoprotein and may serve to integrate pro-growth and pro-death signaling pathways. A SNP has been identified that is present in approximately 29% of European populations [rs2073498, A(133)S]. Several studies have now presented evidence that this SNP is associated with an enhanced risk of developing breast cancer. We have used a proteomics based approach to identify multiple differences in the pattern of protein/protein interactions mediated by the wild type compared to the SNP variant protein. We have also identified a significant difference in biological activity between wild type and SNP variant protein. However, we have found only a very modest association of the SNP with breast cancer predisposition. PMID:22649770

  14. Isolation and Characterization of 11 Polymorphic Microsatellite Markers Developed for Orthops palus (Heteroptera: Miridae)

    PubMed Central

    Atiama, M.; Delatte, H.; Deguine, J.-P.


    Miridae (Hemiptera: Heteroptera: Cimicomorpha), or plant bugs, are one of the most diverse and species-rich families of insects. Most of them are phytophagous, but some are insect predators and used for biocontrol. Among this family, the mango bug, Orthops palus (Taylor 1947), is one of the most important pest of mango in Reunion Island. We developed 11 polymorphic microsatellite loci to study the population genetics of this pest species. The microsatellite markers were characterized by genotyping 78 field-collected insects sampled at different localities in Reunion Island. The number of alleles per locus ranged from 1 to 13 and heterozygosity levels ranged between 0.40 and 0.94. Several loci were not at Hardy–Weinberg equilibrium for the tested populations. These markers are the first to be developed for a species of the genus Orthops. PMID:26922804

  15. Development of polymorphic microsatellite markers for the Killarney Fern (Vandenboschia speciosa, Hymenophyllaceae)1

    PubMed Central

    García-López, M. del Carmen; Schuler, Samira Ben-Menni; López-Flores, Inmaculada; Nieto-Lugilde, Marta; Terrón-Camero, Laura; Aguilera, Ismael Mazuecos; Suárez-Santiago, Víctor N.


    Premise of the study: We characterize 10 microsatellite loci in the endangered fern Vandenboschia speciosa (Hymenophyllaceae), enabling studies on the genetic population structure of this Macaronesian-European species using DNA hypervariable markers. Methods and Results: Ten primer sets were developed and tested on 47 individuals in a total of two Iberian populations of V. speciosa. The primers amplified di- and hexanucelotide repeats. The number of alleles ranged from two to eight, and the expected heterozygosity ranged from 0.107 to 0.807 among the populations analyzed. Conclusions: The 10 microsatellite markers developed will be useful in characterizing the genetic diversity of V. speciosa and understanding its population structure (including the possible structure between sporophyte and gametophyte phases) and biogeographic history, and will provide important genetic data for the conservation of this species. PMID:26649267

  16. Isolation and Characterization of 11 Polymorphic Microsatellite Markers Developed for Orthops palus (Heteroptera: Miridae).


    Atiama, M; Delatte, H; Deguine, J-P


    Miridae (Hemiptera: Heteroptera: Cimicomorpha), or plant bugs, are one of the most diverse and species-rich families of insects. Most of them are phytophagous, but some are insect predators and used for biocontrol. Among this family, the mango bug, Orthops palus (Taylor 1947), is one of the most important pest of mango in Reunion Island. We developed 11 polymorphic microsatellite loci to study the population genetics of this pest species. The microsatellite markers were characterized by genotyping 78 field-collected insects sampled at different localities in Reunion Island. The number of alleles per locus ranged from 1 to 13 and heterozygosity levels ranged between 0.40 and 0.94. Several loci were not at Hardy-Weinberg equilibrium for the tested populations. These markers are the first to be developed for a species of the genus Orthops. PMID:26922804

  17. Development and characterization of microsatellite markers in the African deciduous tree Terminalia superba (Combretaceae)1

    PubMed Central

    Demenou, Boris B.; Migliore, Jérémy; Tosso, Felicien; Kaymak, Esra; Hardy, Olivier J.


    Premise of the study: Microsatellites were designed and characterized in the African timber forest tree Terminalia superba (Combretaceae). Due to their high variability, these markers are suitable to investigate gene flow patterns and the structure of genetic diversity. Methods and Results: From a genomic library obtained by next-generation sequencing, seven monomorphic and 14 polymorphic microsatellite loci were developed. The polymorphic microsatellites displayed two to 27 alleles (mean 11.4; expected heterozygosity range 0.283–0.940, mean 0.736) in one population from southeastern Cameroon. Genotypes were typical of an outbreeding diploid species, although null alleles explain a significant heterozygote deficit in three loci. Cross-amplification in three congeneric species (T. ivorensis, T. avicennioides, and T. mantaly) failed, suggesting that T. superba is rather divergent. Conclusions: This set of newly developed microsatellite markers will be useful for assessing the genetic diversity, population structure, and demographic history of T. superba in tropical African forests. PMID:26697276

  18. Development and characterization of 15 microsatellite markers for Cephalotaxus fortunei (Cephalotaxaceae)1

    PubMed Central

    Wang, Chunbo; Guo, Zhiyou; Huang, Xilian; Huang, Lu


    Premise of the study: To survey population variation and the adaptive evolution of Cephalotaxus fortunei (Cephalotaxaceae), an endemic and endangered conifer in China, microsatellite markers were developed and characterized for this species. Methods and Results: Based on the Fast Isolation by AFLP of Sequences COntaining repeats (FIASCO) protocol, 15 microsatellite markers were developed for C. fortunei, 13 of which were polymorphic within a sample of 75 individuals representing five natural populations. The number of alleles per locus ranged from one to seven. The expected and observed heterozygosities were 0.108–0.738 and 0.000–1.000, respectively. Ten polymorphic loci were also successfully amplified in C. oliveri. Conclusions: These polymorphic loci provide a valuable tool for population genetic analysis of C. fortunei, which will contribute to its management and conservation. PMID:27213121

  19. SNP Miniplexes for Individual Identification of Random-Bred Domestic Cats.


    Brooks, Ashley; Creighton, Erica K; Gandolfi, Barbara; Khan, Razib; Grahn, Robert A; Lyons, Leslie A


    Phenotypic and genotypic characteristics of the cat can be obtained from single nucleotide polymorphisms (SNPs) analyses of fur. This study developed miniplexes using SNPs with high discriminating power for random-bred domestic cats, focusing on individual and phenotypic identification. Seventy-eight SNPs were investigated using a multiplex PCR followed by a fluorescently labeled single base extension (SBE) technique (SNaPshot(®) ). The SNP miniplexes were evaluated for reliability, reproducibility, sensitivity, species specificity, detection limitations, and assignment accuracy. Six SNPplexes were developed containing 39 intergenic SNPs and 26 phenotypic SNPs, including a sex identification marker, ZFXY. The combined random match probability (cRMP) was 6.58 × 10(-19) across all Western cat populations and the likelihood ratio was 1.52 × 10(18) . These SNPplexes can distinguish individual cats and their phenotypic traits, which could provide insight into crime reconstructions. A SNP database of 237 cats from 13 worldwide populations is now available for forensic applications.

  20. Development of polymorphic microsatellite markers for Dioscorea zingiberensis and cross-amplification in other Dioscorea species.


    Yan, Q-Q; Sun, X-Q; Guo, J-L; Hang, Y-Y; Li, M-M


    Dioscorea zingiberensis C.H. Wright (Dioscoreaceae) is an endemic species in central and southwestern China. In order to study the genetic diversity and population structure of this species, 19 novel polymorphic microsatellite loci were developed using a dual-suppression PCR technique. The number of alleles per locus ranged from 3 to 21, with an average of 9.53. All the markers showed high transferability in cross-species amplification in other species of sect. Stenophora.

  1. MATS; A novel, rapid method for the development of microsatellite markers from YACs

    SciTech Connect

    Chen, H.; Polido, J.; Duyk, G.M.


    The availability of high resolution genetic maps has enabled the rapid mapping of a large number of disease loci. In absence of good candidate genes, the eventual identification of the disease locus requires effective strategies for completing the positional cloning {open_quotes}end game{close_quotes}. An essential element of this exercise is the development of local high resolution genetic maps, enabling the precise localization of the minimal interval containing the targeted gene. In addition, one also requires an accurate clone map of this minimal interval. Currently, clone coverage can be obtained using YACs, but rapid development of new genetic markers or additional STSs for walking or confirmation of clone order is a tedious process. Here we describe the successful application of a novel, rapid and efficient procedure, based on subtractive hybridization and PCR amplification for generating microsatellite markers on non-polymorphic STSs directly from the YACs or other large insert cloning vectors. After a single round of subtraction, the target sequences (YAC) are amplified by PCR and cloned into plasmid vectors. Several key steps have been designed to achieve efficient subtractive hybridization and to obtain preferential amplification of the target sequences. These technical steps include the design of novel adapters, PCR primers, efficient development of small insert libraries and non-radioactive screening methods. For example, using a 600 kb YAC as a target, we developed 14 new microsatellite markers. These new markers greatly facilitated genetic localization of a disease locus and allowed the accurate ordering by STS content mapping of a cloned contig spanning the interval. In addition to the utility of this approach in positional cloning, this strategy may provide an approach for filling gaps in the emerging genetic maps.

  2. Interim report on updated microarray probes for the LLNL Burkholderia pseudomallei SNP array

    SciTech Connect

    Gardner, S; Jaing, C


    The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. We will analyze the microarray genotyping results to characterize the genetic diversity of these new isolates and triage the samples for whole genome sequencing. In this interim report, we described the SNP analysis and the microarray probe design for the Burkholderia SNP microarray.

  3. Development of novel tetra- and trinucleotide microsatellite markers for giant grouper Epinephelus lanceolatus using 454 pyrosequencing.


    Kim, Keun-Sik; Noh, Choong Hwan; Moon, Shin-Joo; Han, Seung-Hee; Bang, In-Chul


    Giant grouper (Epinephelus lanceolatus) is a commercially important species, but its wild population has recently been classified as vulnerable. This species has significant potential for use in aquaculture, though a greater understanding of population genetics is necessary for selective breeding programs to minimize kinship for genetically healthy individuals. High-throughput pyrosequencing of genomic DNA was used to identify and characterize novel tetra- and trinucleotide microsatellite markers in giant grouper from Sabah, Malaysia. In total, of 62,763 sequences containing simple sequence repeats (SSRs) were obtained, and 78 SSR loci were selected to possibly contain tetra- and trinucleotide repeats. Of these loci, 16 had tetra- and 8 had trinucleotide repeats, all of which exhibited polymorphisms within easily genotyped regions. A total of 143 alleles were identified with an average of 5.94 alleles per locus, with mean observed and expected heterozygosities of 0.648 and 0.620, respectively. Among of them, 15 microsatellite markers were identified without null alleles and with Hardy-Weinberg equilibrium. These alleles showed a combined non-exclusion probability of 0.01138. The probability of individual identification (PID) value combined with in descending order 12 microsatellite markers was 0.00008, which strongly suggests that the use of the microsatellite markers developed in this study in various combinations would result in a high resolution method for parentage analysis and individual identification. These markers could be used to establish a broodstock management program for giant grouper and to provide a foundation for genetic studies such as population structure, parentage analysis, and kinship selection. PMID:27059503

  4. Novel and Stress Relevant EST Derived SSR Markers Developed and Validated in Peanut.


    Bosamia, Tejas C; Mishra, Gyan P; Thankappan, Radhakrishnan; Dobaria, Jentilal R


    With the aim to increase the number of functional markers in resource poor crop like cultivated peanut (Arachis hypogaea), large numbers of available expressed sequence tags (ESTs) in the public databases, were employed for the development of novel EST derived simple sequence repeat (SSR) markers. From 16424 unigenes, 2784 (16.95%) SSRs containing unigenes having 3373 SSR motifs were identified. Of these, 2027 (72.81%) sequences were annotated and 4124 gene ontology terms were assigned. Among different SSR motif-classes, tri-nucleotide repeats (33.86%) were the most abundant followed by di-nucleotide repeats (27.51%) while AG/CT (20.7%) and AAG/CTT (13.25%) were the most abundant repeat-motifs. A total of 2456 EST-SSR novel primer pairs were designed, of which 366 unigenes having relevance to various stresses and other functions, were PCR validated using a set of 11 diverse peanut genotypes. Of these, 340 (92.62%) primer pairs yielded clear and scorable PCR products and 39 (10.66%) primer pairs exhibited polymorphisms. Overall, the number of alleles per marker ranged from 1-12 with an average of 3.77 and the PIC ranged from 0.028 to 0.375 with an average of 0.325. The identified EST-SSRs not only enriched the existing molecular markers kitty, but would also facilitate the targeted research in marker-trait association for various stresses, inter-specific studies and genetic diversity analysis in peanut.

  5. The use of recently developed histochemical markers for localizing neurotoxicant induced regional brain pathologies.


    Sarkar, Sumit; Raymick, James; Schmued, Larry C


    Neuronal and vascular brain components are interrelated morphologically, physiologically and developmentally. Due to this close interrelationship, it is often difficult to understand the cause and effect relationship between neuronal vs. vascular dysfunction and pathology. This review will discuss four of the more promising recent developments for detecting vascular pathology, and will compare them with the labeling pattern seen with markers of glial and neuronal pathology; following exposure to well characterized neurotoxicants. To detect the vascular dysfunction in the brain, we recently developed a Fluoro-Turquoise gelatin conjugate (FT-gel), a fluorescent probe that helps to delineate between healthy vs. sclerotic vessels. Similarly, we have investigated the potential for Fluoro-Gold to label in vivo all the endothelial cells in the brain as they co-localize with RECA, an endothelial cell marker. We have also developed Amylo-Glo, a fluorescent tracer that can detect neurotoxic A-beta aggregates in the brain. In this article, we will discuss the potential use of these novel histochemical markers to study the neurotoxicant induced brain. We will also discuss neurovascular strategies that may offer novel therapeutic opportunities for neurodegenerative disorders. PMID:24763333

  6. The use of recently developed histochemical markers for localizing neurotoxicant induced regional brain pathologies.


    Sarkar, Sumit; Raymick, James; Schmued, Larry C


    Neuronal and vascular brain components are interrelated morphologically, physiologically and developmentally. Due to this close interrelationship, it is often difficult to understand the cause and effect relationship between neuronal vs. vascular dysfunction and pathology. This review will discuss four of the more promising recent developments for detecting vascular pathology, and will compare them with the labeling pattern seen with markers of glial and neuronal pathology; following exposure to well characterized neurotoxicants. To detect the vascular dysfunction in the brain, we recently developed a Fluoro-Turquoise gelatin conjugate (FT-gel), a fluorescent probe that helps to delineate between healthy vs. sclerotic vessels. Similarly, we have investigated the potential for Fluoro-Gold to label in vivo all the endothelial cells in the brain as they co-localize with RECA, an endothelial cell marker. We have also developed Amylo-Glo, a fluorescent tracer that can detect neurotoxic A-beta aggregates in the brain. In this article, we will discuss the potential use of these novel histochemical markers to study the neurotoxicant induced brain. We will also discuss neurovascular strategies that may offer novel therapeutic opportunities for neurodegenerative disorders.

  7. Genome-wide characterization of microsatellites and marker development in the carcinogenic liver fluke Clonorchis sinensis.


    Nguyen, Thao T B; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J; Blair, David; Laha, Thewarach; Sripa, Banchob


    Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers that have been used for identification and genetic diversity; however, no information about microsatellites of this liver fluke is published so far. We here report microsatellite characterization and marker development for a genetic diversity study in C. sinensis, using a genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥12 base pairs) were identified from a genome database of C. sinensis, with hexanucleotide motif being the most abundant (51%) followed by pentanucleotide (18.3%) and trinucleotide (12.7%). The tetranucleotide, dinucleotide, and mononucleotide motifs accounted for 9.75, 7.63, and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72% of 547 Mb of the whole genome size, and the frequency of microsatellites was found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri-, and tetranucleotide, the repeat numbers redundant are six (28%), four (45%), and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT, and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and Opisthorchis viverrini. Seven out of 24 loci showed to be heterozygous with observed heterozygosity that ranged from 0.467 to 1. Four primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites, and the genome-wide markers developed may be a useful tool for the genetic study of C. sinensis. PMID:25782682

  8. Genome-wide characterization of microsatelittes and marker development in the carcinogenic liver fluke Clonorchis sinensis

    PubMed Central

    Nguyen, Thao T.B.; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J.; Blair, David; Laha, Thewarach; Sripa, Banchob


    Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers have been used for identification and genetic diversity, however, no information about microsatellites of this liver fluke published so far. We here report microsatellite characterization and marker development for genetic diversity study in C. sinensis using genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥ 12 base pairs) were identified from genome database of C. sinensis with hexa-nucleotide motif being the most abundant (51%) followed by penta-nucleotide (18.3%) and tri-nucleotide (12.7%). The tetra-nucleotide, di-nucleotide and mononucleotide motifs accounted for 9.75 %, 7.63% and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72 % of 547 Mb of the whole genome size and the frequency of microsatellites were found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri, and tetra-nucleotide, the repeat numbers redundant are six (28%), four (45%) and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and O. viverrini. Seven out of 24 loci showed heterozygous with observed heterozygosity ranged from 0.467 to 1. Four-primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites and the genome-wide markers developed may be a useful tool for genetic study of C. sinensis. PMID:25782682

  9. Genetic diversity and relatedness of sweet cherry (prunus avium L.) cultivars based on single nucleotide polymorphic markers.


    Fernandez I Marti, Angel; Athanson, Blessing; Koepke, Tyson; Font I Forcada, Carolina; Dhingra, Amit; Oraguzie, Nnadozie


    Most previous studies on genetic fingerprinting and cultivar relatedness in sweet cherry were based on isoenzyme, RAPD, and simple sequence repeat (SSR) markers. This study was carried out to assess the utility of single nucleotide polymorphism (SNP) markers generated from 3' untranslated regions (UTR) for genetic fingerprinting in sweet cherry. A total of 114 sweet cherry germplasm representing advanced selections, commercial cultivars, and old cultivars imported from different parts of the world were screened with seven SSR markers developed from other Prunus species and with 40 SNPs obtained from 3' UTR sequences of Rainier and Bing sweet cherry cultivars. Both types of marker study had 99 accessions in common. The SSR data was used to validate the SNP results. Results showed that the average number of alleles per locus, mean observed heterozygosity, expected heterozygosity, and polymorphic information content values were higher in SSRs than in SNPs although both set of markers were similar in their grouping of the sweet cherry accessions as shown in the dendrogram. SNPs were able to distinguish sport mutants from their wild type germplasm. For example, "Stella" was separated from "Compact Stella." This demonstrates the greater power of SNPs for discriminating mutants from their original parents than SSRs. In addition, SNP markers confirmed parentage and also determined relationships of the accessions in a manner consistent with their pedigree relationships. We would recommend the use of 3' UTR SNPs for genetic fingerprinting, parentage verification, gene mapping, and study of genetic diversity in sweet cherry.

  10. Sniper: improved SNP discovery by multiply mapping deep sequenced reads.


    Simola, Daniel F; Kim, Junhyong


    SNP (single nucleotide polymorphism) discovery using next-generation sequencing data remains difficult primarily because of redundant genomic regions, such as interspersed repetitive elements and paralogous genes, present in all eukaryotic genomes. To address this problem, we developed Sniper, a novel multi-locus Bayesian probabilistic model and a computationally efficient algorithm that explicitly incorporates sequence reads that map to multiple genomic loci. Our model fully accounts for sequencing error, template bias, and multi-locus SNP combinations, maintaining high sensitivity and specificity under a broad range of conditions. An implementation of Sniper is freely available at

  11. Predictive ability of direct genomic values for lifetime net merit of Holstein sires using selected subsets of single nucleotide polymorphism markers.


    Weigel, K A; de los Campos, G; González-Recio, O; Naya, H; Wu, X L; Long, N; Rosa, G J M; Gianola, D


    The objective of the present study was to assess the predictive ability of subsets of single nucleotide polymorphism (SNP) markers for development of low-cost, low-density genotyping assays in dairy cattle. Dense SNP genotypes of 4,703 Holstein bulls were provided by the USDA Agricultural Research Service. A subset of 3,305 bulls born from 1952 to 1998 was used to fit various models (training set), and a subset of 1,398 bulls born from 1999 to 2002 was used to evaluate their predictive ability (testing set). After editing, data included genotypes for 32,518 SNP and August 2003 and April 2008 predicted transmitting abilities (PTA) for lifetime net merit (LNM$), the latter resulting from progeny testing. The Bayesian least absolute shrinkage and selection operator method was used to regress August 2003 PTA on marker covariates in the training set to arrive at estimates of marker effects and direct genomic PTA. The coefficient of determination (R(2)) from regressing the April 2008 progeny test PTA of bulls in the testing set on their August 2003 direct genomic PTA was 0.375. Subsets of 300, 500, 750, 1,000, 1,250, 1,500, and 2,000 SNP were created by choosing equally spaced and highly ranked SNP, with the latter based on the absolute value of their estimated effects obtained from the training set. The SNP effects were re-estimated from the training set for each subset of SNP, and the 2008 progeny test PTA of bulls in the testing set were regressed on corresponding direct genomic PTA. The R(2) values for subsets of 300, 500, 750, 1,000, 1,250, 1,500, and 2,000 SNP with largest effects (evenly spaced SNP) were 0.184 (0.064), 0.236 (0.111), 0.269 (0.190), 0.289 (0.179), 0.307 (0.228), 0.313 (0.268), and 0.322 (0.291), respectively. These results indicate that a low-density assay comprising selected SNP could be a cost-effective alternative for selection decisions and that significant gains in predictive ability may be achieved by increasing the number of SNP allocated to

  12. Development of a SCAR (sequence-characterised amplified region) marker for acid resistance-related gene in Lactobacillus plantarum.


    Liu, Shu-Wen; Li, Kai; Yang, Shi-Ling; Tian, Shu-Fen; He, Ling


    A sequence characterised amplified region marker was developed to determine an acid resistance-related gene in Lactobacillus plantarum. A random amplified polymorphic DNA marker named S116-680 was reported to be closely related to the acid resistance of the strains. The DNA band corresponding to this marker was cloned and sequenced with the induction of specific designed PCR primers. The results of PCR test helped to amplify a clear specific band of 680 bp in the tested acid-resistant strains. S116-680 marker would be useful to explore the acid-resistant mechanism of L. plantarum and to screen desirable malolactic fermentation strains.

  13. SAT, a flexible and optimized Web application for SSR marker development

    PubMed Central

    Dereeper, Alexis; Argout, Xavier; Billot, Claire; Rami, Jean-François; Ruiz, Manuel


    Background Simple Sequence Repeats (SSRs), or microsatellites, are among the most powerful genetic markers known. A common method for the development of SSR markers is the construction of genomic DNA libraries enriched for SSR sequences, followed by DNA sequencing. However, designing optimal SSR markers from bulk sequence data is a laborious and time-consuming process. Results SAT (SSR Analysis Tool) is a user-friendly Web application developed to minimize tedious manual operations and reduce errors. This tool facilitates the integration, analysis and display of sequence data from SSR-enriched libraries. SAT is designed to successively perform base calling and quality evaluation of chromatograms, eliminate cloning vector, adaptors and low quality sequences, detect chimera or partially digested sequences, search for SSR motifs, cluster and assemble the redundant sequences, and design SSR primer pairs. An additional virtual PCR step establishes primer specificity. Users may modify the different parameters of each step of the SAT analysis. Although certain steps are compulsory, such as SSR motifs search and sequence assembly, users do not have to run the entire pipeline, and they can choose selectively which steps to perform. A database allows users to store and query results, and to redo individual steps of the workflow. Conclusion The SAT Web application is available at , and a standalone command-line version is also freely downloadable. Users must send an email to the SAT administrator to request a login and password. PMID:18047663

  14. Development of microsatellite markers in potato and their transferability in some members of Solanaceae.


    Grover, Atul; Ramesh, B; Sharma, P C


    We have developed thirty new microsatellite markers in potato by screening genomic libraries and ESTs. Genomic libraries of potato cultivar Kufri Bahar were screened for sequences containing microsatellite motifs GA, GT, ACA, ATC, GAA, TAA and GATA. Using flanking sequences, PCR primers were designed for microsatellites identified from genomic libraries and ESTs. Sixteen new primer pairs from genomic libraries and fourteen from ESTs along with seven previously published primer pairs amplified PCR products in the selected genotypes comprising of 65 Solanum tuberosum lines and 14 other species of the potato gene pool. Neighbor-joining tree based on genetic distance matrix developed using microsatellite markers successfully distinguished all these genotypes in the expected size range. Seventeen microsatellites could also be cross-amplified in at least one of the five members of solanaceae, namely tomato, eggplant, pepper, petunia and tobacco. The new microsatellite markers obtained in this study will be useful in various genetic and taxonomic studies in potato and related genomes. PMID:23572945

  15. Development and characterization of 27 microsatellite markers for the mangrove fern, Acrostichum aureum (Pteridaceae)1

    PubMed Central

    Yamamoto, Takashi; Tsuda, Yoshiaki; Mori, Gustavo Maruyama; Cruz, Mariana Vargas; Shinmura, Yoshimi; Wee, Alison K. S.; Takayama, Koji; Asakawa, Takeshi; Yamakawa, Takeru; Suleiman, Monica; Núñez-Farfán, Juan; Webb, Edward L.; Watano, Yasuyuki; Kajita, Tadashi


    Premise of the study: Twenty-seven nuclear microsatellite markers were developed for the mangrove fern, Acrostichum aureum (Pteridaceae), to investigate the genetic structure and demographic history of the only pantropical mangrove plant. Methods and Results: Fifty-six A. aureum individuals from three populations were sampled and genotyped to characterize the 27 loci. The number of alleles and expected heterozygosity ranged from one to 15 and 0.000 to 0.893, respectively. Across the 26 polymorphic loci, the Malaysian population showed much higher levels of polymorphism compared to the other two populations in Guam and Brazil. Cross-amplification tests in the other two species from the genus determined that seven and six loci were amplifiable in A. danaeifolium and A. speciosum, respectively. Conclusions: The 26 polymorphic microsatellite markers will be useful for future studies investigating the genetic structure and demographic history of of A. aureum, which has the widest distributional range of all mangrove plants. PMID:27672519

  16. Development of 18 polymorphic microsatellite markers for Vinca minor (Apocynaceae) via 454 pyrosequencing1

    PubMed Central

    Moeller, Sina; Wöhrmann, Tina; Huettel, Bruno; Weising, Kurt


    Premise of the study: Polymorphic microsatellite markers were developed in Vinca minor (Apocynaceae) to evaluate the level of clonality, population structure, and genetic diversity of the species within its native and introduced range. Methods and Results: A total of 1371 microsatellites were found in 43,565 reads from 454 pyrosequencing of genomic V. minor DNA. Additional microsatellite loci were mined from publicly available cDNA sequences. After several rounds of screening, 18 primer pairs flanking di-, tri-, or tetranucleotide repeats were identified that revealed high levels of genetic diversity in two native Italian populations, with two to 11 alleles per locus. Clonal growth predominated in two populations from the introduced range in Germany. Five loci successfully cross-amplified in three additional Vinca species. Conclusions: The novel polymorphic microsatellite markers are promising tools for studying clonality and population genetics of V. minor and for assessing the historical origin of Central European populations. PMID:25995978

  17. Development and characterization of microsatellite markers for Central American Begonia sect. Gireoudia (Begoniaceae)1

    PubMed Central

    Twyford, Alex D.; Ennos, Richard A.; Kidner, Catherine A.


    • Premise of the study: Transcriptome sequence data were used to design microsatellite primers for two widespread Central American Begonia species, B. heracleifolia and B. nelumbiifolia, to investigate population structure and hybridization. • Methods and Results: The transcriptome from vegetative meristem tissue from the related B. plebeja was mined for microsatellite loci, and 31 primer pairs amplified in the target species. Fifteen primer pairs were combined in two multiplex PCR reactions, which amplified an average of four alleles per locus. • Conclusions: The markers developed will be a valuable genetic resource for medium-throughput genotyping of Central American species of Begonia sect. Gireoudia. A subset of these markers have perfect sequence matches to Asian B. venusta, and are promising for studies in other Begonia sections. PMID:25202548

  18. Development and characterization of 27 microsatellite markers for the mangrove fern, Acrostichum aureum (Pteridaceae)1

    PubMed Central

    Yamamoto, Takashi; Tsuda, Yoshiaki; Mori, Gustavo Maruyama; Cruz, Mariana Vargas; Shinmura, Yoshimi; Wee, Alison K. S.; Takayama, Koji; Asakawa, Takeshi; Yamakawa, Takeru; Suleiman, Monica; Núñez-Farfán, Juan; Webb, Edward L.; Watano, Yasuyuki; Kajita, Tadashi


    Premise of the study: Twenty-seven nuclear microsatellite markers were developed for the mangrove fern, Acrostichum aureum (Pteridaceae), to investigate the genetic structure and demographic history of the only pantropical mangrove plant. Methods and Results: Fifty-six A. aureum individuals from three populations were sampled and genotyped to characterize the 27 loci. The number of alleles and expected heterozygosity ranged from one to 15 and 0.000 to 0.893, respectively. Across the 26 polymorphic loci, the Malaysian population showed much higher levels of polymorphism compared to the other two populations in Guam and Brazil. Cross-amplification tests in the other two species from the genus determined that seven and six loci were amplifiable in A. danaeifolium and A. speciosum, respectively. Conclusions: The 26 polymorphic microsatellite markers will be useful for future studies investigating the genetic structure and demographic history of of A. aureum, which has the widest distributional range of all mangrove plants.

  19. Transcriptome sequencing and simple sequence repeat marker development for three Macaronesian endemic plant species1

    PubMed Central

    White, Oliver W.; Doo, Bethany; Carine, Mark A.; Chapman, Mark A.


    Premise of the study: Oceanic islands offer unparalleled opportunities to investigate evolutionary processes such as adaptation and speciation. However, few genomic resources are available for oceanic island endemics. In this study, we publish transcriptome sequences from three Macaronesian endemic plant species (Argyranthemum broussonetii [Asteraceae], Descurainia bourgaeana [Brassicaceae], and Echium wildpretii [Boraginaceae]) that are representative of lineages that have radiated in the region. In addition, the utility of transcriptome data for marker development is demonstrated. Methods and Results: Transcriptomes from the three plant species were sequenced, assembled, and annotated. Between 1972 and 2282 simple sequence repeats (SSRs) were identified for each taxon. Primers were designed and tested for 30 of the candidate SSRs identified in Argyranthemum, of which 12 amplified well across three species and eight were polymorphic. Conclusions: We demonstrate here that a single transcriptome sequence is sufficient to identify hundreds of polymorphic SSR markers. The SSRs are applicable to a wide range of questions relating to the evolution of island lineages.

  20. Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests.


    Addisalem, A B; Esselink, G Danny; Bongers, F; Smulders, M J M


    Microsatellite (or simple sequence repeat, SSR) markers are highly informative DNA markers often used in conservation genetic research. Next-generation sequencing enables efficient development of large numbers of SSR markers at lower costs. Boswellia papyrifera is an economically important tree species used for frankincense production, an aromatic resinous gum exudate from bark. It grows in dry tropical forests in Africa and is threatened by a lack of rejuvenation. To help guide conservation efforts for this endangered species, we conducted an analysis of its genomic DNA sequences using Illumina paired-end sequencing. The genome size was estimated at 705 Mb per haploid genome. The reads contained one microsatellite repeat per 5.7 kb. Based on a subset of these repeats, we developed 46 polymorphic SSR markers that amplified 2-12 alleles in 10 genotypes. This set included 30 trinucleotide repeat markers, four tetranucleotide repeat markers, six pentanucleotide markers and six hexanucleotide repeat markers. Several markers were cross-transferable to Boswellia pirrotae and B. popoviana. In addition, retrotransposons were identified, the reads were assembled and several contigs were identified with similarity to genes of the terpene and terpenoid backbone synthesis pathways, which form the major constituents of the bark resin. PMID:25573702

  1. Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests

    PubMed Central

    Addisalem, A. B.; Esselink, G. Danny; Bongers, F.; Smulders, M. J. M.


    Microsatellite (or simple sequence repeat, SSR) markers are highly informative DNA markers often used in conservation genetic research. Next-generation sequencing enables efficient development of large numbers of SSR markers at lower costs. Boswellia papyrifera is an economically important tree species used for frankincense production, an aromatic resinous gum exudate from bark. It grows in dry tropical forests in Africa and is threatened by a lack of rejuvenation. To help guide conservation efforts for this endangered species, we conducted an analysis of its genomic DNA sequences using Illumina paired-end sequencing. The genome size was estimated at 705 Mb per haploid genome. The reads contained one microsatellite repeat per 5.7 kb. Based on a subset of these repeats, we developed 46 polymorphic SSR markers that amplified 2–12 alleles in 10 genotypes. This set included 30 trinucleotide repeat markers, four tetranucleotide repeat markers, six pentanucleotide markers and six hexanucleotide repeat markers. Several markers were cross-transferable to Boswellia pirrotae and B. popoviana. In addition, retrotransposons were identified, the reads were assembled and several contigs were identified with similarity to genes of the terpene and terpenoid backbone synthesis pathways, which form the major constituents of the bark resin. PMID:25573702

  2. Fine mapping for SNP markers associated with VSH behavior

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Varroa Sensitive Hygiene (VSH) is a trait that effectively reduces varroa mite populations by removal of brood cells that contain primarily reproductive mites. Breeding for VSH has proven to be a successful control of mite populations in both pure VSH colonies as well as in out-crossed populations....

  3. Allele frequencies for 40 autosomal SNP loci typed for US population samples using electrospray ionization mass spectrometry

    PubMed Central

    Kiesler, Kevin M.; Vallone, Peter M.


    Aim To type a set of 194 US African American, Caucasian, and Hispanic samples (self-declared ancestry) for 40 autosomal single nucleotide polymorphism (SNP) markers intended for human identification purposes. Methods Genotyping was performed on an automated commercial electrospray ionization time-of-flight mass spectrometer, the PLEX-ID. The 40 SNP markers were amplified in eight unique 5plex PCRs, desalted, and resolved based on amplicon mass. For each of the three US sample groups statistical analyses were performed on the resulting genotypes. Results The assay was found to be robust and capable of genotyping the 40 SNP markers consuming approximately 4 nanograms of template per sample. The combined random match probabilities for the 40 SNP assay ranged from 10−16 to 10−21. Conclusion The multiplex PLEX-ID SNP-40 assay is the first fully automated genotyping method capable of typing a panel of 40 forensically relevant autosomal SNP markers on a mass spectrometry platform. The data produced provided the first allele frequencies estimates for these 40 SNPs in a National Institute of Standards and Technology US population sample set. No population bias was detected although one locus deviated from its expected level of heterozygosity. PMID:23771752

  4. Transcriptome sequencing to produce SNP-based genetic maps of onion.


    Duangjit, J; Bohanec, B; Chan, A P; Town, C D; Havey, M J


    We used the Roche-454 platform to sequence from normalized cDNA libraries from each of two inbred lines of onion (OH1 and 5225). From approximately 1.6 million reads from each inbred, 27,065 and 33,254 cDNA contigs were assembled from OH1 and 5225, respectively. In total, 3,364 well supported single nucleotide polymorphisms (SNPs) on 1,716 cDNA contigs were identified between these two inbreds. One SNP on each of 1,256 contigs was randomly selected for genotyping. OH1 and 5225 were crossed and 182 gynogenic haploids extracted from hybrid plants were used for SNP mapping. A total of 597 SNPs segregated in the OH1 × 5225 haploid family and a genetic map of ten linkage groups (LOD ≥8) was constructed. Three hundred and thirty-nine of the newly identified SNPs were also mapped using a previously developed segregating family from BYG15-23 × AC43, and 223 common SNPs were used to join the two maps. Because these new SNPs are in expressed regions of the genome and commonly occur among onion germplasms, they will be useful for genetic mapping, gene tagging, marker-aided selection, quality control of seed lots, and fingerprinting of cultivars.

  5. A high-density SNP map of sunflower derived from RAD-sequencing facilitating fine-mapping of the rust resistance gene R12

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high-resolution genetic map of sunflower was constructed by integrating SNP data from three F2 mapping populations (HA 89/ RHA 464, B-line/ RHA 464, and CR 29/ RHA 468). The consensus map spanned a total length of 1443.84 cM, and consisted of 5,019 SNP markers derived from RAD tag sequencing and 1...

  6. Development of candidate gene markers associated to common bacterial blight resistance in common bean.


    Shi, Chun; Yu, Kangfu; Xie, Weilong; Perry, Gregory; Navabi, Alireza; Pauls, K Peter; Miklas, Phillip N; Fourie, Deidré


    Common bacterial blight (CBB), caused by Xanthomonas axonopodis pv. phaseoli (Xap), is a major yield-limiting factor of common bean (Phaseolus vulgaris L.) production around the world. Two major CBB-resistant quantitative trait loci (QTL), linked to the sequence characterized amplified region markers BC420 and SU91, are located at chromosomes 6 and 8, respectively. Using map-based cloning approach, four bacterial artificial chromosome (BAC) clones from the BC420-QTL locus and one BAC clone containing SU91 were sequenced by Roche 454 technique and subsequently assembled using merged assemblies from three different programs. Based on the quality of the assembly, only the sequences of BAC 32H6 and 4K7 were used for candidate gene marker (CGM) development and candidate gene (CG) selection. For the BC420-QTL locus, 21 novel genes were predicted in silico by FGENESH using Medicago gene model, whereas 16 genes were identified in the SU91-QTL locus. For each putative gene, one or more primer pairs were designed and tested in the contrasting near isogenic lines. Overall, six and nine polymorphic markers were found in the SU91- and BC420-QTL loci, respectively. Afterwards, association mapping was conducted in a breeding population of 395 dry bean lines to discover marker-trait associations. Two CGMs per each locus showed better association with CBB resistance than the BC420 and SU91 markers, which include BC420-CG10B and BC420-CG14 for BC420_QTL locus, and SU91-CG10 and SU91-CG11 for SU91_QTL locus. The strong associations between CBB resistance and the CGs 10 and 14 from BC420_QTL locus and the CGs 10 and 11 from SU91_QTL locus indicate that the genes 10 and 14 from the BC420 locus are potential CGs underlying the BC420_QTL locus, whereas the genes 10 and 11 from the SU91 locus are potential CGs underlying the SU91_QTL locus. The superiority of SU91-CG11 was further validated in a recombinant inbred line population Sanilac × OAC 09-3. Thus, co-dominant CGMs, BC420-CG14 and

  7. Marker development for the EPM1 region of human chromosome 21, q22.3

    SciTech Connect

    Warrington, I.A.; O`Connor, K.; Hebert, S.


    New STSs have been developed for a 0.9 Mb region of chromosome 21 that is not represented in existing YAC libraries using an efficient method that is generally applicable to any region of the genome. The region, 21q22.3, is of particular interest because the gene for progressive myoclonic epilepsy of the Unverricht-Lundborg type (EPM1) maps to this region. Until recently there were only three probes for the 1.3 Mb surrounding the EPM1 gene (D21S141,LJ112, LB2T). This very limited number of probes is problematic for obtaining clone coverage and for confirming map position of newly developed markers in the EPM1 region. To develop new markers, a somatic cell hybrid containing chromosome 21 as its only human complement (GMO8854) was digested with NOT1 and hybridized with D21S141. The fragment hybridizing with D21S141 was excised, amplified by Alu-PCR and the amplification products were cloned and sequenced. Of the fifteen clones sequenced, four were duplicates and one consisted entirely of repeat sequences. STSs were developed for the remaining ten unique clones. To determine the map position of the new STSs, quantitive PCR was used in conjunction with whole genome radiation hybrid (RH) mapping. Quantitative PCR confirmed that the STSs mapped to appropriately sized PFGE fragments and whole genome RH mapping showed that the makers were linked and gave order and distance information. Three of the new STSs are in the EPM1 region, providing additional starting points for obtaining clone coverage and gene isolation. This combination of techniques for developing markers and confirming map position is an effective approach for obtaining probes and has general applicability for regions of the genome not represented in YAC or cosmid libraries.

  8. SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For the first time in many years a comprehensive genome map for cultivated oat has been constructed using a combination of single nucleotide polymorphism (SNP) markers and validated with a collection of cytogenetically defined germplasm lines. The markers were able to help distinguish the three geno...

  9. BM-SNP: A Bayesian Model for SNP Calling Using High Throughput Sequencing Data.


    Xu, Yanxun; Zheng, Xiaofeng; Yuan, Yuan; Estecio, Marcos R; Issa, Jean-Pierre; Qiu, Peng; Ji, Yuan; Liang, Shoudan


    A single-nucleotide polymorphism (SNP) is a sole base change in the DNA sequence and is the most common polymorphism. Detection and annotation of SNPs are among the central topics in biomedical research as SNPs are believed to play important roles on the manifestation of phenotypic events, such as disease susceptibility. To take full advantage of the next-generation sequencing (NGS) technology, we propose a Bayesian approach, BM-SNP, to identify SNPs based on the posterior inference using NGS data. In particular, BM-SNP computes the posterior probability of nucleotide variation at each covered genomic position using the contents and frequency of the mapped short reads. The position with a high posterior probability of nucleotide variation is flagged as a potential SNP. We apply BM-SNP to two cell-line NGS data, and the results show a high ratio of overlap ( >95 percent) with the dbSNP database. Compared with MAQ, BM-SNP identifies more SNPs that are in dbSNP, with higher quality. The SNPs that are called only by BM-SNP but not in dbSNP may serve as new discoveries. The proposed BM-SNP method integrates information from multiple aspects of NGS data, and therefore achieves high detection power. BM-SNP is fast, capable of processing whole genome data at 20-fold average coverage in a short amount of time. PMID:26357041

  10. Efficient large-scale development of microsatellites for marker and mapping applications in Brassica crop species.


    Lowe, A J; Moule, C; Trick, M; Edwards, K J


    A set of 398 simple sequence repeat markers (SSRs) have been developed and characterised for use with genetic studies of Brassica species. Small-insert (250-900 bp) genomic libraries from Brassica rapa, B. nigra, B. oleracea and B. napus, highly enriched for dinucleotide and trinucleotide SSR motifs, were constructed. Screening the clones with a mixture of oligonucleotide repeat probes revealed positive hybridisation to between 75% and 90% of the clones. Of these, 1230 were sequenced. Primer pairs were designed for 398 SSR clones, and of these, 270 (67.8%) amplified a PCR product of the expected size in their focal and/or closely related species. A further screen of 138 primers pairs that produced a PCR product in B. napus germplasm found that 86 (62.3%) revealed length polymorphisms within at least one line of a test array representing the four Brassica species. The results of this screen were used to identify 56 SSRs and were combined with 41 SSRs that had previously shown polymorphism between the parents of a B. napus mapping population. These 97 SSR markers were mapped relative to a framework of RFLP markers and detected 136 loci over all 19 linkage groups of the oilseed rape genome.

  11. Development and characterization of EST-SSR markers for Catalpa bungei (Bignoniaceae)1

    PubMed Central

    Wang, Peng; Ma, Yuzhu; Ma, Lingling; Li, Ya; Wang, Shu’an; Li, Linfang; Yang, Rutong; Wang, Qing


    Premise of the study: Catalpa bungei (Bignoniaceae) is a deciduous tree native to China. We developed microsatellite markers for C. bungei to investigate its population genetics. Methods and Results: One hundred seventy-seven expressed sequence tag (EST)–simple sequence repeat (SSR) primer pairs were isolated and characterized using next-generation sequencing. Thirty of these primer pairs were polymorphic loci in 52 individuals of C. bungei. The number of alleles ranged from two to 18 with observed and expected heterozygosity values of 0.05–1.00 and 0.18–0.95, respectively. The fixation index ranged from –1.00 to 1.00 with an average of 0.32. No linkage disequilibrium was detected in any pair of loci. All markers showed good amplification results in four species (C. bungei, C. fargesii, C. duclouxii, and C. ovata) except three loci. Conclusions: These polymorphic markers are expected to be helpful in further studies on the systematics and phylogeography of C. bungei and related species. PMID:27144105

  12. Development and Implementation of Autoverification Rules for ELISA Results of HBV Serological Markers.


    Li, Jiancheng; Cheng, Bizhen; Yang, Li; Zhao, Ying; Pan, Meichen; Zheng, Gaozhe; Xu, Xiaoyan; Hu, Jing; Xiao, Tongtong; Cai, Yingmu


    Autoverification is a process of using computer-based rules to verify clinical laboratory test results without manual review. But to date, there are few published articles on the use of autoverification over the course of years in a clinical laboratory. In our study, we firstly described the development and implementation of autoverification rules for enzyme-linked immunosorbent assay (ELISA) results of hepatitis B virus (HBV) serological markers in a clinical immunology laboratory. We designed the autoverification rules for HBV by using Boolean logic on five clinically used serological markers in accordance with the framework of AUTO-10A, issued by the American Clinical Laboratory Standards Institute in 2006. The rules were written into the laboratory information system (LIS) and installed in the computer, so we could use the LIS to screen the test results. If the results passed the autoverification rules, they could be sent to doctors immediately. To evaluate the autoverification rules, we applied the real-time data of 11,585 patients with the autoverification rules. The autoverification rate of the five HBV serological markers was 79.5%. Furthermore, the turnaround time (TAT) was reduced by 38% (78 minutes vs. 126 minutes). The error rate was nearly eliminated. These results show that using LIS with autoverification rules can shorten TAT, enhance efficiency, and reduce manual review errors.

  13. Development and characterization of 14 microsatellite markers for Indigofera pseudotinctoria (Fabaceae)1

    PubMed Central

    Otao, Tomoko; Kobayashi, Tatsuaki; Uehara, Koichi


    Premise of the study: Microsatellite markers can be used to evaluate population structure and genetic diversity in native populations of Indigofera pseudotinctoria (Fabaceae) and assess genetic disturbance caused by nonnative plants of the same species. Methods and Results: We developed 14 markers for I. pseudotinctoria using next-generation sequencing and applied them to test two native populations, totaling 77 individuals, and a transplanted population, imported from a foreign country, of 17 individuals. The mean number of alleles was 3.310, observed heterozygosity was 0.242, and expected heterozygosity was 0.346. The fixation index in the transplanted population was 0.469, which was higher than in the native populations (0.154 and 0.158). In addition, the transplanted population contains one allele that is not shared by the native population. Conclusions: Microsatellite markers can be useful for evaluating genetic diversity within and between populations and for studying population genetics in I. pseudotinctoria and related species. PMID:27144104

  14. Development of Gateway Binary Vector Series with Four Different Selection Markers for the Liverwort Marchantia polymorpha.


    Ishizaki, Kimitsune; Nishihama, Ryuichi; Ueda, Minoru; Inoue, Keisuke; Ishida, Sakiko; Nishimura, Yoshiki; Shikanai, Toshiharu; Kohchi, Takayuki


    We previously reported Agrobacterium-mediated transformation methods for the liverwort Marchantia polymorpha using the hygromycin phosphotransferase gene as a marker for selection with hygromycin. In this study, we developed three additional markers for M. polymorpha transformation: the gentamicin 3'-acetyltransferase gene for selection with gentamicin; a mutated acetolactate synthase gene for selection with chlorsulfuron; and the neomycin phosphotransferase II gene for selection with G418. Based on these four marker genes, we have constructed a series of Gateway binary vectors designed for transgenic experiments on M. polymorpha. The 35S promoter from cauliflower mosaic virus and endogenous promoters for constitutive and heat-inducible expression were used to create these vectors. The reporters and tags used were Citrine, 3×Citrine, Citrine-NLS, TagRFP, tdTomato, tdTomato-NLS, GR, SRDX, SRDX-GR, GUS, ELuc(PEST), and 3×FLAG. These vectors, designated as the pMpGWB series, will facilitate molecular genetic analyses of the emerging model plant M. polymorpha. PMID:26406247

  15. Development of Gateway Binary Vector Series with Four Different Selection Markers for the Liverwort Marchantia polymorpha

    PubMed Central

    Ueda, Minoru; Inoue, Keisuke; Ishida, Sakiko; Nishimura, Yoshiki; Shikanai, Toshiharu; Kohchi, Takayuki


    We previously reported Agrobacterium-mediated transformation methods for the liverwort Marchantia polymorpha using the hygromycin phosphotransferase gene as a marker for selection with hygromycin. In this study, we developed three additional markers for M. polymorpha transformation: the gentamicin 3'-acetyltransferase gene for selection with gentamicin; a mutated acetolactate synthase gene for selection with chlorsulfuron; and the neomycin phosphotransferase II gene for selection with G418. Based on these four marker genes, we have constructed a series of Gateway binary vectors designed for transgenic experiments on M. polymorpha. The 35S promoter from cauliflower mosaic virus and endogenous promoters for constitutive and heat-inducible expression were used to create these vectors. The reporters and tags used were Citrine, 3×Citrine, Citrine-NLS, TagRFP, tdTomato, tdTomato-NLS, GR, SRDX, SRDX-GR, GUS, ELuc(PEST), and 3×FLAG. These vectors, designated as the pMpGWB series, will facilitate molecular genetic analyses of the emerging model plant M. polymorpha. PMID:26406247

  16. Development of Genetic Markers in Eucalyptus Species by Target Enrichment and Exome Sequencing

    PubMed Central

    Dasgupta, Modhumita Ghosh; Dharanishanthi, Veeramuthu; Agarwal, Ishangi; Krutovsky, Konstantin V.


    The advent of next-generation sequencing has facilitated large-scale discovery, validation and assessment of genetic markers for high density genotyping. The present study was undertaken to identify markers in genes supposedly related to wood property traits in three Eucalyptus species. Ninety four genes involved in xylogenesis were selected for hybridization probe based nuclear genomic DNA target enrichment and exome sequencing. Genomic DNA was isolated from the leaf tissues and used for on-array probe hybridization followed by Illumina sequencing. The raw sequence reads were trimmed and high-quality reads were mapped to the E. grandis reference sequence and the presence of single nucleotide variants (SNVs) and insertions/ deletions (InDels) were identified across the three species. The average read coverage was 216X and a total of 2294 SNVs and 479 InDels were discovered in E. camaldulensis, 2383 SNVs and 518 InDels in E. tereticornis, and 1228 SNVs and 409 InDels in E. grandis. Additionally, SNV calling and InDel detection were conducted in pair-wise comparisons of E. tereticornis vs. E. grandis, E. camaldulensis vs. E. tereticornis and E. camaldulensis vs. E. grandis. This study presents an efficient and high throughput method on development of genetic markers for family– based QTL and association analysis in Eucalyptus. PMID:25602379

  17. Meninges harbor cells expressing neural precursor markers during development and adulthood.


    Bifari, Francesco; Berton, Valeria; Pino, Annachiara; Kusalo, Marijana; Malpeli, Giorgio; Di Chio, Marzia; Bersan, Emanuela; Amato, Eliana; Scarpa, Aldo; Krampera, Mauro; Fumagalli, Guido; Decimo, Ilaria


    Brain and skull developments are tightly synchronized, allowing the cranial bones to dynamically adapt to the brain shape. At the brain-skull interface, meninges produce the trophic signals necessary for normal corticogenesis and bone development. Meninges harbor different cell populations, including cells forming the endosteum of the cranial vault. Recently, we and other groups have described the presence in meninges of a cell population endowed with neural differentiation potential in vitro and, after transplantation, in vivo. However, whether meninges may be a niche for neural progenitor cells during embryonic development and in adulthood remains to be determined. In this work we provide the first description of the distribution of neural precursor markers in rat meninges during development up to adulthood. We conclude that meninges share common properties with the classical neural stem cell niche, as they: (i) are a highly proliferating tissue; (ii) host cells expressing neural precursor markers such as nestin, vimentin, Sox2 and doublecortin; and (iii) are enriched in extracellular matrix components (e.g., fractones) known to bind and concentrate growth factors. This study underlines the importance of meninges as a potential niche for endogenous precursor cells during development and in adulthood.

  18. Environmental DNA Marker Development with Sparse Biological Information: A Case Study on Opossum Shrimp (Mysis diluviana).


    Carim, Kellie J; Christianson, Kyle R; McKelvey, Kevin M; Pate, William M; Silver, Douglas B; Johnson, Brett M; Galloway, Bill T; Young, Michael K; Schwartz, Michael K


    The spread of Mysis diluviana, a small glacial relict crustacean, outside its native range has led to unintended shifts in the composition of native fish communities throughout western North America. As a result, biologists seek accurate methods of determining the presence of M. diluviana, especially at low densities or during the initial stages of an invasion. Environmental DNA (eDNA) provides one solution for detecting M. diluviana, but building eDNA markers that are both sensitive and species-specific is challenging when the distribution and taxonomy of closely related non-target taxa are poorly understood, published genetic data are sparse, and tissue samples are difficult to obtain. To address these issues, we developed a pair of independent eDNA markers to increase the likelihood of a positive detection of M. diluviana when present and reduce the probability of false positive detections from closely related non-target species. Because tissue samples of closely-related and possibly sympatric, non-target taxa could not be obtained, we used synthetic DNA sequences of closely related non-target species to test the specificity of eDNA markers. Both eDNA markers yielded positive detections from five waterbodies where M. diluviana was known to be present, and no detections in five others where this species was thought to be absent. Daytime samples from varying depths in one waterbody occupied by M. diluviana demonstrated that samples near the lake bottom produced 5 to more than 300 times as many eDNA copies as samples taken at other depths, but all samples tested positive regardless of depth.

  19. Environmental DNA Marker Development with Sparse Biological Information: A Case Study on Opossum Shrimp (Mysis diluviana).


    Carim, Kellie J; Christianson, Kyle R; McKelvey, Kevin M; Pate, William M; Silver, Douglas B; Johnson, Brett M; Galloway, Bill T; Young, Michael K; Schwartz, Michael K


    The spread of Mysis diluviana, a small glacial relict crustacean, outside its native range has led to unintended shifts in the composition of native fish communities throughout western North America. As a result, biologists seek accurate methods of determining the presence of M. diluviana, especially at low densities or during the initial stages of an invasion. Environmental DNA (eDNA) provides one solution for detecting M. diluviana, but building eDNA markers that are both sensitive and species-specific is challenging when the distribution and taxonomy of closely related non-target taxa are poorly understood, published genetic data are sparse, and tissue samples are difficult to obtain. To address these issues, we developed a pair of independent eDNA markers to increase the likelihood of a positive detection of M. diluviana when present and reduce the probability of false positive detections from closely related non-target species. Because tissue samples of closely-related and possibly sympatric, non-target taxa could not be obtained, we used synthetic DNA sequences of closely related non-target species to test the specificity of eDNA markers. Both eDNA markers yielded positive detections from five waterbodies where M. diluviana was known to be present, and no detections in five others where this species was thought to be absent. Daytime samples from varying depths in one waterbody occupied by M. diluviana demonstrated that samples near the lake bottom produced 5 to more than 300 times as many eDNA copies as samples taken at other depths, but all samples tested positive regardless of depth. PMID:27551919

  20. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.


    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru


    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding. PMID:27055463

  1. Development, characterization, and cross-species/genera transferability of SSR markers for rubber tree (Hevea brasiliensis).


    Yu, Fei; Wang, Bao-Hua; Feng, Su-Ping; Wang, Jing-Yi; Li, Wei-Guo; Wu, Yao-Ting


    Genomic simple sequence repeat (SSR) markers are particularly valuable in studies of genetic diversity, evolution, genetic linkage map construction, quantitative trait loci tagging, and marker-assisted selection because of their multi-allelic nature, reproducibility, co-dominant inheritance, high abundance, and extensive genome coverage. The traditional methods of SSR marker development, such as genomic-SSR hybrid screening and microsatellite enrichment, have the disadvantages of high cost and complex operation. The selectively amplified microsatellite method is less costly and highly efficient as well as being simple and convenient. In this study, 252 sequences with SSRs were cloned from the rubber tree (Hevea brasiliensis) genome from which 258 SSR loci were obtained. The average repeat number was six. There were only 10 (3.9%) mononucleotide, trinucleotide, and pentanucleotide repeats, whereas the remaining 248 (96.1%) were dinucleotide repeats, including 128 (49.6%) GT/CA repeats, 118 (45.7%) GA/CT repeats, and 2 (0.8%) AT/TA repeats. A total of 126 primer pairs (see ESM) were successfully designed of which 36 primer pairs generated polymorphic products from 12 accessions of the cultivated species, 4 related species, and 3 species of the family Euphorbiaceae. In addition, investigations based on four genomic SSRs (GAR4, ACR22, CTR25, and GTR28) by cloning and sequencing provided evidence for cross-species/genera applicability, and homologous sequences were obtained from the rubber tree and Euphorbiaceae. Further analysis about the variation of the flanking regions of the four markers was carried out. PMID:20960206

  2. Environmental DNA Marker Development with Sparse Biological Information: A Case Study on Opossum Shrimp (Mysis diluviana)

    PubMed Central

    Carim, Kellie J.; Christianson, Kyle R.; McKelvey, Kevin M.; Pate, William M.; Silver, Douglas B.; Johnson, Brett M.; Galloway, Bill T.; Young, Michael K.; Schwartz, Michael K.


    The spread of Mysis diluviana, a small glacial relict crustacean, outside its native range has led to unintended shifts in the composition of native fish communities throughout western North America. As a result, biologists seek accurate methods of determining the presence of M. diluviana, especially at low densities or during the initial stages of an invasion. Environmental DNA (eDNA) provides one solution for detecting M. diluviana, but building eDNA markers that are both sensitive and species-specific is challenging when the distribution and taxonomy of closely related non-target taxa are poorly understood, published genetic data are sparse, and tissue samples are difficult to obtain. To address these issues, we developed a pair of independent eDNA markers to increase the likelihood of a positive detection of M. diluviana when present and reduce the probability of false positive detections from closely related non-target species. Because tissue samples of closely-related and possibly sympatric, non-target taxa could not be obtained, we used synthetic DNA sequences of closely related non-target species to test the specificity of eDNA markers. Both eDNA markers yielded positive detections from five waterbodies where M. diluviana was known to be present, and no detections in five others where this species was thought to be absent. Daytime samples from varying depths in one waterbody occupied by M. diluviana demonstrated that samples near the lake bottom produced 5 to more than 300 times as many eDNA copies as samples taken at other depths, but all samples tested positive regardless of depth. PMID:27551919

  3. Development of Specific Sequence-Characterized Amplified Region Markers for Detecting Histoplasma capsulatum in Clinical and Environmental Samples

    PubMed Central

    Frías De León, María Guadalupe; Arenas López, Gabina; Taylor, Maria Lucia; Acosta Altamirano, Gustavo


    Sequence-characterized amplified region (SCAR) markers, generated by randomly amplified polymorphic DNA (RAPD)-PCR, were developed to detect Histoplasma capsulatum selectively in clinical and environmental samples. A 1,200-bp RAPD-PCR-specific band produced with the 1281-1283 primers was cloned, sequenced, and used to design two SCAR markers, 1281-1283220 and 1281-1283230. The specificity of these markers was confirmed by Southern hybridization. To evaluate the relevance of the SCAR markers for the diagnosis of histoplasmosis, another molecular marker (M antigen probe) was used for comparison. To validate 1281-1283220 and 1281-1283230 as new tools for the identification of H. capsulatum, the specificity and sensitivity of these markers were assessed for the detection of the pathogen in 36 clinical (17 humans, as well a