Sample records for developmental delay growth

  1. Could head circumference be used to screen for autism in young males with developmental delay?

    PubMed

    Gray, Kylie M; Taffe, John; Sweeney, Deborah J; Forster, Sheridan; Tonge, Bruce J

    2012-04-01

    Research has suggested an abnormal acceleration in head circumference growth in children with autism within the first 12 months of life. This study aimed to examine head circumference at birth and head circumference growth rates in young children with autism and developmental delay, and young children with developmental delay without autism. This study assessed head circumference at birth and rate of change in head circumference in young children with autism (n=86) and children with developmental delay without autism (n=40). For both groups of children, head circumference at birth and head circumference growth were compared with Centers for Disease Control normative data. No differences were found between the group of children with autism and developmental delay compared with the group with developmental delay only. However, when the sample was compared with a range of selected Centers for Disease Control normative medians, the children with autism were found to have significantly smaller head circumferences at birth and significantly larger head circumference at 18.5 months of age. These results are discussed in relation to the potential of accelerated head circumference growth as an early marker for autism. This study failed to find a difference in the head circumferences of children with autism and developmental delay and children with developmental delay only, thus suggesting that head circumference measurement has limited value as an early marker for autism. © 2011 The Authors. Journal of Paediatrics and Child Health © 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

  2. Sleep Problems and Early Developmental Delay: Implications for Early Intervention Programs

    ERIC Educational Resources Information Center

    Bonuck, Karen; Grant, Roy

    2012-01-01

    Sleep disorders negatively impact behavior, cognition, and growth--the same areas targeted by early intervention. Conversely, developmental delays and disabilities may themselves precipitate sleep disorders. Young children with developmental delays experience sleep disorders at a higher rate than do typically developing children; the most common…

  3. Decreased head circumference velocity as related to developmental deficit in infancy.

    PubMed

    Tal, Galit; Cohen, Ayala; Habib, Sonia; Tirosh, Emanuel

    2012-11-01

    We evaluated the significance of head circumference growth velocity as related to developmental deficits during infancy. Head circumferences, lengths, and developmental diagnoses were retrieved in a standard manner at ≥ 2 time points from 437 infants with developmental deficits, and 3909 normally developing infants. Infants' ages ranged from 1-24 months, with final diagnoses ascertained at age 24 months. Increased velocity during the first 2 months in typical infants was evident in the study group during the period 2-4 months. A differential head circumference growth velocity was observed, and infants diagnosed with motor delay presented decreased velocity between ages 2-4 months, compared with infants receiving other nonmotor developmental diagnoses. These differences remained after controlling for birth weight and length. No significant sex effect was evident. Infants with developmental deficits demonstrate delayed acceleration of head circumference velocity, compared with typical infants in the first 2 months. Infants with motor delay manifest decreased velocity, compared with infants presenting other developmental deficits. These differences may be related to delayed white matter maturation. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Trajectories of Developmental Functioning among Children of Adolescent Mothers: Factors Associated with Risk for Delay

    ERIC Educational Resources Information Center

    Jahromi, Laudan B.; Umaña-Taylor, Adriana J.; Updegraff, Kimberly A.; Zeiders, Katharine H.

    2016-01-01

    Children of adolescent mothers are at risk for developmental delays. Less is known about the heterogeneity in these children's developmental trajectories, and factors associated with different patterns of development. This longitudinal study used latent class growth analysis (LCGA) to identify distinct trajectories in children of Mexican-origin…

  5. Developmental risk and young children's regulatory strategies: predicting behavior problems at age five.

    PubMed

    Gerstein, Emily D; Pedersen Y Arbona, Anita; Crnic, Keith A; Ryu, Ehri; Baker, Bruce L; Blacher, Jan

    2011-04-01

    Children with early developmental delays are at heightened risk for behavior problems and comorbid psychopathology. This study examined the trajectories of regulatory capabilities and their potentially mediating role in the development of behavior problems for children with and without early developmental delays. A sample of 231 children comprised of 137 typically developing children and 94 children with developmental delays were examined during mildly frustrating laboratory tasks across the preschool period (ages 3-5). Results indicated that children with delays had greater use of maladaptive strategies (distraction, distress venting) and lower use of adaptive strategies (constructive coping) than typically developing children. For both groups, strategies had similar rates of growth across time; maladaptive strategies decreased and adaptive strategies increased. The intercept of strategy use, but not the slope, was found to mediate the relation between developmental risk and externalizing behaviors. Findings support that dysregulation, rather than the developmental risk, may be responsible for the high levels of comorbid psychopathology.

  6. Refinement of the 12q14 microdeletion syndrome: primordial dwarfism and developmental delay with or without osteopoikilosis

    PubMed Central

    Mari, Francesca; Hermanns, Pia; Giovannucci-Uzielli, Maria L; Galluzzi, Fiorella; Scott, Daryl; Lee, Brendan; Renieri, Alessandra; Unger, Sheila; Zabel, Bernhard; Superti-Furga, Andrea

    2009-01-01

    In their studies on the molecular basis of osteopoikilosis, Menten et al have identified three individuals with microdeletions on chromosome 12q14.4, which removed several genes including LEMD3, the osteopoikilosis gene. In addition to osteopoikilosis, affected individuals had growth retardation and developmental delay. We now report a smaller 12q14.4 microdeletion in a boy with severe pre and postnatal growth failure, and mild developmental delay; the patient was small at birth and presented with poor feeding and failure to thrive during the first 2 years of life, similar to the phenotype of primordial dwarfism or severe Silver-Russell syndrome (SRS). The 12q14 deletion did not include LEMD3, and no signs of osteopoikilosis were observed on skeletal radiographs. Among the deleted genes, HMGA2 is of particular interest in relationship to the aberrant somatic growth in our patient, as HMGA2 variants have been linked to stature variations in the general population and loss of function of Hmga2 in the mouse results in the pygmy phenotype that combines pre and postnatal growth failure, with resistance to the adipogenic effect of overfeeding. Sequencing of the remaining HMGA2 allele in our patient showed a normal sequence, suggesting that HMGA2 haploinsufficiency may be sufficient to produce the aberrant growth phenotype. We conclude that the 12q14.4 microdeletion syndrome can occur with or without deletion of LEMD3 gene; in LEMD3-intact cases, the phenotype includes primordial short stature and failure to thrive with moderate developmental delay, but osteopoikilosis is absent. Such cases will likely be diagnosed as Silver-Russell-like or as primordial dwarfism. PMID:19277063

  7. Sotos Syndrome. Clinical Exchange.

    ERIC Educational Resources Information Center

    Shuey, Elaine M.; Jamison, Kristen

    1996-01-01

    Sotos syndrome is characterized by high birth length, rapid bone growth, distinctive facial features, and possible verbal and motor delays. It is more common in males than females. Developmental deficits, specific learning problems, and speech/language delays may also occur. (DB)

  8. Risk Factors and Relationship Between Intestinal Parasites and the Growth Retardation and Psychomotor Development Delays of Children in Şanlıurfa, Turkey.

    PubMed

    Yentur Doni, Nebiye; Yildiz Zeyrek, Fadile; Simsek, Zeynep; Gurses, Gulcan; Sahin, İbrahim

    2015-12-01

    The objective of this study was to determine the risk factors for and relationship among parasitic infections, growth retardation, and psychomotor developmental delays in children aged 6 years and below. This case-control study was performed in Şanlıurfa in southeastern Turkey between October and December 2007. Data were collected using a structured questionnaire, anthropometry, Ankara Development Screening Inventory, and laboratory analysis of stool specimens. The most common parasite was Giardia intestinalis (42.53%) followed by Enterobius vermicularis (27.58%), Ascaris lumbricoides (18.39%), Hymenolepis nana (5.75%), Trichuris trichiura (3.45%), Escherichia coli (1.15%), and Blastocystis spp. (1.15%). Fifty-eight percent of all children were infected with intestinal parasites; 55.2% had only one parasite, whereas 44.8% had multiple parasites. The children infected with G. intestinalis and other intestinal parasites had significantly higher levels of growth retardation and psychomotor development delay than non-infected children. Children with parasitic infections had growth delay up to 2.9 times, general development delay up to 1.9 times, language-cognitive development delay up to 2.2 times, and fine motor development delay up to 2.9 times higher than children without any parasitic infections. However, no significant relationship among intestinal parasites, gross motor development, social-self skills, and development delay was identified. The education level of parents, poor economic situation, number of households, not washing hands, playing with soil, family history of parasitic infection were the significant risk factors for intestinal parasites. Our study indicates that the presence of either malnutrition or intestinal parasites may put a child in a high-risk group for developmental delays and growth retardation. Therefore, public health interventions can embrace nationwide deworming in children.

  9. Intraspecific priority effects modify compensatory responses to changes in hatching phenology in an amphibian.

    PubMed

    Murillo-Rincón, Andrea P; Kolter, Nora A; Laurila, Anssi; Orizaola, Germán

    2017-01-01

    In seasonal environments, modifications in the phenology of life-history events can alter the strength of time constraints experienced by organisms. Offspring can compensate for a change in timing of hatching by modifying their growth and development trajectories. However, intra- and interspecific interactions may affect these compensatory responses, in particular if differences in phenology between cohorts lead to significant priority effects (i.e. the competitive advantage that early-hatching individuals have over late-hatching ones). Here, we conducted a factorial experiment to determine whether intraspecific priority effects can alter compensatory phenotypic responses to hatching delay in a synchronic breeder by rearing moor frog (Rana arvalis) tadpoles in different combinations of phenological delay and food abundance. Tadpoles compensated for the hatching delay by speeding up their development, but only when reared in groups of individuals with identical hatching phenology. In mixed phenology groups, strong competitive effects by non-delayed tadpoles prevented the compensatory responses and delayed larvae metamorphosed later than in single phenology treatments. Non-delayed individuals gained advantage from developing with delayed larvae by increasing their developmental and growth rates as compared to single phenology groups. Food shortage prolonged larval period and reduced mass at metamorphosis in all treatments, but it did not prevent compensatory developmental responses in larvae reared in single phenology groups. This study demonstrates that strong intraspecific priority effects can constrain the compensatory growth and developmental responses to phenological change, and that priority effects can be an important factor explaining the maintenance of synchronic life histories (i.e. explosive breeding) in seasonal environments. © 2016 The Authors. Journal of Animal Ecology © 2016 British Ecological Society.

  10. A variant microcephalic osteodysplastic slender-bone disorder with growth hormone deficiency and a pigmentary retinopathy.

    PubMed

    Maclean, K; Ambler, G; Flaherty, M; Kozlowski, K; Adès, L C

    2002-10-01

    We present the case of a 3-year-old boy with post-natal growth failure, microcephaly, developmental delay, facial dysmorphism, an evolving pigmentary retinopathy, pituitary hypoplasia, micropenis, and growth hormone (GH) deficiency. He has a microcephalic osteodysplastic slender-bone disorder with disharmonic delayed osseous maturation, most closely resembling patients with microcephalic osteodysplastic primordial dwarfism type II (MOPD II). Intrauterine growth retardation, a universal finding in the MOPD II, was absent in our patient.

  11. Growth and development of children prenatally exposed to telbivudine administered for the treatment of chronic hepatitis B in their mothers.

    PubMed

    Zeng, Huihui; Cai, Haodong; Wang, Ying; Shen, Ying

    2015-04-01

    We studied the growth and development of children prenatally exposed to telbivudine used to treat chronic hepatitis B virus (HBV) infection in their mothers. Maternal abnormalities during pregnancy and delivery and infant congenital anomalies, physical development status, developmental quotient (DQ), HBV vertical transmission status, and HBV vaccination outcomes of 54 infants were evaluated (2010-2013). No fetal abnormalities were observed during pregnancy or delivery. Postpartum, three infants (5.56%) had abnormalities: ankyloglossia, cutaneous hemangioma, and vaginal canal leak. Height and weight were within the normal range at birth and at 6 weeks, but were higher than the reference at 12 months (p<0.05). Body mass index increased gradually with age (p<0.05). DQ scores were normal (84.81%, 229/270) in 37 children (68.52%), abnormal or suspicious for a developmental delay (15.19%, 41/270) in 17 children (31.48%), and indicated a developmental delay (4.07%, 11/270) in seven children (12.96%). There were no significant differences in developmental delay between children prenatally exposed to telbivudine and controls (p>0.05). HBV vertical transmission was successfully blocked in all infants. The effective HBV vaccination rate was 98.15% (53/54). The growth and development of children prenatally exposed to telbivudine was normal, indicating that telbivudine treatment during pregnancy is safe and effective. Copyright © 2015. Published by Elsevier Ltd.

  12. Fetal Growth and Neurobehavioral Outcomes in Childhood

    PubMed Central

    Chatterji, Pinka; Lahiri, Kajal; Kim, Dohyung

    2014-01-01

    Using a sample of sibling pairs from a nationally representative U.S. survey, we examine the effects of the fetal growth rate on a set of neurobehavioral outcomes in childhood measured by parent-reported diagnosed developmental disabilities and behavior problems. Based on models that include mother fixed effects, we find that the fetal growth rate, a marker for the fetal environment, is negatively associated with lifetime diagnosis of developmental delay. We also find that the fetal growth rate is negatively associated with disruptive behaviors among male children. These results suggest that developmental disabilities and problem behaviors may play a role in explaining the well-documented association between birth weight and human capital outcomes measured in adulthood. PMID:25464342

  13. Delayed cerebral development in twins with congenital hyperthyroidism.

    PubMed

    Kopelman, A E

    1983-09-01

    Twins had congenital hyperthyroidism and delayed cerebral development manifested as ventriculomegaly, increased space in the interhemispheric fissure, and an exaggerated gyral pattern on cranial computed tomographic scans. At 3 1/2 years of age, both children had delayed development. Fetal and neonatal hyperthyroidism may interfere with normal brain growth and maturation with both neuranatomic and developmental sequelae.

  14. CO2 induced seawater acidification impacts sea urchin larval development I: elevated metabolic rates decrease scope for growth and induce developmental delay.

    PubMed

    Stumpp, M; Wren, J; Melzner, F; Thorndyke, M C; Dupont, S T

    2011-11-01

    Anthropogenic CO(2) emissions are acidifying the world's oceans. A growing body of evidence is showing that ocean acidification impacts growth and developmental rates of marine invertebrates. Here we test the impact of elevated seawater pCO(2) (129 Pa, 1271 μatm) on early development, larval metabolic and feeding rates in a marine model organism, the sea urchin Strongylocentrotus purpuratus. Growth and development was assessed by measuring total body length, body rod length, postoral rod length and posterolateral rod length. Comparing these parameters between treatments suggests that larvae suffer from a developmental delay (by ca. 8%) rather than from the previously postulated reductions in size at comparable developmental stages. Further, we found maximum increases in respiration rates of +100% under elevated pCO(2), while body length corrected feeding rates did not differ between larvae from both treatments. Calculating scope for growth illustrates that larvae raised under high pCO(2) spent an average of 39 to 45% of the available energy for somatic growth, while control larvae could allocate between 78 and 80% of the available energy into growth processes. Our results highlight the importance of defining a standard frame of reference when comparing a given parameter between treatments, as observed differences can be easily due to comparison of different larval ages with their specific set of biological characters. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Acute exposure to tris (2-butoxyethyl) phosphate (TBOEP) affects growth and development of embryo-larval zebrafish.

    PubMed

    Liu, Yiran; Wu, Ding; Xu, Qinglong; Yu, Liqin; Liu, Chunsheng; Wang, Jianghua

    2017-10-01

    Tris (2-butoxyethyl) phosphate (TBOEP), is used as a flame retardant worldwide. It is an additive in materials and can be easily discharged into the surrounding environment. There is evidence linking TBOEP exposure to abnormal development and growth in zebrafish embryos/larvae. Here, using zebrafish embryo as a model, we investigated toxicological effects on developing zebrafish (Danio rerio) caused by TBOEP at concentrations of 0, 20, 200, 1000, 2000μg/L starting from 2h post-fertilization (hpf). Our findings revealed that TBOEP exposure caused developmental toxicity, such as malformation, growth delay and decreased heart rate in zebrafish larvae. Correlation analysis indicated that inhibition of growth was possibly due to down-regulation of expression of genes related to the growth hormone/insulin-like growth factor (GH/IGF) axis. Furthermore, exposure to TBOEP significantly increased thyroxine (T4) and 3,5,3'-triiodothyronine (T3) in whole larvae. In addition, changed expression of genes involved in the hypothalamic-pituitary-thyroid (HPT) axis was observed, indicating that perturbation of HPT axis might be responsible for the developmental damage and growth delay induced by TBOEP. The present study provides a new set of evidence that exposure of embryo-larval zebrafish to TBOEP can cause perturbation of GH/IGF axis and HPT axis, which could result in developmental impairment and growth inhibition. Copyright © 2017. Published by Elsevier B.V.

  16. Measuring functional developmental delay in infants and young children: prevalence rates from the NHIS-D.

    PubMed

    Simpson, Gloria A; Colpe, Lisa; Greenspan, Stanley

    2003-01-01

    In order to measure the prevalence of developmental delay among US infants and children, two types of questions were asked of parents in the 1994-95 National Health Interview Survey on Disability (NHIS-D). To measure functional delay (FD), questions from the Functional Developmental Growth Chart (FDQ), which measures specific age-appropriate tasks, were used. General delay (GD) was defined using the general type of questions about developmental delay that had been used in previous surveys. Using a nationally representative sample of 15 291 infants and children aged 4-59 months from the NHIS-D, analyses revealed that, according to these questions, approximately 3.3% had FD and 3.4% of the children had GD. However, only one-third of the children were identified by both sets of questions. Thus, two-thirds of the children identified as having FD were not recognised by their parents as having a delay. Conversely, many parents responded to the GD questions indicating that their child had a delay, but failed to indicate that their child had a functional problem. In addition, only 17% of the children with FD and 31% of those with GD were receiving special services. Multivariable logistic regression analyses found that children with both FD and GD were more likely to be male and to be living in families with incomes below 200% of the poverty level. The findings suggest that the general types of developmental delay questions used in national surveys may not identify children with functional delays. As parents failed to identify these children, it is possible that many of these children may be slipping through paediatric surveillance. Further research to evaluate the use of these measures in population surveys is recommended.

  17. First Steps for Early Success: State Strategies to Support Developmental Screening in Early Childhood Settings

    ERIC Educational Resources Information Center

    Johnson-Staub, Christine

    2014-01-01

    Young children's development occurs along a continuum, with milestones reached at ages that vary within an accepted timeframe. Milestones not met within the expected timeframe can raise concerns about developmental delays, health conditions, or other factors contributing negatively to the child's growth and learning. Monitoring children's…

  18. Cushing disease in a toddler: not all obese children are just fat.

    PubMed

    Moriarty, Megan; Hoe, Francis

    2009-08-01

    Cushing disease is exceedingly rare in children, especially in those under the age of 2 years. This case report describes an 18-month-old female child who presented with morbid obesity, decreased linear growth, and reversal of developmental milestones. Her diagnosis was delayed; however, she was successfully treated by surgical excision of the microadenoma. This was followed by resolution of signs and symptoms of Cushing syndrome. Although the patient's hypertension resolved, linear growth improved and development began to progress, she is still developmentally delayed and now has hypopituitarism. Review of this case, as well as a handful of other cases of infantile Cushing disease in the literature, suggests that features such as hypertension and slowed linear growth, which are rare in nutritional causes of obesity in infants, can help identify this rare, but life-threatening, illness among an increasing number of overweight infants.

  19. Perfluorooctanoic acid (PFOA)-induced developmental toxicity in the mouse is dependent on expression of peroxisome proliferator activated receptor-alpha (PPAR-α)

    EPA Science Inventory

    PFOA is a member of a family of perfluorinated chemicals that have a variety of applications. PFOA persists in the environment and is found in wildlife and humans. In mice, PFOA is developmentally toxic producing mortality, delayed eye opening, growth deficits, and altered puber...

  20. Phenotypic Dichotomy Following Developmental Exposure to Perfluorooctanic Acid (PFOA) Exposure in CD-1 Mice: Low Doses Induce Elevated Serum, Leptin, Insulin, and Overweight in Mid-Life.

    EPA Science Inventory

    The synthetic surfactant, perfluorooctanoic acid (PFOA) is a proven developmental toxicant in mice, causing prenatal pregnancy loss, increased neonatal mortality, delayed eye opening, and abnormal mammary gland growth in animals exposed during fetal life. PFOA is found in the ser...

  1. Growth and development in internationally adopted children: extent and timing of recovery after early adversity.

    PubMed

    Palacios, Jesús; Román, Maite; Camacho, Carlos

    2011-03-01

    Following initial adversity, internationally adopted children arrive with significant growth and developmental delays. Post-placement recovery has been widely documented, but little has been known about its extent and timing several years after placement and in children with diverse pre-adoptive experiences. A total of 289 children adopted from six countries into Spanish families were studied. Growth and psychological development were considered on arrival and after an average of over 3 years. Growth and developmental initial delays affected a substantial percentage of the children. Post-adoption recovery seemed quicker and more complete in weight and height than in head circumference and psychological development. Initial and later values were correlated, but growth-development relation on arrival subsequently lost significance. Most of the catch-up happened in the first three post-adoption years. Adoption offers an impressive opportunity for recovery after previous adversity, although continuity between past and present persists. The improvement is more marked in some areas than in others and more substantial in the first post-adoption years. © 2010 Blackwell Publishing Ltd.

  2. Parenting Practices and Associations with Development Delays among Young Children in Dominican Republic.

    PubMed

    Uwemedimo, Omolara Thomas; Howlader, Afrin; Pierret, Giselina

    According to the World Health Organization, >200 million children in low- and middle-income countries experience developmental delays. However, household structure and parenting practices have been minimally explored as potential correlates of developmental delay in low- and middle-income countries, despite potential as areas for intervention. The objective of the study was to examine associations of developmental delays with use of World Health Organization-recommended parenting practices among a clinic-based cohort of children aged 6-60 months attending in La Romana, Dominican Republic. This study was conducted among 74 caregiver-child pairs attending the growth-monitoring clinic at Hospital Francisco Gonzalvo in June 2015. The Malawi Developmental Assessment Tool was adapted and performed on each child to assess socioadaptive, fine motor, gross motor, and language development. The IMCI Household Level Survey Questionnaire was used to assess parenting practices. Fisher's exact test was used to determine associations significant at P < .05. Significant variables were then entered into a multivariable logistic regression. Almost two-thirds of children had a delay in at least 1 developmental domain. Most caregivers used scolding (43.2%) or spanking (44%) for child discipline. Children who were disciplined by spanking and scolding were more likely to have language delay (P = .007) and socioadaptive delay (P = .077), respectively. On regression analysis, children with younger primary caregivers had 7 times higher odds of language delay (adjusted odds ratio [AOR]: 7.35, 95% confidence interval [CI]: 1.52-35.61) and 4 times greater odds of any delay (AOR: 4.72, 95% CI: 1.01-22.22). In addition, children punished by spanking had 5 times higher odds of having language delay (AOR: 5.04, 95% CI: 1.13-22.39). Parenting practices such as harsh punishment and lack of positive parental reinforcement were found to have strong associations with language and socioadaptive delays. Likewise, delays were also more common among children with younger caregivers. Copyright © 2017 Icahn School of Medicine at Mount Sinai. Published by Elsevier Inc. All rights reserved.

  3. [Characteristics of growth and development in children from families at social risk].

    PubMed

    Stojadinović, A

    2001-01-01

    Body height and weight are important indicators of children's health status. There are many evidences that children from disadvantaged families have lower height and weight than children of the same age from families without social risk. The aim of this study was to investigate characteristics of growth and development of children from economically disadvantaged families. The study was partly retrospective and partly prospective. The retrospective study included 509 children from disadvantaged families hospitalized at the Institute of Child and Adolescent Health Care in Novi Sad, during a five-year period. The prospective study included 90 children from disadvantaged families (experimental group) and 132 children from families without social risk (control group) hospitalized at the Institute during a six month period. Height/length, weight, head circumference, and psychomotor/intellectual development have been examined. In the retrospective study results were compared with theoretically expected values, whereas the prospective study results of experimental and control group were compared. In the retrospective study that included only children from disadvantaged families, 136 (26.7%) children had height/length, 173 (34%) had weight, and 86 (16.9%) children had head circumference below 10th percentile. Delay in psychomotor/intellectual development was established in 177 (34.8%) children. Children from families with social risk have significantly more often height/length, weight, head circumference and developmental delay than theoretically expected. In the prospective study 40 (44.4%) children from experimental group had height/length, 29 (32.2%) had weight, 20 (22.2%) children had head circumference below 10th percentile, and 17 (26.2%) had delay in psychomotor/intellectual development. Children from disadvantaged families (experimental group) significantly more often had delay in growth and development comparing with children from families without social risk (control group). Children from disadvantaged families significantly more often exhibit delay in growth and development, comparing with children of the same age from families without social risk. Therefore, pediatricians should consider social risk factors whenever treating children with growth or developmental delay.

  4. A rare case of short stature: Say Meyer syndrome.

    PubMed

    Karthik, T S; Prasad, N Rajendra; Rani, P Radha; Maheshwari, Rushikesh; Reddy, P Amaresh; Chakradhar, B V S; Menon, Bindu

    2013-10-01

    Say Meyer syndrome is rare X linked condition characterized by developmental delay, short stature and metopic suture synostosis. We are reporting a case of Say Meyer syndrome presented to our hospital for short stature and developmental delay at age 3½ years. A 3½-year-old boy presented to our hospital for decreased growth velocity from the age of 1 year. History revealed the boy had a birth weight of 2.3 kg, had an episode of seizures in the neonatal period. He was born to non-consanguineous marriage. He had global developmental delay and there was a lack of bowel and bladder control. History did not reveal any hearing or visual impairment. No history of any chronic systemic illnesses. Magnetic resonance imaging (MRI) brain revealed mild diffuse frontotemporal atrophy with multiple irregular gliotic areas in bilateral frontal lobes. Diffuse white matter volume loss in bilateral cerebral hemispheres. Diffuse thinning of corpus callosum. Diffuse periventricular hyper intensity on T2W and fluid attenuated inversion recovery sequences. Say Meyer syndrome is rare X linked condition characterized by developmental delay, short stature and metopic suture synostosis. Characteristic MRI brain findings include diffuse frontotemporal atrophy with multiple gliotic areas in frontal lobes. Diffuse white matter volume loss in bilateral cerebral hemispheres.

  5. Growth and development of very low birth weight infants aged 18-24 months at Queen Sirikit National Institute of Child Health.

    PubMed

    Sangtawesin, Varaporn; Singarj, Yupayao; Kanjanapattanakul, Wiboon

    2011-08-01

    The number of very low birth weight (VLBW) births is increasing worldwide. Despite better care in recent years, they have a high incidence of delayed growth and development. There are no previous studies regarding the growth and development of these infants at Queen Sirikit National Institute of Child Health (QSNICH). To study growth and developmental outcome of VLBW infants, aged 18-24 months who were discharged from QSNICH. VLBW infants who were discharged from QSNICH during the year 2007 were recruited in the study. Patients with chromosomal abnormalities, major congenital anomalies, definite congenital infections and positive maternal anti-HIV tests were excluded. At the corrected age of 18-24 months, the parents were called upon to bring their infants for complete physical examination and developmental evaluation on 2 occasions, two months apart. There were 111 cases of VLBW infants who were discharged from QSNICH during the year 2007. Fifty-four patients were eligible for the present study. Thirty cases (55.56%) were contacted for the first examination. During this examination, there were 3 cases (10%) with low head circumference, 1 case (3.33%) with poor weight gain, 5 cases (16.67%) with visual defect, 1 case (3.33%) with moderately severe hearing loss, 1 case (3.33%) with cerebral palsy and 7 cases (23.33%) with delayed development. Twenty-one cases could be recalled for a second evaluation. Two of the 5 cases had delayed language development. There were no cases with hydrocephalous, blindness or profound hearing loss. VLBW infants at QSNICH had much better survival during recent years. Most of these survivors had normal growth and development. Those with delayed growth and development need aggressive intervention and long-term follow-up for enhancement of quality of their lives.

  6. Growth Coordination During Drosophila melanogaster Imaginal Disc Regeneration Is Mediated by Signaling Through the Relaxin Receptor Lgr3 in the Prothoracic Gland.

    PubMed

    Jaszczak, Jacob S; Wolpe, Jacob B; Bhandari, Rajan; Jaszczak, Rebecca G; Halme, Adrian

    2016-10-01

    Damage to Drosophila melanogaster imaginal discs activates a regeneration checkpoint that (1) extends larval development and (2) coordinates the regeneration of the damaged disc with the growth of undamaged discs. These two systemic responses to damage are both mediated by Dilp8, a member of the insulin/insulin-like growth factor/relaxin family of peptide hormones, which is released by regenerating imaginal discs. Growth coordination between regenerating and undamaged imaginal discs is dependent on Dilp8 activation of nitric oxide synthase (NOS) in the prothoracic gland (PG), which slows the growth of undamaged discs by limiting ecdysone synthesis. Here we demonstrate that the Drosophila relaxin receptor homolog Lgr3, a leucine-rich repeat-containing G-protein-coupled receptor, is required for Dilp8-dependent growth coordination and developmental delay during the regeneration checkpoint. Lgr3 regulates these responses to damage via distinct mechanisms in different tissues. Using tissue-specific RNA-interference disruption of Lgr3 expression, we show that Lgr3 functions in the PG upstream of NOS, and is necessary for NOS activation and growth coordination during the regeneration checkpoint. When Lgr3 is depleted from neurons, imaginal disc damage no longer produces either developmental delay or growth inhibition. To reconcile these discrete tissue requirements for Lgr3 during regenerative growth coordination, we demonstrate that Lgr3 activity in both the CNS and PG is necessary for NOS activation in the PG following damage. Together, these results identify new roles for a relaxin receptor in mediating damage signaling to regulate growth and developmental timing. Copyright © 2016 by the Genetics Society of America.

  7. Variation in chemical composition and allelopathic potential of mixoploid Trigonella foenum-graecum L. with developmental stages.

    PubMed

    Omezzine, Faten; Bouaziz, Mohamed; Simmonds, Monique S J; Haouala, Rabiaa

    2014-04-01

    This study was conducted to evaluate the influence of developmental stages (vegetative, flowering and fruiting) of mixoploid fenugreek aerial parts on their chemical composition and allelopathic potential, assessed on lettuce germination and seedling growth. Aqueous and organic extracts significantly delayed germination, reduced its rate and affected seedling growth. Ethyl acetate and methanol extracts of aerial parts harvested at vegetative stage were the most toxic for lettuce germination and seedling growth, respectively. LC-MS/MS analysis of T. foenum-graecum aerial parts methanolic extract showed nine different flavonol glycosides (quercetin and kaempferol glucosides). Chemical composition of aerial parts differed with the developmental stage; indeed, at the vegetative and fruiting stages, analysis revealed the presence of 9 compounds as compared to only 6 compounds at the flowering stage. Thus, it is necessary to follow the qualitative changes of allelochemicals production at different developmental stages to identify the most productive one. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Growth and development of children with congenital heart disease.

    PubMed

    Chen, Chi-Wen; Li, Chung-Yi; Wang, Jou-Kou

    2004-08-01

    Children with congenital heart disease (CHD) commonly experience delayed growth. Because growth and development are closely related, both should be considered when a child's progress is examined. This paper reports a study to evaluate and compare the growth and development of preschool children with CHD to those of normal preschool children. The heights and weights of 42 preschool children with CHD and 116 normal preschool children were compared with standard growth curves. Differences in development of personal and social skills, fine motor skills and adaptability, language, and gross motor skills were evaluated. Developmental skills were assessed using the Denver Developmental Screening Test II. A significant difference was found in both body height (P < 0.05) and weight (P < 0.05) between the two groups. More preschoolers with congenital hear disease were below the 50th percentile in height (P < 0.05) and weight (P < 0.001). Preschoolers with CHD had more suspicious interpretations than non-CHD preschoolers, specifically in the language (P < 0.01) and gross motor sections (P < 0.001). Nevertheless, there were two items in the personal-social section and one in the language section on which the children with heart disease passed in the range of 55.6-63.2%. Problems were encountered with the Denver II test because of differences in language, culture and childrearing methods between Taiwanese and Western societies. These cultural differences must be considered when the test is used to assess development. Learning about the growth and developmental differences between children with CHD and normal children may help parents of the former to detect problems associated with delayed growth and development earlier. These children and their families should have the opportunity to participate in a long-term, follow-up programme that provides information and encourages developmental progress. The results could serve as a reference for those in both clinical and community workers who provide nursing care to children with CHD.

  9. Identification of a pathogenic FTO mutation by next-generation sequencing in a newborn with growth retardation and developmental delay.

    PubMed

    Daoud, Hussein; Zhang, Dong; McMurray, Fiona; Yu, Andrea; Luco, Stephanie M; Vanstone, Jason; Jarinova, Olga; Carson, Nancy; Wickens, James; Shishodia, Shifali; Choi, Hwanho; McDonough, Michael A; Schofield, Christopher J; Harper, Mary-Ellen; Dyment, David A; Armour, Christine M

    2016-03-01

    A homozygous loss-of-function mutation p.(Arg316Gln) in the fat mass and obesity-associated (FTO) gene, which encodes for an iron and 2-oxoglutarate-dependent oxygenase, was previously identified in a large family in which nine affected individuals present with a lethal syndrome characterised by growth retardation and multiple malformations. To date, no other pathogenic mutation in FTO has been identified as a cause of multiple congenital malformations. We investigated a 21-month-old girl who presented distinctive facial features, failure to thrive, global developmental delay, left ventricular cardiac hypertrophy, reduced vision and bilateral hearing loss. We performed targeted next-generation sequencing of 4813 clinically relevant genes in the patient and her parents. We identified a novel FTO homozygous missense mutation (c.956C>T; p.(Ser319Phe)) in the affected individual. This mutation affects a highly conserved residue located in the same functional domain as the previously characterised mutation p.(Arg316Gln). Biochemical studies reveal that p.(Ser319Phe) FTO has reduced 2-oxoglutarate turnover and N-methyl-nucleoside demethylase activity. Our findings are consistent with previous reports that homozygous mutations in FTO can lead to rare growth retardation and developmental delay syndrome, and further support the proposal that FTO plays an important role in early development of human central nervous and cardiovascular systems. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  10. International adoption: a health and developmental prospective.

    PubMed

    Mason, Patrick; Narad, Christine

    2005-02-01

    Adoptions from international countries have become an option for many US families, with over 150,000 children adopted in the past 14 years. Typically, internationally adopted children present with a host of medical and developmental concerns. Issues such as growth stunting, abnormal behaviors, and significant delays in motor, speech, and language development are likely directly related to the prenatal and early postnatal environment experienced prior to adoption. The new family and its health-care team must quickly work to identify and address these issues to aid the child's integration into his or her new family. This article will examine potential issues seen in children who are being adopted, including the impact of early environment on subsequent development. We will summarize early and long-term medical issues and review the extent of developmental delays seen in children adopted internationally. Finally, we will discuss possible mechanisms leading to the observed delays, including the impact of stress on subsequent development. By understanding the extent of expected delays and the mechanisms likely causing the issues, the health-care team will be in a good position to quickly identify and develop intervention protocols that will foster the child's assimilation into his or her new family.

  11. A Community-based Study on Growth and Development of Under-Five Children in an Urbanized Village of South Delhi.

    PubMed

    Dabar, Deepti; Das, Ranjan; Nagesh, Seetharamaiya; Yadav, Vikas; Mangal, Abha

    2016-12-01

    Optimal development of children in their early months and years has a bearing on their achievement levels later in life. To assess the socio-emotional and cognitive development in children 0-5 years and to find out the proportion of children having developmental delay and its associated factors. A community-based cross-sectional study was carried out in 520 children in Delhi. Development was assessed using the Indian Council for Medical Research Development Screening Test. In all, 10.6% of children <5 years old were found to be developmentally delayed. Maximum number of children (10.1%) were found to have a delay in the do main of 'hearing language, concept development'. Of all the factors, the strongest association was found with stunting, paternal education, alcohol abuse, attendance in anganwadi/playschool. The study concludes that developmental delay is present in a sizable proportion of children <5 years of age and may be a significant factor in the overall achievement of life's potential in them. © The Author [2016]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Contribution of parenting to complex syntax development in preschool children with developmental delays or typical development.

    PubMed

    Moody, C T; Baker, B L; Blacher, J

    2018-05-10

    Despite studies of how parent-child interactions relate to early child language development, few have examined the continued contribution of parenting to more complex language skills through the preschool years. The current study explored how positive and negative parenting behaviours relate to growth in complex syntax learning from child age 3 to age 4 years, for children with typical development or developmental delays (DDs). Participants were children with or without DD (N = 60) participating in a longitudinal study of development. Parent-child interactions were transcribed and coded for parenting domains and child language. Multiple regression analyses were used to identify the contribution of parenting to complex syntax growth in children with typical development or DD. Analyses supported a final model, F(9,50) = 11.90, P < .001, including a significant three-way interaction between positive parenting behaviours, negative parenting behaviours and child delay status. This model explained 68.16% of the variance in children's complex syntax at age 4. Simple two-way interactions indicated differing effects of parenting variables for children with or without DD. Results have implications for understanding of complex syntax acquisition in young children, as well as implications for interventions. © 2018 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.

  13. Differentiation of Speech Delay and Global Developmental Delay in Children Using DTI Tractography-Based Connectome.

    PubMed

    Jeong, J-W; Sundaram, S; Behen, M E; Chugani, H T

    2016-06-01

    Pure speech delay is a common developmental disorder which, according to some estimates, affects 5%-8% of the population. Speech delay may not only be an isolated condition but also can be part of a broader condition such as global developmental delay. The present study investigated whether diffusion tensor imaging tractography-based connectome can differentiate global developmental delay from speech delay in young children. Twelve children with pure speech delay (39.1 ± 20.9 months of age, 9 boys), 14 children with global developmental delay (39.3 ± 18.2 months of age, 12 boys), and 10 children with typical development (38.5 ± 20.5 months of age, 7 boys) underwent 3T DTI. For each subject, whole-brain connectome analysis was performed by using 116 cortical ROIs. The following network metrics were measured at individual regions: strength (number of the shortest paths), efficiency (measures of global and local integration), cluster coefficient (a measure of local aggregation), and betweeness (a measure of centrality). Compared with typical development, global and local efficiency were significantly reduced in both global developmental delay and speech delay (P < .0001). The nodal strength of the cognitive network is reduced in global developmental delay, whereas the nodal strength of the language network is reduced in speech delay. This finding resulted in a high accuracy of >83% ± 4% to discriminate global developmental delay from speech delay. The network abnormalities identified in the present study may underlie the neurocognitive and behavioral consequences commonly identified in children with global developmental delay and speech delay. Further validation studies in larger samples are required. © 2016 by American Journal of Neuroradiology.

  14. Large Area Crop Inventory Experiment (LACIE). Evaluation of the LACIE transition year crop calendar model. [Wheat growth in the Great Plains Corridor, North America

    NASA Technical Reports Server (NTRS)

    Cheffin, R. E.; Woolley, S. K. (Principal Investigator)

    1979-01-01

    The author has identified the following significant results. The estimates of developmental stage dates from the LACIE adjustable crop calendar (ACC) winter wheat model was somewhat more accurate than the historical crop calendar after jointing. The ACC winter wheat model was not so accurate for the Texas Panhandle as it was for the other areas of the USPG-7 because dry soil conditions delayed fall planting in the Panhandle. Since the LACIE ACC winter wheat model does not contain a moisture term and it was started with historical planting dates, lengthy delays in planting mean that the ACC model will probably be started early and will estimate the developmental growth stages to occur too early in the season. The LACIE ACC spring wheat model was also started early in most areas because of late planting due to fields wet from melting snow and rain. The starter model used to estimate spring planting dates was not accurate under these wet soil conditions and tended to predict the developmental stages to occur earlier than the dates observed in the fields.

  15. Persistent G. lamblia impairs growth in a murine malnutrition model

    PubMed Central

    Bartelt, Luther A.; Roche, James; Kolling, Glynis; Bolick, David; Noronha, Francisco; Naylor, Caitlin; Hoffman, Paul; Warren, Cirle; Singer, Steven; Guerrant, Richard

    2013-01-01

    Giardia lamblia infections are nearly universal among children in low-income countries and are syndemic with the triumvirate of malnutrition, diarrhea, and developmental growth delays. Amidst the morass of early childhood enteropathogen exposures in these populations, G. lamblia–specific associations with persistent diarrhea, cognitive deficits, stunting, and nutrient deficiencies have demonstrated conflicting results, placing endemic pediatric giardiasis in a state of equipoise. Many infections in endemic settings appear to be asymptomatic/subclinical, further contributing to uncertainty regarding a causal link between G. lamblia infection and developmental delay. We used G. lamblia H3 cyst infection in a weaned mouse model of malnutrition to demonstrate that persistent giardiasis leads to epithelial cell apoptosis and crypt hyperplasia. Infection was associated with a Th2-biased inflammatory response and impaired growth. Malnutrition accentuated the severity of these growth decrements. Faltering malnourished mice exhibited impaired compensatory responses following infection and demonstrated an absence of crypt hyperplasia and subsequently blunted villus architecture. Concomitantly, severe malnutrition prevented increases in B220+ cells in the lamina propria as well as mucosal Il4 and Il5 mRNA in response to infection. These findings add insight into the potential role of G. lamblia as a “stunting” pathogen and suggest that, similarly, malnourished children may be at increased risk of G. lamblia–potentiated growth decrements. PMID:23728173

  16. Persistent G. lamblia impairs growth in a murine malnutrition model.

    PubMed

    Bartelt, Luther A; Roche, James; Kolling, Glynis; Bolick, David; Noronha, Francisco; Naylor, Caitlin; Hoffman, Paul; Warren, Cirle; Singer, Steven; Guerrant, Richard

    2013-06-01

    Giardia lamblia infections are nearly universal among children in low-income countries and are syndemic with the triumvirate of malnutrition, diarrhea, and developmental growth delays. Amidst the morass of early childhood enteropathogen exposures in these populations, G. lamblia–specific associations with persistent diarrhea, cognitive deficits, stunting, and nutrient deficiencies have demonstrated conflicting results, placing endemic pediatric giardiasis in a state of equipoise. Many infections in endemic settings appear to be asymptomatic/ subclinical, further contributing to uncertainty regarding a causal link between G. lamblia infection and developmental delay. We used G. lamblia H3 cyst infection in a weaned mouse model of malnutrition to demonstrate that persistent giardiasis leads to epithelial cell apoptosis and crypt hyperplasia. Infection was associated with a Th2-biased inflammatory response and impaired growth. Malnutrition accentuated the severity of these growth decrements. Faltering malnourished mice exhibited impaired compensatory responses following infection and demonstrated an absence of crypt hyperplasia and subsequently blunted villus architecture. Concomitantly, severe malnutrition prevented increases in B220+ cells in the lamina propria as well as mucosal Il4 and Il5 mRNA in response to infection. These findings add insight into the potential role of G. lamblia as a "stunting" pathogen and suggest that, similarly, malnourished children may be at increased risk of G. lamblia– potentiated growth decrements.

  17. CDK10 Mutations in Humans and Mice Cause Severe Growth Retardation, Spine Malformations, and Developmental Delays.

    PubMed

    Windpassinger, Christian; Piard, Juliette; Bonnard, Carine; Alfadhel, Majid; Lim, Shuhui; Bisteau, Xavier; Blouin, Stéphane; Ali, Nur'Ain B; Ng, Alvin Yu Jin; Lu, Hao; Tohari, Sumanty; Talib, S Zakiah A; van Hul, Noémi; Caldez, Matias J; Van Maldergem, Lionel; Yigit, Gökhan; Kayserili, Hülya; Youssef, Sameh A; Coppola, Vincenzo; de Bruin, Alain; Tessarollo, Lino; Choi, Hyungwon; Rupp, Verena; Roetzer, Katharina; Roschger, Paul; Klaushofer, Klaus; Altmüller, Janine; Roy, Sudipto; Venkatesh, Byrappa; Ganger, Rudolf; Grill, Franz; Ben Chehida, Farid; Wollnik, Bernd; Altunoglu, Umut; Al Kaissi, Ali; Reversade, Bruno; Kaldis, Philipp

    2017-09-07

    In five separate families, we identified nine individuals affected by a previously unidentified syndrome characterized by growth retardation, spine malformation, facial dysmorphisms, and developmental delays. Using homozygosity mapping, array CGH, and exome sequencing, we uncovered bi-allelic loss-of-function CDK10 mutations segregating with this disease. CDK10 is a protein kinase that partners with cyclin M to phosphorylate substrates such as ETS2 and PKN2 in order to modulate cellular growth. To validate and model the pathogenicity of these CDK10 germline mutations, we generated conditional-knockout mice. Homozygous Cdk10-knockout mice died postnatally with severe growth retardation, skeletal defects, and kidney and lung abnormalities, symptoms that partly resemble the disease's effect in humans. Fibroblasts derived from affected individuals and Cdk10-knockout mouse embryonic fibroblasts (MEFs) proliferated normally; however, Cdk10-knockout MEFs developed longer cilia. Comparative transcriptomic analysis of mutant and wild-type mouse organs revealed lipid metabolic changes consistent with growth impairment and altered ciliogenesis in the absence of CDK10. Our results document the CDK10 loss-of-function phenotype and point to a function for CDK10 in transducing signals received at the primary cilia to sustain embryonic and postnatal development. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schimmenti, L.A.; Berry, S.A.; Tuchman, M.

    The authors report on a male infant with developmental delay, growth failure, hypotonia, dolichocephaly, hypoplastic midface, epicanthal folds, down-slanting palpebral fissures, foveal hypoplasia, tracheomalacia, pectus excavatum, supraventricular tachycardia, gut malrotation, hypospadias, talipes equinovarus, short third metatarsals, capillary hemangiomata, and a de novo terminal deletion at 9q34.3.

  19. An epidemiological study of urban and rural children in Pakistan: examining the relationship between delayed psychomotor development, low birth weight and postnatal growth failure.

    PubMed

    Avan, Bilal I; Raza, Syed A; Kirkwood, Betty R

    2015-03-01

    Low birth weight is known to be associated with postnatal growth failure. It is not yet established that both conditions are determinants of psychomotor development. The study investigated whether or not low birth weight leads to delayed psychomotor development of a child, and whether it can be mitigated by adequate postnatal growth. A cross-sectional study was conducted in 2002 in 15 rural and 11 urban communities of Sindh province, Pakistan. Assessment of 1234 children less than 3 years of age included Bayley's Scale of Infant Development II, socioeconomic questionnaire and anthropometry; WHO standards were used to calculate z-scores of height-for-age, weight-for-height and weight-for-age. The underlying study hypotheses were tested through multiple regression modelling. Out of 1219 children, 283 (23.2%) had delayed psychomotor development and 639 (52.4%) were undernourished according to the composite index of anthropometric failure. Strong negative associations with the psychomotor development index were detected between stunting and being underweight, with a larger magnitude of effect for stunting (p<0.001). The strong relationship persisted even when the analysis was restricted to non-malnourished children. The psychomotor index increased by 2.07 points with every unit increase in height-for-age z-score. The relationship between low birth weight and psychomotor development appears to be mediated largely by postnatal growth and nutritional status. This association suggests that among undernourished children there is significant likelihood of a group that is developmentally delayed. It is important to emphasize developmental needs in programmes that target underprivileged children. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Long-Term Neurodevelopmental Outcome of Neonates with Hypernatremic Dehydration.

    PubMed

    Boskabadi, Hassan; Akhondian, Javad; Afarideh, Maliheh; Maamouri, Gholamali; Bagheri, Sepideh; Parizadeh, Seyyed Mostafa; Mobarhan, Majid Ghayour; Mohammadi, Shabnam; Frens, Gordon A A

    2017-04-01

    Neonatal hypernatremic dehydration (NHD) is a dangerous condition that can lead to severe weight loss, renal impairment, and central nervous system complications. We aimed to evaluate the consequences of NHD in infants in their second year of life. This was a prospective case-control study in Ghaem hospital, Mashhad, Iran. Sixty-five healthy breastfed neonates (serum sodium concentration <150 mmol/L) and 65 hypernatremic (serum sodium concentration ≥150 mmol/L) neonates were followed up from 2008 to 2011. Maternal and neonatal factors were compared between the two groups together with their growth parameters, and developmental milestones (using Denver II developmental assessment scores) were assessed and compared in ages 6, 12, 18, and 24 months, respectively. The weight of infants at 6 months of age was significantly different between the two groups (7,264 ± 1,089 g vs. 7,596 ± 957 g, p = 0.009). Twenty-five percent of infants in the group who had developed NHD had a delay in development at 6 months of age, with corresponding values of 21% at 12 months, 19% at 18 months, and 12% at 24 months of age. Developmental delay was ∼0.3% for the control group at similar ages. The severity of hypernatremia was strongly correlated with poor developmental outcome at 6 months (p = 0.001). Serum sodium concentration of neonates was 153-195 mg/dL in the NHD group. Median peak serum sodium was 158 ± 16 in case group and 141 ± 9 in control group. Serious complications were cerebral edema (five cases), hemorrhage (five cases), and kidney stones (six cases). Hypernatremic dehydration has an adverse effect on child development especially in the first year of life, their prevalence decreases with advanced age. Growth problems are also present during their first year of life. The major signs and symptoms of infants with poor prognosis on admission were poor feeding (8 infants, 61.5%), seizure (3 infants, 23.1%), hyperthermia (1 infant, 7.7%), and lethargy (1 infant, 7.7%). NHD affects growth parameters and developmental milestones of children. Occasionally the child's weight gain was normalized by the end of first year of life; although developmental delay continued, its severity was reduced, with age.

  1. Morphological plasticity reduces the effect of poor developmental conditions on fledging age in mourning doves

    PubMed Central

    Miller, David A.

    2010-01-01

    Developmental plasticity can be integral in adapting organisms to the environment experienced during growth. Adaptive plastic responses may be especially important in prioritizing development in response to stress during ontogeny. To evaluate this, I examined how developmental conditions for mourning doves related to early growth and how this affected fledging age, an important life-history transition for birds. The life history of mourning doves is consistent with strong selective pressure to minimize fledging age. Therefore, I predicted that in the face of nutritional stress associated with experimental brood-size increases, young would prioritize growth to structures that promote early fledging to reduce the effect of slowed overall growth on fledging age. Increasing brood size slowed overall structural growth of nestlings and affected the relative allocation of growth among different body parts. Total wing area was the best predictor of fledging age and individuals from larger broods had larger wings relative to overall body size. Although nestlings from larger broods fledged at later ages owing to slower overall growth, prioritization of wing growth reduced this effect by an estimated 1.6 days relative to the delay if plasticity among body parts had not occurred. This was an 11 per cent reduction in the predicted developmental time it took to reach this important life-history transition. Results demonstrate that preferential allocation to wing growth can affect the timing of this life-history transition and that morphological plasticity during development can have adaptive near-term effects during avian development. PMID:20129984

  2. Diagnosis of a terminal deletion of 4p with duplication of Xp22.31 in a patient with findings of Opitz G/BBB syndrome and Wolf-Hirschhorn syndrome.

    PubMed

    So, Joyce; Müller, Ines; Kunath, Melanie; Herrmann, Susanne; Ullmann, Reinhard; Schweiger, Susann

    2008-01-01

    Opitz G/BBB syndrome (OS) is a congenital midline malformation syndrome characterized by hypertelorism, hypospadias, cleft lip/palate, laryngotracheoesophageal abnormalities, imperforate anus, developmental delay and cardiac defects. The X-linked form is caused by mutations in the MID1 gene, while no gene has yet been identified for the autosomal dominant form. Here, we report on a 15-year-old boy who was referred for MID1 mutation analysis with findings typical of OS, including apparent hypertelorism, hypospadias, a history of feeding difficulties, dysphagia secondary to esophageal arteria lusoria, growth retardation and developmental delay. No MID1 mutation was found, but subsequent sub-megabase resolution array CGH unexpectedly documented a 2.34 Mb terminal 4p deletion, suggesting a diagnosis of WHS, and a duplication in Xp22.31. Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving terminal chromosome 4p deletions, in particular 4p16.3. WHS is characterized by typical facial appearance ("Greek helmet facies"), mental retardation, congenital hypotonia, and growth retardation. While the severity of developmental delay in this patient supports the diagnosis of WHS rather than OS, this case illustrates the striking similarities of clinical findings in seemingly unrelated syndromes, suggesting common or interacting pathways at the molecular and pathogenetic level. This is the first report of arteria lusoria (esophageal vascular ring) in a patient with WHS. (c) 2007 Wiley-Liss, Inc.

  3. Disposition of Perfluorooctanoic Acid (PFOA) in Pregnant and Lactating CD-1 Mice and Their Pups

    EPA Science Inventory

    Previous studies in mice prenatally-exposed to PFOA demonstrate growth and developmental effects, including impaired body weight gain and mammary gland development, delayed eye opening, and increased mortality. Those dose dependent effects appeared to worsen if offspring exposed ...

  4. The 12q14 microdeletion syndrome: six new cases confirming the role of HMGA2 in growth

    PubMed Central

    Lynch, Sally Ann; Foulds, Nicola; Thuresson, Ann-Charlotte; Collins, Amanda L; Annerén, Göran; Hedberg, Bernt-Oves; Delaney, Carol A; Iremonger, James; Murray, Caroline M; Crolla, John A; Costigan, Colm; Lam, Wayne; Fitzpatrick, David R; Regan, Regina; Ennis, Sean; Sharkey, Freddie

    2011-01-01

    We report six patients with array deletions encompassing 12q14. Out of a total of 2538 array investigations carried out on children with developmental delay and dysmorphism in three diagnostic testing centres, six positive cases yielded a frequency of 1 in 423 for this deletion syndrome. The deleted region in each of the six cases overlaps significantly with previously reported cases with microdeletions of this region. The chromosomal range of the deletions extends from 12q13.3q15. In the current study, we report overlapping deletions of variable extent and size but primarily comprising chromosomal bands 12q13.3q14.1. Four of the six deletions were confirmed as de novo events. Two cases had deletions that included HMGA2, and both children had significant short stature. Neither case had osteopoikilosis despite both being deleted for LEMD3. Four cases had deletions that ended proximal to HMGA2 and all of these had much better growth. Five cases had congenital heart defects, including two with atrial septal defects, one each with pulmonary stenosis, sub-aortic stenosis and a patent ductus. Four cases had moderate delay, two had severe developmental delay and a further two had a diagnosis of autism. All six cases had significant speech delay with subtle facial dysmorphism. PMID:21267005

  5. Behavior Problems in Toddlers with and without Developmental Delays: Comparison of Treatment Outcomes

    ERIC Educational Resources Information Center

    Holtz, Casey A.; Carrasco, Jennifer M.; Mattek, Ryan J.; Fox, Robert A.

    2009-01-01

    The purpose of this study is to examine the effectiveness of an in-home parent management program for toddlers with behavior problems and developmental delays by comparing outcomes for a group of toddlers with developmental delays (n = 27) and a group of toddlers without developmental delays (n = 27). The majority of children lived in single…

  6. Toddler Developmental Delays After Extensive Hospitalization: Primary Care Practitioner Guidelines.

    PubMed

    Lehner, Dana C; Sadler, Lois S

    2015-01-01

    This review investigated developmental delays toddlers may encounter after a lengthy pediatric hospitalization (30 days or greater). Physical, motor, cognitive, and psychosocial development of children aged 1 to 3 years was reviewed to raise awareness of factors associated with developmental delay after extensive hospitalization. Findings from the literature suggest that neonatal and pediatric intensive care unit (NICU/PICU) graduates are most at risk for developmental delays, but even non-critical hospital stays interrupt development to some extent. Primary care practitioners (PCPs) may be able to minimize risk for delays through the use of formal developmental screening tests and parent report surveys. References and resources are described for developmental assessment to help clinicians recognize delays and to educate families about optimal toddler development interventions. Pediatric PCPs play a leading role in coordinating health and developmental services for the young child following an extensive hospital stay.

  7. A Drosophila model for fetal alcohol syndrome disorders: role for the insulin pathway

    PubMed Central

    McClure, Kimberly D.; French, Rachael L.; Heberlein, Ulrike

    2011-01-01

    SUMMARY Prenatal exposure to ethanol in humans results in a wide range of developmental abnormalities, including growth deficiency, developmental delay, reduced brain size, permanent neurobehavioral abnormalities and fetal death. Here we describe the use of Drosophila melanogaster as a model for exploring the effects of ethanol exposure on development and behavior. We show that developmental ethanol exposure causes reduced viability, developmental delay and reduced adult body size. We find that flies reared on ethanol-containing food have smaller brains and imaginal discs, which is due to reduced cell division rather than increased apoptosis. Additionally, we show that, as in mammals, flies reared on ethanol have altered responses to ethanol vapor exposure as adults, including increased locomotor activation, resistance to the sedating effects of the drug and reduced tolerance development upon repeated ethanol exposure. We have found that the developmental and behavioral defects are largely due to the effects of ethanol on insulin signaling; specifically, a reduction in Drosophila insulin-like peptide (Dilp) and insulin receptor expression. Transgenic expression of Dilp proteins in the larval brain suppressed both the developmental and behavioral abnormalities displayed by ethanol-reared adult flies. Our results thus establish Drosophila as a useful model system to uncover the complex etiology of fetal alcohol syndrome. PMID:21303840

  8. Growth and development of children aged 1-5 years in low-intensity armed conflict areas in Southern Thailand: a community-based survey.

    PubMed

    Jeharsae, Rohani; Sangthong, Rassamee; Wichaidit, Wit; Chongsuvivatwong, Virasakdi

    2013-04-04

    A low-intensity armed conflict has been occurring for nearly a decade in southernmost region of Thailand. However, its impact on child health has not yet been investigated. This study aimed to estimate the prevalence of delayed child growth and development in the affected areas and to determine the association between the violence and health among children aged 1-5 years. A total of 498 children aged 1-5 years were recruited. Intensity of conflict for each sub-district was calculated as the 6-year average number of incidents per 100,000 population per year and classified into quartiles. Growth indices were weight-for-age, height-for-age, and weight-for-height, while development was measured by the Denver Development Screening Test II (Thai version). Food insecurity, child-rearing practice, health service accessibility, household sanitation, and depression among the caregivers were assessed using screening scales and questionnaires. Contextual information such as average income and numbers of violent events in each sub-district was obtained from external sources. Growth retardation was highly prevalent in the area as reported by rates of underweight, stunting, and wasting at 19.3%, 27.6% and 7.4%, respectively. The prevalence of developmental delay was also substantially high (37.1%). Multi-level analysis found no evidence of association between insurgency and health outcomes. However, children in areas with higher intensity of violence had a lower risk of delay in personal-social development (OR = 0.4; 95% CI = 0.2 - 0.9; p-value = 0.05). Unlike war refugees and internally-displaced persons in camp-like settings, the relationship between level of armed conflict and growth and developmental delay among children aged 1-5 years could not be demonstrated in the community setting of this study where food supply had been minimally perturbed.

  9. A Comparison of Motor Delays in Young Children: Autism Spectrum Disorder, Developmental Delay, and Developmental Concerns

    ERIC Educational Resources Information Center

    Provost, Beth; Lopez, Brian R.; Heimerl, Sandra

    2007-01-01

    This study assessed motor delay in young children 21-41 months of age with autism spectrum disorder (ASD), and compared motor scores in children with ASD to those of children without ASD. Fifty-six children (42 boys, 14 girls) were in three groups: children with ASD, children with developmental delay (DD), and children with developmental concerns…

  10. Developmental delays and dental caries in low-income preschoolers in the USA: a pilot cross-sectional study and preliminary explanatory model

    PubMed Central

    2013-01-01

    Background Anecdotal evidence suggests that low-income preschoolers with developmental delays are at increased risk for dental caries and poor oral health, but there are no published studies based on empirical data. The purpose of this pilot study was two-fold: to examine the relationship between developmental delays and dental caries in low-income preschoolers and to present a preliminary explanatory model on the determinants of caries for enrollees in Head Start, a U.S. school readiness program for low-income preschool-aged children. Methods Data were collected on preschoolers ages 3–5 years at two Head Start centers in Washington, USA (N = 115). The predictor variable was developmental delay status (no/yes). The outcome variable was the prevalence of decayed, missing, and filled surfaces (dmfs) on primary teeth. We used multiple variable Poisson regression models to test the hypothesis that within a population of low-income preschoolers, those with developmental delays would have increased dmfs prevalence than those without developmental delays. Results Seventeen percent of preschoolers had a developmental delay and 51.3% of preschoolers had ≥1 dmfs. Preschoolers with developmental delays had a dmfs prevalence ratio that was 1.26 times as high as preschoolers without developmental delays (95% CI: 1.01, 1.58; P < .04). Other factors associated with increased dmfs prevalence ratios included: not having a dental home (P = .01); low caregiver education (P < .001); and living in a non-fluoridated community (P < .001). Conclusions Our pilot data suggest that developmental delays among low-income preschoolers are associated with increased primary tooth dmfs. Additional research is needed to further examine this relationship. Future interventions and policies should focus on caries prevention strategies within settings like Head Start classrooms that serve low-income preschool-aged children with additional targeted home- and community-based interventions for those with developmental delays. PMID:24119240

  11. Neonatal morbidities and developmental delay in moderately preterm-born children.

    PubMed

    Kerstjens, Jorien M; Bocca-Tjeertes, Inger F; de Winter, Andrea F; Reijneveld, Sijmen A; Bos, Arend F

    2012-08-01

    Children born moderately preterm (32-35(6/7) weeks' gestation) are at increased risk of both neonatal morbidities and developmental delays in early childhood. It is unknown whether neonatal morbidities contribute to the increased risk of developmental delay. The objective of this study was to determine the effect of neonatal morbidities after moderately preterm birth on development at preschool age. In a community-based, stratified cohort, parents of 832 moderately preterm children born in 2002 or 2003 completed the Ages and Stage Questionnaire when their child was 43 to 49 months old. Data on Apgar scores, asphyxia, tertiary NICU admission, hospital transfer, circulatory insufficiency, hypoglycemia, septicemia, mechanical ventilation, continuous positive airway pressure, apneas, caffeine treatment, and hyperbilirubinemia were obtained from medical records. We assessed associations of neonatal characteristics with developmental delay, adjusted for gender, small-for-gestational-age status, gestational age, and maternal education. Hypoglycemia and asphyxia were associated with developmental delay; odds ratios (ORs) were 2.42 (95% confidence interval [CI]: 1.23-4.77) and 3.18 (95% CI: 1.01-10.0), respectively. Tertiary NICU admission and hyperbilirubinemia had positive but statistically borderline nonsignificant associations with developmental delay: ORs were 1.74 (95% CI: 0.96-3.15) and 1.52 (95% CI: 0.94-2.46), respectively. No other neonatal morbidities were associated with developmental delay. In multivariate analyses, only hypoglycemia was associated with developmental delay (OR: 2.19; 95% CI: 1.08-4.46). In moderately preterm-born children, only hypoglycemia increased the risk of developmental delay at preschool age. A concerted effort to prevent hypoglycemia might enhance developmental outcome in this group.

  12. The Impact of Congenital Deafblindness on the Struggle to Symbolism

    ERIC Educational Resources Information Center

    Bruce, Susan M.

    2005-01-01

    Most children who are congenitally deafblind are severely delayed in their communication development and many will not achieve symbolic understanding and expression. This article discusses developmental markers cited in the research literature as predictive of or facilitative of the development of symbolism. These markers include the growth toward…

  13. The reliability and validity of the Greenspan Social Emotional Growth Chart (GSEGC) in Israeli children with developmental delay and autism-A pilot study.

    PubMed

    Tede, Zoma; Ophir Cohen, Michal; Riskin, Arieh; Tirosh, Emanuel

    2016-08-01

    Healthy social-emotional development in early childhood is important as an indicator of general well-being and for positive outcome in later childhood. Therefore, screening for potential social emotional problems is valuable. Accurate, usable, and affordable screening tools have been especially difficult to develop. The cross cultural validity of a screening instrument should be assessed. The aim of the current study was to investigate the reliability and validity of the Greenspan social-emotional growth chart (GSEGC) in Israeli children of three diagnostic groups: (1) Autistic spectrum disorder (ASD) (2) Developmental language disorder (DLD) and (3) Developmental motor delay (DMD). An internal reliability of alpha of 0.95 for the GSEGC standardized for age score and of 0.78 for the sensory processing sub scores was found. A confirmatory factor analysis (CFA) using a 5-factor model confirmed an acceptable fit. Positive (62.86%) and negative (94.73%) predictive values also support the clinical usefulness of the GSEGC in identifying children at low risk for ASD. The GSEGC appears to be a promising tool for the screening of social emotional problems in early childhood. Further studies in different cultures are warranted. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Multilevel linear modelling of the response-contingent learning of young children with significant developmental delays.

    PubMed

    Raab, Melinda; Dunst, Carl J; Hamby, Deborah W

    2018-02-27

    The purpose of the study was to isolate the sources of variations in the rates of response-contingent learning among young children with multiple disabilities and significant developmental delays randomly assigned to contrasting types of early childhood intervention. Multilevel, hierarchical linear growth curve modelling was used to analyze four different measures of child response-contingent learning where repeated child learning measures were nested within individual children (Level-1), children were nested within practitioners (Level-2), and practitioners were nested within the contrasting types of intervention (Level-3). Findings showed that sources of variations in rates of child response-contingent learning were associated almost entirely with type of intervention after the variance associated with differences in practitioners nested within groups were accounted for. Rates of child learning were greater among children whose existing behaviour were used as the building blocks for promoting child competence (asset-based practices) compared to children for whom the focus of intervention was promoting child acquisition of missing skills (needs-based practices). The methods of analysis illustrate a practical approach to clustered data analysis and the presentation of results in ways that highlight sources of variations in the rates of response-contingent learning among young children with multiple developmental disabilities and significant developmental delays. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  15. Achondroplasia: Development, pathogenesis, and therapy.

    PubMed

    Ornitz, David M; Legeai-Mallet, Laurence

    2017-04-01

    Autosomal dominant mutations in fibroblast growth factor receptor 3 (FGFR3) cause achondroplasia (Ach), the most common form of dwarfism in humans, and related chondrodysplasia syndromes that include hypochondroplasia (Hch), severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), and thanatophoric dysplasia (TD). FGFR3 is expressed in chondrocytes and mature osteoblasts where it functions to regulate bone growth. Analysis of the mutations in FGFR3 revealed increased signaling through a combination of mechanisms that include stabilization of the receptor, enhanced dimerization, and enhanced tyrosine kinase activity. Paradoxically, increased FGFR3 signaling profoundly suppresses proliferation and maturation of growth plate chondrocytes resulting in decreased growth plate size, reduced trabecular bone volume, and resulting decreased bone elongation. In this review, we discuss the molecular mechanisms that regulate growth plate chondrocytes, the pathogenesis of Ach, and therapeutic approaches that are being evaluated to improve endochondral bone growth in people with Ach and related conditions. Developmental Dynamics 246:291-309, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Global Developmental Delay and Its Relationship to Cognitive Skills

    ERIC Educational Resources Information Center

    Riou, Emilie M.; Ghosh, Shuvo; Francoeur, Emmett; Shevell, Michael I.

    2009-01-01

    Global developmental delay (GDD) is defined as evidence of significant delays in two or more developmental domains. Our study determined the cognitive skills of a cohort of young children with GDD. A retrospective chart review of all children diagnosed with GDD within a single developmental clinic was carried out. Scores on fine motor (Peabody…

  17. [Neuropsychomotor developmental delay: conceptual map, term definitions, uses and limitations].

    PubMed

    Dornelas, Lílian de Fátima; Duarte, Neuza Maria de Castro; Magalhães, Lívia de Castro

    2015-01-01

    To retrieve the origin of the term neuropsychomotor developmental delay" (NPMD), its conceptual evolution over time, and to build a conceptual map based on literature review. A literature search was performed in the SciELO Brazil, Web of Science, Science Direct, OneFile (GALE), Pubmed (Medline), Whiley Online, and Springer databases, from January of 1940 to January of 2013, using the following keywords NPMD delay, NPMD retardation, developmental delay, and global developmental delay. A total of 71 articles were selected, which were used to build the conceptual map of the term. Of the 71 references, 55 were international and 16 national. The terms developmental delay and global developmental delay were the most frequently used in the international literature and, in Brazil, delayed NPMD was the most often used. The term developmental delay emerged in the mid 1940s, gaining momentum in the 1990 s. In Brazil, the term delayed NPMD started to be used in the 1980s, and has been frequently cited and published in the literature. Delayed development was a characteristic of 13 morbidities described in 23 references. Regarding the type of use, 19 references were found, with seven forms of use. Among the references, 34 had definitions of the term, and 16 different concepts were identified. Developmental delay is addressed in the international and national literature under different names, various applications, and heterogeneous concepts. Internationally, ways to improve communication between professionals have been indicated, with standardized definition of the term and use in very specific situations up to the fifth year of life, which was not found in Brazilian publications. Copyright © 2014 Associação de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

  18. Neuropsychomotor developmental delay: conceptual map, term definitions, uses and limitations

    PubMed Central

    Dornelas, Lílian de Fátima; Duarte, Neuza Maria de Castro; Magalhães, Lívia de Castro

    2015-01-01

    OBJECTIVE: To retrieve the origin of the term neuropsychomotor developmental delay" (NPMD), its conceptual evolution over time, and to build a conceptual map based on literature review. DATA SOURCE: A literature search was performed in the SciELO Brazil, Web of Science, Science Direct, OneFile (GALE), Pubmed (Medline), Whiley Online, and Springer databases, from January of 1940 to January of 2013, using the following keywords: NPMD delay, NPMD retardation, developmental delay, and global developmental delay. A total of 71 articles were selected, which were used to build the conceptual map of the term. DATA SYNTHESIS: Of the 71 references, 55 were international and 16 national. The terms developmental delay and global developmental delay were the most frequently used in the international literature and, in Brazil, delayed NPMD was the most often used. The term developmental delay emerged in the mid 1940s, gaining momentum in the 1990s. In Brazil, the term delayed NPMD started to be used in the 1980s, and has been frequently cited and published in the literature. Delayed development was a characteristic of 13 morbidities described in 23 references. Regarding the type of use, 19 references were found, with seven forms of use. Among the references, 34 had definitions of the term, and 16 different concepts were identified. CONCLUSIONS: Developmental delay is addressed in the international and national literature under different names, various applications, and heterogeneous concepts. Internationally, ways to improve communication between professionals have been indicated, with standardized definition of the term and use in very specific situations up to the fifth year of life, which was not found in Brazilian publications. PMID:25662016

  19. Longitudinal prediction of language emergence in infants at high and low risk for autism spectrum disorder.

    PubMed

    Edmunds, Sarah R; Ibañez, Lisa V; Warren, Zachary; Messinger, Daniel S; Stone, Wendy L

    2017-02-01

    This study used a prospective longitudinal design to examine the early developmental pathways that underlie language growth in infants at high risk (n = 50) and low risk (n = 34) for autism spectrum disorder in the first 18 months of life. While motor imitation and responding to joint attention (RJA) have both been found to predict expressive language in children with autism spectrum disorder and those with typical development, the longitudinal relation between these capacities has not yet been identified. As hypothesized, results revealed that 15-month RJA mediated the association between 12-month motor imitation and 18-month expressive vocabulary, even after controlling for earlier levels of RJA and vocabulary. These results provide new information about the developmental sequencing of skills relevant to language growth that may inform future intervention efforts for children at risk for language delay or other developmental challenges.

  20. Expanding the clinical spectrum of chromosome 15q26 terminal deletions associated with IGF-1 resistance.

    PubMed

    O'Riordan, Aisling M; McGrath, Niamh; Sharif, Farhana; Murphy, Nuala P; Franklin, Orla; Lynch, Sally Ann; O'Grady, Michael J

    2017-01-01

    Haploinsufficiency of the insulin-like growth factor-1 receptor (IGF1R) gene on chromosome 15q26.3 is associated with impaired prenatal and postnatal growth, developmental delay, dysmorphic features and skeletal abnormalities. Terminal deletions of chromosome 15q26 arising more proximally may also be associated with congenital heart disease, epilepsy, diaphragmatic hernia and renal anomalies. We report three additional cases of 15q26 terminal deletions with novel features which may further expand the spectrum of this rarely reported contiguous gene syndrome. Phenotypic features including neonatal lymphedema, aplasia cutis congenita and aortic root dilatation have not been reported previously. Similarly, laboratory features of insulin-like growth factor 1 (IGF-1) resistance are described, including markedly elevated IGF-1 of up to +4.7 SDS. In one patient, the elevated IGF-1 declined over time and this coincided with a period of spontaneous growth acceleration. Deletions of 15q26 are a potential risk factor for aortic root dilatation, neonatal lymphedema and aplasia cutis in addition to causing growth restriction. What is Known: • Terminal deletions of chromosome 15q26 are associated with impaired prenatal and postnatal growth, developmental delay, dysmorphic features and skeletal abnormalities. What is New: • Neonatal lymphedema, aplasia cutis congenita and aortic root dilatation have not been previously described in 15q26 terminal deletions and may represent novel features. • IGF-1 levels may be increased up to 4.7 SDS.

  1. Profile of referrals for early childhood developmental delay to ambulatory subspecialty clinics.

    PubMed

    Shevell, M I; Majnemer, A; Rosenbaum, P; Abrahamowicz, M

    2001-09-01

    The objective of this study was to determine the profile and pattern of referral to subspecialty clinics of young children with suspected developmental delay together with the factors prompting their referral. All children under 5 years of age referred to either developmental pediatrics or pediatric neurology clinics at a single tertiary hospital over an 18-month period were prospectively identified. Standardized demographic and referral information were collected at intake, final developmental delay subtype diagnosed was identified, and referring physicians were surveyed regarding factors prompting referral. A total of 224 children met study criteria. There was a marked male preponderance (166/224), especially among those with either cognitive or language delay. Two delay subtypes, global developmental delay and developmental language disorder, accounted for two thirds of the diagnoses made. For slightly more than one third of the children (75/224), the delay subtype diagnosed following specialty evaluation was different from that initially suspected by the referring physician. A mean delay of 15.5 months was observed for the cohort as a whole between initial parental concern and specialty assessment. For referring physicians, the major factor prompting referral was the severity of the observed delay. The most important aspects of the specialty evaluation according to referral sources were the identification of a possible etiology and confirmation of delay. A profile of referrals and the rationale thereof for a cohort of children with suspected developmental delay is presented that, although locale specific, has implications for service provision and training.

  2. Predictors of severity and outcome of global developmental delay without definitive etiologic yield: a prospective observational study.

    PubMed

    Thomaidis, Loretta; Zantopoulos, Georgios Zacharias; Fouzas, Sotirios; Mantagou, Lito; Bakoula, Chryssa; Konstantopoulos, Andreas

    2014-02-12

    Although several determinants of global developmental delay (GDD) have been recognized, a significant number of children remain without definitive etiologic diagnosis. The objective of this study was to assess the effect of various prenatal and perinatal factors on the severity and outcome of developmental delay without definitive etiologic yield. From March 2008 to February 2010, 142 children with developmental quotient (DQ) <70 and without definitive etiologic diagnosis, were included. Prenatal and perinatal risk factors known to be associated with disordered neonatal brain function were identified. Participants underwent a thorough investigation, an individualized habilitation plan was recommended, and the children were followed-up regularly for a period of 2 < years. The effect of prenatal and perinatal risk factors on the severity and outcome of GDD was assessed by regression analysis. The mean age at enrolment was 31 ± 12 < months, and the mean DQ 52.2 ± 11.4. Prematurity and intrauterine growth restriction (IUGR) were found to be independently associated with lower DQ values. The mean DQ after the 2-year follow-up was 62.5 ± 12.7, and the DQ difference from the enrollment 10.4 ± 8.9 (median 10; range-10 to 42). DQ improvement (defined as a DQ difference?≥?median) was noted in 52.8% of the children. IUGR, low socio-economic status, and poor compliance to habilitation plan were found to be independently associated with poorer developmental outcomes. Prematurity and IUGR were found to be significantly and independently related to the severity of GDD in cases without definitive etiologic yield. Poorer 2-year developmental outcome was associated with IUGR, low socioeconomic status and non compliance to habilitation plan. Prematurity was a significant determinant of the outcome only in association with the above mentioned factors.

  3. Association of Arsenic Methylation Capacity with Developmental Delays and Health Status in Children: A Prospective Case-Control Trial

    NASA Astrophysics Data System (ADS)

    Hsueh, Yu-Mei; Chen, Wei-Jen; Lee, Chih-Ying; Chien, Ssu-Ning; Shiue, Horng-Sheng; Huang, Shiau-Rung; Lin, Ming-I.; Mu, Shu-Chi; Hsieh, Ru-Lan

    2016-11-01

    This case-control study identified the association between the arsenic methylation capacity and developmental delays and explored the association of this capacity with the health status of children. We recruited 120 children with developmental delays and 120 age- and sex-matched children without developmental delays. The health status of the children was assessed using the Pediatric Quality of Life Inventory (PedsQL) and Pediatric Outcomes Data Collection Instrument (PODCI). The arsenic methylation capacity was determined by the percentages of inorganic arsenic (InAs%), monomethylarsonic acid (MMAV%), and dimethylarsinic acid (DMAV%) through liquid chromatography and hydride generation atomic absorption spectrometry. Developmental delays were significantly positively associated with the total urinary arsenic concentration, InAs%, and MMAV%, and was significantly negatively associated with DMAV% in a dose-dependent manner. MMAV% was negatively associated with the health-related quality of life (HRQOL; -1.19 to -1.46, P < 0.01) and functional performance (-0.82 to -1.14, P < 0.01), whereas DMAV% was positively associated with HRQOL (0.33-0.35, P < 0.05) and functional performance (0.21-0.39, P < 0.01-0.05) in all children and in those with developmental delays. The arsenic methylation capacity is dose-dependently associated with developmental delays and with the health status of children, particularly those with developmental delays.

  4. Young Children with Developmental Delays as Young Adults: Predicting Developmental and Personal-Social Outcomes

    ERIC Educational Resources Information Center

    Bernheimer, Lucinda P.; Keogh, Barbara K.; Guthrie, Donald

    2006-01-01

    We report on a 20-year follow-up of 30 children with developmental delays identified at age 3. Our purpose was to assess the relationship of early indicators of delay to cognitive and personal-social status in young adulthood. Predictors were Developmental and Personal-Social factors derived from standardized tests and parent questionnaires…

  5. Early Intervention Practices in China: Present Situation and Future Directions

    ERIC Educational Resources Information Center

    Hu, Xiaoyi; Yang, Xijie

    2013-01-01

    Early intervention services to young children with developmental delays in China have experienced significant growth since 1978, the beginning of the period of Reform and Opening. This article described the present situation of early intervention practices in mainland China, framed around the key components and guiding principles of Guralnick's…

  6. Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal mouse tissues.

    EPA Science Inventory

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...

  7. Cognitive Profile in a Large French Cohort of Adults with Prader-Willi Syndrome: Differences between Genotypes

    ERIC Educational Resources Information Center

    Copet, P.; Jauregi, J.; Laurier, V.; Ehlinger, V.; Arnaud, C.; Cobo, A. -M.; Molinas, C.; Tauber, M.; Thuilleaux, D.

    2010-01-01

    Background: Prader-Willi syndrome (PWS) is a rare genetic disorder characterised by developmental abnormalities leading to somatic and psychological symptoms. These include dysmorphic features, impaired growth and sexual maturation, hyperphagia, intellectual delay, learning disabilities and maladaptive behaviours. PWS is caused by a lack of…

  8. Global developmental delay in guanidionacetate methyltransferase deficiency: differences in formal testing and clinical observation.

    PubMed

    Verbruggen, Krijn T; Knijff, Wilma A; Soorani-Lunsing, Roelineke J; Sijens, Paul E; Verhoeven, Nanda M; Salomons, Gajja S; Goorhuis-Brouwer, Siena M; van Spronsen, Francjan J

    2007-09-01

    Guanidinoacetate N-methyltransferase (GAMT) deficiency is a defect in the biosynthesis of creatine (Cr). So far, reports have not focused on the description of developmental abilities in this disorder. Here, we present the result of formal testing of developmental abilities in a GAMT-deficient patient. Our patient, a 3-year-old boy with GAMT deficiency, presented clinically with a severe language production delay and nearly normal nonverbal development. Treatment with oral Cr supplementation led to partial restoration of the cerebral Cr concentration and a clinically remarkable acceleration of language production development. In contrast to clinical observation, formal testing showed a rather harmonic developmental delay before therapy and a general improvement, but no specific acceleration of language development after therapy. From our case, we conclude that in GAMT deficiency language delay is not always more prominent than delays in other developmental areas. The discrepancy between the clinical impression and formal testing underscores the importance of applying standardized tests in children with developmental delays. Screening for Cr deficiency by metabolite analysis of body fluids or proton magnetic resonance spectroscopy of the brain deficiency should be considered in any child with global developmental delay/mental retardation lacking clues for an alternative etiology.

  9. Maternal nationality and developmental delays in young children: Analysis of the data from the national registry in Taiwan.

    PubMed

    Tseng, Yen-Cheng; Guo, How-Ran; Lai, Der-Chung

    2016-01-01

    With globalization, transnational marriages become more and more common around the world. Children born to immigrant mothers might be more likely to have developmental delays, but studies on this topic are limited and with inconsistent results. To determine whether children born to immigrant mothers are more likely to have developmental delays. We analyzed the data from the national registry of children with developmental delays from 2009 to 2013 and compared the incidence of developmental delays between children born to immigrant mothers and native mothers. We also performed stratified analyses by age, sex, and geographic area. From 2009 to 2013, 78,946 new cases of developmental delays under 6 years of age were registered, including 5619 (7.1%) born to immigrant mothers. The incidence was higher in children born to native mothers in every year with rate ratios ranging from 1.32 to 1.48, and the differences reached statistical significance even after stratification by age, sex, and geographic area. Children born to immigrant mothers had lower incidence of developmental delays in Taiwan. The result may help reduce the discrimination of foreign spouses and their children. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. The administrative population report on children with developmental delays in Taiwan, 2003 through 2007.

    PubMed

    Lin, Jin-Ding; Yen, Chia-Feng; Wu, Jia-Ling; Kang, Shih-Wan

    2009-01-01

    This paper was a population study with developmental delays and it included an examination of the trends the overtime change trend and reported channels of this group of people in Taiwan. We analyzed data for the present study mainly from the Department of Statistics, Ministry of the Interiors, Taipei, Taiwan: "Number of early intervention for children with developmental delays in Taiwan" from 2003 through 2007. The reported number of children with developmental delays slightly increased from 13,231 to 14,250 (increase rate=7.7%) from the year of 2003 through 2007 in Taiwan. More than one-half of children with developmental delays were reported during the age 3-5 years. Aged 0-2 group has the highest increasing reported numbers in the previous 5 years which changed dramatically increased from 4139 (31.3%) in 2003 to 6201 (43.5%) in 2007 (increase rate=49.8%). The medical care setting was the main reported channel of the children with developmental delays and the results also showed that the reported prevalence of the aged 0-2 developmentally delayed children was 57.4-102.2 per 10,000 children; aged 3-5 was 79.0-105.1 per 10,000 children from the year 2003-2007 in Taiwan. The present concluded that early intervention based on the precise affected population would provide important supports for families of children with developmental delays. Therefore, the health care system should be strengthened to increase the proportion of children identified at the earlier age and to decrease the variability in the age at identification for most of the conditions of children with developmental delays.

  11. A clinical approach to developmental delay and intellectual disability.

    PubMed

    Vasudevan, Pradeep; Suri, Mohnish

    2017-12-01

    Global developmental delay and intellectual disability are phenotypically and genetically heterogeneous and a specific diagnosis is not reached in many cases. This paper outlines a systematic approach to global developmental delay and intellectual disability. © Royal College of Physicians 2017. All rights reserved.

  12. Correlation Between Mothers' Depression and Developmental Delay in Infants Aged 6-18 Months.

    PubMed

    Vameghi, Roshanak; Amir Ali Akbari, Sedigheh; Sajjadi, Homeira; Sajedi, Firoozeh; Alavimajd, Hamid

    2015-08-23

    Regarding the importance of children's developmental status and various factors that delay their development, this study was conducted to examine the correlation between mothers' depression levels and the developmental delay in infants. This descriptive study was performed on 1053 mothers and their infants' age 6 to18 month-old in medical centers affiliated with Shahid Beheshti University of Medical Sciences, Iran, in 2014-2015. The participants were selected through multi-stage random sampling. The following instruments were used in this study: A demographic and obstetric specification questionnaire, infant specification questionnaire, the Beck Depression Inventory, and the Ages and Stages Questionnaire to determine the status of the children's development. The data were analyzed using SPSS19 software, Mann-Whitney; independent T-test and logistic-Regression tests were used. The results showed that 491 mothers (46.7%) suffered mild to extremely severe depression. The delay in infant development was 11.8%. The Mann-Whitney test showed a correlation between mothers' depression levels and developmental delay in infants (P=0.001). Moreover, there was a significant correlation between mothers' depression and developmental delays in gross-motor and problem-solving skills (P<0/05). In logistic model age of infants showed significant correlation with developmental delay (P=0.004 OR=1.07), but unwanted pregnancy, gender of infants, type of delivery and socioeconomic status had no correlation with developmental delay. Given the correlation between mothers' depression and infant development, it is recommended to screen mothers for depression in order to perform early interventions in developmental delay.

  13. Health of children adopted from Ethiopia.

    PubMed

    Miller, Laurie C; Tseng, Beverly; Tirella, Linda G; Chan, Wilma; Feig, Emily

    2008-09-01

    Since 2000, American families have adopted 1,700 children from Ethiopia. Little is known about the health and development of these children. Retrospective chart review of the arrival health status of all 50 (26F:24M) children from Ethiopia/Eritrea seen in the International Adoption Clinic. Prior to adoption, most children resided with relatives; 36% were >18 months old prior to entry into care. More than 50% were true orphans, often due to HIV. Arrival age ranged from 3 months to 15 years (mean +/- SD 4 years +/- 43.8 months). At arrival, growth z scores were near-average (weight -.59, height -.64, head circumference -.09); significantly better than adopted children Guatemala, China, or Russia seen in our clinic. However, some Ethiopian children were significantly growth delayed (WAZ < or =-2, 8%, HAZ 12%, HCZ 18%). Age at adoption did not relate to growth delays. Medical issues on arrival included intestinal parasites (53%, [14% with > or =3 types]), skin infections (45%), dental caries (25%), elevated liver transaminases (20%), latent tuberculosis (18%), and hepatitis B (2%). Age-appropriate vaccines had been administered in 15-77% of children (depending on specific vaccine). Behavior problems were uncommon. Gross/fine motor and cognitive skills were approximately 86% of expected for age. Age correlated inversely with developmental scores for cognition (r = -.49, P = .003). Five children had age reassignments. Ethiopian/Eritean adoptees differ from other groups of internationally adopted children: they reside for relatively long periods of time with relatives prior to institutionalization, often have uncertain ages, exhibit few behavioral problems at arrival, have better growth, and may have less severe developmental delays. Whether these differences at arrival predict better outcomes for the Ethiopian/Eritrean children is unknown.

  14. Cerebrotendinous xanthomatosis (CTX): an association of pulverulent cataracts and pseudo-dominant developmental delay in a family with a splice site mutation in CYP27A1--a case report.

    PubMed

    Bourkiza, Rabia; Joyce, Sarah; Patel, Himanshu; Chan, Michelle; Meyer, Esther; Maher, Eamonn R; Reddy, M Ashwin

    2010-06-01

    A 15-year-old boy with developmental delay presented to the pediatric ophthalmology clinic with bilateral pulverulent cataracts. The family was examined for developmental delay, cataracts and systemic problems. The parents were consanguineous and originally from Bangladesh. All the children were born in the UK. The mother and 5 children had developmental delay. Three children had global developmental delay, diarrhea and pulverulent cataracts. Two children had microcephaly, developmental delay, constipation and no cataracts. The mother did not have microcephaly, cataracts or gastrointestinal problems. Linkage analysis via autozygosity testing was performed for detection of loci and candidate genes. The patients with cataracts were segregated with homozygous mutations in the CYP27A1 (G to A substitution at position +1 of intron 6). The complex nature of this family's findings suggested that it had an unusual autosomal dominant condition with variable expression. Autozygosity testing demonstrated that three members had Cerebrotendinous xanthomatosis (CTX), which is inherited in an autosomal recessive manner. The aetiology of the developmental delay in other family members remains unknown. Cerebrotendinous xanthomatosis is a rare autosomal recessive condition that can result in neurological deficits and early death if left untreated. In view of the reversible nature of the condition with appropriate treatment, there needs to be a high level of suspicion of CTX for any child with cataracts and developmental delay even if the pattern of inheritance is not straightforward at initial assessment.

  15. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hsieh, Ru-Lan

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) weremore » measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT high-risk haplotype was significantly associated with developmental delay.« less

  16. A Direct Comparison of Self-Injurious and Stereotyped Motor Behavior Between Preschool-Aged Children With and Without Developmental Delays

    PubMed Central

    Spofford, Lisa; Dimian, Adele; Tervo, Raymond; MacLean, William E.; Symons, Frank J.

    2016-01-01

    Objective To compare the prevalence of self-injurious behavior (SIB) and stereotyped motor behavior (STY) of preschool-aged children with developmental delays (DD group) and their peers without developmental delays (TD group) using a standardized caregiver report scale. Methods The Repetitive Behavior Scale-Revised was completed by caregivers of children with developmental delays and their peers without developmental delays. Frequency of occurrence and severity ratings for SIB and STY were compared between groups. Results SIB and STY were reported more often and at a greater level of severity in the DD group. Older chronological age was associated with more severe STY in the DD group but not the TD group. Gender was not related to STY or SIB for either group. Conclusions Differences in STY and SIB were evident between preschoolers with and without DD. Findings are discussed from developmental and behavioral psychology perspectives regarding the expression of repetitive behavior in developmentally at-risk pediatric populations. PMID:26514642

  17. Mosaic Trisomy 9p in a Patient with Mild Dysmorphic Features and Normal Intelligence.

    PubMed

    Brar, Randeep; Basel, Donald G; Bick, David P; Weik, LuAnn; vanTuinen, Peter; Peterson, Jess F

    2017-01-01

    To the Editor: Partial and whole duplications of the short arm of chromosome 9 have been commonly reported in the literature with characteristic phenotypic features and intellectual disabilities. The clinical features of 9p duplications are broad and can include growth retardation, developmental delay, intellectual disability, microbrachycephaly, deep set eyes, hypertelorism, downslanting palpebral fissures, prominent nasal root, bulbous nasal tip, low-set ears, short fingers and toes with hypoplastic nails, and delayed bone age (Bonaglia et al., 2002; Zou et al., 2009; Guilherme et al., 2014).

  18. Delaying Developmental Mathematics: The Characteristics and Costs

    ERIC Educational Resources Information Center

    Johnson, Marianne; Kuennen, Eric

    2004-01-01

    This paper investigates which students delay taking a required developmental mathematics course and the impact of delay on student performance in introductory microeconomics. Analysis of a sample of 1462 students at a large Midwestern university revealed that, although developmental-level mathematics students did not reach the same level of…

  19. Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

    PubMed

    Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

    2016-07-01

    Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

  20. Is "treat your child normally" helpful advice for parents of survivors of treatment of hypoplastic left heart syndrome?

    PubMed

    Rempel, Gwen R; Harrison, Margaret J; Williamson, Deanna L

    2009-04-01

    Developing technology affords children with complex congenitally malformed hearts a chance for survival. Parents gratefully pursue life-saving options on behalf of their children, despite the risks to the life of their child, and uncertainty about outcomes. Little is known about how mothers and fathers experience parenting a child whose new state as a survivor may include less than optimal developmental sequels. Our study involved multiple interactive interviews with 9 mothers and 7 fathers of infants and preschool children with hypoplastic left heart syndrome who had survived the Norwood surgical approach. Qualitative methodology included grounded theory methods of simultaneous collection and analysis of data, and we used open and selective coding of transcribed interviews. Parents used normalization in the context of uncertainty regarding the ongoing survival of their child. Parents described their underweight children as being on their own growth curve, and viewed their developmental progress, however delayed, as reason for celebration, as they had been prepared for their child to die. There is growing evidence that children with congenitally malformed hearts who require surgical intervention during the first year of life may experience developmental delay. The use of normalization by their parents may be effective in decreasing their worry regarding the uncertain future faced by their child, but may negatively affect the developmental progress of the child if they do not seek resources to assist development. Advice from paediatric specialists for parents to view their children as normal needs to be balanced with assistance for parents to access services to support optimal growth and development of their child.

  1. Parental age and child growth and development: child health check-up data.

    PubMed

    Iwayama, Mariko; Kira, Ryutaro; Kinukawa, Naoko; Sakai, Yasunari; Torisu, Hiroyuki; Sanefuji, Masafumi; Ishizaki, Yoshito; Nose, Yoshiaki; Matsumoto, Toshimichi; Hara, Toshiro

    2011-10-01

    The aim of the present study was to determine whether parental age has any influence on child health. Well-baby check-up data at 1 month and at 12 months of age were used. The trends of parental age in association with growth measurements, incidence of physical and developmental abnormalities, occurrence of low birthweight, and maternal history of spontaneous abortion were analyzed. Associations between increasing paternal age and incidence of psychomotor developmental delay at 12 months, increasing paternal and maternal age and increasing birthweight, and increasing parental age and higher incidence of history of spontaneous abortion were found. The incidence of low-birthweight infants was significantly decreased with increasing paternal age. Not only increasing maternal age but also increasing paternal age have influences on child development and growth in the general population. © 2011 The Authors. Pediatrics International © 2011 Japan Pediatric Society.

  2. Performance of South African children on the Communication and Symbolic Behavior Scales-Developmental Profile (CSBS DP).

    PubMed

    Chambers, Nola; Stronach, Sheri T; Wetherby, Amy M

    2016-05-01

    Substantial development in social communication skills occurs in the first two years of life. Growth should be evident in sharing emotion and eye gaze; rate of communication, communicating for a variety of functions; using gestures, sounds and words; understanding language, and using functional and pretend actions with objects in play. A delay in these early social communication skills may be the first sign of a developmental delay in young children in nearly all categories of disabilities-including specific language impairment, autism spectrum disorder, HIV/AIDS, lack of environmental stimulation or institutionalization, and global developmental delays-and early detection of these delays is critical for enrolment in appropriate early intervention services. No standardized tests of early social communication skills exist for very young children in South Africa (SA). An existing evaluation tool that has the potential to be culturally fair for children from cultural backgrounds different to the standardization group is the Communication and Symbolic Behaviour Scales-Developmental Profile (CSBS DP). This study aimed to document the performance of a group of English-speaking SA children ranging in age from 12 to 24 months on the CSBS DP and to compare this performance with the original standardization sample. Sixty-seven English-speaking SA children from a range of cultural and linguistic backgrounds were assessed on the CSBS DP Behaviour Sample. Group scores were compared with the original standardization sample using inferential statistics. The results provide preliminary support for the suitability and validity of the face-to-face Behaviour Sample as a measure of early social communication skills in this sample of English-speaking SA children from a range of cultural groups between 12 and 24 months of age. While further research in the SA population is needed, these findings are a first step towards validating a culturally appropriate measure for early detection of social communication delays in a sample of SA toddlers. © 2015 Royal College of Speech and Language Therapists.

  3. Developmental Delays in Executive Function from 3 to 5 Years of Age Predict Kindergarten Academic Readiness

    ERIC Educational Resources Information Center

    Willoughby, Michael T.; Magnus, Brooke; Vernon-Feagans, Lynne; Blair, Clancy B.

    2017-01-01

    Substantial evidence has established that individual differences in executive function (EF) in early childhood are uniquely predictive of children's academic readiness at school entry. The current study tested whether growth trajectories of EF across the early childhood period could be used to identify a subset of children who were at pronounced…

  4. Examining the Dimensionality of Effortful Control in Preschool Children and Its Relation to Academic and Socioemotional Indicators

    ERIC Educational Resources Information Center

    Allan, Nicholas P.; Lonigan, Christopher J.

    2011-01-01

    Effortful control (EC) is an important developmental construct, associated with socioemotional growth, academic performance, and psychopathology. EC is defined as the ability to execute goal-directed behavior to inhibit or delay a prepotent response in favor of a subdominant response. Extant research indicates that EC may be multidimensional.…

  5. Educational Outcomes of Children Adopted from Eastern Europe, Now Ages 8-12

    ERIC Educational Resources Information Center

    Tirella, Linda Grey; Chan, Wilma; Miller, Laurie C.

    2006-01-01

    More than 230,000 children have been adopted from other countries by American parents since 1989, including more than 72,000 from Eastern Europe. Many arrive with growth and development delays, and medical problems. Yet, little is known about the long-term outcomes for these children. Therefore, we assessed long-term developmental,…

  6. The Diagnostic Yield of Array Comparative Genomic Hybridization Is High Regardless of Severity of Intellectual Disability/Developmental Delay in Children.

    PubMed

    D'Arrigo, Stefano; Gavazzi, Francesco; Alfei, Enrico; Zuffardi, Orsetta; Montomoli, Cristina; Corso, Barbara; Buzzi, Erika; Sciacca, Francesca L; Bulgheroni, Sara; Riva, Daria; Pantaleoni, Chiara

    2016-05-01

    Microarray-based comparative genomic hybridization is a method of molecular analysis that identifies chromosomal anomalies (or copy number variants) that correlate with clinical phenotypes. The aim of the present study was to apply a clinical score previously designated by de Vries to 329 patients with intellectual disability/developmental disorder (intellectual disability/developmental delay) referred to our tertiary center and to see whether the clinical factors are associated with a positive outcome of aCGH analyses. Another goal was to test the association between a positive microarray-based comparative genomic hybridization result and the severity of intellectual disability/developmental delay. Microarray-based comparative genomic hybridization identified structural chromosomal alterations responsible for the intellectual disability/developmental delay phenotype in 16% of our sample. Our study showed that causative copy number variants are frequently found even in cases of mild intellectual disability (30.77%). We want to emphasize the need to conduct microarray-based comparative genomic hybridization on all individuals with intellectual disability/developmental delay, regardless of the severity, because the degree of intellectual disability/developmental delay does not predict the diagnostic yield of microarray-based comparative genomic hybridization. © The Author(s) 2015.

  7. Gigantism and comparative life-history parameters of tyrannosaurid dinosaurs.

    PubMed

    Erickson, Gregory M; Makovicky, Peter J; Currie, Philip J; Norell, Mark A; Yerby, Scott A; Brochu, Christopher A

    2004-08-12

    How evolutionary changes in body size are brought about by variance in developmental timing and/or growth rates (also known as heterochrony) is a topic of considerable interest in evolutionary biology. In particular, extreme size change leading to gigantism occurred within the dinosaurs on multiple occasions. Whether this change was brought about by accelerated growth, delayed maturity or a combination of both processes is unknown. A better understanding of relationships between non-avian dinosaur groups and the newfound capacity to reconstruct their growth curves make it possible to address these questions quantitatively. Here we study growth patterns within the Tyrannosauridae, the best known group of large carnivorous dinosaurs, and determine the developmental means by which Tyrannosaurus rex, weighing 5,000 kg and more, grew to be one of the most enormous terrestrial carnivorous animals ever. T. rex had a maximal growth rate of 2.1 kg d(-1), reached skeletal maturity in two decades and lived for up to 28 years. T. rex's great stature was primarily attained by accelerating growth rates beyond that of its closest relatives.

  8. Magnetic resonance imaging (MRI) evaluation of developmental delay in pediatric patients.

    PubMed

    Ali, Althaf S; Syed, Naziya P; Murthy, G S N; Nori, Madhavi; Abkari, Anand; Pooja, B K; Venkateswarlu, J

    2015-01-01

    Developmental delay is defined as significant delay in one or more developmental domains. Magnetic Resonance Imaging (MRI) is the best modality to investigate such patients. Evaluation of a child with developmental delay is important not only because it allows early diagnosis and treatment but also helpful for parental counseling regarding the outcome of their child and to identify any possible risk of recurrence in the siblings. Thus this study was undertaken to evaluate the developmental delay in Indian children which will help the clinicians in providing an estimation of the child's ultimate developmental potential and organize specific treatment requirement and also relieve parental apprehension. To study the prevalence of normal and abnormal MRI in pediatric patients presenting with developmental delay and further categorize the abnormal MRI based on its morphological features. It is a prospective, observational & descriptive study of MRI Brain in 81 paediatric patients (46 Males and 35 Females), aged between three months to 12 years; presenting with developmental delay in Deccan College of Medical Sciences, Hyderabad; over a period of three years (Sept 2011 to Sept 2014). MRI brain was done on 1.5T Siemens Magnetom Essenza & 0.35T Magnetom C with appropriate sequences and planes after making the child sleep/sedated/ anesthetized. Various anatomical structures like Ventricles, Corpus callosum, etc were systematically assessed. The MRI findings were divided into various aetiological subgroups. Normal MRI findings were seen in 32% cases and 68% had abnormal findings of which the proportion of Traumatic/ Neurovascular Diseases, Congenital & Developmental, Metabolic and Degenerative, neoplastic and non specific were 31%, 17%, 10%, 2.5% and 7.5% respectively. The ventricles and white matter mainly the corpus callosum were the most commonly affected anatomical structures. The diagnostic yield was found to be 68% and higher yield was seen in patients presenting with developmental delay plus. The clinical diagnosis of developmental delay should not be the end point, but rather a springboard for an effective search for causal factors. MRI is the best investigation with a high yield in such patients.

  9. Magnetic Resonance Imaging (MRI) Evaluation of Developmental Delay in Pediatric Patients

    PubMed Central

    Syed, Naziya P.; Murthy, G.S.N.; Nori, Madhavi; Abkari, Anand; Pooja, B.K.; Venkateswarlu, J.

    2015-01-01

    Introduction: Developmental delay is defined as significant delay in one or more developmental domains. Magnetic Resonance Imaging (MRI) is the best modality to investigate such patients. Evaluation of a child with developmental delay is important not only because it allows early diagnosis and treatment but also helpful for parental counseling regarding the outcome of their child and to identify any possible risk of recurrence in the siblings. Thus this study was undertaken to evaluate the developmental delay in Indian children which will help the clinicians in providing an estimation of the child’s ultimate developmental potential and organize specific treatment requirement and also relieve parental apprehension. Aims and Objectives: To study the prevalence of normal and abnormal MRI in pediatric patients presenting with developmental delay and further categorize the abnormal MRI based on its morphological features. Materials and Methods: It is a prospective, observational & descriptive study of MRI Brain in 81 paediatric patients (46 Males and 35 Females), aged between three months to 12 years; presenting with developmental delay in Deccan College of Medical Sciences, Hyderabad; over a period of three years (Sept 2011 to Sept 2014). MRI brain was done on 1.5T Siemens Magnetom Essenza & 0.35T Magnetom C with appropriate sequences and planes after making the child sleep/sedated/ anesthetized. Various anatomical structures like Ventricles, Corpus callosum, etc were systematically assessed. The MRI findings were divided into various aetiological subgroups. Results: Normal MRI findings were seen in 32% cases and 68% had abnormal findings of which the proportion of Traumatic/ Neurovascular Diseases, Congenital & Developmental, Metabolic and Degenerative, neoplastic and non specific were 31%, 17%, 10%, 2.5% and 7.5% respectively. The ventricles and white matter mainly the corpus callosum were the most commonly affected anatomical structures. The diagnostic yield was found to be 68% and higher yield was seen in patients presenting with developmental delay plus. Conclusion: The clinical diagnosis of developmental delay should not be the end point, but rather a springboard for an effective search for causal factors. MRI is the best investigation with a high yield in such patients. PMID:25738057

  10. Case study: child with global developmental delay.

    PubMed

    Okumakpeyi, Pearline; Lunney, Margaret

    2010-01-01

    This case study focused on the care of a child with global developmental delay. Data were obtained through the author's clinical practice in long-term care pediatric rehabilitation and literature sources. NANDA-International Classifications, the Nursing Interventions Classification (NIC), and Nursing Outcomes Classification (NOC) were used to identify the appropriate nursing diagnosis, nursing interventions, and patient outcomes. This case study provides the pertinent nursing diagnoses, interventions, and outcomes for a child with global developmental delay. The interdisciplinary team approach and family involvement is addressed. Use of NANDA, NIC, and NOC outcomes constructs for enhancing the care of a child with global developmental delay.

  11. Maternal inheritance of BDNF deletion, with phenotype of obesity and developmental delay in mother and child.

    PubMed

    Harcourt, Brooke E; Bullen, Denise V R; Kao, Kung-Ting; Tassoni, Daniella; Alexander, Erin J; Burgess, Trent; White, Susan M; Sabin, Matthew A

    2018-01-01

    Childhood obesity is a significant world health problem. Understanding the genetic and environmental factors contributing to the development of obesity in childhood is important for the rational design of strategies for obesity prevention and treatment. Brain-derived neurotrophic factor (BDNF) plays an important role in the growth and development of the central nervous system, there is also an evidence that BDNF plays a role in regulation of appetite. Disruption of the expression of this gene in a child has been previously reported to result in a phenotype of severe obesity, hyperphagia, impaired cognitive function, and hyperactivity. We report a mother and child, both with micro-deletions encompassing the BDNF gene locus, who both have obesity and developmental delay, although without hyperactivity. This report highlights the maternal inheritance of a rare genetic cause of childhood obesity. © 2017 Wiley Periodicals, Inc.

  12. Patterns of physical growth and dental development in Jordanian children and adolescents with thalassemia major.

    PubMed

    Hattab, Faiez N

    2013-03-01

    Dental development and physical growth are of particular interest in pediatric dentistry and orthodontics. This study evaluated these variables in patients with thalassemia major (TM). Physical growth was assessed in 54 patients (31 males and 23 females) aged 5.5 to 18.3 years and dental development was analyzed using panoramic radiographs from 39 of the 54 patients. The Demirjian system was used to characterize dental development of the seven left mandibular permanent teeth. Chronologic age (CA) and dental age (DA) were compared using the paired t-test, and the correlation between CA and extent of delay in dental development (DA minus CA) was assessed using Pearson's correlation coefficients. Growth retardation (< 10th percentile for height and weight) was present in 75.9% of TM patients. Height less than the third percentile was noted in 41.9% (13/31) of males and 34.8% (8/23) of females. Mean (SD) body mass index was 16.5 ± 2.2 kg/m(2). The extent of growth retardation increased with advancing age. Patient radiographs revealed a delay in dental development in 31 of 39 (79.5%) of participants (mean delay, 1.12 years in males and 0.81 years in females; range, 0.1 to 2.7 years). The mean difference between CA and DA was 0.97 years (P < 0.001). CA was significant correlated with extent of dental developmental delay (r = 0.64, P < 0.01). The results show that, among children and adolescents with TM, the proportions of those who had short stature, were underweight, and had a low growth rate increased with age. In addition, participants had significant delays in dental development.

  13. Latent Class Analysis of Early Developmental Trajectory in Baby Siblings of Children with Autism

    PubMed Central

    Landa, Rebecca J.; Gross, Alden L.; Stuart, Elizabeth A.; Bauman, Margaret

    2012-01-01

    Background Siblings of children with autism (sibs-A) are at increased genetic risk for autism spectrum disorders (ASD) and milder impairments. To elucidate diversity and contour of early developmental trajectories exhibited by sibs-A, regardless of diagnostic classification, latent class modeling was used. Methods Sibs-A (n=204) were assessed with the Mullen Scales of Early Learning from age 6–36 months. Mullen T scores served as dependent variables. Outcome classifications at age 36 months included: ASD (n=52); non-ASD social/communication delay (broader autism phenotype; BAP) (n=31); and unaffected (n=121). Child-specific patterns of performance were studied using latent class growth analysis. Latent class membership was then related to diagnostic outcome through estimation of within-class proportions of children assigned to each diagnostic classification. Results A 4-class model was favored. Class 1 represented accelerated development and consisted of 25.7% of the sample, primarily unaffected children. Class 2 (40.0% of the sample), was characterized by normative development with above-average nonverbal cognitive outcome. Class 3 (22.3% of the sample) was characterized by receptive language, and gross and fine motor delay. Class 4 (12.0% of the sample), was characterized by widespread delayed skill acquisition, reflected by declining trajectories. Children with an outcome diagnosis of ASD were spread across Classes 2, 3, and 4. Conclusions Results support a category of ASD that involves slowing in early non-social development. Receptive language and motor development is vulnerable to early delay in sibs-A with and without ASD outcomes. Non-ASD sibs-A are largely distributed across classes depicting average or accelerated development. Developmental trajectories of motor, language, and cognition appear independent of communication and social delays in non-ASD sibs-A. PMID:22574686

  14. The social context of parenting 3-year-old children with developmental delay in the UK.

    PubMed

    Emerson, E; Graham, H; McCulloch, A; Blacher, J; Hatton, C; Llewellyn, G

    2009-01-01

    Children with intellectual or developmental disability have significantly poorer health and mental health than their non-disabled peers and are at high risk of social exclusion. The aim of the present paper is to provide information on the circumstances in which 3-year-old children at risk of intellectual or developmental disability are growing up in the UK. Secondary analysis of data on 12 689 families in English-speaking monolingual households from the first two waves of the UK's Millennium Cohort Study. A total of 440 children (3% of the weighted sample) were identified as being developmentally delayed. When compared with other children, children with developmental delays were more disadvantaged on every indicator of social and economic disadvantage examined. Two out of three children with developmental delays had been exposed to repeated disadvantage as measured by income poverty, material hardship, social housing and receipt of means-tested benefits. The effect of repeated disadvantage on the risk of developmental delay remained after account was taken of parental education and occupational status. Young children with delayed development in the UK are likely to be exposed to repeated socio-economic disadvantage. Implications for policy and understanding the nature of the link between poverty and child disability are discussed.

  15. The child with developmental delay: An approach to etiology

    PubMed Central

    Meschino, Wendy S

    2003-01-01

    OBJECTIVE: To describe an approach to history, physical examination and investigation for the developmentally delayed child. METHODS: A review of electronic databases from 1997 to 2001 was done searching for articles relating to the approach to or investigations of children with developmental delay. Five studies, including a review of a consensus conference on evaluation of mental retardation, were chosen because of their general approaches to developmental delay and/or mental retardation, or specific evaluations of a particular laboratory investigation. CONCLUSIONS: A diagnosis or cause of mental retardation can be identified in 20% to 60% of cases. Evaluation of the developmentally delayed child should include a detailed history and physical examination, taking special care to record a three-generation pedigree, as well as to look for dysmorphic features. If no other cause is apparent, routine investigations should include a chromosome study and fragile X studies. Further investigations are warranted depending on the clinical features. PMID:20011550

  16. Gerodermia osteodysplastica and wrinkly skin syndrome: are they the same?

    PubMed

    Al-Gazali, L I; Sztriha, L; Skaff, F; Haas, D

    2001-07-01

    Gerodermia osteodysplastica (GO) is a connective tissue disorder characterized by premature aging, wrinkled, and lax skin with reduced elasticity which is more marked on the dorsum of the hands and feet associated with hyperextensible joints and osteoporosis. The wrinkly skin syndrome (WSS) is characterized by wrinkled skin over the dorsum of the hands, feet, and abdomen; hyperextensible joints, particularly of the hands; intrauterine growth retardation; postnatal failure to thrive; and mental and developmental delay. We report on five children from two consanguineous Arab families with features overlapping both GO and WSS. All five children had similar dysmorphic facial features consisting of broad and prominent forehead, hypotelorism with epicanthal folds, prominent bulbous nose, flat malar region, and large protruding ears. All had wrinkling of the skin more marked on the dorsum of the hands, feet, and abdomen; hyperextensibility of the joints, particularly of the hands; and aged appearance. Intrauterine growth retardation, subsequent failure to thrive, developmental delay, and variable degree of osteoporosis was also present in all of them. The older three children developed progressive prognathism. We suggest that GO and WSS could represent variable manifestation of the same disorder. Copyright 2001 Wiley-Liss, Inc.

  17. Barriers to Success in Parent Training for Young Children with Developmental Delay: The Role of Cumulative Risk

    ERIC Educational Resources Information Center

    Bagner, Daniel M.; Graziano, Paulo A.

    2013-01-01

    The purpose of this study was to examine the effect of cumulative risk on dropout and treatment outcome in parent training. Participants were 44 families of young children (mean age of 49.59 months) who presented with elevated externalizing behavior problems and developmental delay or borderline developmental delay. All families were offered to…

  18. Gender and Geographic Differences in Developmental Delays among Young Children: Analysis of the Data from the National Registry in Taiwan

    ERIC Educational Resources Information Center

    Lai, Der-Chung; Tseng, Yen-Cheng; Guo, How-Ran

    2011-01-01

    Although developmental delays are not uncommon in children, the incidence is seldom assessed, and the reported prevalence varies widely. In Taiwan, the government mandates the reporting of suspected cases. Using the national registry data, we conducted a study to estimate the incidence and prevalence of developmental delays in young children in…

  19. Child Care Providers' Competence and Confidence in Referring Children at Risk for Developmental Delays

    ERIC Educational Resources Information Center

    Branson, Diane; Bingham, Ann

    2017-01-01

    Despite the benefits of early intervention for children, the majority of children with developmental delays are not identified prior to the age of 5 years. Child care providers could aid in recognition of children at risk for developmental delays; however, there is little research on this topic. This article reports on a qualitative research study…

  20. Parent Pathways: Recognition and Responses to Developmental Delays in Young Children: A Mixed-Methods Exploratory Study

    ERIC Educational Resources Information Center

    Marshall, Jennifer Tess

    2013-01-01

    The importance of early recognition and intervention for developmental delays is increasingly acknowledged, yet high rates of under-enrollment and 1-3 year delays in entry to the public early intervention system continue. Much research has examined developmental screening in health and child care settings, but less well understood is what prompts…

  1. Pigmentary changes and atopic dermatitis in a patient with Seckel syndrome.

    PubMed

    Brackeen, Amy; Babb-Tarbox, Michelle; Smith, Jennifer

    2007-01-01

    Seckel syndrome is a very rare form of primordial dwarfism characterized by antenatal and postnatal growth delay, proportionate extreme short stature, a prominent beak-like nose, hypoplasia of the malar area, small chin, microcephaly, deformed ears lacking lobules, skeletal malformations, mental retardation, and developmental delay. This syndrome has been described with associated disorders of orthopedic, neurologic, hematologic, cardiac, and ocular systems; however, only a few reports mention dermatologic involvement. We describe a 5-year-old girl with classic Seckel syndrome who presented with moderately severe atopic dermatitis and diffuse hypopigmented macules and papules.

  2. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan.

    PubMed

    Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

    2017-04-15

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G+G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08-2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. A Direct Comparison of Self-Injurious and Stereotyped Motor Behavior Between Preschool-Aged Children With and Without Developmental Delays.

    PubMed

    Hoch, John; Spofford, Lisa; Dimian, Adele; Tervo, Raymond; MacLean, William E; Symons, Frank J

    2016-06-01

    To compare the prevalence of self-injurious behavior (SIB) and stereotyped motor behavior (STY) of preschool-aged children with developmental delays (DD group) and their peers without developmental delays (TD group) using a standardized caregiver report scale. The Repetitive Behavior Scale-Revised was completed by caregivers of children with developmental delays and their peers without developmental delays. Frequency of occurrence and severity ratings for SIB and STY were compared between groups. SIB and STY were reported more often and at a greater level of severity in the DD group. Older chronological age was associated with more severe STY in the DD group but not the TD group. Gender was not related to STY or SIB for either group. Differences in STY and SIB were evident between preschoolers with and without DD. Findings are discussed from developmental and behavioral psychology perspectives regarding the expression of repetitive behavior in developmentally at-risk pediatric populations. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Supporting Optimal Neurodevelopmental Outcomes in Infants and Children With Congenital Heart Disease.

    PubMed

    Peterson, Jennifer K

    2018-06-01

    Improved survival has led to increased recognition of developmental delays in infants and children with congenital heart disease. Risk factors for developmental delays in congenital heart disease survivors may not be modifiable; therefore, it is important that lifesaving, high-technology critical care interventions be combined with nursing interventions that are also developmentally supportive. Implementing developmental care in a pediatric cardiac intensive care unit requires change implementation strategies and widespread support from all levels of health care professionals. This manuscript reviews developmentally supportive interventions such as massage, developmentally supportive positioning, kangaroo care, cue-based feeding, effective pain/anxiety management, and procedural preparation and identifies strategies to implement developmentally supportive interventions in the care of infants and children with congenital heart disease. Improving developmental support for these infants and children at high risk for developmental delay may improve their outcomes and help promote family-centered care. ©2018 American Association of Critical-Care Nurses.

  5. In vivo loss of function study reveals the short stature homeobox-containing (shox) gene plays indispensable roles in early embryonic growth and bone formation in zebrafish.

    PubMed

    Sawada, Rie; Kamei, Hiroyasu; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Shimizu, Toshiaki

    2015-02-01

    Congenital loss of the SHOX gene is considered to be a genetic cause of short stature phenotype in Turner syndrome and Leri-Weill dyschondrosteosis patients. Though SHOX expression initiates during early fetal development, little is known about the embryonic roles of SHOX. The evolutionary conservation of the zebrafish shox gene and the convenience of the early developmental stages for analyses make zebrafish a preferred model. Here, we characterized structure, expression, and developmental roles of zebrafish shox through a loss-of-function approach. We found a previously undiscovered Shox protein that has both a homeodomain and an OAR-domain in zebrafish. The shox transcript emerged during the segmentation period and it increased in later stages. The predominant domains of shox expression were mandibular arch, pectoral fin, anterior notochord, rhombencephalon, and mesencephalon, suggesting that Shox is involved in bone and neural development. Translational blockade of Shox mRNA by an antisense morpholino oligo delayed embryonic growth, which was restored by the co-overexpression of morpholino-resistant Shox mRNA. At later stages, impaired Shox expression markedly delayed the calcification process in the anterior vertebral column and craniofacial bones. Our data demonstrate evolutionarily conserved Shox plays roles in early embryonic growth and in later bone formation. © 2014 Wiley Periodicals, Inc.

  6. Nutritional status, psychosocial development and the home environment of Indian rural children.

    PubMed

    Vazir, S; Naidu, A N; Vidyasagar, P

    1998-10-01

    To assess the psychosocial development of well nourished and malnourished children aged 0-6 years and to identify the microenvironmental factors influencing their growth and development. Multicentric cross-sectional. Rural Communities. Total of 3668 children of whom 2212 were well nourished and 1456 were malnourished. Weight for age index to assess nutritional status. Cut-off < 75% NCHS standards used based on Gomez grades II and III being malnourished and Normal and grade I being well nourished. ICMR Developmental Screening Test to assess psychosocial development and modified WHO parental interview schedule to assess family and micro-environmental factors. Malnourished children attained developmental milestones at a later age. Developmental delay among the malnourished was especially observed in areas like vision and fine motor, language and comprehension and personal social. The delay was to the extent of 7-11 months in these areas in different age groups. Paternal involvement with child care especially, father spending time, telling stories and taking child for outing was found to be important for positive psychosocial development. Other significant factors included parents teaching child, small family size and paternal occupation. Child's appetite, absence of health problems, parental age and family having own house and electricity were the factors significantly related to better nutritional status of children. Factors identified in the study are important for the development of relevant intervention at the home level. Appropriate multifaceted community based programmes such as the ICDS are also required for stimulating growth and development of backward rural children.

  7. Pre-school children with and without developmental delay: behaviour problems and parenting stress over time.

    PubMed

    Baker, B L; McIntyre, L L; Blacher, J; Crnic, K; Edelbrock, C; Low, C

    2003-01-01

    Children with intellectual disability are at heightened risk for behaviour problems and diagnosed mental disorder. The present authors studied the early manifestation and continuity of problem behaviours in 205 pre-school children with and without developmental delays. Behaviour problems were quite stable over the year from age 36-48 months. Children with developmental delays were rated higher on behaviour problems than their non-delayed peers, and were three times as likely to score in the clinical range. Mothers and fathers showed high agreement in their rating of child problems, especially in the delayed group. Parenting stress was also higher in the delayed group, but was related to the extent of behaviour problems rather than to the child's developmental delay. Over time, a transactional model fit the relationship between parenting stress and behaviour problems: high parenting stress contributed to a worsening in child behaviour problems over time, and high child behaviour problems contributed to a worsening in parenting stress. Findings for mothers and fathers were quite similar.

  8. Maternal depressive symptoms are negatively associated with child growth and development: Evidence from rural India.

    PubMed

    Nguyen, Phuong Hong; Friedman, Jed; Kak, Mohini; Menon, Purnima; Alderman, Harold

    2018-05-17

    Maternal depression has been suggested as a risk factor for both poor child growth and development in many low- and middle-income countries, but the validity of many studies is hindered by small sample sizes, varying cut-offs used in depression diagnostics, and incomplete control of confounding factors. This study examines the association between maternal depressive symptoms (MDSs) and child physical growth and cognitive development in Madhya Pradesh, India, where poverty, malnutrition, and poor mental health coexist. Data were from a baseline household survey (n = 2,934) of a randomized controlled trial assessing an early childhood development programme. Multivariate linear and logistic regression analyses were conducted, adjusting for socio-economic factors to avoid confounding the association of mental health and child outcomes. MDS (measured using the Center for Epidemiologic Studies Short Depression Scale) was categorized as low, medium, and high in 47%, 42%, and 10% of mothers, respectively. The prevalence of child developmental delay ranged from 16% to 27% for various development domains. Compared with children of mothers with low MDS, those of high MDS mothers had lower height-for-age, weight-for-age, and weight-for-height z-scores (0.22, 0.21, and 0.15, respectively), a higher rate of stunting and underweight (~1.5 times), and higher rate of developmental delay (partial adjusted odds ratio ranged from 1.3-1.8 for different development domains and fully adjusted odds ratio = 1.4 for fine motor). Our results-that MDS is significantly associated with both child undernutrition and development delay-add to the call for practical interventions to address maternal depression to simultaneously address multiple outcomes for both women and children. © 2018 The Authors. Maternal & Child Nutrition Published by John Wiley & Sons, Ltd.

  9. Rapamycin treatment causes developmental delay, pigmentation defects, and gastrointestinal malformation on Xenopus embryogenesis.

    PubMed

    Moriyama, Yuki; Ohata, Yoshihisa; Mori, Shoko; Matsukawa, Shinya; Michiue, Tatsuo; Asashima, Makoto; Kuroda, Hiroki

    2011-01-28

    Rapamycin is a drug working as an inhibitor of the TOR (target of rapamycin) signaling pathway and influences various life phenomena such as cell growth, proliferation, and life span extension in eukaryote. However, the extent to which rapamycin controls early developmental events of amphibians remains to be understood. Here we report an examination of rapamycin effects during Xenopus early development, followed by a confirmation of suppression of TOR downstream kinase S6K by rapamycin treatment. First, we found that developmental speed was declined in dose-dependent manner of rapamycin. Second, black pigment spots located at dorsal and lateral skin in tadpoles were reduced by rapamycin treatment. Moreover, in tadpole stages severe gastrointestinal malformations were observed in rapamycin-treated embryos. Taken together with these results, we conclude that treatment of the drug rapamycin causes enormous influences on early developmental period. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Self-Recognition in Young Children Using Delayed versus Live Feedback: Evidence of a Developmental Asynchrony.

    ERIC Educational Resources Information Center

    Povinelli, Daniel J.; And Others

    1996-01-01

    Investigated the ability of young children to recognize themselves in delayed videotapes and recent photographs. Results suggested a significant developmental delay in young children's success on mark tests of self-recognition using delayed feedback as compared to live feedback, which may have important implications for characterizing the…

  11. Evaluation of the Affymetrix CytoScan® Dx Assay for Developmental Delay

    PubMed Central

    Webb, Bryn D.; Scharf, Rebecca J.; Spear, Emily A.; Edelmann, Lisa J.; Stroustrup, Annemarie

    2015-01-01

    The goal of molecular cytogenetic testing for children presenting with developmental delay is to identify or exclude genetic abnormalities that are associated with cognitive, behavioral, and/or motor symptoms. Until 2010, chromosome analysis was the standard first-line genetic screening test for evaluation of patients with developmental delay when a specific syndrome was not suspected. In 2010, The American College of Medical Genetics and several other groups recommended chromosomal microarray (CMA) as the first-line test in children with developmental delays, multiple congenital anomalies, and/or autism. This test is able to detect regions of genomic imbalances at a much finer resolution than G-banded karyotyping. Until recently, no CMA testing had been approved by the United States Food and Drug Administration (FDA). This review will focus on the use of the Affymetrix CytoScan® Dx Assay, the first CMA to receive FDA approval for the genetic evaluation of individuals with developmental delay. PMID:25350348

  12. Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion

    PubMed Central

    Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

    2017-01-01

    We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early. PMID:28720553

  13. Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion.

    PubMed

    Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

    2017-12-15

    We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early.

  14. Severe intrauterine growth retardation with increased mitomycin C sensitivity: a further chromosome breakage syndrome.

    PubMed Central

    Woods, C G; Leversha, M; Rogers, J G

    1995-01-01

    We report an infant with pre- and postnatal microcephaly and growth retardation, a distinctive face, and developmental delay. The initial diagnosis was of Seckel syndrome. He became pancytopenic at 16 months and died soon after. His bone marrow was of normal cellularity but had a small lymphocyte infiltration. Increased spontaneous chromosome breakage was seen in blood and fibroblasts. Mitomycin C induced chromosome damage was increased and comparable to that seen in Fanconi anaemia. Reports of similar patients are reviewed. This entity of severe intrauterine growth retardation and increased mitomycin C sensitivity is hypothesised to be a distinct chromosome breakage syndrome. Images PMID:7643362

  15. Role of neighbourhoods in child growth and development: does 'place' matter?

    PubMed

    Avan, Bilal Iqbal; Kirkwood, Betty

    2010-07-01

    It is estimated that at least 200 million children--mostly from developing countries--suffer from developmental delays. The study aims to contribute to an understanding of the contextual environment in which a child grows and develops in such setup; and in particular to evaluate the relative contributions of socio-economic status and rural-urban neighbourhoods on growth and psychomotor development. A cross-sectional study was conducted from May to November 2002 in 15 rural and 11 urban communities of Sindh, Pakistan. 1,244 children aged less than 3 years were assessed via home visits using Bayley's Infant Developmental Scale for psychomotor development, anthropometry and a socio-economic and demographic questionnaire. A socio-economic index was created using principal component analysis, and the study hypotheses explored through hierarchical linear modelling. We found that sub-optimal growth and development were prevalent among the study's children. Overall the mean psychomotor development (PD) index was 96.0 (SD 16.7), with 23% assessed as having delayed development, and undernourished with 39.8% stunted, 30.9% underweight and 18.1% wasted. Lower socio-economic status and living in a rural rather than urban neighbourhood were all found to have strong associations with lower psychomotor scores and with undernutrition. Rural-urban differences in undernutrition were explained by the lower socio-economic status of families in rural areas. By contrast, rural-urban differences in psychomotor scores remained strong even after controlling for differences in socio-economic status. It was estimated that rural residence accounted for 28% of cases of delayed psychomotor development among study children. Improvements in socio-economic status are vital to achieve optimal growth and development during early childhood. The study draws attention to the importance of taking heed of contextual needs, especially relating to differences between rural and urban neighbourhoods, in the formulation and implementation of early child care and development interventions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  16. Developmental delay in the Amazon: The social determinants and prevalence among rural communities in Peru

    PubMed Central

    Alnasser, Yossef

    2017-01-01

    The consequences of poor child development are becoming increasingly recognized. Programs are being put in place around the world to improve child development by providing healthy and stimulating environments for children. However, these programs often have limited reach and little is known about the prevalence of developmental delay in under-developed communities. The current study set-out to better understand the prevalence of developmental delay in rural communities in the Amazon region of Peru. Also, it explores social determinants that are associated with any delay. Cross-sectional study by evaluating developmental delay in children under 4 years utilizing Ages and Stages Questionnaire (ASQ-3). Additionally, conducting a social determinants questionnaire answered by caretakers to identify social drivers for developmental delay. The data was analyzed with multi-variant analysis to measure association. The prevalence of developmental delay in the Amazonian communities was 26.7% (19.3% in communication, 11.4% in gross motor skills, 8% in both) (N = 596). The multivariate logistic regression analysis revealed significant associations between developmental delay and; level of education (OR 0.64, p = 0.009), age of mother during child’s birth (OR 0.96, p = 0.002), visits by community health agents (OR 0.73, p = 0.013), and river as primary water source (OR 2.39, p = 0.001). The social determinants questionnaire revealed that 39% of the mothers had their first child before the age of 17, nearly half stopped going to school before the age of 12 (52%), 29% gave birth at home, 13% breast fed for less than 7 months, and 50% of the children had diarrhea in the last month. There is still a great need to improve the conditions for child development in the Amazon region of Peru. One-fourth of the children suffer from developmental delay, which will likely impede their potentials for life unless something is done. The impact of education, age of mother at birth of the child, community health agents, and access to clean drinking water were important findings. Improvements can be made in these areas to create a large, cost-effective impact on the well-being of the communities. PMID:29023517

  17. Developmental delay in the Amazon: The social determinants and prevalence among rural communities in Peru.

    PubMed

    Westgard, Christopher; Alnasser, Yossef

    2017-01-01

    The consequences of poor child development are becoming increasingly recognized. Programs are being put in place around the world to improve child development by providing healthy and stimulating environments for children. However, these programs often have limited reach and little is known about the prevalence of developmental delay in under-developed communities. The current study set-out to better understand the prevalence of developmental delay in rural communities in the Amazon region of Peru. Also, it explores social determinants that are associated with any delay. Cross-sectional study by evaluating developmental delay in children under 4 years utilizing Ages and Stages Questionnaire (ASQ-3). Additionally, conducting a social determinants questionnaire answered by caretakers to identify social drivers for developmental delay. The data was analyzed with multi-variant analysis to measure association. The prevalence of developmental delay in the Amazonian communities was 26.7% (19.3% in communication, 11.4% in gross motor skills, 8% in both) (N = 596). The multivariate logistic regression analysis revealed significant associations between developmental delay and; level of education (OR 0.64, p = 0.009), age of mother during child's birth (OR 0.96, p = 0.002), visits by community health agents (OR 0.73, p = 0.013), and river as primary water source (OR 2.39, p = 0.001). The social determinants questionnaire revealed that 39% of the mothers had their first child before the age of 17, nearly half stopped going to school before the age of 12 (52%), 29% gave birth at home, 13% breast fed for less than 7 months, and 50% of the children had diarrhea in the last month. There is still a great need to improve the conditions for child development in the Amazon region of Peru. One-fourth of the children suffer from developmental delay, which will likely impede their potentials for life unless something is done. The impact of education, age of mother at birth of the child, community health agents, and access to clean drinking water were important findings. Improvements can be made in these areas to create a large, cost-effective impact on the well-being of the communities.

  18. Phelan-McDermid syndrome presenting with developmental delays and facial dysmorphisms.

    PubMed

    Kim, Yoon-Myung; Choi, In-Hee; Kim, Jun Suk; Kim, Ja Hye; Cho, Ja Hyang; Lee, Beom Hee; Kim, Gu-Hwan; Choi, Jin-Ho; Seo, Eul-Ju; Yoo, Han-Wook

    2016-11-01

    Phelan-McDermid syndrome is a rare genetic disorder caused by the terminal or interstitial deletion of the chromosome 22q13.3. Patients with this syndrome usually have global developmental delay, hypotonia, and speech delays. Several putative genes such as the SHANK3 , RAB , RABL2B , and IB2 are responsible for the neurological features. This study describes the clinical features and outcomes of Korean patients with Phelan-McDermid syndrome. Two patients showing global developmental delay, hypotonia, and speech delay were diagnosed with Phelan-McDermid syndrome via chromosome analysis, fluorescent in situ hybridization, and multiplex ligation-dependent probe amplification analysis. Brain magnetic resonance imaging of Patients 1 and 2 showed delayed myelination and severe communicating hydrocephalus, respectively. Electroencephalography in patient 2 showed high amplitude spike discharges from the left frontotemporoparietal area, but neither patient developed seizures. Kidney ultrasonography of both the patients revealed multicystic kidney disease and pelviectasis, respectively. Patient 2 experienced recurrent respiratory infections, and chest computed tomography findings demonstrated laryngotracheomalacia and bronchial narrowing. He subsequently died because of heart failure after a ventriculoperitoneal shunt operation at 5 months of age. Patient 1, who is currently 20 months old, has been undergoing rehabilitation therapy. However, global developmental delay was noted, as determines using the Korean Infant and Child Development test, the Denver developmental test, and the Bayley developmental test. This report describes the clinical features, outcomes, and molecular genetic characteristics of two Korean patients with Phelan-McDermid syndrome.

  19. Amphibian Population Sensitivity to Environmental and ...

    EPA Pesticide Factsheets

    Anticipating chronic effects of contaminant exposure on amphibian species is complicated both by toxicological and ecological uncertainty. Data for both chemical exposures and amphibian vital rates, including altered growth, are sparse. Developmental plasticity in amphibians further complicates evaluation of chemical impacts as metamorphosis is also influenced by other biotic and abiotic stressors, such as temperature, hydroperiod, predation, and conspecific density. Determining the effect of delayed tadpole development on survival through metamorphosis and subsequent recruitment must include possible effects of pond drying accelerating metamorphosis near the end of the larval stage. This model considers the combined influence of delayed onset of metamorphosis in a cohort as well as accelerated metamorphosis toward the end of the hydroperiod and determines the net influence of counteracting forces on tadpole development and survival. Amphibian populations with greater initial density dependence have less capacity for developmental plasticity and are therefore more vulnerable to delayed development and reduced hydroperiod. The consequential reduction in larval survival has a relatively greater impact on species with a shorter lifespan, allowing for fewer breeding seasons during which to successfully produce offspring. In response to risk assessment approaches that consider only survival and reproductive endpoints in population evaluation, we calculate conta

  20. Skeletal muscle characterization of Japanese quail line selectively bred for lower body weight as an avian model of delayed muscle growth with hypoplasia.

    PubMed

    Choi, Young Min; Suh, Yeunsu; Shin, Sangsu; Lee, Kichoon

    2014-01-01

    This study was designed to extensively characterize the skeletal muscle development in the low weight (LW) quail selected from random bred control (RBC) Japanese quail in order to provide a new avian model of impaired and delayed growth in physically normal animals. The LW line had smaller embryo and body weights than the RBC line in all age groups (P<0.05). During 3 to 42 d post-hatch, the LW line exhibited approximately 60% smaller weight of pectoralis major muscle (PM), mainly resulting from lower fiber numbers compared to the RBC line (P<0.05). During early post-hatch period when myotubes are still actively forming, the LW line showed impaired PM growth with prolonged expression of Pax7 and lower expression levels of MyoD, Myf-5, and myogenin (P<0.05), likely leading to impairment of myogenic differentiation and consequently, reduced muscle fiber formation. Additionally, the LW line had delayed transition of neonatal to adult myosin heavy chain isoform, suggesting delayed muscle maturation. This is further supported by the finding that the LW line continued to grow unlike the RBC line; difference in the percentages of PMW to body weights between both quail lines diminished with increasing age from 42 to 75 d post-hatch. This delayed muscle growth in the LW line is accompanied by higher levels of myogenin expression at 42 d (P<0.05), higher percentage of centered nuclei at 42 d (P<0.01), and greater rate of increase in fiber size between 42 and 75 d post-hatch (P<0.001) compared to the RBC line. Analysis of physiological, morphological, and developmental parameters during muscle development of the LW quail line provided a well-characterized avian model for future identification of the responsible genes and for studying mechanisms of hypoplasia and delayed muscle growth.

  1. PUF60 variants cause a syndrome of ID, short stature, microcephaly, coloboma, craniofacial, cardiac, renal and spinal features

    PubMed Central

    Low, Karen J; Ansari, Morad; Abou Jamra, Rami; Clarke, Angus; El Chehadeh, Salima; FitzPatrick, David R; Greenslade, Mark; Henderson, Alex; Hurst, Jane; Keller, Kory; Kuentz, Paul; Prescott, Trine; Roessler, Franziska; Selmer, Kaja K; Schneider, Michael C; Stewart, Fiona; Tatton-Brown, Katrina; Thevenon, Julien; Vigeland, Magnus D; Vogt, Julie; Willems, Marjolaine; Zonana, Jonathan; Study, D D D; Smithson, Sarah F

    2017-01-01

    PUF60 encodes a nucleic acid-binding protein, a component of multimeric complexes regulating RNA splicing and transcription. In 2013, patients with microdeletions of chromosome 8q24.3 including PUF60 were found to have developmental delay, microcephaly, craniofacial, renal and cardiac defects. Very similar phenotypes have been described in six patients with variants in PUF60, suggesting that it underlies the syndrome. We report 12 additional patients with PUF60 variants who were ascertained using exome sequencing: six through the Deciphering Developmental Disorders Study and six through similar projects. Detailed phenotypic analysis of all patients was undertaken. All 12 patients had de novo heterozygous PUF60 variants on exome analysis, each confirmed by Sanger sequencing: four frameshift variants resulting in premature stop codons, three missense variants that clustered within the RNA recognition motif of PUF60 and five essential splice-site (ESS) variant. Analysis of cDNA from a fibroblast cell line derived from one of the patients with an ESS variants revealed aberrant splicing. The consistent feature was developmental delay and most patients had short stature. The phenotypic variability was striking; however, we observed similarities including spinal segmentation anomalies, congenital heart disease, ocular colobomata, hand anomalies and (in two patients) unilateral renal agenesis/horseshoe kidney. Characteristic facial features included micrognathia, a thin upper lip and long philtrum, narrow almond-shaped palpebral fissures, synophrys, flared eyebrows and facial hypertrichosis. Heterozygote loss-of-function variants in PUF60 cause a phenotype comprising growth/developmental delay and craniofacial, cardiac, renal, ocular and spinal anomalies, adding to disorders of human development resulting from aberrant RNA processing/spliceosomal function. PMID:28327570

  2. Nutrient signaling and developmental timing of maturation.

    PubMed

    Danielsen, E Thomas; Moeller, Morten E; Rewitz, Kim F

    2013-01-01

    In animals, developmental timing of sexual maturation is tightly linked to nutrition and growth. Maturation only occurs once the juvenile has acquired sufficient nutrients and completed enough growth to produce a reproductively mature adult with a genetically predefined body size. Animals therefore adjust the duration of juvenile development to the dietary conditions. When nutrients are scarce the juvenile growth phase is extended to compensate for slow growth. Conversely, development is accelerated in nutrient rich environments where animals rapidly reach their genetic target size. To achieve such flexibility, nutrient-dependent growth regulators must feed into the endocrine system that controls the timing of maturation. Work on the fruit fly Drosophila has revealed a central role of secreted signal molecules with similarity to the conserved insulin-like growth factors (IGFs) in the decision making process. These molecules are involved in checkpoints that allow the endocrine system to decide whether to release the steroid hormone, ecdysone, that triggers maturation or extent development, depending on nutrient levels and growth status. Importantly, different dietary components influence timing of maturation in Drosophila, with proteins having the greatest impact; fat and sugar play a minor role, at least within the limits of what can be considered a balanced diet. Remarkably, excess dietary sugar concentrations that mimic physiological conditions associated with diabetes, negatively affect growth and delays maturation. Altogether, this shows that the source of energy in the diet is important for timing and may provide a paradigm for understanding the emerging links between diet, obesity and diabetes, and the onset of puberty. Here, we provide an overview of the system underlying developmental timing of maturation in Drosophila and review recent success in understanding its coupling to nutrition and growth. © 2013 Elsevier Inc. All rights reserved.

  3. Maternal Obesity: Risks for Developmental Delays in Early Childhood.

    PubMed

    Duffany, Kathleen O'Connor; McVeigh, Katharine H; Kershaw, Trace S; Lipkind, Heather S; Ickovics, Jeannette R

    2016-02-01

    To assess the risk for neurodevelopmental delays for children of mothers who were obese (≥200 pounds) prior to pregnancy, and to characterize delays associated with maternal obesity among children referred to and found eligible to receive Early Intervention Program services. We conducted a retrospective cohort study (N = 541,816) using a population-based New York City data warehouse with linked birth and Early Intervention data. Risks for children suspected of a delay and 'significantly delayed', with two moderate or one severe delay, were calculated. Among the group of children eligible by delay for Early Intervention, analyses assessed risk for being identified with a moderate-to-severe delay across each of five functional domains as well as risks for multiple delays. Children of mothers who were obese were more likely to be suspected of a delay (adjusted RR 1.19 [CI 1.15-1.22]) and borderline association for 'significantly delayed' (adjusted RR 1.01 [CI 1.00-1.02). Among children eligible by delay, children of mothers who were obese evidenced an increased risk for moderate-to-severe cognitive (adjusted RR 1.04 [CI 1.02-1.07]) and physical (adjusted RR 1.04 [CI 1.01-1.08]) delays and for global developmental delay (adjusted RR 1.05 [CI 1.01-1.08]). Maternal obesity is associated with increased risk of developmental delay in offspring. Among children with moderate or severe delays, maternal obesity is associated with increased risk of cognitive and physical delays as well as with increased risk for global developmental delay. While causation remains uncertain, this adds to the growing body of research reporting an association between maternal obesity and neurodevelopmental delays in offspring.

  4. Children adopted from China: a prospective study of their growth and development.

    PubMed

    Cohen, Nancy J; Lojkasek, Mirek; Zadeh, Zohreh Yaghoub; Pugliese, Mirella; Kiefer, Heidi

    2008-04-01

    China has become a lead country for international adoption because of the relatively young age of the children and reported positive conditions of the orphanages. This study examined the process and outcome of growth and development of children adopted from China over their first two years with their adoptive families. Seventy infant girls adopted from China at 8 to 21 months of age (Mean age = 13 months) were examined on arrival in Canada and 6, 12, and 24 months later. Comparisons were made with non-adopted Canadian girls of similar age and from a similar family background as adoptive parents on indices of growth and standardized measures of mental, psychomotor, and language development. At arrival, children adopted from China were smaller physically and exhibited developmental delays compared to current peers. Children adopted from China were functioning in the average range on physical and developmental measures within the first 6 months following adoption. However, they were not performing as well as current peers until the end of their second year after adoption. Even then, there was developmental variation in relation to comparison children and continuation of relatively smaller size with respect to height, weight, and head circumference. Physical measurement was related to outcomes at various points on all developmental measures. Deprivation in experience in the first year of life has more long-lasting effects on physical growth than on mental development. The variable most consistently related to development was height-to-age ratio. As a measure of nutritional status, the findings reinforce the critical importance of early nutrition.

  5. Chromosomal Microarray With Clinical Diagnostic Utility in Children With Developmental Delay or Intellectual Disability.

    PubMed

    Lee, Jin Sook; Hwang, Hee; Kim, Soo Yeon; Kim, Ki Joong; Choi, Jin Sun; Woo, Mi Jung; Choi, Young Min; Jun, Jong Kwan; Lim, Byung Chan; Chae, Jong Hee

    2018-09-01

    Chromosomal microarray (CMA) testing is a first-tier test for patients with developmental delay, autism, or congenital anomalies. It increases diagnostic yield for patients with developmental delay or intellectual disability. In some countries, including Korea, CMA testing is not yet implemented in clinical practice. We assessed the diagnostic utility of CMA testing in a large cohort of patients with developmental delay or intellectual disability in Korea. We conducted a genome-wide microarray analysis of 649 consecutive patients with developmental delay or intellectual disability at the Seoul National University Children's Hospital. Medical records were reviewed retrospectively. Pathogenicity of detected copy number variations (CNVs) was evaluated by referencing previous reports or parental testing using FISH or quantitative PCR. We found 110 patients to have pathogenic CNVs, which included 100 deletions and 31 duplications of 270 kb to 30 Mb. The diagnostic yield was 16.9%, demonstrating the diagnostic utility of CMA testing in clinic. Parental testing was performed in 66 patients, 86.4% of which carried de novo CNVs. In eight patients, pathogenic CNVs were inherited from healthy parents with a balanced translocation, and genetic counseling was provided to these families. We verified five rarely reported deletions on 2p21p16.3, 3p21.31, 10p11.22, 14q24.2, and 21q22.13. This study demonstrated the clinical utility of CMA testing in the genetic diagnosis of patients with developmental delay or intellectual disability. CMA testing should be included as a clinical diagnostic test for all children with developmental delay or intellectual disability. © The Korean Society for Laboratory Medicine.

  6. The Usefulness of M-B CDI-K Short Form as Screening Test in Children With Language Developmental Delay.

    PubMed

    Kim, Seong Woo; Jeon, Ha Ra; Park, Eun Ji; Kim, Hyo In; Jung, Da Wa; Woo, Mee Ryung

    2014-06-01

    To investigate the usefulness of MacArthur-Bates Communicative Development Inventories-Korean (M-B CDI-K) short form as a screening test in children with language developmental delay. From April 2010 to May 2012, a total of 87 patients visited the department of physical medicine and rehabilitation of National Health Insurance Service Ilsan Hospital with the complaint of language developmental delay and were enrolled in this study. All patients took M-B CDI-K short form and Sequenced Language Scale for Infants (SELSI) or Preschool Receptive-Expressive Language Scale (PRES) according to their age. The study group consisted of 58 male patients and 29 female patients and the mean age was 25.9 months. The diagnosis are global developmental delay in 26 patients, selective language impairment in 31 patients, articulation disorder in 7 patients, cerebral palsy in 8 patients, autism spectrum disorder in 4 patients, motor developmental delay in 4 patients, and others in 7 patients. Seventy-one patients are diagnosed with language developmental delay in SELSI or PRES and of them showed 69 patients a high risk in the M-B CDI-K short form. Sixteen patients are normal in SELSI or PRES and of them showed 14 patients non-high risk in the M-B CDI-K short form. The M-B CDI-K short form has 97.2% sensitivity, 87.5% specificity, a positive predictive value of 0.97, and a negative predictive value of 0.88. The M-B CDI-K short form has a high sensitivity and specificity so it is considered as an useful screening tool in children with language developmental delay. Additional researches targeting normal children will be continued to supply the specificity of the M-B CDI-K short form.

  7. High prevalence of developmental delay among children under three years of age in poverty-stricken areas of China.

    PubMed

    Wei, Q W; Zhang, J X; Scherpbier, R W; Zhao, C X; Luo, S S; Wang, X L; Guo, S F

    2015-12-01

    Poverty and its associated factors put children at risk for developmental delay. The aim of this study was to describe the neurodevelopment of children under three years of age in poverty-stricken areas of China and explore possible associated factors. A cross-sectional survey was conducted among 2837 children aged 1-35 months in poverty-stricken areas of China. Characteristics of the child, caregiver, and family were collected through face-to-face caregiver interviews. Developmental delay was explored with the five-domain, structured, parent-completed Ages and Stages Questionnaire. The Zung Self-rating Depression Scale was used to assess depressive symptoms of the caregivers. The Chi-squared test and multivariate logistic regression analyses were used to explore associated factors. Of the children, 39.7% (95% confidence interval, 37.9-41.5) had developmental delay in at least one of the five domains. For the domains of communication, gross motor, fine motor, problem solving, and personal-social skills, the prevalence was 11.5%, 18.5%, 21.4%, 18.4%, and 17.9%, respectively. Significant predictors of increased odds of developmental delay included the child having no toys (odds ratio [OR] = 2.31), the caregiver having depression (OR = 2.24), insufficient learning activities (OR = 1.65), and more children in the family (OR = 1.16). The high prevalence of developmental delay in children younger than three years in poverty-stricken areas of China and the presence of risk factors for developmental delay such as inadequate learning resources and activities in the home, caregiver depression, and low family income highlight the need for early identification and interventions. Copyright © 2015 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  8. Parenting Stress and Depression in Children with Mental Retardation and Developmental Disabilities.

    ERIC Educational Resources Information Center

    Kobe, Frank H.

    1994-01-01

    This study of 29 children with developmental delays found that parent ratings of children's depression were significantly associated with maternal depression, negative self-image, anxiety, and conduct problems. Data suggest that children with developmental delays exhibit a similar pattern of symptoms and associated characteristics to those found…

  9. Early life exposure to PCB126 results in delayed mortality and growth impairment in the zebrafish larvae.

    PubMed

    Di Paolo, Carolina; Groh, Ksenia J; Zennegg, Markus; Vermeirssen, Etiënne L M; Murk, Albertinka J; Eggen, Rik I L; Hollert, Henner; Werner, Inge; Schirmer, Kristin

    2015-12-01

    The occurrence of chronic or delayed toxicity resulting from the exposure to sublethal chemical concentrations is an increasing concern in environmental risk assessment. The Fish Embryo Toxicity (FET) test with zebrafish provides a reliable prediction of acute toxicity in adult fish, but it cannot yet be applied to predict the occurrence of chronic or delayed toxicity. Identification of sublethal FET endpoints that can assist in predicting the occurrence of chronic or delayed toxicity would be advantageous. The present study characterized the occurrence of delayed toxicity in zebrafish larvae following early exposure to PCB126, previously described to cause delayed effects in the common sole. The first aim was to investigate the occurrence and temporal profiles of delayed toxicity during zebrafish larval development and compare them to those previously described for sole to evaluate the suitability of zebrafish as a model fish species for delayed toxicity assessment. The second aim was to examine the correlation between the sublethal endpoints assessed during embryonal and early larval development and the delayed effects observed during later larval development. After exposure to PCB126 (3-3000ng/L) until 5 days post fertilization (dpf), larvae were reared in clean water until 14 or 28 dpf. Mortality and sublethal morphological and behavioural endpoints were recorded daily, and growth was assessed at 28 dpf. Early life exposure to PCB126 caused delayed mortality (300 ng/L and 3000 ng/L) as well as growth impairment and delayed development (100 ng/L) during the clean water period. Effects on swim bladder inflation and cartilaginous tissues within 5 dpf were the most promising for predicting delayed mortality and sublethal effects, such as decreased standard length, delayed metamorphosis, reduced inflation of swim bladder and column malformations. The EC50 value for swim bladder inflation at 5 dpf (169 ng/L) was similar to the LC50 value at 8 dpf (188 and 202 ng/L in two experiments). Interestingly, the patterns of delayed mortality and delayed effects on growth and development were similar between sole and zebrafish. This indicates the comparability of critical developmental stages across divergent fish species such as a cold water marine flatfish and a tropical freshwater cyprinid. Additionally, sublethal effects in early embryo-larval stages were found promising for predicting delayed lethal and sublethal effects of PCB126. Therefore, the proposed method with zebrafish is expected to provide valuable information on delayed mortality and delayed sublethal effects of chemicals and environmental samples that may be extrapolated to other species. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Suppression of severe achondroplasia with developmental delay and acanthosis nigricans by the p.Thr651Pro mutation.

    PubMed

    Manickam, Kandamurugu; Donoghue, Daniel J; Meyer, April N; Snyder, Pamela J; Prior, Thomas W

    2014-01-01

    Severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN) is an extremely rare severe skeletal dysplasia characterized by significant developmental delay, brain structural abnormalities, hearing loss, and acanthosis nigricans. The disorder is the result of a single missense mutation at codon 650 (p.Lys650Met) in the fibroblast growth factor receptor 3 gene (FGFR3). We describe a child who initially presented with a mild achondroplasia or hypochondroplasia like phenotype. Molecular analysis of the FGFR3 gene showed the common SADDAN mutation and a second novel mutation at codon 651 (p.Thr651Pro). Both mutations were shown to occur on the same allele (cis) and de novo. Transient transfection studies with FGFR3 double mutant constructs show that the p.Thr651Pro mutation causes a dramatic decrease in constitutive receptor kinase activity than that observed by the p.Lys650Met mutation. Our data suggest that the molecular effect by the p.Thr651Pro is to elicit a conformational change that decreases the FGFR3 tyrosine kinase activity, which is constitutively activated by the SADDAN mutation. Due to the inheritance of both a gain-of-function and a loss-of-function mutation, we conclude that a reduction of constitutive activation caused the milder skeletal phenotype. Although the occurrence of double mutations are expected to be rare, the presence of other FGFR3 modifiers may be responsible for some of the clinically discrepant skeletal dysplasia cases. © 2013 Wiley Periodicals, Inc.

  11. De novo microdeletions and point mutations affecting SOX2 in three individuals with intellectual disability but without major eye malformations.

    PubMed

    Dennert, Nicola; Engels, Hartmut; Cremer, Kirsten; Becker, Jessica; Wohlleber, Eva; Albrecht, Beate; Ehret, Julia K; Lüdecke, Hermann-Josef; Suri, Mohnish; Carignani, Giulia; Renieri, Alessandra; Kukuk, Guido M; Wieland, Thomas; Andrieux, Joris; Strom, Tim M; Wieczorek, Dagmar; Dieux-Coëslier, Anne; Zink, Alexander M

    2017-02-01

    Loss-of-function mutations and deletions of the SOX2 gene are known to cause uni- and bilateral anophthalmia and microphthalmia as well as related disorders such as anophthalmia-esophageal-genital syndrome. Thus, anophthalmia/microphthalmia is the primary indication for targeted, "phenotype first" analyses of SOX2. However, SOX2 mutations are also associated with a wide range of non-ocular abnormalities, such as postnatal growth retardation, structural brain anomalies, hypogenitalism, and developmental delay. The present report describes three patients without anophthalmia/microphthalmia and loss-of-function mutations or microdeletions of SOX2 who had been investigated in a "genotype first" manner due to intellectual disability/developmental delay using whole exome sequencing or chromosomal microarray analyses. This result prompted us to perform SOX2 Sanger sequencing in 192 developmental delay/intellectual disability patients without anophthalmia or microphthalmia. No additional SOX2 loss-of-function mutations were detected in this cohort, showing that SOX2 is clearly not a major cause of intellectual disability without anophthalmia/microphthalmia. In our three patients and four further, reported "genotype first" SOX2 microdeletion patients, anophthalmia/microphthalmia was present in less than half of the patients. Thus, SOX2 is another example of a gene whose clinical spectrum is broadened by the generation of "genotype first" findings using hypothesis-free, genome-wide methods. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Mild orotic aciduria in UMPS heterozygotes: a metabolic finding without clinical consequences.

    PubMed

    Wortmann, Saskia B; Chen, Margaret A; Colombo, Roberto; Pontoglio, Alessandro; Alhaddad, Bader; Botto, Lorenzo D; Yuzyuk, Tatiana; Coughlin, Curtis R; Descartes, Maria; Grűnewald, Stephanie; Maranda, Bruno; Mills, Philippa B; Pitt, James; Potente, Catherine; Rodenburg, Richard; Kluijtmans, Leo A J; Sampath, Srirangan; Pai, Emil F; Wevers, Ron A; Tiller, George E

    2017-05-01

    Elevated urinary excretion of orotic acid is associated with treatable disorders of the urea cycle and pyrimidine metabolism. Establishing the correct and timely diagnosis in a patient with orotic aciduria is key to effective treatment. Uridine monophosphate synthase is involved in de novo pyrimidine synthesis. Uridine monophosphate synthase deficiency (or hereditary orotic aciduria), due to biallelic mutations in UMPS, is a rare condition presenting with megaloblastic anemia in the first months of life. If not treated with the pyrimidine precursor uridine, neutropenia, failure to thrive, growth retardation, developmental delay, and intellectual disability may ensue. We identified mild and isolated orotic aciduria in 11 unrelated individuals with diverse clinical signs and symptoms, the most common denominator being intellectual disability/developmental delay. Of note, none had blood count abnormalities, relevant hyperammonemia or altered plasma amino acid profile. All individuals were found to have heterozygous alterations in UMPS. Four of these variants were predicted to be null alleles with complete loss of function. The remaining variants were missense changes and predicted to be damaging to the normal encoded protein. Interestingly, family screening revealed heterozygous UMPS variants in combination with mild orotic aciduria in 19 clinically asymptomatic family members. We therefore conclude that heterozygous UMPS-mutations can lead to mild and isolated orotic aciduria without clinical consequence. Partial UMPS-deficiency should be included in the differential diagnosis of mild orotic aciduria. The discovery of heterozygotes manifesting clinical symptoms such as hypotonia and developmental delay are likely due to ascertainment bias.

  13. Evaluative understanding and role-taking ability: a comparison of deaf and hearing children.

    PubMed

    Kusché, C A; Greenberg, M T

    1983-02-01

    The purposes of this study were (1) to evaluate the growth of social-cognitive knowledge in deaf and hearing children during the early and middle school years and (2) to assess the relative importance of language in 2 domains of social cognition. This study separately examined the child's ability to (1) evaluate the concepts of good and bad and (2) take another person's perspective. Subjects consisted of 30 deaf and 30 hearing children divided into 3 developmental levels (52 months, 74 months, and 119 months old). For the good/bad evaluation test, each child was shown 12 sets of multiple-choice pictures. Each set had 4 alternatives, which included 1 good, 1 bad, or all neutral activities. Role-taking ability was evaluated through the child's choice of strategy in a binary-choice hiding/guessing game. The results showed that deaf children evidence a developmental delay in the understanding of the concepts of good and bad. With regard to role-taking ability, there appears to be a developmental delay with young deaf children, which is no longer apparent by the age of 6. The assumption of egocentrism in school-age deaf children frequently found in the literature thus appears to be misleading. It is not that these deaf children are unable to take another person's perspective, but rather that they are delayed in evaluative understanding. The results suggest that language is of varying importance in differing domains of social and personality development.

  14. Sotos syndrome: a study of the diagnostic criteria and natural history.

    PubMed Central

    Cole, T R; Hughes, H E

    1994-01-01

    Seventy-nine patients with a provisional diagnosis of Sotos syndrome were clinically assessed, and their photographs between the ages of 1 and 6 years evaluated. These photographs, together with photographs of first degree relatives, also at ages 1 to 6 years, were reviewed by four clinical geneticists. Forty-one probands (but no first degree relatives) were identified in whom the facial gestalt was thought to be characteristic of Sotos syndrome. Comparison of anthropometric measurements, bone age, and developmental delay in these 41 probands showed marked differences between them and the remaining 38 probands, and allowed the formulation of guidelines for the diagnosis of Sotos syndrome. Length was identified as the most significantly increased prenatal parameter. In childhood occipitofrontal head circumference (OFC), height, and weight were all increased. OFC remained above the 97th centile in all but one case throughout childhood and adulthood, whereas height and weight had a tendency to return towards the mean. This 'normalisation' was more pronounced in females and was probably related to their early puberty. Early developmental delay and an advanced bone age, seen in 100% and 84% respectively of study cases, may be invariable in Sotos syndrome, but selection bias and limited data prevented confirmation of this supposition. The authors suggest that facial gestalt, growth pattern, bone age, and developmental delay are the major diagnostic criteria. Using these criteria, no affected first degree relatives were identified. There were few long term medical complications in the probands, but behavioural difficulties caused considerable parental concern. Images PMID:7512144

  15. Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom's syndrome gene.

    PubMed

    Chester, N; Kuo, F; Kozak, C; O'Hara, C D; Leder, P

    1998-11-01

    Bloom's syndrome is a human autosomal genetic disorder characterized at the cellular level by genome instability and increased sister chomatid exchanges (SCEs). Clinical features of the disease include proportional dwarfism and a predisposition to develop a wide variety of malignancies. The human BLM gene has been cloned recently and encodes a DNA helicase. Mouse embryos homozygous for a targeted mutation in the murine Bloom's syndrome gene (Blm) are developmentally delayed and die by embryonic day 13.5. The fact that the interrupted gene is the homolog of the human BLM gene was confirmed by its homologous sequence, its chromosomal location, and by demonstrating high numbers of SCEs in cultured murine Blm-/- fibroblasts. The proportional dwarfism seen in the human is consistent with the small size and developmental delay (12-24 hr) seen during mid-gestation in murine Blm-/- embryos. Interestingly, the growth retardation in mutant embryos can be accounted for by a wave of increased apoptosis in the epiblast restricted to early post-implantation embryogenesis. Mutant embryos do not survive past day 13.5, and at this time exhibit severe anemia. Red blood cells and their precursors from Blm-/- embryos are heterogeneous in appearance and have increased numbers of macrocytes and micronuclei. Both the apoptotic wave and the appearance of micronuclei in red blood cells are likely cellular consequences of damaged DNA caused by effects on replicating or segregating chromosomes.

  16. 2q37 Deletion syndrome confirmed by high-resolution cytogenetic analysis

    PubMed Central

    Cho, Eun-Kyung; Kim, Jinsup; Yang, Aram; Jin, Dong-Kyu

    2017-01-01

    Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. PMID:28690993

  17. Expanding the spectrum of phenotypes associated with germline PIGA mutations: a child with developmental delay, accelerated linear growth, facial dysmorphisms, elevated alkaline phosphatase, and progressive CNS abnormalities.

    PubMed

    van der Crabben, Saskia N; Harakalova, Magdalena; Brilstra, Eva H; van Berkestijn, Frédérique M C; Hofstede, Floris C; van Vught, Adrianus J; Cuppen, Edwin; Kloosterman, Wigard; Ploos van Amstel, Hans Kristian; van Haaften, Gijs; van Haelst, Mieke M

    2014-01-01

    Phosphatidyl inositol glycan (PIG) enzyme subclasses are involved in distinct steps of glycosyl phosphatidyl inositol anchor protein biosynthesis. Glycolsyl phosphatidyl inositol-anchored proteins have heterogeneous functions; they can function as enzymes, adhesion molecules, complement regulators and co-receptors in signal transduction pathways. Germline mutations in genes encoding different members of the PIG family result in diverse conditions with (severe) developmental delay, (neonatal) seizures, hypotonia, CNS abnormalities, growth abnormalities, and congenital abnormalities as hallmark features. The variability of clinical features resembles the typical diversity of other glycosylation pathway deficiencies such as the congenital disorders of glycosylation. Here, we report the first germline missense mutation in the PIGA gene associated with accelerated linear growth, obesity, central hypotonia, severe refractory epilepsy, cardiac anomalies, mild facial dysmorphic features, mildly elevated alkaline phosphatase levels, and CNS anomalies consisting of progressive cerebral atrophy, insufficient myelinization, and cortical MRI signal abnormalities. X-exome sequencing in the proband identified a c.278C>T (p.Pro93Leu) mutation in the PIGA gene. The mother and maternal grandmother were unaffected carriers and the mother showed 100% skewing of the X-chromosome harboring the mutation. These results together with the clinical similarity of the patient reported here and the previously reported patients with a germline nonsense mutation in PIGA support the determination that this mutation caused the phenotype in this family. © 2013 Wiley Periodicals, Inc.

  18. Exposure of children with developmental delay to social determinants of poor health: cross-sectional case record review study.

    PubMed

    Emerson, E; Brigham, P

    2015-03-01

    Research on child development in general has highlighted the importance that the family environment plays in mediating the pathway between exposure to low socio-economic position (SEP) and child well-being. While child developmental models in intellectual disability have highlighted the interplay between social context, family environment and child development, little empirical work has attempted to formally evaluate the evidence in support of specific mediating pathways between low SEP and child outcomes. Secondary analysis of cross-sectional confidentialized needs analysis data collected in three Primary Care Trusts in England covering a total population of 1.25 million people. Case record reviews were undertaken for 46 023 households, 2236 (4.9%) of which contained a child in the target age range with developmental delay. Children with developmental delay, when compared with their non-disabled peers, were at significantly increased risk of poorer health outcomes and of being exposed to a wide range of social determinants of poor health. Controlling for between-group differences in exposure to social determinants of poor health reduced the risk of developmental delay being associated with poorer health outcomes by 45% for behaviour problems and 89% for risk of significant harm. For children with developmental delay, parenting difficulties appears to play a particularly significant role in partially mediating the effects of low SEP. The findings of the present study point to the potential effectiveness of family-focused early intervention to prevent the emergence and escalation of behavioural difficulties and health problems in children with developmental delay. © 2014 John Wiley & Sons Ltd.

  19. Latent class analysis of early developmental trajectory in baby siblings of children with autism.

    PubMed

    Landa, Rebecca J; Gross, Alden L; Stuart, Elizabeth A; Bauman, Margaret

    2012-09-01

    Siblings of children with autism (sibs-A) are at increased genetic risk for autism spectrum disorders (ASD) and milder impairments. To elucidate diversity and contour of early developmental trajectories exhibited by sibs-A, regardless of diagnostic classification, latent class modeling was used. Sibs-A (N = 204) were assessed with the Mullen Scales of Early Learning from age 6 to 36 months. Mullen T scores served as dependent variables. Outcome classifications at age 36 months included: ASD (N = 52); non-ASD social/communication delay (broader autism phenotype; BAP; N = 31); and unaffected (N = 121). Child-specific patterns of performance were studied using latent class growth analysis. Latent class membership was then related to diagnostic outcome through estimation of within-class proportions of children assigned to each diagnostic classification. A 4-class model was favored. Class 1 represented accelerated development and consisted of 25.7% of the sample, primarily unaffected children. Class 2 (40.0% of the sample), was characterized by normative development with above-average nonverbal cognitive outcome. Class 3 (22.3% of the sample) was characterized by receptive language, and gross and fine motor delay. Class 4 (12.0% of the sample), was characterized by widespread delayed skill acquisition, reflected by declining trajectories. Children with an outcome diagnosis of ASD were spread across Classes 2, 3, and 4. Results support a category of ASD that involves slowing in early non-social development. Receptive language and motor development is vulnerable to early delay in sibs-A with and without ASD outcomes. Non-ASD sibs-A are largely distributed across classes depicting average or accelerated development. Developmental trajectories of motor, language, and cognition appear independent of communication and social delays in non-ASD sibs-A. © 2012 The Authors. Journal of Child Psychology and Psychiatry © 2012 Association for Child and Adolescent Mental Health.

  20. Caging, but not air deprivation, slows tadpole growth and development in the amphibian Xenopus laevis.

    PubMed

    Rose, Christopher S

    2014-08-01

    Xenopus laevis tadpoles raised in submerged cages in normoxic water develop more slowly than tadpoles raised with access to air. This study distinguishes between the effects of being caged and being deprived access to air on development and growth. Tadpoles were raised in high and low density control tanks and in cages in the same tank that were either completely submerged or with the top exposed to air. Experiments were repeated with the cages in different positions relative to the air stones and with and without the water flow from air stones supplemented with a pump. Whereas caging tadpoles has a large effect on their development and growth, additionally depriving them of air has a small effect and this effect can be removed by optimizing water flow through the cage. The effect of caging, though significant in this study, is small compared to the variation in growth and developmental rates that is commonly encountered within and among controls in lab studies. Caging effects can also be diminished by optimizing rearing conditions and/or having exceptionally vigorous tadpoles. The effects of air deprivation and caging thus pose less of a problem for experimenting on air-deprived (AD) and air-restored Xenopus tadpoles than their inherent variability in growth and developmental rates and their susceptibility to growth and developmental arrest. Further, the effect of air deprivation in this air-breathing amphibian does not pose a conflict with evolutionary hypotheses for lung loss involving lengthening of the larval period and delay in the onset of air breathing. © 2014 Wiley Periodicals, Inc.

  1. Imaginal discs secrete insulin-like peptide 8 to mediate plasticity of growth and maturation.

    PubMed

    Garelli, Andres; Gontijo, Alisson M; Miguela, Veronica; Caparros, Esther; Dominguez, Maria

    2012-05-04

    Developing animals frequently adjust their growth programs and/or their maturation or metamorphosis to compensate for growth disturbances (such as injury or tumor) and ensure normal adult size. Such plasticity entails tissue and organ communication to preserve their proportions and symmetry. Here, we show that imaginal discs autonomously activate DILP8, a Drosophila insulin-like peptide, to communicate abnormal growth and postpone maturation. DILP8 delays metamorphosis by inhibiting ecdysone biosynthesis, slowing growth in the imaginal discs, and generating normal-sized animals. Loss of dilp8 yields asymmetric individuals with an unusually large variation in size and a more varied time of maturation. Thus, DILP8 is a fundamental element of the hitherto ill-defined machinery governing the plasticity that ensures developmental stability and robustness.

  2. Environmental Enrichment Decreases Asphyxia-Induced Neurobehavioral Developmental Delay in Neonatal Rats

    PubMed Central

    Kiss, Peter; Vadasz, Gyongyver; Kiss-Illes, Blanka; Horvath, Gabor; Tamas, Andrea; Reglodi, Dora; Koppan, Miklos

    2013-01-01

    Perinatal asphyxia during delivery produces long-term disability and represents a major problem in neonatal and pediatric care. Numerous neuroprotective approaches have been described to decrease the effects of perinatal asphyxia. Enriched environment is a popular strategy to counteract nervous system injuries. The aim of the present study was to investigate whether enriched environment is able to decrease the asphyxia-induced neurobehavioral developmental delay in neonatal rats. Asphyxia was induced in ready-to-deliver mothers by removing the pups by caesarian section after 15 min of asphyxia. Somatic and neurobehavioral development was tested daily and motor coordination weekly. Our results show that rats undergoing perinatal asphyxia had a marked developmental delay and worse performance in motor coordination tests. However, pups kept in enriched environment showed a decrease in the developmental delay observed in control asphyctic pups. Rats growing up in enriched environment did not show decrease in weight gain after the first week and the delay in reflex appearance was not as marked as in control rats. In addition, the development of motor coordination was not as strikingly delayed as in the control group. Short-term neurofunctional outcome are known to correlate with long-term deficits. Our results thus show that enriched environment could be a powerful strategy to decrease the deleterious developmental effects of perinatal asphyxia. PMID:24232451

  3. Environmental enrichment decreases asphyxia-induced neurobehavioral developmental delay in neonatal rats.

    PubMed

    Kiss, Peter; Vadasz, Gyongyver; Kiss-Illes, Blanka; Horvath, Gabor; Tamas, Andrea; Reglodi, Dora; Koppan, Miklos

    2013-11-13

    Perinatal asphyxia during delivery produces long-term disability and represents a major problem in neonatal and pediatric care. Numerous neuroprotective approaches have been described to decrease the effects of perinatal asphyxia. Enriched environment is a popular strategy to counteract nervous system injuries. The aim of the present study was to investigate whether enriched environment is able to decrease the asphyxia-induced neurobehavioral developmental delay in neonatal rats. Asphyxia was induced in ready-to-deliver mothers by removing the pups by caesarian section after 15 min of asphyxia. Somatic and neurobehavioral development was tested daily and motor coordination weekly. Our results show that rats undergoing perinatal asphyxia had a marked developmental delay and worse performance in motor coordination tests. However, pups kept in enriched environment showed a decrease in the developmental delay observed in control asphyctic pups. Rats growing up in enriched environment did not show decrease in weight gain after the first week and the delay in reflex appearance was not as marked as in control rats. In addition, the development of motor coordination was not as strikingly delayed as in the control group. Short-term neurofunctional outcome are known to correlate with long-term deficits. Our results thus show that enriched environment could be a powerful strategy to decrease the deleterious developmental effects of perinatal asphyxia.

  4. Adaptive developmental delay in Chagas disease vectors: an evolutionary ecology approach.

    PubMed

    Menu, Frédéric; Ginoux, Marine; Rajon, Etienne; Lazzari, Claudio R; Rabinovich, Jorge E

    2010-05-25

    The developmental time of vector insects is important in population dynamics, evolutionary biology, epidemiology and in their responses to global climatic change. In the triatomines (Triatominae, Reduviidae), vectors of Chagas disease, evolutionary ecology concepts, which may allow for a better understanding of their biology, have not been applied. Despite delay in the molting in some individuals observed in triatomines, no effort was made to explain this variability. We applied four methods: (1) an e-mail survey sent to 30 researchers with experience in triatomines, (2) a statistical description of the developmental time of eleven triatomine species, (3) a relationship between development time pattern and climatic inter-annual variability, (4) a mathematical optimization model of evolution of developmental delay (diapause). 85.6% of responses informed on prolonged developmental times in 5(th) instar nymphs, with 20 species identified with remarkable developmental delays. The developmental time analysis showed some degree of bi-modal pattern of the development time of the 5(th) instars in nine out of eleven species but no trend between development time pattern and climatic inter-annual variability was observed. Our optimization model predicts that the developmental delays could be due to an adaptive risk-spreading diapause strategy, only if survival throughout the diapause period and the probability of random occurrence of "bad" environmental conditions are sufficiently high. Developmental delay may not be a simple non-adaptive phenotypic plasticity in development time, and could be a form of adaptive diapause associated to a physiological mechanism related to the postponement of the initiation of reproduction, as an adaptation to environmental stochasticity through a spreading of risk (bet-hedging) strategy. We identify a series of parameters that can be measured in the field and laboratory to test this hypothesis. The importance of these findings is discussed in terms of global climatic change and epidemiological consequences.

  5. Septo-Optic Dysplasia

    MedlinePlus

    ... children with SOD have normal intelligence, others have learning disabilities. Most, however, are developmentally delayed due to vision ... children with SOD have normal intelligence, others have learning disabilities. Most, however, are developmentally delayed due to vision ...

  6. Discrimination Acquisition in Children with Developmental Disabilities under Immediate and Delayed Reinforcement

    ERIC Educational Resources Information Center

    Sy, Jolene R.; Vollmer, Timothy R.

    2012-01-01

    We evaluated the discrimination acquisition of individuals with developmental disabilities under immediate and delayed reinforcement. In Experiment 1, discrimination between two alternatives was examined when reinforcement was immediate or delayed by 20 s, 30 s, or 40 s. In Experiment 2, discrimination between 2 alternatives was compared across an…

  7. Promoting Healthy Weight among Children with Developmental Delays

    ERIC Educational Resources Information Center

    Natale, Ruby R.; Camejo, Stephanie T.; Asfour, Lila; Uhlhorn, Susan B.; Delamater, Alan; Messiah, Sarah E.

    2017-01-01

    An extensive body of research demonstrates a higher prevalence of obesity among children with developmental delays (DD) versus children without delays. This analysis examined the effectiveness of a randomized controlled trial to promote healthy weight in a subsample of preschool-age children with DD (n = 71) on the adoption of quality nutrition…

  8. DNA Damage Analysis in Children with Non-syndromic Developmental Delay by Comet Assay.

    PubMed

    Susai, Surraj; Chand, Parkash; Ballambattu, Vishnu Bhat; Hanumanthappa, Nandeesha; Veeramani, Raveendranath

    2016-05-01

    Majority of the developmental delays in children are non-syndromic and they are believed to have an underlying DNA damage, though not well substantiated. Hence the present study was carried out to find out if there is any increased DNA damage in children with non-syndromic developmental delay by using the comet assay. The present case-control study was undertaken to assess the level of DNA damage in children with non syndromic developmental delay and compare the same with that of age and sex matched controls using submarine gel electrophoresis (Comet Assay). The blood from clinically diagnosed children with non syndromic developmental delay and controls were subjected for alkaline version of comet assay - Single cell gel electrophoresis using lymphocytes isolated from the peripheral blood. The comets were observed under a bright field microscope; photocaptured and scored using the Image J image quantification software. Comet parameters were compared between the cases and controls and statistical analysis and interpretation of results was done using the statistical software SPSS version 20. The mean comet tail length in cases and control was 20.77+7.659μm and 08.97+4.398μm respectively which was statistically significant (p<0.001). Other comet parameters like total comet length and % DNA in tail also showed a statistically significant difference (p < 0.001) between cases and controls. The current investigation unraveled increased levels of DNA damage in children with non syndromic developmental delay when compared to the controls.

  9. Arid1b haploinsufficient mice reveal neuropsychiatric phenotypes and reversible causes of growth impairment

    PubMed Central

    Celen, Cemre; Chuang, Jen-Chieh; Luo, Xin; Nijem, Nadine; Walker, Angela K; Chen, Fei; Zhang, Shuyuan; Chung, Andrew S; Nguyen, Liem H; Nassour, Ibrahim; Budhipramono, Albert; Sun, Xuxu; Bok, Levinus A; McEntagart, Meriel; Gevers, Evelien F; Birnbaum, Shari G; Eisch, Amelia J; Powell, Craig M; Ge, Woo-Ping; Santen, Gijs WE; Chahrour, Maria; Zhu, Hao

    2017-01-01

    Sequencing studies have implicated haploinsufficiency of ARID1B, a SWI/SNF chromatin-remodeling subunit, in short stature (Yu et al., 2015), autism spectrum disorder (O'Roak et al., 2012), intellectual disability (Deciphering Developmental Disorders Study, 2015), and corpus callosum agenesis (Halgren et al., 2012). In addition, ARID1B is the most common cause of Coffin-Siris syndrome, a developmental delay syndrome characterized by some of the above abnormalities (Santen et al., 2012; Tsurusaki et al., 2012; Wieczorek et al., 2013). We generated Arid1b heterozygous mice, which showed social behavior impairment, altered vocalization, anxiety-like behavior, neuroanatomical abnormalities, and growth impairment. In the brain, Arid1b haploinsufficiency resulted in changes in the expression of SWI/SNF-regulated genes implicated in neuropsychiatric disorders. A focus on reversible mechanisms identified Insulin-like growth factor (IGF1) deficiency with inadequate compensation by Growth hormone-releasing hormone (GHRH) and Growth hormone (GH), underappreciated findings in ARID1B patients. Therapeutically, GH supplementation was able to correct growth retardation and muscle weakness. This model functionally validates the involvement of ARID1B in human disorders, and allows mechanistic dissection of neurodevelopmental diseases linked to chromatin-remodeling. DOI: http://dx.doi.org/10.7554/eLife.25730.001 PMID:28695822

  10. The Efficacy of Arabic Version of the Developmental Assessment of Young Children Second Edition (DAYC-2) Scale in Detecting Developmental Delay among Jordanian Children Aged Birth to 71 Months

    ERIC Educational Resources Information Center

    Saleh, Rawan M. Abu; Smadi, Jamil M.

    2017-01-01

    This study aimed to assess the efficacy of the developmental assessment of young children second edition (DAYC-2) Scale in detecting Developmental Delay among Jordanian children aged birth to 71 months. Firstly, the scale was translated and reviewed for language and cultural appropriateness. Secondly, the Arabic Jordanian version of the scale was…

  11. The use of the Bayley Scales of Infant and Toddler Development III with clinical populations: a preliminary exploration.

    PubMed

    Milne, Susan; McDonald, Jenny; Comino, Elizabeth J

    2012-02-01

    In response to concerns that the Bayley Scales of Infant and Toddler Development III (BSIDIII) underestimate delay in clinical populations, this study explores developmental quotient scores as an alternative to composite scores for these children. One hundred and twenty-two children aged ≤42 months, referred for diagnosis of developmental disability from January 2007 to May 2010, were assessed, and their composite and developmental quotient scores on each scale were compared. Composite scores identified only 22% (cognitive), 27% (motor), and 47.5% (language) of children as having a developmental disability. Developmental quotient scores were significantly lower than composite scores, giving rates of developmental disability of 56.6% (cognitive), 48.4% (motor), and 74.6% (language) and more closely matching both clinical impressions of delay and the proportions of those children who were also delayed on standardized tests of adaptive function.

  12. Developmental cigarette smoke exposure II: Hippocampus proteome and metabolome profiles in adult offspring.

    PubMed

    Neal, Rachel E; Jagadapillai, Rekha; Chen, Jing; Webb, Cindy; Stocke, Kendall; Greene, Robert M; Pisano, M Michele

    2016-10-01

    Exposure to cigarette smoke during development is linked to neurodevelopmental delays and cognitive impairment including impulsivity, attention deficit disorder, and lower IQ. Utilizing a murine experimental model of "active" inhalation exposure to cigarette smoke spanning the entirety of gestation and through human third trimester equivalent hippocampal development [gestation day 1 (GD1) through postnatal day 21 (PD21)], we examined hippocampus proteome and metabolome alterations present at a time during which developmental cigarette smoke exposure (CSE)-induced behavioral and cognitive impairments are evident in adult animals from this model system. At six month of age, carbohydrate metabolism and lipid content in the hippocampus of adult offspring remained impacted by prior exposure to cigarette smoke during the critical period of hippocampal ontogenesis indicating limited glycolysis. These findings indicate developmental CSE-induced systemic glucose availability may limit both organism growth and developmental trajectory, including the capacity for learning and memory. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. A Descriptive Study of Hyperlexia in a Clinically Referred Sample of Children with Developmental Delays.

    ERIC Educational Resources Information Center

    Grigorenok, Elena L.; Klin, Ami; Pauls, David L.; Senft, Riley; Hooper, Catalina; Volkmar, Fred

    2002-01-01

    This study of hyperlexia in 80 children with developmental delays found no significant differences in the frequency of hyperlexia in girls compared with boys; a significantly elevated frequency of hyperlexia in children diagnosed with pervasive developmental disorders (PDD) compared with children with non-PDD diagnoses; and a similar range of IQ…

  14. Effects of Weighted Vests on the Engagement of Children with Developmental Delays and Autism

    ERIC Educational Resources Information Center

    Reichow, Brian; Barton, Erin E.; Sewell, Joanna Neely; Good, Leslie; Wolery, Mark

    2010-01-01

    The use of weighted vests for children with autism spectrum disorders and developmental disabilities is a common practice as part of sensory integration therapy programs. The purpose of the current investigation was to extend the research on the use of weighted vests for children with autism and developmental delays in a methodologically rigorous…

  15. Early Generalized Overgrowth in Boys With Autism

    PubMed Central

    Chawarska, Katarzyna; Campbell, Daniel; Chen, Lisha; Shic, Frederick; Klin, Ami; Chang, Joseph

    2016-01-01

    Context Multiple studies have reported an overgrowth in head circumference (HC) in the first year of life in autism. However, it is unclear whether this phenomenon is independent of overall body growth and whether it is associated with specific social or cognitive features. Objectives To examine the trajectory of early HC growth in autism compared with control groups; to assess whether HC growth in autism is independent of height and weight growth during infancy; and to examine HC growth from birth to 24 months in relationship to social, verbal, cognitive, and adaptive functioning levels. Design Retrospective study. Setting A specialized university-based clinic. Participants Boys diagnosed as having autistic disorder (n=64), pervasive developmental disorder–not otherwise specified (n=34), global developmental delay (n=13), and other developmental problems (n=18) and typically developing boys (n=55). Main Outcome Measures Age-related changes in HC, height, and weight between birth and age 24 months; measures of social, verbal, and cognitive functioning at age 2 years. Results Compared with typically developing controls, boys with autism were significantly longer by age 4.8 months, had a larger HC by age 9.5 months, and weighed more by age 11.4 months (P=.05 for all). None of the other clinical groups showed a similar overgrowth pattern. Boys with autism who were in the top 10% of overall physical size in infancy exhibited greater severity of social deficits (P=.009) and lower adaptive functioning (P=.03). Conclusions Boys with autism experienced accelerated HC growth in the first year of life. However, this phenomenon reflected a generalized process affecting other morphologic features, including height and weight. The study highlights the importance of studying factors that influence not only neuronal development but also skeletal growth in autism. PMID:21969460

  16. Rhomboid Enhancer Activity Defines a Subset of Drosophila Neural Precursors Required for Proper Feeding, Growth and Viability

    PubMed Central

    Gresser, Amy L.; Gutzwiller, Lisa M.; Gauck, Mackenzie K.; Hartenstein, Volker; Cook, Tiffany A.; Gebelein, Brian

    2015-01-01

    Organismal growth regulation requires the interaction of multiple metabolic, hormonal and neuronal pathways. While the molecular basis for many of these are well characterized, less is known about the developmental origins of growth regulatory structures and the mechanisms governing control of feeding and satiety. For these reasons, new tools and approaches are needed to link the specification and maturation of discrete cell populations with their subsequent regulatory roles. In this study, we characterize a rhomboid enhancer element that selectively labels four Drosophila embryonic neural precursors. These precursors give rise to the hypopharyngeal sensory organ of the peripheral nervous system and a subset of neurons in the deutocerebral region of the embryonic central nervous system. Post embryogenesis, the rhomboid enhancer is active in a subset of cells within the larval pharyngeal epithelium. Enhancer-targeted toxin expression alters the morphology of the sense organ and results in impaired larval growth, developmental delay, defective anterior spiracle eversion and lethality. Limiting the duration of toxin expression reveals differences in the critical periods for these effects. Embryonic expression causes developmental defects and partially penetrant pre-pupal lethality. Survivors of embryonic expression, however, ultimately become viable adults. In contrast, post-embryonic toxin expression results in fully penetrant lethality. To better define the larval growth defect, we used a variety of assays to demonstrate that toxin-targeted larvae are capable of locating, ingesting and clearing food and they exhibit normal food search behaviors. Strikingly, however, following food exposure these larvae show a rapid decrease in consumption suggesting a satiety-like phenomenon that correlates with the period of impaired larval growth. Together, these data suggest a critical role for these enhancer-defined lineages in regulating feeding, growth and viability. PMID:26252385

  17. The intrinsic growth rate as a predictor of population viability under climate warming.

    PubMed

    Amarasekare, Priyanga; Coutinho, Renato M

    2013-11-01

    1. Lately, there has been interest in using the intrinsic growth rate (rm) to predict the effects of climate warming on ectotherm population viability. However, because rm is calculated using the Euler-Lotka equation, its reliability in predicting population persistence depends on whether ectotherm populations can achieve a stable age/stage distribution in thermally variable environments. Here, we investigate this issue using a mathematical framework that incorporates mechanistic descriptions of temperature effects on vital rates into a stage-structured population model that realistically captures the temperature-induced variability in developmental delays that characterize ectotherm life cycles. 2. We find that populations experiencing seasonal temperature variation converge to a stage distribution whose intra-annual pattern remains invariant across years. As a result, the mean annual per capita growth rate also remains constant between years. The key insight is the mechanism that allows populations converge to a stationary stage distribution. Temperature effects on the biochemical processes (e.g. enzyme kinetics, hormonal regulation) that underlie life-history traits (reproduction, development and mortality) exhibit well-defined thermodynamical properties (e.g. changes in entropy and enthalpy) that lead to predictable outcomes (e.g. reduction in reaction rates or hormonal action at temperature extremes). As a result, life-history traits exhibit a systematic and predictable response to seasonal temperature variation. This in turn leads to temporally predictable temperature responses of the stage distribution and the per capita growth rate. 3. When climate warming causes an increase in the mean annual temperature and/or the amplitude of seasonal fluctuations, the population model predicts the mean annual per capita growth rate to decline to zero within 100 years when warming is slow relative to the developmental period of the organism (0.03-0.05°C per year) and to become negative, causing population extinction, well before 100 years when warming is fast (e.g. 0.1°C per year). The Euler-Lotka equation predicts a slower decrease in rm when warming is slow and a longer persistence time when warming is fast, with the deviation between the two metrics increasing with increasing developmental period. These results suggest that predictions of ectotherm population viability based on rm may be valid only for species with short developmental delays, and even then, only over short time-scales and under slow warming regimes. © 2013 The Authors. Journal of Animal Ecology © 2013 British Ecological Society.

  18. Using Time Delay to Teach Literacy to Students with Severe Developmental Disabilities

    ERIC Educational Resources Information Center

    Browder, Diane; Ahlgrim-Delzell, Lynn; Spooner, Fred; Mims, Pamela J.; Baker, Joshua N.

    2009-01-01

    A review of the literature was conducted for articles published between 1975 and 2007 on the application of time delay as an instructional procedure to teach word and picture recognition to students with severe developmental disabilities in an effort to evaluate time delay as an evidence-based practice. A total of 30 experiments were analyzed…

  19. Global developmental delay with sodium valproate-induced gingival hyperplasia.

    PubMed

    Patil, Ravi B; Urs, Pallavi; Kiran, Shital; Bargale, Seema Dinesh

    2014-01-22

    Global developmental delay (GDD) refers to a disturbance in an individual child across one or more developmental domains, which include motor, cognition, daily activities, speech and language. The present case discusses a 5-year-old child with GDD associated with infantile spasms treated with sodium valproate. Delay in the widespread acquisition of skills, epilepsy and poor oral hygiene with gingival enlargement was the main concern to seek medical aid. This case is special as the child was suffering from GDD associated with sodium valproate-induced gingival enlargement.

  20. Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions.

    PubMed

    Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst

    2013-09-01

    In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Three Positive Parenting Practices and Their Correlation with Risk of Childhood Developmental, Social, or Behavioral Delays: An Analysis of the National Survey of Children's Health.

    PubMed

    Cprek, Sarah E; Williams, Corrine M; Asaolu, Ibitola; Alexander, Linda A; Vanderpool, Robin C

    2015-11-01

    (1) Investigate the relationship between three specific positive parenting practices (PPP)-reading to children, engaging in storytelling or singing, and eating meals together as a family-and parent-reported risk of developmental, behavioral, or social delays among children between the ages of 1-5 years in the US. (2) Determine if a combination of these parenting practices has an effect on the outcome. Chi square and multiple logistic regression analyses were used to analyze cross-sectional data from the National Survey of Children's Health 2011/2012 in regards to the relationship between each of the three individual PPP as well as a total PPP score and the child's risk of being developmentally, socially, or behaviorally delayed (N = 21,527). Risk of delay was calculated using the Parents' Evaluation of Developmental Status Questionnaire, which is a parental self-report measure that has been correlated with diagnosed child delays. These analyses controlled for poverty and parental education. All analyses were completed using SAS Version 9.3. A strong correlation was found between each of the three PPP as well as the total PPP score and the child's risk of developmental, social, or behavioral delays (p < 0.05 for each test). These associations were found to have a dose-response relationship (p < 0.05 in all but one analysis). Daily engagement in PPP could possibly reduce children's risk of delay, and specifically engaging in all three PPP may have greater benefit.

  2. Developmental profiles and mentality in preschool children with Prader-Willi syndrome: a preliminary study.

    PubMed

    Chen, Chien-Min; Chen, Chia-Ling; Hou, Jia-Woei; Hsu, Hung-Chih; Chung, Chia-Ying; Chou, Shih-Wei; Lin, Chu-Hsu; Chen, Kai-Hua

    2010-01-01

    A majority of the children with Prader-Willi syndrome (PWS) have global developmental delay and mental delay. The aim of this study was to investigate the developmental profiles and mental assessments among preschool children with PWS. Ten children with PWS between the ages of 15 months to 6 years, and 11 children with typical development were enrolled. Developmental profiles in terms of their developmental quotient (DQ) for the eight domains of the Chinese Children Developmental Inventory (CCDI) and mental assessments in terms of intelligence quotient (IQ) and developmental index (DI) were carried out for all children. The DQs of all eight domains, including gross motor, fine motor, expressive language, concept comprehension, situation comprehension, self help, personal- social and general development, in the PWS group were lower than the DQs of the children from the typical development group (p < 0.01). Children with PWS had better DQs in the fine motor domain than in the gross motor domain and in the receptive language domain than in the expressive language domain. Furthermore, their verbal IQ were better than their performance IQ and their mental DI was better than their psychomotor DI. These findings suggest that the children with PWS show an uneven global developmental delay together with an uneven mental delay. The results of this study should allow clinicians to better understand the developmental functioning of children with PWS and this will help with the planning of treatment strategies.

  3. Severe developmental delay and multiple strawberry naevi: a new syndrome?

    PubMed Central

    Upton, C J; Young, I D

    1993-01-01

    An 18 month old girl with dysmorphic features, severe developmental delay, multiple strawberry naevi, and capillary naevi is described. No previous report of a similar association of features has been identified. Images PMID:8230170

  4. Prader-Willi-like phenotype: investigation of 1p36 deletion in 41 patients with delayed psychomotor development, hypotonia, obesity and/or hyperphagia, learning disabilities and behavioral problems.

    PubMed

    D'Angelo, Carla S; Da Paz, José A; Kim, Chong A; Bertola, Débora R; Castro, Claudia I E; Varela, Monica C; Koiffmann, Célia P

    2006-01-01

    Monosomy 1p36 is one of the most commonly observed mental retardation (MR) syndromes that results in a clinically recognizable phenotype including delayed psychomotor development and/or MR, hypotonia, epilepsy, hearing loss, growth delay, microcephaly, deep-set eyes, flat nasal bridge and pointed chin. Besides, a Prader-Willi syndrome (PWS)-like phenotype has been described in patients with 1p36 monosomy. Forty-one patients presenting hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who tested negative for PWS were investigated by FISH and/or microsatellite markers. Twenty-six were analyzed with a 1p-specific subtelomeric probe, and one terminal deletion was identified. Thirty patients (15 of which also studied by FISH) were investigated by microsatellite markers, and no interstitial 1p36 deletion was found. Our patient presenting the 1p36 deletion did not have the striking features of this monosomy, but her clinical and behavioral features were quite similar to those observed in patients with PWS, except for the presence of normal sucking at birth. The extent of the deletion could be limited to the most terminal 2.5 Mb of 1p36, within the chromosomal region 1p36.33-1p36.32, that is smaller than usually seen in monosomy 1p36 patients. Therefore, chromosome 1p36.33 deletion should be investigated in patients with hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who test negative for PWS.

  5. A unique combination of 17pter trisomy and 21qter monosomy in a boy with developmental delay, severe intellectual disability, growth retardation and dysmorphisms.

    PubMed

    Zheng, Zhaojing; Yao, Ru-En; Geng, Juan; Jin, Xingming; Shen, Yongnian; Ying, Daming; Fu, Qihua; Yu, Yongguo

    2013-03-10

    Microduplication at 17p13.3 and microdeletion at 21q22 are both rare chromosomal aberrations. The presence of both genomic imbalances in one patient has not been previously reported in literature. In this study, we performed a molecular diagnostic testing with a whole genome microarray on a 3-year-old boy with developmental delay, mental retardation and multiple malformations. A routine G-banding karyotype analysis was performed using peripheral lymphocytes. Chromosome microarray analysis (CMA) was done using Affymetrix CytoScan™ HD array. Genomic imbalances were further confirmed by multiple ligation-dependent probe amplification (MLPA). The result of karyotyping was normal but CMA detected a 9.8 Mb microduplication at 17p13.3-13.1 (chr17: 1-9,875,545) and a 2.8 Mb microdeletion involving 21q22.3-qter (chr21: 45,239,077-48,097,372). The imbalances were due to a balanced translocation present in patient's mother. The patient was characterized with short stature, profound developmental delay, non-verbal, intellectual disability as well as craniofacial dysmorphism, subtle brain structural anomaly and sparse scalp hair. This is the first patient reported with a combination of a microduplication at 17p13.3-13.1 and a microdeletion at 21q22.3-qter. Both genomic imbalances were undetected by conventional karyotyping but were delineated with CMA test. Synergistic effect from the two rare genomic imbalances is likely responsible for the severe clinical phenotypes observed in this patient. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Developmental delay in moderately preterm-born children with low socioeconomic status: risks multiply.

    PubMed

    Potijk, Marieke R; Kerstjens, Jorien M; Bos, Arend F; Reijneveld, Sijmen A; de Winter, Andrea F

    2013-11-01

    To assess separate and joint effects of low socioeconomic status (SES) and moderate prematurity on preschool developmental delay. Prospective cohort study with a community-based sample of preterm- and term-born children (Longitudinal Preterm Outcome Project). We assessed SES on the basis of education, occupation, and family income. The Ages and Stages Questionnaire was used to assess developmental delay at age 4 years. We determined scores for overall development, and domains fine motor, gross motor, communication, problem-solving, and personal-social of 926 moderately preterm-born (MP) (32-36 weeks gestation) and 544 term-born children. In multivariable logistic regression analyses, we used standardized values for SES and gestational age (GA). Prevalence rates for overall developmental delay were 12.5%, 7.8%, and 5.6% in MP children with low, intermediate, and high SES, respectively, and 7.2%, 4.0%, and 2.8% in term-born children, respectively. The risk for overall developmental delay increased more with decreasing SES than with decreasing GA, but the difference was not statistically significant: OR (95% CI) for a 1 standard deviation decrease were: 1.62 (1.30-2.03) and 1.34 (1.05-1.69), respectively, after adjustment for sex, number of siblings, and maternal age. No interaction was found except for communication, showing that effects of SES and GA are mostly multiplicative. Low SES and moderate prematurity are separate risk factors with multiplicative effects on developmental delay. The double jeopardy of MP children with low SES needs special attention in pediatric care. Copyright © 2013 Mosby, Inc. All rights reserved.

  7. Fetal growth from mid- to late pregnancy is associated with infant development: the Generation R Study.

    PubMed

    Henrichs, Jens; Schenk, Jacqueline J; Barendregt, Charlotte S; Schmidt, Henk G; Steegers, Eric Ap; Hofman, Albert; Jaddoe, Vincent W V; Moll, Henriette A; Verhulst, Frank C; Tiemeier, Henning

    2010-07-01

    The aim of this study was to investigate within a population-based cohort of 4384 infants (2182 males, 2202 females) whether fetal growth from early pregnancy onwards is related to infant development and whether this potential relationship is independent of postnatal growth. Ultrasound measurements were performed in early, mid-, and late pregnancy. Estimated fetal weight was calculated using head and abdominal circumference and femur length. Infant development was measured with the Minnesota Infant Development Inventory at 12 months (SD 1.1mo, range 10-17mo). Information on postnatal head size and body weight at 7 months was obtained from medical records. After adjusting for potential confounders and for postnatal growth, faster fetal weight gain from mid- to late pregnancy predicted a reduced risk of delayed social development (odds ratio [OR] 0.82; 95% confidence interval [CI] 0.71-0.95, p=0.008), self-help abilities (OR 0.84; 95% CI 0.73-0.98, p=0.023), and overall infant development (OR 0.65; 95% CI 0.49-0.87, p=0.003). Similar findings were observed for fetal head growth from mid- to late pregnancy. Faster fetal growth predicts a lower risk of delayed infant development independent of postnatal growth. These results suggest that reduced fetal growth between mid- and late pregnancy may determine subsequent developmental outcomes.

  8. Developmental delay

    USDA-ARS?s Scientific Manuscript database

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  9. Trajectories of autonomy development across the adolescent transition in children with spina bifida.

    PubMed

    Friedman, Deborah; Holmbeck, Grayson N; DeLucia, Christian; Jandasek, Barbara; Zebracki, Kathy

    2009-02-01

    The current study investigated individual growth in autonomy development across the adolescent transition, comparing the trajectories of children with and without spina bifida. Individual growth curve modeling procedures were utilized to describe the developmental course of autonomy across four waves of data collection, from ages 9 to 15, and to test whether illness status [spina bifida vs. matched comparison group (N = 68 for both groups at Time 1)] would significantly predict individual variability in autonomy development. Potential moderators [child gender, SES, and Peabody Picture Vocabulary Test (PPVT) score] of the association between illness status and autonomy development were also examined. Children with spina bifida demonstrated distinct developmental trajectories, though the nature of the group differences varied by type of autonomy development (emotional vs. behavioral), context (i.e. school vs. family), and reporter. Significant interactions with PPVT score and child gender were found. Overall, children with spina bifida show considerable developmental resiliency, but may lag behind their peers in specific areas of autonomy. Boys with spina bifida, and children with spina bifida who have lower than average levels of verbal intelligence, appear to be at greater risk for exhibiting delays in autonomy development.

  10. Prenatal exposure to a common organophosphate insecticide delays motor development in a mouse model of idiopathic autism.

    PubMed

    De Felice, Alessia; Scattoni, Maria Luisa; Ricceri, Laura; Calamandrei, Gemma

    2015-01-01

    Autism spectrum disorders are characterized by impaired social and communicative skills and repetitive behaviors. Emerging evidence supported the hypothesis that these neurodevelopmental disorders may result from a combination of genetic susceptibility and exposure to environmental toxins in early developmental phases. This study assessed the effects of prenatal exposure to chlorpyrifos (CPF), a widely diffused organophosphate insecticide endowed with developmental neurotoxicity at sub-toxic doses, in the BTBR T+tf/J mouse strain, a validated model of idiopathic autism that displays several behavioral traits relevant to the autism spectrum. To this aim, pregnant BTBR mice were administered from gestational day 14 to 17 with either vehicle or CPF at a dose of 6 mg/kg/bw by oral gavages. Offspring of both sexes underwent assessment of early developmental milestones, including somatic growth, motor behavior and ultrasound vocalization. To evaluate the potential long-term effects of CPF, two different social behavior patterns typically altered in the BTBR strain (free social interaction with a same-sex companion in females, or interaction with a sexually receptive female in males) were also examined in the two sexes at adulthood. Our findings indicate significant effects of CPF on somatic growth and neonatal motor patterns. CPF treated pups showed reduced weight gain, delayed motor maturation (i.e., persistency of immature patterns such as pivoting at the expenses of coordinated locomotion) and a trend to enhanced ultrasound vocalization. At adulthood, CPF associated alterations were found in males only: the altered pattern of investigation of a sexual partner, previously described in BTBR mice, was enhanced in CPF males, and associated to increased ultrasonic vocalization rate. These findings strengthen the need of future studies to evaluate the role of environmental chemicals in the etiology of neurodevelopment disorders.

  11. Are the anticipatory pathways in lecithotrophic larvae that delay metamorphosis adaptations? (A review).

    PubMed

    Freeman, Gary

    2012-01-01

    During anticipatory development in lecithotrophic larvae that delay metamorphosis, the growth and differentiation of features of the adult action system continue to develop at a slow pace even though they do not become functional. After metamorphosis occurs, the larger size and advanced development of these components may allow juveniles to initially grow at a faster rate than they normally would. Anticipatory development has been demonstrated in archeogastropods, some solitary ascidians and a hydrozoan. In the gastropod Haliotis and the hydrozoan Phialidium anticipatory development increases the initial growth rate of juveniles. In Haliotis and ascidians all of the larvae of a given female that live long enough exhibit anticipatory development. In Phialidium, the ability of a given female to produce larvae that can exhibit anticipatory development is a maternal polymorphic character. In Haliotis and solitary ascidians that exhibit anticipatory development, it appears to be a slower version of the rapid developmental changes that occur in parts of the adult action system at metamorphosis. In Phialidium, developmental changes in relative sizes of the different presumptive regions of the polyp are slowly altered prior to and independently of metamorphosis. Anticipatory development is not linked to the decrease in the size or nutrient reserves of older larvae but to the length of their larval period. From an evolutionary perspective, the mechanisms that operate during anticipatory development are probably of adaptive significance for lecithotrophic larvae of species that spend variable amounts of time in the water column because of a patchy distribution of appropriate settlement cues. The developmental mechanisms that underlie anticipatory development may have been used during the transition from lecithotrophy to planktotrophy. © 2012 Wiley Periodicals, Inc.

  12. Depressive and Anxiety Symptom Trajectories From School-Age Through Young Adulthood in Samples With Autism Spectrum Disorder and Developmental Delay

    PubMed Central

    Gotham, Katherine; Brunwasser, Steven M.; Lord, Catherine

    2015-01-01

    Objective To (1) model growth in anxiety and depressive symptoms from late school age through young adulthood in individuals with autism spectrum disorder (ASD) and controls with developmental delay (DD); and (2) assess relationships between internalizing growth patterns, participant characteristics, baseline predictors, and distal outcomes. Method Data were collected between 6-24 years of age in 165 participants (n=109 with ASD; n=56 with nonspectrum DD), most of whom received diagnostic evaluations in both childhood and early adulthood. Questionnaires were collected approximately every 3-6 months between ages 9-24. Parent-rated Child and Adult Behavior Checklists (CBCL; ABCL) and Developmental Behavior Checklist anxiety- and depression-related subscale distributions were modeled with mixed-effects Poisson models, covarying diagnosis, age, verbal IQ (VIQ), gender, and significant two- and three-way interactions. Results Anxiety was positively associated with VIQ, and controlling for VIQ, both anxiety and depressive symptoms were greater in ASD than nonspectrum participants. Female gender predicted greater increases over time in anxiety and depressive symptoms for both diagnostic groups. Lower maternal education was associated with increasing internalizing symptoms in a subset of less verbal individuals with ASD. In exploratory post-hoc analyses, internalizing symptoms were associated with poorer emotional regulation in school age, and with lower life satisfaction and greater social difficulties in early adulthood. Conclusion Findings support previous claims that individuals with ASD are at particular risk for affect- and anxiety-specific problems. While symptom levels in females increase at a faster rate throughout adolescence, males with ASD appear to have elevated levels of depressive symptoms in school age that are maintained into young adulthood. PMID:25901773

  13. Depressive and anxiety symptom trajectories from school age through young adulthood in samples with autism spectrum disorder and developmental delay.

    PubMed

    Gotham, Katherine; Brunwasser, Steven M; Lord, Catherine

    2015-05-01

    The objectives of this study were to model growth in anxiety and depressive symptoms from late school age through young adulthood in individuals with autism spectrum disorder (ASD) and controls with developmental delay (DD), and to assess relationships among internalizing growth patterns, participant characteristics, baseline predictors, and distal outcomes. Data were collected between ages 6 and 24 years in 165 participants (n = 109 with ASD; n = 56 with nonspectrum DD), most of whom received diagnostic evaluations in both childhood and early adulthood. Questionnaires were collected approximately every 3 to 6 months between ages 9 and 24 years. Parent-rated Child Behavior Checklist (CBCL), Adult Behavior Checklist (ABCL), and Developmental Behaviour Checklist anxiety- and depression-related subscale distributions were modeled with mixed-effects Poisson models, covarying diagnosis, age, verbal IQ (VIQ), gender, and significant 2- and 3-way interactions. Anxiety was positively associated with VIQ, and controlling for VIQ, both anxiety and depressive symptoms were greater in ASD than nonspectrum participants. Female gender predicted greater increases over time in anxiety and depressive symptoms for both diagnostic groups. Lower maternal education was associated with increasing internalizing symptoms in a subset of less verbal individuals with ASD. In exploratory post hoc analyses, internalizing symptoms were associated with poorer emotional regulation in school age, and with lower life satisfaction and greater social difficulties in early adulthood. Findings support previous claims that individuals with ASD are at particular risk for affect- and anxiety-specific problems. Although symptom levels in females increase at a faster rate throughout adolescence, males with ASD appear to have elevated levels of depressive symptoms in school age that are maintained into young adulthood. Copyright © 2015 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  14. Functional Outcome of School Children With History of Global Developmental Delay.

    PubMed

    Dornelas, Lílian F; Duarte, Neuza M C; Morales, Nívea M O; Pinto, Rogério M C; Araújo, Renata R H; Pereira, Sílvia A; Magalhães, Lívia C

    2016-07-01

    This study aimed to investigate the functional and developmental outcomes in school age children diagnosed with global developmental delay before 2 years old and to verify the association between their final diagnosis and environmental and biological factors. Forty-five Brazilian children (26 boys), mean age 95.84 (7.72) months, who attended regular school and were diagnosed with global developmental delay before they were 2 years old had their functions evaluated. Children with global developmental delay were diagnosed with several conditions at school age. Students with greater chances of receiving a diagnosis were those whose mothers were younger at the time their children were born (OR = 1.47, CI = 1.04-2.09, P = .03), who had impaired motor performance, specially balance (OR = 1.33, CI = 1.01-1.75, P = .04), and who needed help during cognitive and behavioral tasks at school (OR = 1.08, CI = 1.00-1.17, P = .048). Interdisciplinary evaluation contributed to defining the specific diagnosis and to identifying the necessity of specialized support. © The Author(s) 2016.

  15. [Diagnostic evaluation of the developmental level in children identified at risk of delay through the Child Development Evaluation Test].

    PubMed

    Rizzoli-Córdoba, Antonio; Campos-Maldonado, Martha Carmen; Vélez-Andrade, Víctor Hugo; Delgado-Ginebra, Ismael; Baqueiro-Hernández, César Iván; Villasís-Keever, Miguel Ángel; Reyes-Morales, Hortensia; Ojeda-Lara, Lucía; Davis-Martínez, Erika Berenice; O'Shea-Cuevas, Gabriel; Aceves-Villagrán, Daniel; Carrasco-Mendoza, Joaquín; Villagrán-Muñoz, Víctor Manuel; Halley-Castillo, Elizabeth; Sidonio-Aguayo, Beatriz; Palma-Tavera, Josuha Alexander; Muñoz-Hernández, Onofre

    The Child Development Evaluation (or CDE Test) was developed in Mexico as a screening tool for child developmental problems. It yields three possible results: normal, slow development or risk of delay. The modified version was elaborated using the information obtained during the validation study but its properties according to the base population are not known. The objective of this work was to establish diagnostic confirmation of developmental delay in children 16- to 59-months of age previously identified as having risk of delay through the CDE Test in primary care facilities. A population-based cross-sectional study was conducted in one Mexican state. CDE test was administered to 11,455 children 16- to 59-months of age from December/2013 to March/2014. The eligible population represented the 6.2% of the children (n=714) who were identified at risk of delay through the CDE Test. For inclusion in the study, a block randomization stratified by sex and age group was performed. Each participant included in the study had a diagnostic evaluation using the Battelle Development Inventory, 2 nd edition. From the 355 participants included with risk of delay, 65.9% were male and 80.2% were from rural areas; 6.5% were false positives (Total Development Quotient ˃90) and 6.8% did not have any domain with delay (Domain Developmental Quotient <80). The proportion of delay for each domain was as follows: communication 82.5%; cognitive 80.8%; social-personal 33.8%; motor 55.5%; and adaptive 41.7%. There were significant differences in the percentages of delay both by age and by domain/subdomain evaluated. In 93.2% of the participants, developmental delay was corroborated in at least one domain evaluated. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  16. 12q14 microdeletion associated with HMGA2 gene disruption and growth restriction.

    PubMed

    Alyaqoub, Fadel; Pyatt, Robert E; Bailes, Andrea; Brock, Amanda; Deeg, Carol; McKinney, Aimee; Astbury, Caroline; Reshmi, Shalini; Shane, Kate P; Thrush, Devon Lamb; Sommer, Annemarie; Gastier-Foster, Julie M

    2012-11-01

    The 12q14 microdeletion syndrome is a rare condition that has previously been characterized by pre- and postnatal growth restriction, proportionate short stature, failure to thrive, developmental delay, and osteopoikilosis. Previously reported microdeletions within this region have ranged in size from 1.83 to 10.12 Mb with a proposed 2.61 Mb smallest region of overlap containing the LEMD3, HMGA2, and GRIP1 genes. Here, we report on the identification of a 12q14 microdeletion in a female child presenting with proportionate short stature, failure to thrive, and speech delay. The genomic loss (minimum size 4.17 Mb, maximum size 4.21 Mb) contained 25 RefSeq genes including IRAK3, GRIP1, and the 3' portion of the HMGA2 gene. This is the first partial deletion of HMGA2 associated with the 12q14 microdeletion syndrome. This case further clarifies the association of LEMD3 deletions with the 12q14 microdeletion syndrome and provides additional support for the role of the HMGA2 gene in human growth. Copyright © 2012 Wiley Periodicals, Inc.

  17. Facilitating relational framing in children and individuals with developmental delay using the relational completion procedure.

    PubMed

    Walsh, Sinead; Horgan, Jennifer; May, Richard J; Dymond, Simon; Whelan, Robert

    2014-01-01

    The Relational Completion Procedure is effective for establishing same, opposite and comparative derived relations in verbally able adults, but to date it has not been used to establish relational frames in young children or those with developmental delay. In Experiment 1, the Relational Completion Procedure was used with the goal of establishing two 3-member sameness networks in nine individuals with Autism Spectrum Disorder (eight with language delay). A multiple exemplar intervention was employed to facilitate derived relational responding when required. Seven of nine participants in Experiment 1 passed tests for derived relations. In Experiment 2, eight participants (all of whom, except one, had a verbal repertoire) were given training with the aim of establishing two 4-member sameness networks. Three of these participants were typically developing young children aged between 5 and 6 years old, all of whom demonstrated derived relations, as did four of the five participants with developmental delay. These data demonstrate that it is possible to reliably establish derived relations in young children and those with developmental delay using an automated procedure. © Society for the Experimental Analysis of Behavior.

  18. Limited access to special education services for school-aged children with developmental delay.

    PubMed

    Twardzik, Erica; Smit, Ellen; Hatfield, Bridget; Odden, Michelle C; Dixon-Ibarra, Alicia; MacDonald, Megan

    2018-01-01

    Current policy in Oregon limits eligibility of children diagnosed with developmental delay for school-based services. Due to eligibility definitions, children with developmental delay may face additional barriers transitioning from early intervention/early childhood special education into school-based special education services. Examine the relationship between enrollment in school-based special education programs given a change in primary disability diagnosis. Logistic regression models were fit for children who enrolled in early intervention/early childhood special education services with a primary disability diagnosis of developmental delay and changed primary disability diagnosis before third grade (n=5076). Odds of enrollment in future special education were greater in children with a change in primary disability diagnosis after the age of five in comparison to children that had a change in primary disability diagnosis before the age of five, while adjusting for demographic characteristics (adjusted odds ratio: 2.37, 95% CI 1.92, 2.92). Results suggest that children who are diagnosed with a developmental delay and exit early childhood special education due to maximum age of eligibility are more likely to enroll in special education compared to children without a gap in service access. Gaps in service access during early development are associated with the need for supportive services later on in life. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Achondroplasia: Development, Pathogenesis, and Therapy

    PubMed Central

    Ornitz, David M.; Legeai-Mallet, Laurence

    2016-01-01

    Autosomal dominant mutations in Fibroblast Growth Factor Receptor 3 (FGFR3) cause Achondroplasia (Ach), the most common form of dwarfism in humans, and related chondrodysplasia syndromes that include Hypochondroplasia (Hch), Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN), and Thanatophoric dysplasia (TD). FGFR3 is expressed in chondrocytes and mature osteoblasts where it functions to regulate bone growth. Analysis of the mutations in FGFR3 revealed increased signaling through a combination of mechanisms that include stabilization of the receptor, enhanced dimerization, and enhanced tyrosine kinase activity. Paradoxically, increased FGFR3 signaling profoundly suppresses proliferation and maturation of growth plate chondrocytes resulting in decreased growth plate size, reduced trabecular bone volume, and resulting decreased bone elongation. In this review we discuss the molecular mechanisms that regulate growth plate chondrocytes, the pathogenesis of Ach, and therapeutic approaches that are being evaluated to improve endochondral bone growth in people with Ach and related conditions. PMID:27987249

  20. Say-Meyer syndrome: additional manifestations in a new patient and phenotypic assessment.

    PubMed

    Salinas-Torres, Victor M

    2015-07-01

    In 1981, Say and Meyer described a seemingly X-linked recessive syndrome of trigonocephaly, short stature, and developmental delay. Here, I present a new patient and review eight patients from the literature examining the nature and phenotypic differences. A Mexican 10-year-old boy with Say-Meyer syndrome is described. Additionally, he had C6 vertebral right pedicle agenesis, brachymesophalangy of the fifth fingers, bilateral widening of Sylvian fissure, and white matter amplitude as novel observed findings of the syndrome. This appears to be the first Say-Meyer syndrome patient with extracranial skeletal anomalies. In light of these manifestations, a detailed comparative phenotypic analysis of published patients revealed a heterogeneous syndrome with a significant clinical variability. Moreover, increasing evidence points to a variable expressivity of the same autosomal dominant mutation. Accordingly, it is proposed that Say-Meyer syndrome should be considered in those patients with the combination of trigonocephaly/metopic synostosis, short stature, developmental delay including prenatal and postnatal growth disorders, craniofacial dysmorphic features (especially hypotelorism), structural CNS anomalies (mainly white matter involvement), conductive hearing loss, seizures, and cardiovascular abnormalities.

  1. Three Positive Parenting Practices and Their Correlation with Risk of Childhood Developmental, Social, or Behavioral Delays: An Analysis of the National Survey of Children's Health

    PubMed Central

    Cprek, Sarah E.; Williams, Corrine M.; Asaolu, Ibitola; Alexander, Linda A.; Vanderpool, Robin C.

    2016-01-01

    Objectives (1) Investigate the relationship between three specific positive parenting practices (PPP)—reading to children, engaging in storytelling or singing, and eating meals together as a family—and parent-reported risk of developmental, behavioral, or social delays among children between the ages of 1–5 years in the US. (2) Determine if a combination of these parenting practices has an effect on the outcome. Methods Chi square and multiple logistic regression analyses were used to analyze cross-sectional data from the National Survey of Children's Health 2011/2012 in regards to the relationship between each of the three individual PPP as well as a total PPP score and the child's risk of being developmentally, socially, or behaviorally delayed (N = 21,527). Risk of delay was calculated using the Parents’ Evaluation of Developmental Status Questionnaire, which is a parental self-report measure that has been correlated with diagnosed child delays. These analyses controlled for poverty and parental education. All analyses were completed using SAS Version 9.3. Results A strong correlation was found between each of the three PPP as well as the total PPP score and the child's risk of developmental, social, or behavioral delays (p < 0.05 for each test). These associations were found to have a dose–response relationship (p < 0.05 in all but one analysis). Conclusions Daily engagement in PPP could possibly reduce children's risk of delay, and specifically engaging in all three PPP may have greater benefit. PMID:26100132

  2. Developmental Trajectories for Children With Dyslexia and Low IQ Poor Readers

    PubMed Central

    2016-01-01

    Reading difficulties are found in children with both high and low IQ and it is now clear that both groups exhibit difficulties in phonological processing. Here, we apply the developmental trajectories approach, a new methodology developed for studying language and cognitive impairments in developmental disorders, to both poor reader groups. The trajectory methodology enables identification of atypical versus delayed development in datasets gathered using group matching designs. Regarding the cognitive predictors of reading, which here are phonological awareness, phonological short-term memory (PSTM) and rapid automatized naming (RAN), the method showed that trajectories for the two groups diverged markedly. Children with dyslexia showed atypical development in phonological awareness, while low IQ poor readers showed developmental delay. Low IQ poor readers showed atypical PSTM and RAN development, but children with dyslexia showed developmental delay. These divergent trajectories may have important ramifications for supporting each type of poor reader, although all poor readers showed weakness in all areas. Regarding auditory processing, the developmental trajectories were very similar for the two poor reader groups. However, children with dyslexia demonstrated developmental delay for auditory discrimination of Duration, while the low IQ children showed atypical development on this measure. The data show that, regardless of IQ, poor readers have developmental trajectories that differ from typically developing children. The trajectories approach enables differences in trajectory classification to be identified across poor reader group, as well as specifying the individual nature of these trajectories. PMID:27110928

  3. Developmental Toxicity of Endocrine Disrupters Bisphenol A and Vinclozolin in a Terrestrial Isopod

    PubMed Central

    van Gestel, C. A. M.; Soares, A. M. V. M.

    2010-01-01

    Studies of the effects of endocrine-disrupting compounds (EDCs) on invertebrates are still largely underrepresented. This work aims to fill this gap by assessing the effects of bisphenol A (BPA) and vinclozolin (Vz) on the terrestrial isopod Porcellio scaber (common rough woodlouse). Male adult and sexually undifferentiated juvenile woodlice were exposed to the toxicants. Effects on molting regime and growth were investigated independently for males and female woodlice after sexual differentiation. Both chemicals elicited developmental toxicity to P. scaber by causing overall decreased growth. Nevertheless, BPA induced molting, whereas Vz delayed it. Although the LC50 values for juvenile and adult survival were fairly similar, juvenile woodlice showed an increased chronic sensitivity to both chemicals, and female woodlice were most the sensitive to BPA. We recommend the use of adults, juveniles, female, and male woodlice, as well as a large range of toxicant concentrations, to provide valuable information regarding differential dose responses, effects, and threshold values for EDCs. PMID:20148245

  4. Developmental toxicity of endocrine disrupters bisphenol A and vinclozolin in a terrestrial isopod.

    PubMed

    Lemos, M F L; van Gestel, C A M; Soares, A M V M

    2010-08-01

    Studies of the effects of endocrine-disrupting compounds (EDCs) on invertebrates are still largely underrepresented. This work aims to fill this gap by assessing the effects of bisphenol A (BPA) and vinclozolin (Vz) on the terrestrial isopod Porcellio scaber (common rough woodlouse). Male adult and sexually undifferentiated juvenile woodlice were exposed to the toxicants. Effects on molting regime and growth were investigated independently for males and female woodlice after sexual differentiation. Both chemicals elicited developmental toxicity to P. scaber by causing overall decreased growth. Nevertheless, BPA induced molting, whereas Vz delayed it. Although the LC50 values for juvenile and adult survival were fairly similar, juvenile woodlice showed an increased chronic sensitivity to both chemicals, and female woodlice were most the sensitive to BPA. We recommend the use of adults, juveniles, female, and male woodlice, as well as a large range of toxicant concentrations, to provide valuable information regarding differential dose responses, effects, and threshold values for EDCs.

  5. Anthropogenic noise causes body malformations and delays development in marine larvae

    PubMed Central

    de Soto, Natacha Aguilar; Delorme, Natali; Atkins, John; Howard, Sunkita; Williams, James; Johnson, Mark

    2013-01-01

    Understanding the impact of noise on marine fauna at the population level requires knowledge about the vulnerability of different life-stages. Here we provide the first evidence that noise exposure during larval development produces body malformations in marine invertebrates. Scallop larvae exposed to playbacks of seismic pulses showed significant developmental delays and 46% developed body abnormalities. Similar effects were observed in all independent samples exposed to noise while no malformations were found in the control groups (4881 larvae examined). Malformations appeared in the D-veliger larval phase, perhaps due to the cumulative exposure attained by this stage or to a greater vulnerability of D-veliger to sound-mediated physiological or mechanical stress. Such strong impacts suggest that abnormalities and growth delays may also result from lower sound levels or discrete exposures during the D-stage, increasing the potential for routinely-occurring anthropogenic noise sources to affect recruitment of wild scallop larvae in natural stocks. PMID:24088868

  6. Risk and protective factors in early child development: Results from the All Our Babies (AOB) pregnancy cohort.

    PubMed

    McDonald, Sheila; Kehler, Heather; Bayrampour, Hamideh; Fraser-Lee, Nonie; Tough, Suzanne

    2016-11-01

    Understanding factors that protect against early developmental delay among children who are experiencing adversity can inform prevention and early intervention strategies. To identify risk factors for development delay at one year and protective factors for developmental delay in 'at risk' environments (poor maternal mental health and socio-demographic risk). Data was analyzed from 3360 mother-child dyads who participated in the All Our Babies (AOB) pregnancy cohort. Participants completed four questionnaires spanning pregnancy to one year postpartum and provided access to medical records. Risk factors for developmental delay at age one were identified using bivariate methods and multivariable modeling. Protective factors for child development in 'at risk' family environments were identified using bivariate analyses. At one year, 17% of children were developmentally delayed, defined as scoring in the monitoring zone on at least 2 of the 5 developmental domains of the Ages and Stages Questionnaire. Prenatal depression, preterm birth, low community engagement, and non-daily parent-child interaction increased the risk of delay. Protective factors for children in 'at risk' environments included relationship happiness, parenting self-efficacy, community engagement, higher social support, and daily parent-child interaction. The study results suggest that maternal and infant outcomes would be improved, even for vulnerable women, through identification and intervention to address poor mental health and through normalizing engagement with low cost, accessible community resources that can also support parent-child interaction. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Validity of false belief tasks in blind children.

    PubMed

    Brambring, Michael; Asbrock, Doreen

    2010-12-01

    Previous studies have reported that congenitally blind children without any additional impairment reveal a developmental delay of at least 4 years in perspective taking based on testing first-order false-belief tasks. These authors interpret this delay as a sign of autism-like behavior. However, the delay may be caused by testing blind children with false-belief tasks that require visual experience. Therefore, the present study gave alternative false-belief tasks based on tactile or auditory experience to 45 congenitally blind 4-10-year-olds and 37 sighted 3-6-year-olds. Results showed criterion performance at 80 months (6; 8 years) in blind children compared with 61 months (5; 1 years) in sighted controls. It is concluded that this 19-month (1; 7 year) difference, which is comparable with delays in other developmental areas, is a developmental delay caused by the fact of congenital blindness rather than a sign of a psychopathological disorder of autism-like behavior.

  8. Accumulation and developmental toxicity of hexabromocyclododecanes (HBCDs) on the marine copepod Tigriopus japonicus.

    PubMed

    Shi, Dalin; Lv, Dongmei; Liu, Wanxin; Shen, Rong; Li, Dongmei; Hong, Haizheng

    2017-01-01

    The brominated flame retardants hexabromocyclododecanes (HBCDs) are ubiquitous environmental contaminants, widely distributed in aquatic systems including the marine environment and marine organisms. HBCDs are toxic to the development of both freshwater and marine fish. However, the impacts of HBCDs on marine invertebrates are not well known. In this study, the marine copepod, Tigriopus japonicus, was used to assess the bioaccumulation and developmental toxicity of technical HBCD (tHBCD) through water-borne exposure. The uptake rate constant of tHBCD by T. japonicus was high, which resulted in high bioaccumulation potential. The bioconcentration factors of tHBCD were 8.73 × 10 4 and 6.34 × 10 4  L kg -1 in T. japonicus, calculated using the kinetic and steady-state methods, respectively. Exposure of T. japonicus nauplii to tHBCD caused significant growth delay. The lowest-observable-effect-concentrations of tHBCD induced developmental delay were 30 and 8 μg L -1 for the F0 and F1 generations, respectively, which suggested that the F1 generation was more sensitive to tHBCD than the F0 generation and warranted multiple-generation toxicity tests for future studies. Furthermore, exposure of the adult copepods to tHBCD induced the transcription of oxidative stress response genes and apoptotic genes, e.g., SOD,CAT, GST, OGG1, P53 and Caspase-3. It was therefore speculated that tHBCD exposure induced the generation of reactive oxygen species in T. japonicus, which activated the oxidative stress defense genes and meanwhile resulted in oxidative DNA damage. The damaged DNA activated the transcription of p53 and triggered the caspase-mediated apoptosis pathway, which may be the reason for the tHBCD induced developmental delay in T. japonicus nauplii. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Mild Wolf-Hirschhorn phenotype and partial GH deficiency in a patient with a 4p terminal deletion.

    PubMed

    Titomanlio, L; Romano, A; Conti, A; Genesio, R; Salerno, M; De Brasi, D; Nitsch, L; Del Giudice, E

    2004-06-01

    Wolf-Hirschhorn syndrome (WHS) is caused by a variably-sized deletion of chromosome 4 involving band 4p16 whose typical craniofacial features are "Greek warrior helmet appearance" of the nose, microcephaly, and prominent glabella. Almost all patients show mental retardation and pre- and post-natal growth delay. Patient was born at term, after a pregnancy characterized by intra-uterine growth retardation (IUGR). Delivery was uneventful. Developmental delay was evident since the first months of life. At 2 years, he developed generalized tonic-clonic seizures. Because of short stature, low growth velocity and delayed bone age, at 4 years he underwent growth hormone (GH) evaluation. Peak GH after two provocative tests revealed a partial GH deficiency. Clinical observation at 7 years disclosed a distinctive facial appearance, with microcephaly, prominent eyes, and beaked nose. Brain MRI showed left temporal mesial sclerosis. GTG banded karyotype was normal. Because of mental retardation, subtelomeric fluorescence in situ hybridization (FISH) analysis was performed, disclosing a relatively large deletion involving 4p16.2 --> pter (about 4.5 Mb), in the proband, not present in the parents. The smallest deletion detected in a WHS patient thus far includes two candidate genes, WHSC1 and WHSC2. Interestingly, that patient did not show shortness of stature, and that could be due to the haploinsufficiency of other genes localized in the flanking regions. Contribution of GH alterations and possible GH therapy should be further considered in WHS patients. Copyright 2004 Wiley-Liss, Inc.

  10. Chronic Disease and Perceived Developmental Progression in Adolescence.

    ERIC Educational Resources Information Center

    Seiffge-Krenke, Inge

    1998-01-01

    Examined whether chronic illness causes delays in adolescents' perceived developmental status, using annually-completed questionnaires from insulin-dependent and healthy adolescents. Found that, in first year of study, diabetic adolescents reported delays in physical maturity and an independent lifestyle compared with healthy peers. Overall…

  11. Syndrome of proximal interstitial deletion 4p15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fryns, J.P.

    1995-09-11

    In this journal, Chitayat et al. reported on 2 boys and a girl with interstitial deletion in the short arm of chromosome 4, including p15.2p15.33. All 3 patients had a characteristic face distinct from that of Wolf-Hirschhorn syndrome and multiple minor congenital anomalies. One patient had a congenitally enlarged penis. The authors noted that all had normal growth, and all had moderate psychomotor retardation (patient 1, developmental age of 4-6 years at age 9 years; patient 2, mental age 6 years at age 25 years; and patient 3, global delay with hypotonia, difficulties in both gross and fine motor development,more » and persistent delay in language skills). 5 refs., 1 fig.« less

  12. Inclusive intervention to enhance the fundamental movement skills of children without hearing: a preliminary study.

    PubMed

    Gursel, Ferda

    2014-02-01

    The purpose of this study was to assess an intervention program on the fundamental movement skill of students with and without hearing impairment, using the Test of Gross Motor Development-2 (TGMD-2) standardized Turkish norm. Preschool children with and without hearing impairment participated in this study. At the beginning of the study, most of the children with hearing impairment demonstrated developmental delay on the Locomotor subscale (6/7), as did about one-third (4/11) of the children without hearing impairment. For the Object control subscale, 4/7 of children with hearing impairment and none without hearing impairment showed developmental delay prior to the intervention program. After the intervention program, 3/7 children with hearing impairment had developmental delay on the Locomotor subscale. On the Object control subscale, 2/7 children with hearing impairment and none without hearing impairment showed developmental delay. The six-week intervention program improved TGMD-2 scores of children with hearing impairment, yet did not yield statistically significant improvement of fundamental movement skills.

  13. Education on the Brain: A Partnership Between a Pediatric Primary Care Center and Neurology Residency.

    PubMed

    Zwemer, Eric; Bernson-Leung, Miya; Rea, Corinna; Patel, Archana A; Guerriero, Rejean; Urion, David K; Toomey, Sara L

    2018-01-01

    The national shortage of pediatric neurologists is worsening, yet referral rates by pediatricians are high. Suboptimal training of pediatric residents in care of patients with neurologic disease may be a contributing factor. We formed a partnership between the Boston Children's Primary Care at Longwood clinic and Child Neurology Residency Training Program. The educational intervention included lectures, observed neurologic examinations, in-person and virtual triage, and an electronic medical record-based consult system. Residents in other primary care clinics served as the comparison group. Intervention-group residents reported significantly improved confidence in diagnosis of chronic/recurrent headache, attention deficit hyperactivity disorder (ADHD), and developmental delay; initial management of ADHD and developmental delay; and secondary management of ADHD, developmental delay, and concussion/traumatic brain injury. Comparison-group residents reported significantly improved confidence only in diagnosis of developmental delay. Our multipronged intervention is a promising approach to improving pediatric resident training in pediatric neurology and may be generalizable to subspecialty collaborations for other residency programs.

  14. The differences in clinical aspect between specific language impairment and global developmental delay.

    PubMed

    Kim, Seong Woo; Jeon, Ha Ra; Park, Eun Ji; Chung, Hee Jung; Song, Jung Eun

    2014-12-01

    To compare and analyze the clinical characteristics of children with delayed language acquisition due to two different diagnoses, which were specific language impairment (SLI, a primarily delayed language development) and global developmental delay (GDD, a language delay related to cognitive impairment). Among 1,598 children who had visited the developmental delay clinic from March 2005 to February 2011, 467 children who were diagnosed with GDD and 183 children who were diagnosed with SLI were included in this study. All children were questioned about past, family, and developmental history, and their language competences and cognitive function were assessed. Some children got electroencephalography (EEG), in case of need. The presence of the perinatal risk factors showed no difference in two groups. In the children with GDD, they had more delayed acquisition of independent walking and more frequent EEG abnormalities compared with the children with SLI (p<0.01). The positive family history of delayed language development was more prevalent in children with SLI (p<0.01). In areas of language ability, the quotient of receptive language and expressive language did not show any meaningful statistical differences between the two groups. Analyzing in each group, the receptive language quotient was higher than expressive language quotient in both group (p<0.01). In the GDD group, the Bayley Scales of Infant Development II (BSID-II) showed a marked low mental and motor quotient while the Wechsler Intelligence Scale showed low verbal and nonverbal IQ. In the SLI group, the BSID-II and Wechsler Intelligence Scale showed low scores in mental area and verbal IQ but sparing motor area and nonverbal IQ. The linguistic profiles of children with language delay could not differentiate between SLI and GDD. The clinicians needed to be aware of these developmental issues, and history taking and clinical evaluation, including cognitive assessment, could be helpful to diagnose adequately and set the treatment plan for each child.

  15. CDC Kerala 5: Developmental therapy clinic experience--use of Child Development Centre grading for motor milestones.

    PubMed

    Nair, M K C; Resmi, V R; Krishnan, Rajee; Harikumaran Nair, G S; Leena, M L; Bhaskaran, Deepa; George, Babu; Russell, Paul Swamidhas Sudhakar

    2014-12-01

    To document the experiences of the intervention given to children who attended the developmental therapy clinic of Child Development Centre (CDC) Kerala, a specialized clinic for providing developmental intervention/therapy for babies less than two years with developmental delay/disability. All the babies referred to this speciality clinic from developmental screening/evaluation clinics of CDC were registered in the clinic and re-evaluation was done using CDC grading for head holding, sitting, standing, Amiel Tison passive angles, and Trivandrum Developmental Screening Chart (TDSC) 0-2 y. Out of a total of 600 consecutive babies below 2 y with developmental delay/disability referred to developmental therapy clinic, on comparing the test results at enrollment and after 6 mo of intervention, a statistically significant reduction was observed (i) in the 2-4 mo age group with regard to abnormal TDSC (25.5%), (ii) in the 4-8 mo age group with regard to abnormal head holding grade (87.1%) and abnormal TDSC (19.4%), (iii) in the 8-12 mo age group, with regard to abnormal sitting grade (71.7%) and (iv) in the above 12 mo age group with regard to abnormal sitting grade (35.3%) and abnormal standing grade (78.8%). The experience of organizing the developmental intervention/therapy clinic at CDC Kerala has shown that therapy services by developmental therapists in a centre and supportive therapy by mother at home is useful in improving the developmental status of children with developmental delay.

  16. Whole Exome Sequencing and Heterologous Cellular Electrophysiology Studies Elucidate a Novel Loss-of-Function Mutation in the CACNA1A-Encoded Neuronal P/Q-Type Calcium Channel in a Child With Congenital Hypotonia and Developmental Delay.

    PubMed

    Weyhrauch, Derek L; Ye, Dan; Boczek, Nicole J; Tester, David J; Gavrilova, Ralitza H; Patterson, Marc C; Wieben, Eric D; Ackerman, Michael J

    2016-02-01

    A 4-year-old boy born at 37 weeks' gestation with intrauterine growth retardation presented with developmental delay with pronounced language and gross motor delay, axial hypotonia, and dynamic hypertonia of the extremities. Investigations including the Minnesota Newborn Screen, thyroid stimulating hormone/thyroxin, and inborn errors of metabolism screening were negative. Cerebral magnetic resonance imaging and spectroscopy were normal. Genetic testing was negative for coagulopathy, Smith-Lemli-Opitz, fragile X, and Prader-Willi/Angelman syndromes. Whole genome array analysis was unremarkable. Whole exome sequencing was performed through a commercial testing laboratory to elucidate the underlying etiology for the child's presentation. A de novo mutation was hypothesized. In attempt to establish pathogenicity of our candidate variant, cellular electrophysiologic functional analysis of the putative de novo mutation was performed using patch-clamp technology. Whole exome sequencing revealed a p.P1353L variant in the CACNA1A gene, which encodes for the α1-subunit of the brain-specific P/Q-type calcium channel (CaV2.1). This presynaptic high-voltage-gated channel couples neuronal excitation to the vesicular release of neurotransmitter and is implicated in several neurologic disorders. DNA Sanger sequencing confirmed that the de novo mutation was absent in both parents and present in the child only. Electrophysiologic analysis of P1353L-CACNA1A demonstrated near complete loss of function, with a 95% reduction in peak current density. Whole exome sequencing coupled with cellular electrophysiologic functional analysis of a de novoCACNA1A missense mutation has elucidated the probable underlying pathophysiologic mechanism responsible for the child's phenotype. Genetic testing of CACNA1A in patients with congenital hypotonia and developmental delay may be warranted. Copyright © 2016. Published by Elsevier Inc.

  17. A Mobile Early Stimulation Program to Support Children with Developmental Delays in Brazil.

    PubMed

    Dias, Raquel da Luz; Silva, Kátia Cristina Correa Guimarães; Lima, Marcela Raquel de Oliveira; Alves, João Guilherme Bezerra; Abidi, Syed Sibte Raza

    2018-01-01

    Developmental delay is a deviation development from the normative milestones during the childhood and it may be caused by neurological disorders. Early stimulation is a standardized and simple technique to treat developmental delays in children (aged 0-3 years), allowing them to reach the best development possible and to mitigate neuropsychomotor sequelae. However, the outcomes of the treatment depending on the involvement of the family, to continue the activities at home on a daily basis. To empower and educate parents of children with neurodevelopmental delays to administer standardized early stimulation programs at home, we developed a mobile early stimulation program that provides timely and evidence-based clinical decision support to health professionals and a personalized guidance to parents about how to administer early stimulation to their child at home.

  18. Rapamycin treatment causes developmental delay, pigmentation defects, and gastrointestinal malformation on Xenopus embryogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moriyama, Yuki; Ohata, Yoshihisa; Mori, Shoko

    Research highlights: {yields} Does famous anti-aging drug rapamycin work from the beginning of life? The answer is yes. {yields} This study shows that developmental speed of frog embryo was dose-dependently decreased by rapamycin treatment. {yields} In additions, morphogenetic effects such as less pigmentations and gut malformation are occurred by rapamycin. -- Abstract: Rapamycin is a drug working as an inhibitor of the TOR (target of rapamycin) signaling pathway and influences various life phenomena such as cell growth, proliferation, and life span extension in eukaryote. However, the extent to which rapamycin controls early developmental events of amphibians remains to be understood.more » Here we report an examination of rapamycin effects during Xenopus early development, followed by a confirmation of suppression of TOR downstream kinase S6K by rapamycin treatment. First, we found that developmental speed was declined in dose-dependent manner of rapamycin. Second, black pigment spots located at dorsal and lateral skin in tadpoles were reduced by rapamycin treatment. Moreover, in tadpole stages severe gastrointestinal malformations were observed in rapamycin-treated embryos. Taken together with these results, we conclude that treatment of the drug rapamycin causes enormous influences on early developmental period.« less

  19. CDC Kerala 15: Developmental Evaluation Clinic (2-10 y)--developmental diagnosis and use of home intervention package.

    PubMed

    Nair, M K C; Lakshmi, M A; Latha, S; Lakshmi, Geetha; Harikumaran Nair, G S; Bhaskaran, Deepa; George, Babu; Leena, M L; Russell, Paul Swamidhas Sudhakar

    2014-12-01

    To describe the last 5 years' experience of Child Development Centre (CDC), Kerala Developmental Evaluation Clinic II for children between 2 and 10 y, referred for suspicion of developmental lag in the preschool years and scholastic difficulty in the primary classes with specific focus on developmental profile and the experience of the home based intervention package taught to the mothers. A team of evaluators including developmental therapist, preschool teacher with special training in clinical child development, speech therapist, special educator, clinical psychologist and developmental pediatrician assessed all the children referred to CDC Kerala. Denver Developmental Screening Test (DDST-II), Vineland Social Maturity Scale (VSMS) and Intelligent Quotient (IQ) tests were administered to all children below 6 y and those above 6 with apparent developmental delay. Speech/delay (35.9%), behavior problem (15.4%), global delay/ intellectual disability (15.4%), learning problem (10.9%), pervasive developmental disorders (7.7%), seizure disorder (1.7%), hearing impairment (0.7%), and visual impairment (0.7%) were the clinical diagnosis by a developmental pediatrician. Each child with developmental problem was offered a home based intervention package consisting of developmental therapy and special education items, appropriate to the clinical diagnosis of the individual child and the same was taught to the mother. The experience of conducting the developmental evaluation clinic for children between 2 and 10 y has shown that a team consisting of developmental therapist, speech therapist, preschool teacher, special educator, clinical child psychologist and developmental pediatrician, using appropriate test results of the child could make a clinical diagnosis good enough for providing early intervention therapy using a home based intervention package.

  20. Trajectories of cognitive development during adolescence among youth at-risk for schizophrenia.

    PubMed

    Dickson, Hannah; Cullen, Alexis E; Jones, Rebecca; Reichenberg, Abraham; Roberts, Ruth E; Hodgins, Sheilagh; Morris, Robin G; Laurens, Kristin R

    2018-04-23

    Among adults with schizophrenia, evidence suggests that premorbid deficits in different cognitive domains follow distinct developmental courses during childhood and adolescence. The aim of this study was to delineate trajectories of adolescent cognitive functions prospectively among different groups of youth at-risk for schizophrenia, relative to their typically developing (TD) peers. Using linear mixed models adjusted for sex, ethnicity, parental occupation and practice effects, cognitive development between ages 9 and 16 years was compared for youth characterised by a triad of well-replicated developmental antecedents of schizophrenia (ASz; N = 32) and youth with a least one affected relative with schizophrenia or schizoaffective disorder (FHx; N = 29), relative to TD youth (N = 45). Participants completed measures of IQ, scholastic achievement, memory and executive function at three time-points, separated by approximately 24-month intervals. Compared to TD youth, both ASz and FHx youth displayed stable developmental deficits in verbal working memory and inhibition/switching executive functions. ASz youth additionally presented with stable deficits in measures of vocabulary (IQ), word reading, numerical operations, and category fluency executive function, and a slower rate of growth (developmental lag) on spelling from 9 to 16 years than TD peers. Conversely, faster rates of growth relative to TD peers (developmental delay) were observed on visual and verbal memory, and on category fluency executive function (ASz youth only) and on matrix reasoning (IQ) and word reading (FHx youth only). These differential patterns of deviation from normative adolescent cognitive development among at-risk youth imply potential for cognitive rehabilitation targeting of specific cognitive deficits at different developmental phases. © 2018 The Authors. Journal of Child Psychology and Psychiatry published by John Wiley & Sons Ltd on behalf of Association for Child and Adolescent Mental Health.

  1. A dysmorphology score system for assessing embryo abnormalities in rat whole embryo culture.

    PubMed

    Zhang, Cindy X; Danberry, Tracy; Jacobs, Mary Ann; Augustine-Rauch, Karen

    2010-12-01

    The rodent whole embryo culture (WEC) system is a well-established model for characterizing developmental toxicity of test compounds and conducting mechanistic studies. Laboratories have taken various approaches in describing type and severity of developmental findings of organogenesis-stage rodent embryos, but the Brown and Fabro morphological score system is commonly used as a quantitative approach. The associated score criteria is based upon developmental stage and growth parameters, where a series of embryonic structures are assessed and assigned respective scores relative to their gestational stage, with a Total Morphological Score (TMS) assigned to the embryo. This score system is beneficial because it assesses a series of stage-specific anatomical landmarks, facilitating harmonized evaluation across laboratories. Although the TMS provides a quantitative approach to assess growth and determine developmental delay, it is limited to its ability to identify and/or delineate subtle or structure-specific abnormalities. Because of this, the TMS may not be sufficiently sensitive for identifying compounds that induce structure or organ-selective effects. This study describes a distinct morphological score system called the "Dysmorphology Score System (DMS system)" that has been developed for assessing gestation day 11 (approximately 20-26 somite stage) rat embryos using numerical scores to differentiate normal from abnormal morphology and define the respective severity of dysmorphology of specific embryonic structures and organ systems. This method can also be used in scoring mouse embryos of the equivalent developmental stage. The DMS system enhances capabilities to rank-order compounds based upon teratogenic potency, conduct structure- relationships of chemicals, and develop statistical prediction models to support abbreviated developmental toxicity screens. © 2010 Wiley-Liss, Inc.

  2. 34 CFR 303.111 - State definition of developmental delay.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... child's development; and (b) Specify the level of developmental delay in functioning or other comparable... INFANTS AND TODDLERS WITH DISABILITIES State Eligibility for a Grant and Requirements for a Statewide... to appropriately identify infants and toddlers with disabilities who are in need of services under...

  3. 34 CFR 303.111 - State definition of developmental delay.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... child's development; and (b) Specify the level of developmental delay in functioning or other comparable... INFANTS AND TODDLERS WITH DISABILITIES State Eligibility for a Grant and Requirements for a Statewide... to appropriately identify infants and toddlers with disabilities who are in need of services under...

  4. 34 CFR 303.111 - State definition of developmental delay.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... child's development; and (b) Specify the level of developmental delay in functioning or other comparable... INFANTS AND TODDLERS WITH DISABILITIES State Eligibility for a Grant and Requirements for a Statewide... to appropriately identify infants and toddlers with disabilities who are in need of services under...

  5. Sodium perchlorate disrupts development and affects metamorphosis- and growth-related gene expression in tadpoles of the wood frog (Lithobates sylvaticus).

    PubMed

    Bulaeva, Elizabeth; Lanctôt, Chantal; Reynolds, Leslie; Trudeau, Vance L; Navarro-Martín, Laia

    2015-10-01

    Numerous endocrine disrupting chemicals can affect the growth and development of amphibians. We investigated the effects of a targeted disruption of the endocrine axes modulating development and somatic growth. Wood frog (Lithobates sylvaticus) tadpoles were exposed for 2weeks (from developmental Gosner stage (Gs) 25 to Gs30) to sodium perchlorate (SP, thyroid inhibitor, 14mg/L), estradiol (E2, known to alter growth and development, 200nM) and a reduced feeding regime (RF, to affect growth and development in a chemically-independent manner). All treatments experienced developmental delay, and animals exposed to SP or subjected to RF respectively reached metamorphic climax (Gs42) approximately 11(±3) and 17(±3) days later than controls. At Gs42, only SP-treated animals showed increased weight and snout-vent length (P<0.05) relative to controls. Tadpoles treated with SP had 10-times higher levels of liver igf1 mRNA after 4days of exposure (Gs28) compared to controls. Tadpoles in the RF treatment expressed 6-times lower levels of liver igf1 mRNA and 2-times higher liver igf1r mRNA (P<0.05) at Gs30. Tadpoles treated with E2 exhibited similar developmental and growth patterns as controls, but had increased liver igf1 mRNA levels at Gs28, and tail igf1r at Gs42. Effects on tail trβ mRNA levels were detected in SP-treated tadpoles at Gs42, 40days post-exposure, suggesting that the chemical inhibition of thyroid hormone production early in development can have long-lasting effects. The growth effects observed in the SP-exposed animals suggest a relationship between TH-dependent development and somatic growth in L. sylvaticus tadpoles. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Child health and parental stress in school-age children with a preschool diagnosis of developmental delay.

    PubMed

    Webster, Richard I; Majnemer, Annette; Platt, Robert W; Shevell, Michael I

    2008-01-01

    Chronic disorders are known to have a wide-ranging impact on overall health and family dynamics. The objective of this study was to assess child health and well-being and parental stress in a cohort of school-age children diagnosed before school entry with either global developmental delay or developmental language impairment. In total, 65 children with preschool developmental delay were assessed at school age (mean +/- SD age: 7.3 +/- 0.7 years) with the Child Health Questionnaire and Parenting Stress Index, with a mean interval between assessment of 3.9 years. Almost all children who completed testing (60/62) continued to show developmental impairments across domains. On the Child Health Questionnaire, children showed the greatest impairment on the mental health scale (median z score: -0.9). The median Child Health Questionnaire psychosocial health score (40.7) was almost 1 SD below established normative values ( P < .001). More than 40% of parents had a Parenting Stress Index above the 85th percentile (clinically significant parenting stress). Using multiple linear regression analysis, high levels of parenting stress were best predicted by a child's Child Health Questionnaire psychosocial health score (r2 = 0.49, P < .001). Thus, 4 years after a preschool-age diagnosis of developmental delay, poor psychosocial health was a common comorbidity. Almost half the parents showed clinically significant levels of parenting stress. There is a need to both recognize and provide ongoing social and emotional support for young children diagnosed with developmental disability and their families.

  7. Oral Health Characteristics and Dental Rehabilitation of Children with Global Developmental Delay.

    PubMed

    Kumar, Saurabh; Pai, Deepika; Saran, Runki

    2017-01-01

    Global developmental delay (GDD) is a chronic neurological disturbance which includes defects in one or more developmental domains. The developmental domain can be motor, cognitive, daily activities, speech or language, and social or personal development. The etiology for GDD can be prenatal, perinatal, or postnatal. It can be diagnosed early in childhood as the delay or absence of one or more developmental milestones. Hence the role of pedodontist and pediatricians becomes more crucial in identifying this condition. The diagnosis of GDD requires a detailed history including family history and environmental risk factors followed by physical and neurological examinations. Investigations for GDD include diagnostic laboratory tests, brain imaging, and other evidence-based evaluations. GDD affects multiple developmental domains that not only have direct bearing on maintenance of oral health, but also require additional behavior management techniques to deliver optimal dental care. This paper describes two different spectra of children with GDD. Since the severity of GDD can vary, this paper also discusses the different behavior management techniques that were applied to provide dental treatment in such children.

  8. Head circumference and development in young children after renal transplantation.

    PubMed

    Motoyama, Osamu; Kawamura, Takeshi; Aikawa, Atushi; Hasegawa, Akira; Iitaka, Kikuo

    2009-02-01

    Growth impairment, microcephaly and developmental delay in young children with chronic renal failure improve after successful renal transplantation. There have been few reports on head circumference (HC) and development after transplantation. Standard deviation scores (SDS) of height and HC and developmental quotient (DQ) after successful renal transplantation were evaluated in 12 recipients under 5 years of age. At the time of transplantation their mean age was 2.5 years and mean bodyweight was 9.0 kg. Mean height SDS was -3.0 at transplantation and increased to -2.3 at 1 year after transplant (P = 0.002). Mean HC-SDS increased from -1.4 to -0.9 at 1 year after transplant (P = 0.02). As for each category of DQ examined 1 year after transplant, mean scores of gross motor function, basic practice, personal relations, speech and recognition increased from 69 to 90 (P = 0.007), from 77 to 102 (P = 0.02), from 87 to 103 (P = 0.04), from 71 to 90 (P = 0.0006), and from 88 to 101 (P = 0.03), respectively. In young children, physical growth, HC growth and DQ scores increased 1 year after transplantation. Dialysis and transplantation program should be planned in young children with end-stage renal failure in anticipation of growth and development of each patient.

  9. Bilingual Children's Lexical Strategies in a Narrative Task

    ERIC Educational Resources Information Center

    Barbosa, Poliana; Nicoladis, Elena; Keith, Margaux

    2017-01-01

    We investigated how bilinguals choose words in a narrative task, contrasting the possibilities of a developmental delay vs. compensatory strategies. To characterize a developmental delay, we compared younger (three to five years) and older (seven to ten years) children's lexicalization of target words (Study 1). The younger children told shorter…

  10. Emotion Discourse, Social Cognition, and Social Skills in Children with and without Developmental Delays

    ERIC Educational Resources Information Center

    Fenning, Rachel M.; Baker, Bruce L.; Juvonen, Jaana

    2011-01-01

    This study examined parent-child emotion discourse, children's independent social information processing, and social skills outcomes in 146 families of 8-year-olds with and without developmental delays. Children's emergent social-cognitive understanding (internal state understanding, perspective taking, and causal reasoning and problem solving)…

  11. Parenting Children with Developmental Delays: The Role of Positive Beliefs

    ERIC Educational Resources Information Center

    Paczkowski, Emilie; Baker, Bruce L.

    2008-01-01

    Parents of children with developmental delays consistently report higher levels of child behavior problems and also parenting stress than parents of typically developing children. This study examined how mothers' positive beliefs influence the relation between children's behavior problems and mothers' parenting stress among families of children…

  12. Social Routines and Language Play: Developing Communication Responses in Developmentally Delayed Blind Children.

    ERIC Educational Resources Information Center

    Rogow, Sally M.

    1983-01-01

    Social routines, which combined nursery rhymes with carefully planned action sequences, were used to help two young developmentally delayed, visually handicapped children acquire communicative responses. Midway through the 3-year project, one child responded to words for objects, people, and actions. (Author/SEW)

  13. Sleep Patterns in Preschool-Age Children with Autism, Developmental Delay, and Typical Development

    ERIC Educational Resources Information Center

    Goodlin-Jones, Beth L.; Tang, Karen; Liu, Jingyi; Anders, Thomas F.

    2008-01-01

    The study investigates sleep disorders by assessing the quantity and quality of sleep in preschool children with autism and comparing them with developmental delay without autism, and typical development. The results prove that sleep patterns are different in preschool children across all three categories.

  14. Identification of Early Risk Factors for Developmental Delay

    ERIC Educational Resources Information Center

    Delgado, Christine E. F.; Vagi, Sara J.; Scott, Keith G.

    2007-01-01

    Statewide birth certificate and preschool exceptionality records were integrated to identify risk factors for developmental delay (DD). Epidemiological methods were used to investigate both individual-level and population-level risk for DD associated with a number of child and maternal factors. Infants born with very low birth weight were at the…

  15. Teaching Ecologically-Based Communication Skills to Persons Who Are Developmentally Delayed.

    ERIC Educational Resources Information Center

    Sousie, Susan P.

    The paper offers a framework for the design, implementation, and evaluation of appropriate, effective communication instructional programs for persons who are severely developmentally delayed. The use of an ecological approach that incorporates the instruction of communication skills with that of activities of daily living (ADL) is emphasized.…

  16. Source-sink regulation of cotyledonary reserve mobilization during cashew (Anacardium occidentale) seedling establishment under NaCl salinity.

    PubMed

    Voigt, Eduardo Luiz; Almeida, Tânia Dias; Chagas, Roberta Magalhães; Ponte, Luiz Ferreira Aguiar; Viégas, Ricardo Almeida; Silveira, Joaquim Albenísio Gomes

    2009-01-01

    Seedling establishment is a critical process to crop productivity, especially under saline conditions. This work was carried out to investigate the hypothesis that reserve mobilization is coordinated with salt-induced inhibition of seedling growth due to changes in source-sink relations. To test this hypothesis, cashew nuts (Anacardium occidentale) were sown in vermiculite irrigated daily with distilled water (control) or 50mM NaCl and they were evaluated at discrete developmental stages from the seed germination until the whole seedling establishment. The salt treatment coordinately delayed the seedling growth and the cotyledonary reserve mobilization. However, these effects were more pronounced at late seedling establishment than in earlier stages. The storage protein mobilization was affected by salt stress before the lipid and starch breakdown. The globulin fraction represented the most important storage proteins of cashew cotyledons, and its mobilization was markedly delayed by NaCl along the seedling establishment. Free amino acids were mostly retained in the cotyledons of salt-treated seedlings when the mobilization of storage proteins, lipids and starch was strongly delayed. Proline was not considerably accumulated in the cotyledons of cashew seedlings as a response to NaCl salinity. According to these results it is noteworthy that the salt-induced inhibition of seedling growth is narrowly coordinated with the delay of reserve mobilization and the accumulation of hydrolysis products in cotyledons. Also, it was evidenced that free amino acids, especially those related to nitrogen transport, are potential signals involved in the regulation of storage protein hydrolysis during cashew seedling establishment under NaCl salinity.

  17. Etiologic yield of subspecialists' evaluation of young children with global developmental delay.

    PubMed

    Shevell, M I; Majnemer, A; Rosenbaum, P; Abrahamowicz, M

    2000-05-01

    To determine the etiologic yield of subspecialists' evaluation of young children with global developmental delay. In addition, variables that may predict finding an underlying etiology were also identified. All children <5 years of age, referred over an 18-month period to subspecialty services for initial evaluation of a suspected developmental delay, were prospectively enrolled. Diagnostic yield was ascertained after the completion of clinical assessments and laboratory investigations requested by the evaluating physician. Ninety-nine children (71 boys) were found to have global developmental delay; 96% had a mild or moderate delay documented. An etiologic diagnosis was determined in 44. Four diagnoses (cerebral dysgenesis, hypoxic-ischemic encephalopathy, toxin exposure, chromosomal abnormalities) accounted for 34 of 44 (77%) of the diagnoses made. The presence of co-existing autistic traits was associated with significantly decreased diagnostic yield (0/19 vs 44/80, P <.0001), whereas specific historical features (eg, family history, toxin exposure, and perinatal difficulty; 23/32 vs 21/67, P =.0002) and findings on physical examination (eg, dysmorphology, microcephaly, and focal motor findings; 35/48 vs 9/51, P <.0001) were significantly associated with identifying a diagnosis. Multiple logistic regression analysis identified antenatal toxin exposure, microcephaly, focal motor findings, and the absence of autistic traits as significant predictor variables for the identification of an etiology. An etiologic diagnosis is often possible in the young child with global developmental delay, particularly in the absence of autistic features. Etiologic yield is augmented by presence of specific findings on history or physical examination on initial assessment.

  18. Twins and virtual twins: Do genetic (as well as experiential) factors affect developmental risks?

    PubMed

    Segal, Nancy L; Tan, Tony Xing; Graham, Jamie L

    2015-08-01

    Factors underlying developmental delays and psychosocial risks are of interest to international adoption communities. The current study administered a Pre-Adoption Adversity (PAA) Questionnaire to mostly American parents raising (a) adopted Chinese twins or (b) same-age unrelated adopted siblings. A goal was to replicate earlier analyses of pre-adoption adversity/adjustment among adopted preschool-age Chinese girls. A second goal was to conduct genetic analyses of four content areas (Developmental Delays at Adoption, Initial Adaptation to Adoption, Crying/Clinging, and Refusal/Avoidance) derived from the PAA Questionnaire. A key finding was that age at adoption added less than other predictors to adoptees' externalizing and internalizing behaviors. Family factors (e.g., parental education) contributed significantly to behavioral outcomes among the adopted Chinese twins. Genetic effects were indicated for all four content areas, with shared environmental effects evident for Developmental Delays at Adoption and Crying/Clinging. Future investigators should consider incorporating genetically sensitive designs into developmental research programs. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. A patient with polymerase E1 deficiency (POLE1): clinical features and overlap with DNA breakage/instability syndromes.

    PubMed

    Thiffault, Isabelle; Saunders, Carol; Jenkins, Janda; Raje, Nikita; Canty, Kristi; Sharma, Mukta; Grote, Lauren; Welsh, Holly I; Farrow, Emily; Twist, Greyson; Miller, Neil; Zwick, David; Zellmer, Lee; Kingsmore, Stephen F; Safina, Nicole P

    2015-05-07

    Chromosome instability syndromes are a group of inherited conditions associated with chromosomal instability and breakage, often leading to immunodeficiency, growth retardation and increased risk of malignancy. We performed exome sequencing on a girl with a suspected chromosome instability syndrome that manifested as growth retardation, microcephaly, developmental delay, dysmorphic features, poikiloderma, immune deficiency with pancytopenia, and myelodysplasia. She was homozygous for a previously reported splice variant, c.4444 + 3A > G in the POLE1 gene, which encodes the catalytic subunit of DNA polymerase E. This is the second family with POLE1-deficency, with the affected individual demonstrating a more severe phenotype than previously described.

  20. Language screening in preschool Chinese children.

    PubMed

    Wong, V; Lee, P W; Lieh-Mak, F; Yeung, C Y; Leung, P W; Luk, S L; Yiu, E

    1992-01-01

    The incidence of language delay in Chinese preschool children was studied by a stratified proportional sampling of all 3 year olds in Hong Kong. The Developmental Language Screening Scale (DLSS) devised for use with Cantonese speaking children was used to identify children with language delay. Of 855 children sampled in the stage I screening procedure, 4%, 2.8% and 3.3% were identified as having delay in verbal comprehension, expression or both respectively. The stage II clinical diagnostic study included a randomly selected group of children screened in stage I with or without any associated behavioural problem. Among these, 3.4% were identified as having a language delay using the Reynell Language Developmental Scale (RDLS) with a criterion of language age of less than or equal to two-thirds of the chronological age; 3% had specific language delay using the criteria of language age less than or equal to two-thirds the chronological age and developmental age more than or equal to two-thirds the chronological age. More boys were found to have language delay, although this was not statistically significant.

  1. Live imaging of developmental processes in a living meristem of Davidia involucrata (Nyssaceae)

    PubMed Central

    Jerominek, Markus; Bull-Hereñu, Kester; Arndt, Melanie; Claßen-Bockhoff, Regine

    2014-01-01

    Morphogenesis in plants is usually reconstructed by scanning electron microscopy and histology of meristematic structures. These techniques are destructive and require many samples to obtain a consecutive series of states. Unfortunately, using this methodology the absolute timing of growth and complete relative initiation of organs remain obscure. To overcome this limitation, an in vivo observational method based on Epi-Illumination Light Microscopy (ELM) was developed and tested with a male inflorescence meristem (floral unit) of the handkerchief tree Davidia involucrata Baill. (Nyssaceae). We asked whether the most basal flowers of this floral unit arise in a basipetal sequence or, alternatively, are delayed in their development. The growing meristem was observed for 30 days, the longest live observation of a meristem achieved to date. The sequence of primordium initiation indicates a later initiation of the most basal flowers and not earlier or simultaneously as SEM images could suggest. D. involucrata exemplarily shows that live-ELM gives new insights into developmental processes of plants. In addition to morphogenetic questions such as the transition from vegetative to reproductive meristems or the absolute timing of ontogenetic processes, this method may also help to quantify cellular growth processes in the context of molecular physiology and developmental genetics studies. PMID:25431576

  2. Live imaging of developmental processes in a living meristem of Davidia involucrata (Nyssaceae).

    PubMed

    Jerominek, Markus; Bull-Hereñu, Kester; Arndt, Melanie; Claßen-Bockhoff, Regine

    2014-01-01

    Morphogenesis in plants is usually reconstructed by scanning electron microscopy and histology of meristematic structures. These techniques are destructive and require many samples to obtain a consecutive series of states. Unfortunately, using this methodology the absolute timing of growth and complete relative initiation of organs remain obscure. To overcome this limitation, an in vivo observational method based on Epi-Illumination Light Microscopy (ELM) was developed and tested with a male inflorescence meristem (floral unit) of the handkerchief tree Davidia involucrata Baill. (Nyssaceae). We asked whether the most basal flowers of this floral unit arise in a basipetal sequence or, alternatively, are delayed in their development. The growing meristem was observed for 30 days, the longest live observation of a meristem achieved to date. The sequence of primordium initiation indicates a later initiation of the most basal flowers and not earlier or simultaneously as SEM images could suggest. D. involucrata exemplarily shows that live-ELM gives new insights into developmental processes of plants. In addition to morphogenetic questions such as the transition from vegetative to reproductive meristems or the absolute timing of ontogenetic processes, this method may also help to quantify cellular growth processes in the context of molecular physiology and developmental genetics studies.

  3. Clinical assessment of early language development: a simplified short form of the Mandarin communicative development inventory.

    PubMed

    Soli, Sigfrid D; Zheng, Yun; Meng, Zhaoli; Li, Gang

    2012-09-01

    The purpose of this study was to develop a practical mean for clinical evaluation of early pediatric language development by establishing developmental trajectories for receptive and expressive vocabulary growth in children between 6 and 32 months of age using a simple, time-efficient assessment tool. Simplified short form versions of the Words and Gestures and Words and Sentences vocabulary inventories in the Mandarin Communicative Development Inventory [1] were developed and used to assess early language development in developmentally normal children from 6 to 32 months of age during routine health checks. Developmental trajectories characterizing the rate of receptive and expressive vocabulary growth between 6 and 32 months of age are reported. These trajectories allow the equivalent age corresponding to a score to be determined after a brief structured interview with the child's parents that can be conducted in a busy clinical setting. The simplified short forms of the Mandarin Communicative Development Inventories can serve as a clinically useful tool to assess early child language development, providing a practical mean of objectively assessing early language development following early interventions to treat young children with hearing impairment as well as speech and language delays. Objective evidence of language development is essential for achievement of effective (re)habilitation outcomes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  4. Cost of autotomy drives ontogenetic switching of anti-predator mechanisms under developmental constraints in a land snail

    PubMed Central

    Hoso, Masaki

    2012-01-01

    Autotomy of body parts offers various prey animals immediate benefits of survival in compensation for considerable costs. I found that a land snail Satsuma caliginosa of populations coexisting with a snail-eating snake Pareas iwasakii survived the snake predation by autotomizing its foot, whereas those out of the snake range rarely survived. Regeneration of a lost foot completed in a few weeks but imposed a delay of shell growth. Imprints of autotomy were found in greater than 10 per cent of S. caliginosa in the snake range but in only less than 1 per cent out of it, simultaneously demonstrating intense predation by the snakes and high efficiency of autotomy for surviving snake predation in the wild. However, in experiments, mature S. caliginosa performed autotomy less frequently. Instead of the costly autotomy, they can use defensive denticles on the inside of their shell apertures. Owing to the constraints from the additive growth of shells, most pulmonate snails can produce these denticles only when they have fully grown up. Thus, this developmental constraint limits the availability of the modified aperture, resulting in ontogenetic switching of the alternative defences. This study illustrates how costs of adaptation operate in the evolution of life-history strategies under developmental constraints PMID:23034702

  5. De novo pathogenic variants in CHAMP1 are associated with global developmental delay, intellectual disability, and dysmorphic facial features.

    PubMed

    Tanaka, Akemi J; Cho, Megan T; Retterer, Kyle; Jones, Julie R; Nowak, Catherine; Douglas, Jessica; Jiang, Yong-Hui; McConkie-Rosell, Allyn; Schaefer, G Bradley; Kaylor, Julie; Rahman, Omar A; Telegrafi, Aida; Friedman, Bethany; Douglas, Ganka; Monaghan, Kristin G; Chung, Wendy K

    2016-01-01

    We identified five unrelated individuals with significant global developmental delay and intellectual disability (ID), dysmorphic facial features and frequent microcephaly, and de novo predicted loss-of-function variants in chromosome alignment maintaining phosphoprotein 1 (CHAMP1). Our findings are consistent with recently reported de novo mutations in CHAMP1 in five other individuals with similar features. CHAMP1 is a zinc finger protein involved in kinetochore-microtubule attachment and is required for regulating the proper alignment of chromosomes during metaphase in mitosis. Mutations in CHAMP1 may affect cell division and hence brain development and function, resulting in developmental delay and ID.

  6. Effects of overweight and obesity on motor and mental development in infants and toddlers.

    PubMed

    Cataldo, R; Huang, J; Calixte, R; Wong, A T; Bianchi-Hayes, J; Pati, S

    2016-10-01

    A consequence of childhood obesity may be poor developmental outcomes. This study aimed to examine the relationship between weight and developmental delays in young children. We conducted a secondary analysis of the Early Childhood Longitudinal Study Birth Cohort data. Logistic regression models quantified the association between different weight statuses (normal weight <85th, overweight ≥90th, obese ≥95th percentile for weight) and delays in motor and mental development. Children classified as overweight in both waves had higher percentages of delays in wave 2 (motor [7.5 vs. 6.2-6.4%], mental [8.6 vs. 5.9-6.7%]), as well as wave 1 and/or wave 2 (motor [14.8 vs. 10.9-13.0%], mental [11.9 vs. 9.0-10.1%]), compared with other children. This association was also found in children who were obese at both time points in wave 2 (motor delay [8.9 vs. 4.9-7.3%], mental delay [10.3 vs. 6.0-7.2%]), as well as wave 1 and/or wave 2 (motor delay [14.5 vs. 10.9-12.9%], mental delay [14.1 vs. 9.4-10.1%]). In the adjusted models, children classified as always obese were more likely to have a mental delay in wave 2 (adjusted odds ratio [aOR] 1.89, 95% confidence interval [CI]: 1.21-2.95) as well as wave 1 and/or wave 2 (aOR 1.56, 95% CI: 1.08-2.26). These children were also more likely to have motor delay (aOR 1.47, 95% CI: 1.02-2.13) in wave 1 and/or wave 2. Overweight children are more likely than their normal-weight peers to have motor and mental developmental delays. Preventing obesity during infancy may facilitate reducing developmental delays in young children. © 2015 World Obesity.

  7. Scalp defects, polythelia, microcephaly, and developmental delay: a new syndrome with apparent autosomal dominant inheritance.

    PubMed

    Marble, Michael; Pridjian, Gabriella

    2002-04-01

    We report a family with apparent autosomal dominant inheritance of scalp defects, polythelia, microcephaly, and developmental delay. A review of the literature revealed no previous report of this combination of anomalies. We conclude that these patients have a new autosomal dominant syndrome. Copyright 2002 Wiley-Liss, Inc.

  8. Maternal Immune-Mediated Conditions, Autism Spectrum Disorders, and Developmental Delay

    ERIC Educational Resources Information Center

    Lyall, Kristen; Ashwood, Paul; Van de Water, Judy; Hertz-Picciotto, Irva

    2014-01-01

    The maternal immune system may play a role in offspring neurodevelopment. We examined whether maternal autoimmune disease, asthma, and allergy were associated with child autism spectrum disorder (ASD) and developmental delay without autism (DD) using 560 ASD cases, 391 typically developing controls, and 168 DD cases from the CHildhood Autism Risk…

  9. Predicting Declassification of Preschool Disabled Students through a Combination of Variables

    ERIC Educational Resources Information Center

    DeFina, Cynthia E.

    2017-01-01

    Early learning programs impact students, especially those with developmental delays. These formative years play a vital role in the overall development of the students' skills. School districts want to reach these special education students during these crucial years to help close the developmental delay gap. This quantitative study examines the…

  10. Graduated Guidance Delivered by Parents to Teach Yoga to Children with Developmental Delays

    ERIC Educational Resources Information Center

    Gruber, Deborah J.; Poulson, Claire L.

    2016-01-01

    We evaluated the effects of a parent-implemented intervention to teach yoga poses to 3 children with developmental delays. Graduated guidance, provided by the participants' mothers, was introduced in a multiple baseline design across the participants. With the introduction of intervention, imitation of the response chains increased over baseline…

  11. Marital Satisfaction, Parental Stress, and Child Behavior Problems among Parents of Young Children with Developmental Delays

    ERIC Educational Resources Information Center

    Robinson, Merideth; Neece, Cameron L.

    2015-01-01

    Studies have found that low marital satisfaction, parenting stress, and child behavior problems are linked in families of children with developmental delays (DD). However, previous investigations examining the relationships between parenting stress, child behavior problems, and marital satisfaction rarely examine the interrelationships of these…

  12. Paternal versus Maternal Coping Styles with Child Diagnosis of Developmental Delay

    ERIC Educational Resources Information Center

    Barak-Levy, Yael; Atzaba-Poria, Na'ama

    2013-01-01

    Parents of children with disabilities vary in their reaction to their children's diagnosis. The current study focused on fathers in addition to mothers and examined their resolution and coping styles when having children diagnosed with developmental delay (DD). Sixty-five fathers and 71 mothers were interviewed using the reaction to the diagnosis…

  13. A Classroom Collaborative Strategy Designed To Improve Oral Motor Skill Deficits in Developmentally Delayed Pre-Kindergarten Students.

    ERIC Educational Resources Information Center

    Hoffman, Lorri J.

    This practicum report describes the design and implementation of an oral motor program to increase the verbal communication skills of seven pre-kindergarten children with developmental delays, including hypotonia in oral motor development with moderate to severe articulation difficulties. Collaborative planning by the pre-kindergarten special…

  14. Preschool Children with and without Developmental Delay: Risk, Parenting, and Child Demandingness

    ERIC Educational Resources Information Center

    Brown, Mallory A.; McIntyre, Laura Lee; Crnic, Keith A.; Baker, Bruce L.; Blacher, Jan

    2011-01-01

    Although past literature has established relations between early child risk factors, negative parenting, and problematic child behavior, the nature of these interrelations and pathways of influence over time remains largely unknown, especially in children with developmental delays or disabilities. In the current study, data were drawn from the…

  15. Perceptions of Early Intervention Services: Adolescent and Adult Mothers in Two States

    ERIC Educational Resources Information Center

    Thompson, Stacy D.; Bruns, Deborah A.

    2013-01-01

    Early intervention (EI) provides critical services to families with young children who have diagnosed disabilities, developmental delays, or who are at-risk for developmental delays. Very little is known about the experiences of adolescent mothers who have children who qualify for EI services. The authors investigated the perceptions of adolescent…

  16. Hyperresponsive Sensory Patterns in Young Children with Autism, Developmental Delay, and Typical Development

    ERIC Educational Resources Information Center

    Baranek, Grace T.; Boyd, Brian A.; Poe, Michele D.; David, Fabian J.; Watson, Linda R.

    2007-01-01

    The nature of hyperresponsiveness to sensory stimuli in children with autism, using a new observational measure, the SPA, was examined. Three groups of young participants were assessed (autism, developmental delay, typical). Across all groups, MA was a predictor of hyperresponsiveness, such that aversion to multisensory toys decreased as MA…

  17. Establishing Auditory-Tactile-Visual Equivalence Classes in Children with Autism and Developmental Delays

    ERIC Educational Resources Information Center

    Mullen, Stuart; Dixon, Mark R.; Belisle, Jordan; Stanley, Caleb

    2017-01-01

    The current study sought to evaluate the efficacy of a stimulus equivalence training procedure in establishing auditory-tactile-visual stimulus classes with 2 children with autism and developmental delays. Participants were exposed to vocal-tactile (A-B) and tactile-picture (B-C) conditional discrimination training and were tested for the…

  18. The Negative Effects of Positive Reinforcement in Teaching Children with Developmental Delay.

    ERIC Educational Resources Information Center

    Biederman, Gerald B.; And Others

    1994-01-01

    This study compared the performance of 12 children (ages 4 to 10) with developmental delay, each trained in 2 tasks, one through interactive modeling (with or without verbal reinforcement) and the other through passive modeling. Results showed that passive modeling produced better rated performance than interactive modeling and that verbal…

  19. Gastrointestinal Problems in Children with Autism, Developmental Delays or Typical Development

    ERIC Educational Resources Information Center

    Chaidez, Virginia; Hansen, Robin L.; Hertz-Picciotto, Irva

    2014-01-01

    To compare gastrointestinal (GI) problems among children with: (1) autism spectrum disorder (ASD), (2) developmental delay (DD) and (3) typical development (TD), GI symptom frequencies were obtained for 960 children from the CHildhood Autism Risks from Genetics and Environment (CHARGE) study. We also examined scores on five Aberrant Behavior…

  20. Movement Exploration as a Technique for Teaching Pre-Swimming Skills to Students with Developmental Delays.

    ERIC Educational Resources Information Center

    Buis, Joyce M.; Schane, Catherine S.

    1980-01-01

    Background, rationale, and techniques for using movement exploration to teach preswimming skills to developmentally delayed persons are given. Objectives (beyond the primary one of safety) of such a program include body awareness, spatial awareness, movement, and perceptual motor functions. Guidelins for activity selection and adaptation are…

  1. Mathematical problems in children with developmental coordination disorder.

    PubMed

    Pieters, Stefanie; Desoete, Annemie; Van Waelvelde, Hilde; Vanderswalmen, Ruth; Roeyers, Herbert

    2012-01-01

    Developmental coordination disorder (DCD) is a heterogeneous disorder, which is often co-morbid with learning disabilities. However, mathematical problems have rarely been studied in DCD. The aim of this study was to investigate the mathematical problems in children with various degrees of motor problems. Specifically, this study explored if the development of mathematical skills in children with DCD is delayed or deficient. Children with DCD performed significantly worse for number fact retrieval and procedural calculation in comparison with age-matched control children. Moreover, children with mild DCD differed significantly from children with severe DCD on both number fact retrieval and procedural calculation. In addition, we found a developmental delay of 1 year for number fact retrieval in children with mild DCD and a developmental delay of 2 years in children with severe DCD. No evidence for a mathematical deficit was found. Diagnostic implications are discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. The effectiveness of parent participation in occupational therapy for children with developmental delay

    PubMed Central

    Lin, Chien-Lin; Lin, Chin-Kai; Yu, Jia-Jhen

    2018-01-01

    Introduction This study aims to explore the impact of Parent Participation Program on the development of developmental delay children. Methods Pretest-posttest equivalent-group experimental design study was used in this paper. A total of 30 pairs of developmental delay children aged 0–72 months and their parents participated into this study. They were divided into two groups, namely control group and experimental group, according to parents’ wishes. The objects of study in control group received 16 courses of direct rehabilitation therapy; those in experimental group received 8 courses of direct rehabilitation therapy and 8 courses of instruction and tracking of Parent Participation Program. The duration of the intervention was 8 weeks. All cases should be evaluated before and after the intervention, to analyze the difference before and after intervention and among groups. The statistical methods in this paper included descriptive analysis, Chi-square test, independent sample t-test, pair-sample t-test. Results and conclusion The intervention of Parent Participation Occupational Program has positive impact on the development of developmental delay children in various fields. Among all the intervention results, the progress of the experimental group is 1.895 times more than that of the control group. With parent involvement, Parent Participation Occupational Therapy can promote the cognitive ability, language ability, action ability (gross and fine movement), social competence and self-care ability of children with developmental delay. Finally, the researcher presents suggestions and directions for future research in accordance with the results. PMID:29503546

  3. The Development of Coordinated Communication in Infants at Heightened Risk for Autism Spectrum Disorder

    PubMed Central

    Parladé, Meaghan V.; Iverson, Jana M.

    2015-01-01

    This study evaluated the extent to which developmental change in coordination of social communication in early infancy differentiates children eventually diagnosed with ASD from those not likely to develop the disorder. A prospective longitudinal design was used to compare 9 infants at heightened risk for ASD (HR) later diagnosed with ASD, to 13 HR infants with language delay, 28 HR infants with no diagnosis, and 30 low risk infants. Hierarchical Linear Modeling (HLM) analyses revealed that ASD infants exhibited significantly slower growth in coordinations overall and in gestures coordinated with vocalizations, even relative to HR infants with language delay. Disruption in the development of gesture-vocalization coordinations may result in negative cascading effects that negatively impact later social and linguistic development. PMID:25689930

  4. Compromised genomic integrity impedes muscle growth after Atrx inactivation

    PubMed Central

    Huh, Michael S.; Price O’Dea, Tina; Ouazia, Dahmane; McKay, Bruce C.; Parise, Gianni; Parks, Robin J.; Rudnicki, Michael A.; Picketts, David J.

    2012-01-01

    ATR-X syndrome is a severe intellectual disability disorder caused by mutations in the ATRX gene. Many ancillary clinical features are attributed to CNS deficiencies, yet most patients have muscle hypotonia, delayed ambulation, or kyphosis, pointing to an underlying skeletal muscle defect. Here, we identified a cell-intrinsic requirement for Atrx in postnatal muscle growth and regeneration in mice. Mice with skeletal muscle–specific Atrx conditional knockout (Atrx cKO mice) were viable, but by 3 weeks of age presented hallmarks of underdeveloped musculature, including kyphosis, 20% reduction in body mass, and 34% reduction in muscle fiber caliber. Atrx cKO mice also demonstrated a marked regeneration deficit that was not due to fewer resident satellite cells or their inability to terminally differentiate. However, activation of Atrx-null satellite cells from isolated muscle fibers resulted in a 9-fold reduction in myoblast expansion, caused by delayed progression through mid to late S phase. While in S phase, Atrx colocalized specifically to late-replicating chromatin, and its loss resulted in rampant signs of genomic instability. These observations support a model in which Atrx maintains chromatin integrity during the rapid developmental growth of a tissue. PMID:23114596

  5. Neurodevelopmental delay associated with nonconvulsive status epilepticus in a toddler.

    PubMed

    Shinawi, M; Shahar, E

    2001-03-01

    Nonconvulsive status epilepticus is a prolonged and continuous state of increased unawareness without overt motor seizures linked with repetitive generalized epileptic discharges. In children, it may occur de novo but more commonly may complicate a preexisting epileptic disorder. We report on a 2-year-old female who presented with global developmental delay as the main manifestation of nonconvulsive status epilepticus. Following valproic acid treatment, her motor, cognitive, and speech delays had gradually subsided and nearly completely resolved, in concert with normalization of electroencephalography (EEG). Hence, given a possible, albeit rare, presentation of nonconvulsive status epilepticus with global developmental delay, we suggest that EEG should be recommended in any infant who manifests neurodevelopmental delay.

  6. Factors affecting the causality assessment of adverse events following immunisation in paediatric clinical trials: An online survey.

    PubMed

    Voysey, Merryn; Tavana, Rahele; Farooq, Yama; Heath, Paul T; Bonhoeffer, Jan; Snape, Matthew D

    2015-12-16

    Serious adverse events (SAEs) in clinical trials require reporting within 24h, including a judgment of whether the SAE was related to the investigational product(s). Such assessments are an important component of pharmacovigilance, however classification systems for assigning relatedness vary across study protocols. This on-line survey evaluated the consistency of SAE causality assessment among professionals with vaccine clinical trial experience. Members of the clinical advisory forum of experts (CAFÉ), a Brighton Collaboration online-forum, were emailed a survey containing SAEs from hypothetical vaccine trials which they were asked to classify. Participants were randomised to either two classification options (related/not related to study immunisation) or three options (possibly/probably/unrelated). The clinical scenarios, were (i) leukaemia diagnosed 5 months post-immunisation with a live RSV vaccine, (ii) juvenile idiopathic arthritis (JIA) 3 months post-immunisation with a group A streptococcal vaccine, (iii) developmental delay diagnosed at age 10 months after infant capsular group B meningococcal vaccine, (iv) developmental delay diagnosed at age 10 months after maternal immunisation with a group B streptococcal vaccine. There were 140 respondents (72 two options, 68 three options). Across all respondents, SAEs were considered related to study immunisation by 28% (leukaemia), 74% (JIA), 29% (developmental delay after infant immunisation) and 42% (developmental delay after maternal immunisation). Having only two options made respondents significantly less likely to classify the SAE as immunisation-related for two scenarios (JIA p=0.0075; and maternal immunisation p=0.045). Amongst study investigators (n=43) this phenomenon was observed for three of the four scenarios: (JIA p=0.0236; developmental delay following infant immunisation p=0.0266; and developmental delay after maternal immunisation p=0.0495). SAE causality assessment is inconsistent amongst study investigators and can be influenced by the classification systems available to them. There is a pressing need for SAE classification systems to be standardised across study protocols. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Individual development of preschool children-prevalences and determinants of delays in Germany: a cross-sectional study in Southern Bavaria.

    PubMed

    Stich, Heribert L; Baune, Bernhard Th; Caniato, Riccardo N; Mikolajczyk, Rafael T; Krämer, Alexander

    2012-12-05

    Even minor abnormalities of early child development may have dramatic long term consequences. Accurate prevalence rates for a range of developmental impairments have been difficult to establish. Since related studies have used different methodological approaches, direct comparisons of the prevalence of developmental delays are difficult. The understanding of the key factors affecting child development, especially in preschool aged children remains limited. We used data from school entry examinations in Bavaria to measure the prevalence of developmental impairments in pre-school children beginning primary school in 1997-2009. The developmental impairments of all school beginners in the district of Dingolfing-Landau, Bavaria were assessed using modified "Bavarian School Entry Model" examination from 1997 to 2009 (N=13,182). The children were assessed for motor, cognitive, language and psychosocial impairments using a standardised medical protocol. Prevalence rates of impairments in twelve domains of development were estimated. Using uni- and multivariable logistic regression models, association between selected factors and development delays were assessed. The highest prevalence existed for impairments of pronunciation (13.8%) followed by fine motor impairments (12.2%), and impairments of memory and concentration (11.3%) and the lowest for impairments of rhythm of speech (3.1%). Younger children displayed more developmental delays. Male gender was strongly associated with all developmental impairments (highest risk for fine motor impairments = OR 3.22, 95% confidence interval 2.86-3.63). Preschool children with siblings (vs. children without any siblings) were at higher risk of having impairments in pronunciation (OR 1.31, 1.14-1.50). The influence of the non-German nationality was strong, with a maximum risk increase for the subareas of grammar and psychosocial development. Although children with non-German nationality had a reduced risk of disorders for the rhythm of speech and pronunciation, in all other 10 subareas their risk was increased. In preschool children, most common were delays of pronunciation, memory and concentration. Age effects suggest that delays can spontaneously resolve, but providing support at school entry might be helpful. Boys and migrant children appear at high risk of developmental problems, which may warrant tailored intervention strategies.

  8. A rare de novo interstitial duplication of 15q15.3q21.2 in a boy with severe short stature, hypogonadism, global developmental delay and intellectual disability.

    PubMed

    Yuan, Haiming; Meng, Zhe; Zhang, Lina; Luo, Xiangyang; Liu, Liping; Chen, Mengfan; Li, Xinwei; Zhao, Weiwei; Liang, Liyang

    2016-01-01

    Interstitial duplications distal to 15q13 are very rare. Here, we reported a 14-year-old boy with severe short stature, delayed bone age, hypogonadism, global developmental delay and intellectual disability. His had distinctive facial features including macrocephaly, broad forehead, deep-set and widely spaced eyes, broad nose bridge, shallow philtrum and thick lips. A de novo 6.4 Mb interstitial duplication of 15q15.3q21.2 was detected by chromosomal microarray analysis. We compared our patient's clinical phenotypes with those of several individuals with overlapping duplications and several candidate genes responsible for the phenotypes were identified as well. The results suggest a novel contiguous gene duplication syndrome characterized with shared features including short stature, hypogonadism, global developmental delay and other congenital anomalies.

  9. Childhood growth, schooling, and cognitive development: further evidence from the Young Lives study.

    PubMed

    Fink, Günther; Rockers, Peter C

    2014-07-01

    A growing literature has linked early childhood growth to later-life cognition and schooling outcomes in developing countries. Although existing evidence suggests that children's ability to recover from early growth delays in later childhood is limited, longitudinal studies on the persistence and risk of growth faltering beyond age 5 y remain scarce. Using longitudinal data recently collected from 4 developing countries as part of the Young Lives study, we investigated catch-up growth in children between the ages of 8 and 15 y and the effects of growth during this late-childhood and early-adolescence period on schooling and developmental outcomes. We analyzed the associations between children's physical growth and development by using longitudinal data from 3327 children aged 8-15 y collected in Ethiopia, India, Peru, and Vietnam as part of the Young Lives project. The study yielded 2 main results. First, 36% of children stunted at age 8 y managed to catch up with their peers by age 15 y, and those who caught up had smaller deficits in cognitive scores than did children who remained stunted. Second, physical growth faltering was not restricted to early childhood but rather affected a substantial share of children in the 8-15-y age range, with large negative consequences for cognition and schooling outcomes. The results from this study suggest that child development in developing countries is a dynamic process offering continued opportunities for children to catch up during adolescence and sustained risks for children to fall behind in their developmental trajectories. © 2014 American Society for Nutrition.

  10. Behavioral characteristics of very-low-birth-weight infants of varying biologic risk at 6, 15, and 24 months of age.

    PubMed

    Oehler, J M; Thompson, R J; Goldstein, R F; Gustafson, K E; Brazy, J E

    1996-01-01

    To explore the relationship between developmental outcome and behavior of very-low-birth-weight (VLBW) infants (< or = 1500 g) at high and low biologic risk. Descriptive, ex post facto. Clinic for follow-up of infants at high risk. A convenience sample of 102 VLBW infants, free of major congenital anomalies, who completed 6-, 15-, and 24-month developmental testing and who were part of a larger study of 274 VLBW infants. Bayley Scales of Infant Development. Infants at high biologic risk, versus infants at low biologic risk, were less attentive and active through age 15 months and were less adept in gross and fine motor skills through age 24 months (p < or = 0.05-0.001). Infants with continuous delay were less attentive than infants with no delay or late delay through age 24 months, less active through age 15 months (p < or = 0.001-0.001), and less skilled in motor behaviors through age 24 months (p < or = 0.05-0.001). Infants at high biologic risk and infants with developmental delays are less attentive, less active, and less skilled in motor tasks during the first 15-24 months of life, suggesting an association between biologic risk and behavior and developmental delay and behavior.

  11. DISCRIMINATION ACQUISITION IN CHILDREN WITH DEVELOPMENTAL DISABILITIES UNDER IMMEDIATE AND DELAYED REINFORCEMENT

    PubMed Central

    Sy, Jolene R.; Vollmer, Timothy R.

    2012-01-01

    We evaluated the discrimination acquisition of individuals with developmental disabilities under immediate and delayed reinforcement. In Experiment 1, discrimination between two alternatives was examined when reinforcement was immediate or delayed by 20 s, 30 s, or 40 s. In Experiment 2, discrimination between 2 alternatives was compared across an immediate reinforcement condition and a delayed reinforcement condition in which subjects could respond during the delay. In Experiment 3, discrimination among 4 alternatives was compared across immediate and delayed reinforcement. In Experiment 4, discrimination between 2 alternatives was examined when reinforcement was immediate and 0-s or 30-s intertrial intervals (ITI) were programmed. For most subjects, discrimination acquisition occurred under immediate reinforcement. However, for some subjects, introducing delays slowed or prevented discrimination acquisition under some conditions. Results from Experiment 4 suggest that longer ITIs cannot account for the lack of discrimination under delayed reinforcement. PMID:23322925

  12. Distinct cerebellar foliation anomalies in a CHD7 haploinsufficient mouse model of CHARGE syndrome

    PubMed Central

    Whittaker, Danielle E.; Kasah, Sahrunizam; Donovan, Alex P. A.; Ellegood, Jacob; Riegman, Kimberley L. H.; Volk, Holger A.; McGonnell, Imelda; Lerch, Jason P.

    2017-01-01

    Mutations in the gene encoding the ATP dependent chromatin‐remodeling factor, CHD7 are the major cause of CHARGE (Coloboma, Heart defects, Atresia of the choanae, Retarded growth and development, Genital‐urinary anomalies, and Ear defects) syndrome. Neurodevelopmental defects and a range of neurological signs have been identified in individuals with CHARGE syndrome, including developmental delay, lack of coordination, intellectual disability, and autistic traits. We previously identified cerebellar vermis hypoplasia and abnormal cerebellar foliation in individuals with CHARGE syndrome. Here, we report mild cerebellar hypoplasia and distinct cerebellar foliation anomalies in a Chd7 haploinsufficient mouse model. We describe specific alterations in the precise spatio‐temporal sequence of fissure formation during perinatal cerebellar development responsible for these foliation anomalies. The altered cerebellar foliation pattern in Chd7 haploinsufficient mice show some similarities to those reported in mice with altered Engrailed, Fgf8 or Zic1 gene expression and we propose that mutations or polymorphisms in these genes may modify the cerebellar phenotype in CHARGE syndrome. Our findings in a mouse model of CHARGE syndrome indicate that a careful analysis of cerebellar foliation may be warranted in patients with CHARGE syndrome, particularly in patients with cerebellar hypoplasia and developmental delay. PMID:29168327

  13. Effect of long-term forest fertilization on Scots pine xylem quality and wood borer performance.

    PubMed

    Heijari, Juha; Nerg, Anne-Marja; Kainulainen, Pirjo; Noldt, Uwe; Levula, Teuvo; Raitio, Hannu; Holopainen, Jarmo K

    2008-01-01

    We tested whether changes in long-term nutrient availability would affect the xylem quality and characteristics of Scots pine trees as a food source for the larvae of the xylophagous wood borer Hylotrupes bajulus L. (Cerambycidae). We looked for an effect of host plant growth and xylem structural traits on H. bajulus larval performance, and looked for delayed effects of long-term forest fertilization on xylem chemical quality. In general, larval performance was dependent on larval developmental stage. However, the growth of larvae also varied with host plant quality (increases in the concentration of nitrogen and carbon-based secondary compounds of xylem were correlated with a decrease in the larval growth rate). The greater annual growth of trees reduced tracheid length and correlated positively with second-instar H. bajulus growth rate. This is consistent with the hypothesis that intrinsic growth patterns of host plants influence the development of the xylophagous wood borer H. bajulus.

  14. Hormonal, metabolic and skeletal phenotype of Schaaf-Yang syndrome: a comparison to Prader-Willi syndrome.

    PubMed

    McCarthy, John M; McCann-Crosby, Bonnie M; Rech, Megan E; Yin, Jiani; Chen, Chun-An; Ali, May A; Nguyen, HaiThuy N; Miller, Jennifer L; Schaaf, Christian P

    2018-05-01

    Nonsense and frameshift mutations in the maternally imprinted, paternally expressed gene MAGEL2, located in the Prader-Willi critical region 15q11-15q13, have been reported to cause Schaaf-Yang syndrome (SYS), a genetic disorder that manifests as developmental delay/intellectual disability, hypotonia, feeding difficulties and autism spectrum disorder. Prader-Willi syndrome (PWS) is a genetic disorder characterised by severe infantile hypotonia, hypogonadotrophic hypogonadism, early childhood onset obesity/hyperphagia, developmental delay/intellectual disability and short stature. Scoliosis and growth hormone insufficiency are also prevalent in PWS.There is extensive documentation of the endocrine and metabolic phenotypes for PWS, but not for SYS. This study served to investigate the hormonal, metabolic and body composition phenotype of SYS and its potential overlap with PWS. In nine individuals with SYS (5 female/4 male; aged 5-17 years), we measured serum ghrelin, glucose, insulin-like growth factor 1 (IGF-1), insulin-like growth factor binding protein 3, follicle-stimulating hormone, luteinising hormone, thyroid-stimulating hormone, free T4, uric acid and testosterone, and performed a comprehensive lipid panel. Patients also underwent X-ray and dual-energy X-ray absorptiometry analyses to assess for scoliosis and bone mineral density. Low IGF-1 levels despite normal weight/adequate nutrition were observed in six patients, suggesting growth hormone deficiency similar to PWS. Fasting ghrelin levels were elevated, as seen in individuals with PWS. X-rays revealed scoliosis >10° in three patients, and abnormal bone mineral density in six patients, indicated by Z-scores of below -2 SDs. This is the first analysis of the hormonal, metabolic and body composition phenotype of SYS. Our findings suggest that there is marked, but not complete overlap between PWS and SYS. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  15. Recall Memory in Children with Down Syndrome and Typically Developing Peers Matched on Developmental Age

    ERIC Educational Resources Information Center

    Milojevich, H.; Lukowski, A.

    2016-01-01

    Background: Whereas research has indicated that children with Down syndrome (DS) imitate demonstrated actions over short delays, it is presently unknown whether children with DS recall information over lengthy delays at levels comparable with typically developing (TD) children matched on developmental age. Method: In the present research, 10…

  16. Divergent Development of Gross Motor Skills in Children Who Are Blind or Sighted

    ERIC Educational Resources Information Center

    Brambring, Michael

    2006-01-01

    This empirical study compared the average ages at which four congenitally blind children acquired 29 gross motor skills with age norms for sighted children. The results indicated distinct developmental delays in the acquisition of motor skills and a high degree of variability in developmental delays within and across the six subdomains that were…

  17. Microarray as a First Genetic Test in Global Developmental Delay: A Cost-Effectiveness Analysis

    ERIC Educational Resources Information Center

    Trakadis, Yannis; Shevell, Michael

    2011-01-01

    Aim: Microarray technology has a significantly higher clinical yield than karyotyping in individuals with global developmental delay (GDD). Despite this, it has not yet been routinely implemented as a screening test owing to the perception that this approach is more expensive. We aimed to evaluate the effect that replacing karyotype with…

  18. Responsive Interaction Interventions for Children with or at Risk for Developmental Delays: A Research Synthesis

    ERIC Educational Resources Information Center

    Kong, Na Young; Carta, Judith J.

    2013-01-01

    The purpose of this article is to synthesize the available studies regarding responsive interaction intervention (RII) for children with or at risk for developmental delays with a focus on six dimensions: (a) the characteristics of participants, (b) the features of RII, (c) the measurement of treatment fidelity, (d) the overall effectiveness of…

  19. State and Jurisdictional Eligibility Definitions for Infants and Toddlers with Disabilities under IDEA. NECTAC Notes.

    ERIC Educational Resources Information Center

    Shackelford, Jo

    Under Part C of the Individuals with Disabilities Education Act (IDEA), participating states and jurisdictions must provide services to children who are either experiencing developmental delays, or who have a diagnosed mental or physical condition that has a a high probability of resulting in developmental delay. Additionally, states may choose to…

  20. State and Jurisdictional Eligibility Definitions for Infants and Toddlers with Disabilities under IDEA. NECTAC Notes No. 16

    ERIC Educational Resources Information Center

    Shackelford, Jo

    2004-01-01

    Under Part C of the Individuals with Disabilities Education Act (IDEA), participating states and jurisdictions must provide services to children who are either experiencing developmental delays, or who have a diagnosed mental or physical condition that has a high probability of resulting in developmental delay. Additionally, states may choose to…

  1. The Positive Impact of Early Intervention for Children with Developmental Delays, Gestational Cocaine Exposure, and Co-Occurring Risk Factors

    ERIC Educational Resources Information Center

    Ullery, Mary Anne; Katz, Lynne

    2017-01-01

    This article examined transition rates of young children (n = 102) from an early intervention program at the Linda Ray Intervention Program (LRIP) who had documented developmental delays and co-occurring prenatal drug exposure often coupled with verified child maltreatment. Findings indicated that there was significant group improvement from…

  2. The Role of Maternal Depression in Accessing Early Intervention Services for Children with Developmental Delay

    ERIC Educational Resources Information Center

    Colgan, Siobhan Eileen

    2012-01-01

    This study investigated the relationship between maternal depression and children's access to early intervention services among a sample of children with developmental delay at age two who were determined to be eligible for early intervention services, were full term and of normal birth weight, and were not previously identified with any special…

  3. Divergent Development of Verbal Skills in Children Who Are Blind or Sighted

    ERIC Educational Resources Information Center

    Journal of Visual Impairment & Blindness, 2007

    2007-01-01

    This empirical study compared the average ages at which four children with congenital blindness acquired 29 verbal skills with given age norms for sighted children. The results indicated only small developmental delays in the acquisition of verbal skills in the four children, but a high degree of variability in developmental delays within and…

  4. Motivational Climate, Motor-Skill Development, and Perceived Competence: Two Studies of Developmentally Delayed Kindergarten Children

    ERIC Educational Resources Information Center

    Valentini, Nadia; Rudisill, Mary E.

    2004-01-01

    Two studies were conducted to examine the effects of motivational climate on motor-skill development and perceived physical competence in kindergarten children with developmental delays. In Experiment 1, two intervention groups were exposed to environments with either high (mastery climate) or low autonomy for 12 weeks. Results showed that the…

  5. A Case-Controlled Investigation of Tactile Reactivity in Young Children with and without Global Developmental Delay

    ERIC Educational Resources Information Center

    Barney, Chantel C.; Tervo, Raymond; Wilcox, George L.; Symons, Frank J.

    2017-01-01

    Assessing tactile function among children with intellectual, motor, and communication impairments remains a clinical challenge. A case control design was used to test whether children with global developmental delays (GDD; n = 20) would be more/less reactive to a modified quantitative sensory test (mQST) compared to controls (n = 20). Reactivity…

  6. Motor Skill Interventions to Improve Fundamental Movement Skills of Preschoolers with Developmental Delay

    ERIC Educational Resources Information Center

    Kirk, Megan A.; Rhodes, Ryan E.

    2011-01-01

    Preschoolers with developmental delay (DD) are at risk for poor fundamental movement skills (FMS), but a paucity of early FMS interventions exist. The purpose of this review was to critically appraise the existing interventions to establish direction for future trials targeting preschoolers with DD. A total of 11 studies met the inclusion…

  7. Introduction to Sexuality Education for Individuals Who Are Deaf-Blind and Significantly Developmentally Delayed.

    ERIC Educational Resources Information Center

    Moss, Kate; Blaha, Robbie

    The ten chapters of this book address sexuality issues in the lives of school age individuals who are deaf-blind or significantly developmentally delayed. It notes that these individuals usually do not experience sexuality through typical relationships and thus require a different type of instruction. Chapters have the following titles: (1)…

  8. Divergent Development of Manual Skills in Children Who Are Blind or Sighted

    ERIC Educational Resources Information Center

    Brambring, Michael

    2007-01-01

    This empirical study compared the average ages at which four children with congenital blindness acquired 32 fine motor skills with age norms for sighted children. The results indicated that the children experienced extreme developmental delays in the acquisition of manual skills and a high degree of variability in developmental delays within and…

  9. A 20 Year Review of Punishment and Alternative Methods to Treat Problem Behaviors in Developmentally Delayed Persons.

    ERIC Educational Resources Information Center

    Matson, Johnny L.; Taras, Marie E.

    1989-01-01

    Studies assessing treatments for severe behavior problems of developmentally delayed persons were reviewed. Procedures used in the 382 studies, published from 1967-1987, were analyzed in terms of problem behaviors, side effects, and treatment methods. Also examined were number of studies reported yearly, maintenance and generalization of effects,…

  10. Small Steps: An Early Intervention Program for Children with Developmental Delays.

    ERIC Educational Resources Information Center

    Pieterse, Moira; And Others

    This boxed set includes eight booklets of home activities for early intervention for young children with developmental delays. The first book provides an introduction to the program and its implementation, lists 23 resources, describes a videotape which supplements the booklets, and includes a glossary. Book 2 covers how to select goals for the…

  11. De novo interstitial deletion of 3q22.3-q25.2 encompassing FOXL2, ATR, ZIC1, and ZIC4 in a patient with blepharophimosis/ptosis/epicanthus inversus syndrome, Dandy-Walker malformation, and global developmental delay.

    PubMed

    Lim, Byung Chan; Park, Woong Yang; Seo, Eul-Ju; Kim, Ki Joong; Hwang, Yong Seung; Chae, Jong Hee

    2011-05-01

    We report a case carrying a de novo interstitial deletion of chromosome 3q22-q25. The clinical phenotype of this case included blepharophimosis/ptosis/epicanthus inversus syndrome, Dandy-Walker malformation, and global developmental delay. Contiguous heterozygous deletion of FOXL2, ATR, ZIC1, and ZIC4 was postulated as the causative mechanism of the clinical phenotype. The association of blepharophimosis, ptosis, and epicanthus inversus syndrome with developmental delay or mental retardation may be an indication for the use of brain imaging and chromosomal analysis capable of detecting chromosomal rearrangements encompassing several candidate genes.

  12. Cold exposure inhibits hypothalamic Kiss-1 gene expression, serum leptin concentration, and delays reproductive development in male Brandt's vole ( Lasiopodomys brandtii)

    NASA Astrophysics Data System (ADS)

    Zhang, Qiang; Lin, Yi; Zhang, Xue-Ying; Wang, De-Hua

    2015-06-01

    Cold commonly affects growth and reproductive development in small mammals. Here, we test the hypothesis that low ambient temperature will affect growth and puberty onset, associated with altered hypothalamic Kiss-1 gene expression and serum leptin concentration in wild rodents. Male Brandt's voles ( Lasiopodomys brandtii) were exposed to cold (4 ± 1 °C) and warm (23 ± 1 °C) conditions from the birth and sacrificed on different developmental stages (day 26, day 40, day 60, and day 90, respectively). Brandt's voles increased the thermogenic capacity of brown adipose tissue, mobilized body fat, decreased serum leptin levels, and delayed the reproductive development especially on day 40 in the cold condition. They increased food intake to compensate for the high energy demands in the cold. The hypothalamic Kiss-1 gene expression on day 26 was decreased, associated with lower wet testis mass and testis testosterone concentration on day 40, in the cold-exposed voles compared to that in the warm. Serum leptin was positively correlated with body fat, testis mass, and testosterone concentration. These data suggested that cold exposure inhibited hypothalamic Kiss-1 gene expression during the early stage of development, decreased serum leptin concentration, and delayed reproductive development in male Brandt's voles.

  13. Heterogeneity in development of aspects of working memory predicts longitudinal attention deficit hyperactivity disorder symptom change.

    PubMed

    Karalunas, Sarah L; Gustafsson, Hanna C; Dieckmann, Nathan F; Tipsord, Jessica; Mitchell, Suzanne H; Nigg, Joel T

    2017-08-01

    The role of cognitive mechanisms in the clinical course of neurodevelopmental disorders is poorly understood. Attention Deficit Hyperactivity Disorder (ADHD) is emblematic in that numerous alterations in cognitive development are apparent, yet how they relate to changes in symptom expression with age is unclear. To resolve the role of cognitive mechanisms in ADHD, a developmental perspective that takes into account expected within-group heterogeneity is needed. The current study uses an accelerated longitudinal design and latent trajectory growth mixture models in a sample of children ages 7-13 years carefully characterized as with (n = 437) and without (n = 297) ADHD to (a) identify heterogeneous developmental trajectories for response inhibition, visual spatial working memory maintenance, and delayed reward discounting and (b) to assess the relationships between these cognitive trajectories and ADHD symptom change. Best-fitting models indicated multiple trajectory classes in both the ADHD and typically developing samples, as well as distinct relationships between each cognitive process and ADHD symptom change. Developmental change in response inhibition and delayed reward discounting were unrelated to ADHD symptom change, while individual differences in the rate of visual spatial working memory maintenance improvement predicted symptom remission in ADHD. Characterizing heterogeneity in cognitive development will be crucial for clarifying mechanisms of symptom persistence and recovery. Results here suggest working memory maintenance may be uniquely related to ADHD symptom improvement. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  14. Human milk for the premature infant

    PubMed Central

    Underwood, Mark A.

    2012-01-01

    Synopsis Premature infants are a heterogeneous group with widely differing needs for nutrition and immune protection with risk of growth failure, developmental delays, necrotizing enterocolitis, and late-onset sepsis increasing with decreasing gestational age and birth weight. Human milk from women delivering prematurely has more protein and higher levels of many bioactive molecules compared to milk from women delivering at term. Human milk must be fortified for small premature infants to achieve adequate growth. Mother’s own milk improves growth and neurodevelopment and decreases the risk of necrotizing enterocolitis and late-onset sepsis and should therefore be the primary enteral diet of premature infants. Donor milk is a valuable resource for premature infants whose mothers are unable to provide an adequate supply of milk, but presents significant challenges including the need for pasteurization, nutritional and biochemical deficiencies and a limited supply. PMID:23178065

  15. Emotion word comprehension from 4 to 16 years old: a developmental survey.

    PubMed

    Baron-Cohen, Simon; Golan, Ofer; Wheelwright, Sally; Granader, Yael; Hill, Jacqueline

    2010-01-01

    Whilst previous studies have examined comprehension of the emotional lexicon at different ages in typically developing children, no survey has been conducted looking at this across different ages from childhood to adolescence. To report how the emotion lexicon grows with age. Comprehension of 336 emotion words was tested in n = 377 children and adolescents, aged 4-16 years old, divided into 6 age-bands. Parents or teachers of children under 12, or adolescents themselves, were asked to indicate which words they knew the meaning of. Between 4 and 11 years old, the size of the emotional lexicon doubled every 2 years, but between 12 and 16 years old, developmental rate of growth of the emotional lexicon leveled off. This survey also allows emotion words to be ordered in terms of difficulty. Studies using emotion terms in English need to be developmentally sensitive, since during childhood there is considerable change. The absence of change after adolescence may be an artifact of the words included in this study. This normative developmental data-set for emotion vocabulary comprehension may be useful when testing for delays in this ability, as might arise for environmental or neurodevelopmental reasons.

  16. Norms for developmental milestones using VABS-II and association with anthropometric measures among apparently healthy urban Indian preschool children.

    PubMed

    Selvam, Sumithra; Thomas, Tinku; Shetty, Priya; Zhu, Jianjun; Raman, Vijaya; Khanna, Deepti; Mehra, Ruchika; Kurpad, Anura V; Srinivasan, Krishnamachari

    2016-12-01

    Assessment of developmental milestones based on locally developed norms is critical for accurate estimate of overall development of a child's cognitive, behavioral, social, and emotional development. A cross-sectional study was done to develop age specific norms for developmental milestones using Vineland Adaptive Behavior Scales (VABS-II) (Sparrow, Cicchetti, & Balla, 2005) for apparently healthy children from 2 to 5 years from urban Bangalore, India, and to examine its association with anthropometric measures. Mothers (or caregivers) of 412 children participated in the study. Age-specific norms using inferential norming method and adaptive levels for all domains and subdomains were derived. Low adaptive level, also called delayed developmental milestone, was observed in 2.3% of the children, specifically 2.7% in motor and daily living skills and 2.4% in communication skills. When these children were assessed on the existing U.S. norms, there was a significant overestimation of delayed development in socialization and motor skills, whereas delay in communication and daily living skills were underestimated (all p < .01). Multiple linear regression revealed that stunted and underweight children had significantly lower developmental scores for communication and motor skills compared with normal children (β coefficient ranges from 2.6-5.3; all p < .01). In the absence of Indian normative data for VABS-II in preschool children, the prevalence of developmental delay could either be under- or overestimated using Western norms. Thus, locally referenced norms are critical for reliable assessments of development in children. Stunted and underweight children are more likely to have poorer developmental scores compared with healthy children. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  17. A prospective study of response to name in infants at risk for autism.

    PubMed

    Nadig, Aparna S; Ozonoff, Sally; Young, Gregory S; Rozga, Agata; Sigman, Marian; Rogers, Sally J

    2007-04-01

    To assess the sensitivity and specificity of decreased response to name at age 12 months as a screen for autism spectrum disorders (ASD) and other developmental delays. Prospective, longitudinal design studying infants at risk for ASD. Research laboratory at university medical center. Infants at risk for autism (55 six-month-olds, 101 twelve-month-olds) and a control group at no known risk (43 six-month-olds, 46 twelve-month-olds). To date, 46 at-risk infants and 25 control infants have been followed up to 24 months. Intervention Experimental task eliciting response-to-name behavior. Autism Diagnostic Observation Schedule, Mullen Scales of Early Learning. At age 6 months, there was a nonsignificant trend for control infants to require a fewer number of calls to respond to name than infants at risk for autism. At age 12 months, 100% of infants in the control group "passed," responding on the first or second name call, while 86% in the at-risk group did. Three fourths of children who failed the task were identified with developmental problems at age 24 months. Specificity of failing to respond to name was 0.89 for ASD and 0.94 for any developmental delay. Sensitivity was 0.50 for ASD and 0.39 for any developmental delay. Failure to respond to name by age 12 months is highly suggestive of developmental abnormality but does not identify all children at risk for developmental problems. Lack of responding to name is not universal among infants later diagnosed with ASD and/or other developmental delays. Poor response to name may be a trait of the broader autism phenotype in infancy.

  18. Using Animation in Microsoft PowerPoint to Enhance Engagement and Learning in Young Learners with Developmental Delay

    ERIC Educational Resources Information Center

    Parette, Howard P., Jr.; Hourcade, Jack; Blum, Craig

    2011-01-01

    Over the past decade, a wide array of instructional technology applications have found their way into early intervention settings. Of particular importance to young learners who evidence developmental delays or are at risk for school failure are those technologies with the potential to more effectively teach basic emergent literacy skills: (1)…

  19. Predictors of Depressive Symptoms in Primary Caregivers of Young Children with or at Risk for Developmental Delay

    ERIC Educational Resources Information Center

    Feldman, M.; McDonald, L.; Serbin, L.; Stack, D.; Secco, M. L.; Yu, C. T.

    2007-01-01

    Background: Despite extensive research with families raising children with or at risk for developmental delay (DD), it is not clear whether primary caregivers of these children are at increased risk for depressive symptoms. Discrepant findings in the literature may be owing to heterogeneity of child problems. More research is needed on child,…

  20. Teaching Language Skills to Preschool Students with Developmental Delays and Autism Spectrum Disorder Using Language for Learning

    ERIC Educational Resources Information Center

    Flores, Margaret M.; Schweck, Kelly B.; Hinton, Vanessa

    2016-01-01

    Language intervention using Direct Instruction (DI) has shown positive results. There is a growing body of investigation of Language for Learning (LL), a DI program, on the performance of students with autism spectrum disorders (ASD) and students with developmental delays (DD). There is need for replication and extension of research to include…

  1. A Digest and Comparative Analysis of Major Federal Programs Affecting Infants and Toddlers with Handicaps and Their Families.

    ERIC Educational Resources Information Center

    O'Reilly, Fran E.; And Others

    This study analyzes major federal programs designed to provide services to children, from birth through age 2, who have developmental delays or a high probability of developmental delays, and their families. Programs were selected based on their provision of education or health-related services to infants and toddlers with handicaps and their…

  2. Longitudinal Assessment of Stereotypic, Proto-Injurious, and Self-Injurious Behavior Exhibited by Young Children with Developmental Delays

    ERIC Educational Resources Information Center

    Richman, David M.; Lindauer, Steven E.

    2005-01-01

    Twelve children (CA, 12 to 32 months) with developmental delay were observed in their homes during monthly analogue functional analysis probes to document patterns of emerging self-injurious behavior. Two patterns of emerging self-injury were observed for 5 participants: (a) The topography and functional analysis pattern remained the same, but the…

  3. The Administrative Population Report on Children with Developmental Delays in Taiwan, 2003 through 2007

    ERIC Educational Resources Information Center

    Lin, Jin-Ding; Yen, Chia-Feng; Wu, Jia-Ling; Kang, Shih-Wan

    2009-01-01

    This paper was a population study with developmental delays and it included an examination of the trends the overtime change trend and reported channels of this group of people in Taiwan. We analyzed data for the present study mainly from the Department of Statistics, Ministry of the Interiors, Taipei, Taiwan: "Number of early intervention…

  4. State and Jurisdictional Eligibility Definitions for Infants and Toddlers with Disabilities under IDEA. Nectas Notes, Number 5. Revised.

    ERIC Educational Resources Information Center

    Shackelford, Jo

    Under Part C of the Individuals with Disabilities Education Act (IDEA), participating states and jurisdictions must provide services to children who are either experiencing developmental delays, or who have a diagnosed condition that carries with it a high risk of developmental delay. Eligibility criteria used by the states influence the numbers…

  5. The Effects of Imitation Instruction Using a Mirror on the Emergence of Duplicative Responses by Preschool Students Diagnosed with Developmental Delays

    ERIC Educational Resources Information Center

    Moreno, Jalene Donica

    2012-01-01

    Using pre-and post-intervention non-concurrent multiple probe designs across participants, I conducted 2 experiments that tested the effects of imitation instruction using a mirror on the emergence of both basic and advanced forms of generalized imitation (GI) involving physical actions with preschool students diagnosed with developmental delays.…

  6. Global Perspective on Early Diagnosis and Intervention for Children with Developmental Delays and Disabilities

    ERIC Educational Resources Information Center

    Scherzer, Alfred L.; Chhagan, Meera; Kauchali, Shuaib; Susser, Ezra

    2012-01-01

    Low- and middle-income countries are experiencing a significant reduction in mortality of children under 5 years of age. This reduction is bringing in its wake large numbers of surviving children with developmental delays and disabilities. Very little attention has been paid to these children, most of whom receive minimal or no support. Thus,…

  7. State and Jurisdictional Eligibility Definitions for Infants and Toddlers with Disabilities under IDEA. NECTAC Notes Issue No. 14

    ERIC Educational Resources Information Center

    Shackelford, Jo

    2004-01-01

    Under Part C of the Individuals with Disabilities Education Act (IDEA), participating states and jurisdictions must provide services to children who are either experiencing developmental delays, or who have a diagnosed mental or physical condition that has a high probability of resulting in developmental delay. Additionally, states may choose to…

  8. Mindfulness-Based Stress Reduction for Parents of Young Children with Developmental Delays: Implications for Parental Mental Health and Child Behavior Problems

    ERIC Educational Resources Information Center

    Neece, Cameron L.

    2014-01-01

    Background: Parents of children with developmental delays (DD) typically report elevated levels of parental stress compared with parents of typically developing children. Children with DD are also at high risk for exhibiting significant behaviour problems. Parental stress has been shown to impact the development of these behaviour problems;…

  9. Comparing Service Delivery Models for Children with Developmental Delays in Canada: Adaptive and Maladaptive Behaviours, Parental Perceptions of Stress and of Care

    ERIC Educational Resources Information Center

    Sladeczek, Ingrid E.; Fontil, Laura; Miodrag, Nancy; Karagiannakis, Anastasia; Amar, Daniel; Amos, Janet

    2017-01-01

    This study compares two service delivery models (community-based and centre-based), examining them in light of children's adaptive and maladaptive behaviours, and parental perceptions of stress and of care. More specifically, parents of 96 children with developmental delays assessed their children's adaptive and maladaptive behaviours and rated…

  10. Review of Recent Research Using Constant Time Delay to Teach Chained Tasks to Persons with Developmental Disabilities

    ERIC Educational Resources Information Center

    Dogoe, Maud; Banda, Devender R.

    2009-01-01

    We reviewed twelve studies that used the constant time delay (CTD) procedure to teach chained tasks to individuals with developmental disabilities from years 1996-2006. Variables analyzed include types of tasks that have been taught with the procedure, how effective CTD has been in teaching participants, and whether researchers have investigated…

  11. Implementing Visually Cued Imitation Training with Children with Autism Spectrum Disorders and Developmental Delays

    ERIC Educational Resources Information Center

    Ganz, Jennifer B.; Bourgeois, Bethany C.; Flores, Margaret M.; Campos, B. Adriana

    2008-01-01

    Clearly, imitation is linked to a variety of skill areas. As a result, children with autism and developmental delays are less likely than their typical peers to perform well in many areas of development, including play and speech. The purpose of this study was to determine if a simple, teacher-friendly strategy could be implemented that would…

  12. Modeling Skills, Signs and Lettering for Children with Down Syndrome, Autism and Other Severe Developmental Delays by Video Instruction in Classroom Setting

    ERIC Educational Resources Information Center

    Biederman, G. B.; Freedman, B.

    2007-01-01

    This paper addresses optimal strategies in teaching essential life and communication skills to children with Down syndrome, autism and other developmental delays. Evidence from the literature concerning the relative efficacy of hand-over-hand (self-modeling) in contrast to passive observational teaching techniques (e.g., video modeling) shows the…

  13. Father's role in parent training for children with developmental delay.

    PubMed

    Bagner, Daniel M

    2013-08-01

    The current pilot study was a quasi-experimental examination of the impact of father involvement in parent training among 44 families with a young child who presented with elevated externalizing behavior problems and developmental delay. All families were offered to receive Parent-Child Interaction Therapy (PCIT), an evidence-based parent-training intervention, at a hospital-based outpatient clinic. Single-mother families were significantly more likely to drop out of treatment than two-parent families. Of the families that completed treatment, children from families in which a father participated in treatment had lower levels of parent-reported externalizing behavior problems than children from single-mother families and children from two-parent families in which the father did not participate in treatment. Additionally, children from father-involved families were significantly more compliant during a cleanup task than children from single-mother families following treatment. The current study is consistent with the limited research examining father involvement in parent training and extends the findings to children with developmental delay. These findings highlight the importance of involving fathers in parent training, particularly when working with children with developmental delay. © 2013 American Psychological Association

  14. Delayed development in Fischer's pygmy fruit bat, Haplonycteris fischeri, in the Philippines.

    PubMed

    Heideman, P D

    1989-03-01

    A long delay in post-implantation embryonic development was detected in Fischer's pygmy fruit bats (palaeotropical fruit bats of the suborder Megachiroptera), the first time such a delay has been demonstrated outside the bat suborder Microchiroptera. Samples of bats were obtained from the Philippines over 5 years, and reproductive tracts were preserved and examined using standard histological techniques. Most parous female pygmy bats were impregnated in June, within a few weeks of parturition, and the embryos underwent superficial implantation at the anterior end of the uterus contralateral to the previously gravid uterus. Shortly thereafter, the rate of embryonic growth slowed tremendously for up to 8 months. During the period of delay, the mean length of the embryoblast increased only from 280 microns to 520 microns. In March of the following year, the developmental rate increased, and the embryos completed development in the next 3 months. The 8-month delay gives these bats a gestation period of 11.5 months, the longest known in bats. Most nulliparous females become pregnant at an age of 3-5 months, and their embryos entered a similar delay that terminated in March or April, after 2-6 months of delay. Males showed signs of fertility throughout the entire year, but testis volume was highest during May, June and July, at about the time when most females become receptive.

  15. [Multiplex Ligation - dependent Probe Amplification (MLPA) as a screening test in children with developmental defects and intellectual disability of unknown etiology].

    PubMed

    Laczmańska, Izabela; Jakubiak, Aleksandra; Slęzak, Ryszard; Pesz, Karolina; Stembalska, Agnieszka; Laczmański, Lukasz; Sąsiadek, Maria M; Smigiel, Robert

    2011-01-01

    Developmental delay and intellectual disability are significant medical and social problems which concern 1-3% of population. The etiology remains unknown in over half of the cases. To evaluate the efficiency of MLPA (Multiplex Ligation-dependent Probe Amplification) as a screening test in diagnosis of patients with developmental delay and/or intellectual disability. 313 MLPA tests were performed in 256 patients with developmental delay and/ or intellectual disability with unknown etiology. MLPA test was made after exclusion of genetic disorders possible to diagnose by dysmorphological examination or using specifi c genetic tests. Positive results were confirmed by FISH analysis with appropriate probes. Chromosomal microaberrations were identifi ed in 15 patients (4,8%): deletions of 1p36 in 4 cases, in one case deletion of 22q11.21, 22q13.33, SNRPN1, 4ptel, 6qtel, 7q11.23, 16ptel, 18qtel as well as one ca se of deletion 3ptel/duplication 15qtel; deletion 18qtel/duplication Xqtel, and also duplication 7q11.23. Detail clinical analysis was performed in patients with diagnosed microaberrations in MLPA test. The molecular MLPA test, screening for chromosomal microaberration syndromes, should be performed in each patient with developmental delay and/or intellectual disability of unknown etiology and normal cytogenetic analysis, even if congenital defects and positive familial history do not exist.

  16. Imitation from 12 to 24 months in autism and typical development: A longitudinal Rasch analysis

    PubMed Central

    Young, Gregory S.; Rogers, Sally J.; Hutman, Ted; Rozga, Agata; Sigman, Marian; Ozonoff, Sally

    2013-01-01

    The development of imitation during the second year of life plays an important role in domains of socio-cognitive development such as language and social learning. Deficits in imitation ability in persons with autism spectrum disorder (ASD) have also been repeatedly documented from toddlerhood into adulthood, raising the possibility that early disruptions in imitation contribute to the onset of ASD and the deficits in language and social interaction that define the disorder. This study prospectively examined the development of imitation between 12 and 24 months of age in 154 infants at familial risk for ASD and 78 typically developing infants who were all later assessed at 36 months for ASD or other developmental delays. The study established a developmental measure of imitation ability, and examined group differences over time, using an analytic Rasch measurement model. Results revealed a unidimensional latent construct of imitation and verified a reliable sequence of imitation skills that was invariant over time for all outcome groups. Results also showed that all groups displayed similar significant linear increases in imitation ability between 12 and 24 months and that these increases were related to individual growth in both expressive language and ratings of social engagement, but not fine motor development. The group of children who developed ASD by age 3 years exhibited delayed imitation development compared to the low-risk typical outcome group across all time-points, but were indistinguishable from other high-risk infants who showed other cognitive delays not related to ASD. PMID:21910524

  17. Developmental Assessment with Young Children: A Systematic Review of Battelle Studies

    ERIC Educational Resources Information Center

    Cunha, Ana C. B.; Berkovits, Michelle D.; Albuquerque, Karolina A.

    2018-01-01

    Developmental assessment scales are important tools for determining developmental delays and planning preventive interventions. One broad assessment scale used to evaluate child development is the Battelle Developmental Inventories (BDIs). The BDI-2 has a standardized version in English with good psychometric properties and a translated version in…

  18. Developmental Milestones in Toddlers with Atypical Development

    ERIC Educational Resources Information Center

    Horovitz, Max; Matson, Johnny L.

    2011-01-01

    The attainment of developmental milestones was examined and compared in 162 infants and toddlers with developmental disabilities, including Down Syndrome (n = 26), Cerebral Palsy (n = 19), Global Developmental Delay (n = 22), Premature birth (n = 66), and Seizure Disorder (n = 29). Toddlers in the Seizures Disorder group began crawling at a…

  19. Symbolic play of preschoolers with severe communication impairments with autism and other developmental delays: more similarities than differences.

    PubMed

    Thiemann-Bourque, Kathy S; Brady, Nancy C; Fleming, Kandace K

    2012-05-01

    Children with autism are often described as having deficient play skills, particularly symbolic play. We compared the play of 35 children with autism to 38 children with other developmental delays. All children were preschool-age and produced less than 20 different words. Results indicated no significant differences across the two groups in their play. Children with autism engaged in more conventional play, that is, putting objects together according to how the toys were constructed (e.g., pieces in a puzzle, lid on a teapot). Results also indicated high correlations between play, language, and cognitive measures. Findings indicate that play relates to language and cognitive levels yet may not discriminate children with autism and children with other developmental delays early in their development.

  20. Symbolic Play of Preschoolers with Severe Communication Impairments with Autism and Other Developmental Delays: More Similarities than Differences

    PubMed Central

    Brady, Nancy C.; Fleming, Kandace K.

    2011-01-01

    Children with autism are often described as having deficient play skills, particularly symbolic play. We compared the play of 35 children with autism to 38 children with other developmental delays. All children were preschool-age and produced less than 20 different words. Results indicated no significant differences across the two groups in their play. Children with autism engaged in more conventional play, that is, putting objects together according to how the toys were constructed (e.g., pieces in a puzzle, lid on a teapot). Results also indicated high correlations between play, language, and cognitive measures. Findings indicate that play relates to language and cognitive levels yet may not discriminate children with autism and children with other developmental delays early in their development. PMID:21720725

  1. Developmental delay and connective tissue disorder in four patients sharing a common microdeletion at 6q13-14.

    PubMed

    Van Esch, Hilde; Rosser, Elisabeth M; Janssens, Sandra; Van Ingelghem, Ingrid; Loeys, Bart; Menten, Bjorn

    2010-10-01

    Interstitial deletions of the long arm of chromosome 6 are rare, and most reported cases represent large, cytogenetically detectable deletions. The implementation of array comparative genome hybridisation in the diagnostic work-up of patients presenting with congenital disorders, including developmental delay, has enabled identification of many patients with smaller chromosomal imbalances. In this report, the cases are presented of four patients with a de novo interstitial deletion of chromosome 6q13-14, resulting in a common microdeletion of 3.7 Mb. All presented with developmental delay, mild dysmorphism and signs of lax connective tissue. Interestingly, the common deleted region harbours 16 genes, of which COL12A1 is a good candidate for the connective tissue pathology.

  2. A role for Lin-28 in growth and metamorphosis in Drosophila melanogaster.

    PubMed

    González-Itier, Sergio; Contreras, Esteban G; Larraín, Juan; Glavic, Álvaro; Faunes, Fernando

    2018-06-13

    Insect metamorphosis has been a classic model to understand the role of hormones in growth and timing of developmental transitions. In addition to hormones, transitions in some species are regulated by genetic programs, such as the heterochronic gene network discovered in C. elegans. However, the functional link between hormones and heterochronic genes is not clear. The heterochronic gene lin-28 is involved in the maintenance of stem cells, growth and developmental timing in vertebrates. In this work, we used gain-of-function and loss-of-function experiments to study the role of Lin-28 in larval growth and the timing of metamorphosis of Drosophila melanogaster. During the late third instar stage, Lin-28 is mainly expressed in neurons of the central nervous system and in the intestine. Loss-of-function lin-28 mutant larvae are smaller and the larval-to-pupal transition is accelerated. This faster transition correlates with increased levels of ecdysone direct target genes such as Broad-Complex (BR-C) and Ecdysone Receptor (EcR). Overexpression of Lin-28 does not affect the timing of pupariation but most animals are not able to eclose, suggesting defects in metamorphosis. Overexpression of human Lin-28 results in delayed pupariation and the death of animals during metamorphosis. Altogether, these results suggest that Lin-28 is involved in the control of growth during larval development and in the timing and progression of metamorphosis. Copyright © 2017. Published by Elsevier B.V.

  3. Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

    PubMed

    Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

    2008-11-01

    Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

  4. Exonic deletions of AUTS2 in Chinese patients with developmental delay and intellectual disability.

    PubMed

    Fan, Yanjie; Qiu, Wenjuan; Wang, Lili; Gu, Xuefan; Yu, Yongguo

    2016-02-01

    Genomic rearrangements involving dosage change of genes have been implicated in a range of developmental disorders. Increasing evidences suggest copy number variations (CNVs) of autism susceptibility candidate gene 2 (AUTS2) are associated with a syndromic form of developmental delay and intellectual disability. However, the genetic and clinical profiles involving AUTS2 variations have not been fully characterized in Asian patients yet, and the outcome of treatments has not been reported. Here we report de novo exonic deletions of AUTS2 detected by chromosomal microarray analysis (CMA) in three Chinese children referred to the clinic for developmental delay, including two deletions involving only exon 6 (98.4 and 262 kb, respectively) and one deletion involving the C-terminal of AUTS2 (2147 kb). The phenotypic presentations of these three patients were described and compared with previous cases in literature. In addition, we presented the outcome of hormonal treatment for short stature in one patient. © 2015 Wiley Periodicals, Inc.

  5. Socioeconomic Status Index to Interpret Inequalities in Child Development

    PubMed Central

    AHMADI DOULABI, Mahbobeh; SAJEDI, Firoozeh; VAMEGHI, Roshanak; MAZAHERI, Mohammad Ali; AKBARZADEH BAGHBAN, Alireza

    2017-01-01

    Objective There have been contradictory findings on the relationship between Socioeconomic Status (SES) and child development although SES is associated with child development outcomes. The present study intended to define the relationship between SES and child development in Tehran kindergartens, Iran. Materials & Methods This cross-sectional survey studied 1036 children aged 36-60 month, in different kindergartens in Tehran City, Iran, in 2014-2015. The principal factor analysis (PFA) model was employed to construct SES indices. The constructed SES variable was employed as an independent variable in logistic regression model to evaluate its role in developmental delay as a dependent variable. Results The relationship between SES and developmental delay was significant at P=0.003. SES proved to have a significant (P<0.05) impact on developmental delay, both as an independent variable and after controlling risk factors. Conclusion There should be more emphasis on developmental monitoring and appropriate intervention programs for children to give them higher chance of having a more productive life. PMID:28698723

  6. Analysing growth and development of plants jointly using developmental growth stages

    PubMed Central

    Dambreville, Anaëlle; Lauri, Pierre-Éric; Normand, Frédéric; Guédon, Yann

    2015-01-01

    Background and Aims Plant growth, the increase of organ dimensions over time, and development, the change in plant structure, are often studied as two separate processes. However, there is structural and functional evidence that these two processes are strongly related. The aim of this study was to investigate the co-ordination between growth and development using mango trees, which have well-defined developmental stages. Methods Developmental stages, determined in an expert way, and organ sizes, determined from objective measurements, were collected during the vegetative growth and flowering phases of two cultivars of mango, Mangifera indica. For a given cultivar and growth unit type (either vegetative or flowering), a multistage model based on absolute growth rate sequences deduced from the measurements was first built, and then growth stages deduced from the model were compared with developmental stages. Key Results Strong matches were obtained between growth stages and developmental stages, leading to a consistent definition of integrative developmental growth stages. The growth stages highlighted growth asynchronisms between two topologically connected organs, namely the vegetative axis and its leaves. Conclusions Integrative developmental growth stages emphasize that developmental stages are closely related to organ growth rates. The results are discussed in terms of the possible physiological processes underlying these stages, including plant hydraulics, biomechanics and carbohydrate partitioning. PMID:25452250

  7. Predictors of receiving therapy among very low birth weight 2-year olds eligible for Part C early intervention in Wisconsin.

    PubMed

    McManus, Beth Marie; Robert, Stephanie; Albanese, Aggie; Sadek-Badawi, Mona; Palta, Mari

    2013-07-11

    The Individuals with Disabilities Education Act (Part C) authorizes states to establish systems to provide early intervention services (e.g., therapy) for children at risk, with the incentive of federal financial support. This study examines family and neighborhood characteristics associated with currently utilizing physical, occupational, or speech therapy among very low birthweight (VLBW) 2-year-old children who meet Wisconsin eligibility requirements for early intervention services (EI) due to developmental delay. This cross-sectional analysis used data from the Newborn Lung Project, a regional cohort study of VLBW infants hospitalized in Wisconsin's newborn intensive care units during 2003-2004. We included the 176 children who were age two at follow-up, and met Wisconsin state eligibility requirements for EI based on developmental delay. Exact logistic regression was used to describe child and neighborhood socio-demographic correlates of parent-reported receipt of therapy. Among VLBW children with developmental delay, currently utilizing therapy was higher among children with Medicaid (aOR = 5.3, 95% CI: 1.3, 28.3) and concomitant developmental disability (aOR = 5.2, 95% CI: 2.1, 13.3) and lower for those living in a socially more disadvantaged neighborhood (aOR=0.48, 95% CI: 0.21, 0.98, per tertile). Among a sample of VLBW 2-year olds with developmental delays who are EI-eligible in WI, 4 out of 5 were currently receiving therapy, per parent report. Participation in Medicaid positively influences therapy utilization. Children with developmental difficulties who live in socially disadvantaged neighborhoods are at highest risk for not receiving therapy.

  8. Growth dynamics and cytoskeleton organization during stem maturation and gravity-induced stem bending in Zea mays L

    NASA Technical Reports Server (NTRS)

    Collings, D. A.; Winter, H.; Wyatt, S. E.; Allen, N. S.; Davies, E. (Principal Investigator)

    1998-01-01

    Characterization of gravitropic bending in the maize stem pulvinus, a tissue that functions specifically in gravity responses, demonstrates that the pulvinus is an ideal system for studying gravitropism. Gravistimulation during the second of three developmental phases of the pulvinus induces a gradient of cell elongation across the non-growing cells of the pulvinus, with the most elongation occurring on the lower side. This cell elongation is spatially and temporally separated from normal internodal cell elongation. The three characterized growth phases in the pulvinus correspond closely to a specialized developmental sequence in which structural features typical of cells not fully matured are retained while cell maturation occurs in surrounding internodal and nodal tissue. For example, the lignification of supporting tissue and rearrangement of transverse microtubules to oblique that occur in the internode when cell elongation ceases are delayed for up to 10 d in the adjacent cells of the pulvinus, and only occurs as a pulvinus loses its capacity to respond to gravistimulation. Gravistimulation does not modify this developmental sequence. Neither wall lignification nor rearrangement of transverse microtubules occurs in the rapidly elongating lower side or non-responsive upper side of the pulvinus until the pulvinus loses the capacity to bend further. Gravistimulation does, however, lead to the formation of putative pit fields within the expanding cells of the pulvinus.

  9. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  10. Patterns of Early Skill Attainment and Loss in Young Children with Autism

    PubMed Central

    Thurm, Audrey; Manwaring, Stacy S.; Luckenbaugh, David A.; Lord, Catherine; Swedo, Susan E.

    2015-01-01

    The purpose of this study was to extend the literature on the ontogeny of autism spectrum disorder (ASD) by examining early attainment and loss of specific sociocommunicative skills in children with autism (AUT; n = 125), pervasive developmental disorder not otherwise specified (PDD-NOS; n = 42), nonspectrum developmental delays (n = 46), and typical development (n = 31). The ages of skill attainment and loss were obtained from a caregiver interview. The findings indicated that children with AUT, PDD-NOS, and developmental delays diverged from typically developing children in attainment of sociocommunicative skills early in the first year of life. Loss of at least one skill was reported in a majority of children with AUT and PDD-NOS. Significant delays in attainment of skills were also reported in children who lost skills. The wide variation in skill attainment and loss reported across children indicates that symptom onset and regression may be best represented continuously, with at least some early delay and loss present for a great majority of children with ASD. PMID:24274034

  11. Patterns of skill attainment and loss in young children with autism.

    PubMed

    Thurm, Audrey; Manwaring, Stacy S; Luckenbaugh, David A; Lord, Catherine; Swedo, Susan E

    2014-02-01

    The purpose of this study was to extend the literature on the ontogeny of autism spectrum disorder (ASD) by examining early attainment and loss of specific sociocommunicative skills in children with autism (AUT; n = 125), pervasive developmental disorder not otherwise specified (PDD-NOS; n = 42), nonspectrum developmental delays (n = 46), and typical development (n = 31). The ages of skill attainment and loss were obtained from a caregiver interview. The findings indicated that children with AUT, PDD-NOS, and developmental delays diverged from typically developing children in attainment of sociocommunicative skills early in the first year of life. Loss of at least one skill was reported in a majority of children with AUT and PDD-NOS. Significant delays in attainment of skills were also reported in children who lost skills. The wide variation in skill attainment and loss reported across children indicates that symptom onset and regression may be best represented continuously, with at least some early delay and loss present for a great majority of children with ASD.

  12. Peripheral Innervation in Children with Global Developmental Delay: Biomarker for Risk for Self-Injurious Behavior?

    PubMed Central

    Symons, Frank J.; Tervo, Raymond C.; Barney, Chantel C.; Damerow, John; Selim, Mona; McAdams, Brian; Foster, Shawn; Crabb, Gwen Wendelschafer; Kennedy, William

    2015-01-01

    The relation between somatosensory mechanisms and self-injury among children with neurological impairments associated with developmental delay is not well understood. We evaluated the feasibility of procuring skin biopsies to examine epidermal nerve fiber density and reported self-injury. Following informed parental consent, epidermal skin biopsies were obtained from a distal leg site with no pre-existing skin damage from 11 children with global developmental delay (55% male; mean age = 36.8 months, 17–63 mo.). Visual microscopic examination and quantitative analyses showed extremely high epidermal nerve fiber density values for some children. Children with reported self-injury (5/11) had significantly (p < 0.02) greater density values (138.8, sd = 45.5) than children without self-injury (80.5, sd = 17.5). Results from this novel immunohistological analysis of skin in very young children with neurodevelopmental delays suggests it may be a useful tool to study peripheral innervation as a possible sensory risk factor for self-injury. PMID:25918119

  13. Peripheral Innervation in Children With Global Developmental Delay: Biomarker for Risk for Self-Injurious Behavior?

    PubMed

    Symons, Frank J; Tervo, Raymond C; Barney, Chantel C; Damerow, John; Selim, Mona; McAdams, Brian; Foster, Shawn; Wendelschafer Crabb, Gwen; Kennedy, William

    2015-11-01

    The relation between somatosensory mechanisms and self-injury among children with neurologic impairments associated with developmental delay is not well understood. We evaluated the feasibility of procuring skin biopsies to examine epidermal nerve fiber density and reported self-injury. Following informed parental consent, epidermal skin biopsies were obtained from a distal leg site with no pre-existing skin damage from 11 children with global developmental delay (55% male; mean age = 36.8 months, 17-63 months). Visual microscopic examination and quantitative analyses showed extremely high epidermal nerve fiber density values for some children. Children with reported self-injury (5/11) had significantly (P < .02) greater density values (138.8, standard deviation = 45.5) than children without self-injury (80.5, standard deviation = 17.5). Results from this novel immunohistologic analysis of skin in very young children with neurodevelopmental delays suggest it may be a useful tool to study peripheral innervation as a possible sensory risk factor for self-injury. © The Author(s) 2015.

  14. Stage-Specific Plasticity in Ovary Size Is Regulated by Insulin/Insulin-Like Growth Factor and Ecdysone Signaling in Drosophila

    PubMed Central

    Mendes, Cláudia C.; Mirth, Christen K.

    2016-01-01

    Animals from flies to humans adjust their development in response to environmental conditions through a series of developmental checkpoints, which alter the sensitivity of organs to environmental perturbation. Despite their importance, we know little about the molecular mechanisms through which this change in sensitivity occurs. Here we identify two phases of sensitivity to larval nutrition that contribute to plasticity in ovariole number, an important determinant of fecundity, in Drosophila melanogaster. These two phases of sensitivity are separated by the developmental checkpoint called “critical weight”; poor nutrition has greater effects on ovariole number in larvae before critical weight than after. We find that this switch in sensitivity results from distinct developmental processes. In precritical weight larvae, poor nutrition delays the onset of terminal filament cell differentiation, the starting point for ovariole development, and strongly suppresses the rate of terminal filament addition and the rate of increase in ovary volume. Conversely, in postcritical weight larvae, poor nutrition affects only the rate of increase in ovary volume. Our results further indicate that two hormonal pathways, the insulin/insulin-like growth factor and the ecdysone-signaling pathways, modulate the timing and rates of all three developmental processes. The change in sensitivity in the ovary results from changes in the relative contribution of each pathway to the rates of terminal filament addition and increase in ovary volume before and after critical weight. Our work deepens our understanding of how hormones act to modify the sensitivity of organs to environmental conditions, thereby affecting their plasticity. PMID:26715667

  15. Early Effects of Responsivity Education/Prelinguistic Milieu Teaching for Children with Developmental Delays and Their Parents

    ERIC Educational Resources Information Center

    Fey, Marc E.; Warren, Steven F.; Brady, Nancy; Finestack, Lizbeth H.; Bredin-Oja, Shelley L.; Fairchild, Martha; Sokol, Shari; Yoder, Paul J.

    2006-01-01

    Purpose: To evaluate the efficacy of a 6-month course of responsivity education/prelinguistic milieu teaching (RE/PMT) for children with developmental delay and RE/PMT's effects on parenting stress in a randomized clinical trial. Method: Fifty-one children, age 24-33 months, with no more than 10 expressive words or signs, were randomly assigned to…

  16. Is Maternal Influenza or Fever During Pregnancy Associated with Autism or Developmental Delays? Results from the CHARGE (CHildhood Autism Risks from Genetics and Environment) Study

    ERIC Educational Resources Information Center

    Zerbo, Ousseny; Iosif, Ana-Maria; Walker, Cheryl; Ozonoff, Sally; Hansen, Robin L.; Hertz-Picciotto, Irva

    2013-01-01

    We analyzed data from case groups of 538 children with autism spectrum disorders (ASD) and 163 with developmental delays (DD), and from 421 typically developing controls to assess associations with maternal influenza or fever during pregnancy. Exposure information was obtained by telephone interviews, and outcomes were clinically confirmed. Though…

  17. Mothers' Perceived Physical Health during Early and Middle Childhood: Relations with Child Developmental Delay and Behavior Problems

    ERIC Educational Resources Information Center

    Eisenhower, Abbey; Blacher, Jan; Baker, Bruce L.

    2013-01-01

    The self-perceived physical health of mothers raising children with developmental delay (DD; N = 116) or typical development (TD; N = 129) was examined across child ages 3-9 years, revealing three main findings. First, mothers of children with DD experienced poorer self-rated physical health than mothers of children with TD at each age. Latent…

  18. The Effects of Constant Time Delay Embedded into Teaching Activities for Teaching the Names of Clothes for Preschool Children with Developmental Disabilities

    ERIC Educational Resources Information Center

    Odluyurt, Serhat

    2011-01-01

    The general purpose of this study was to examine the effectiveness of constant time delay embedded in activities for teaching clothes name for preschool children with developmental disabilities. This study included four participants having Down syndrome with an age range of 43-46 months. All experimental sessions were conducted in one to one…

  19. Parent Concern and Enrollment in Intervention Services for Young Children with Developmental Delays: 2007 National Survey of Children's Health

    ERIC Educational Resources Information Center

    Marshall, Jennifer; Kirby, Russell S.; Gorski, Peter A.

    2016-01-01

    This study sought to address underenrollment and late entry to early intervention by identifying factors associated with parental concern and services for developmental delays. The authors analyzed responses from 27,566 parents of children from birth to age 5 from the 2007 National Survey of Children's Health to quantify and to identify factors…

  20. Assessing the Effects of the "McGraw Hill Phonemic Awareness" Program with Preschool Children with Developmental Delays: A Case Study

    ERIC Educational Resources Information Center

    Isakson, Lisa; Marchand-Martella, Nancy; Martella, Ronald C.

    2011-01-01

    This study assessed the effects of "McGraw Hill Phonemic Awareness" on the phonemic awareness skills of 5 preschool children with developmental delays. The children received 60 of the 110 lessons included in this program over 5 months. They were pre- and posttested using the kindergarten level Initial Sound Fluency and Phoneme…

  1. The Impact of Short-Term Video Games on Performance among Children with Developmental Delays: A Randomized Controlled Trial

    PubMed Central

    Hsieh, Ru-Lan; Lee, Wen-Chung; Lin, Jui-Hsiang

    2016-01-01

    This prospective, randomized controlled study investigated the effects of short-term interactive video game playing among children with developmental delays participating in traditional rehabilitation treatment at a rehabilitation clinic. One hundred and one boys and 46 girls with a mean age of 5.8 years (range: 3 to 12 years) were enrolled in this study. All patients were confirmed to suffer from developmental delays, and were participating in traditional rehabilitation treatment. Children participated in two periods of 4 weeks each, group A being offered intervention of eight 30-minute sessions of interactive video games in the first period, and group B in the second, in addition to the traditional rehabilitation treatment. The physical, psychosocial, and total health of the children was periodically assessed using the parent-reported Pediatric Quality of Life Inventory-Generic Core Scales (PedsQL); and the children’s upper extremity and physical function, transfer and basic mobility, sports and physical functioning, and global functioning were assessed using the Pediatric Outcomes Data Collection Instrument. Parental impact was evaluated using the PedsQL-Family Impact Module for family function, PedsQL-Health Satisfaction questionnaire for parents’ satisfaction with their children’s care and World Health Organization-Quality of Life-Brief Version for quality of life. Compared with the baseline, significant improvements of physical function were observed in both groups (5.6 ± 19.5, p = 0.013; 4.7 ± 13.8, p = 0.009) during the intervention periods. No significant improvement of psychosocial health, functional performance, or family impact was observed in children with developmental delays. Short-term interactive video game play in conjunction with traditional rehabilitation treatment improved the physical health of children with developmental delays. Trial Registration: ClinicalTrials.gov NCT02184715 PMID:26983099

  2. The Impact of Short-Term Video Games on Performance among Children with Developmental Delays: A Randomized Controlled Trial.

    PubMed

    Hsieh, Ru-Lan; Lee, Wen-Chung; Lin, Jui-Hsiang

    2016-01-01

    This prospective, randomized controlled study investigated the effects of short-term interactive video game playing among children with developmental delays participating in traditional rehabilitation treatment at a rehabilitation clinic. One hundred and one boys and 46 girls with a mean age of 5.8 years (range: 3 to 12 years) were enrolled in this study. All patients were confirmed to suffer from developmental delays, and were participating in traditional rehabilitation treatment. Children participated in two periods of 4 weeks each, group A being offered intervention of eight 30-minute sessions of interactive video games in the first period, and group B in the second, in addition to the traditional rehabilitation treatment. The physical, psychosocial, and total health of the children was periodically assessed using the parent-reported Pediatric Quality of Life Inventory-Generic Core Scales (PedsQL); and the children's upper extremity and physical function, transfer and basic mobility, sports and physical functioning, and global functioning were assessed using the Pediatric Outcomes Data Collection Instrument. Parental impact was evaluated using the PedsQL-Family Impact Module for family function, PedsQL-Health Satisfaction questionnaire for parents' satisfaction with their children's care and World Health Organization-Quality of Life-Brief Version for quality of life. Compared with the baseline, significant improvements of physical function were observed in both groups (5.6 ± 19.5, p = 0.013; 4.7 ± 13.8, p = 0.009) during the intervention periods. No significant improvement of psychosocial health, functional performance, or family impact was observed in children with developmental delays. Short-term interactive video game play in conjunction with traditional rehabilitation treatment improved the physical health of children with developmental delays. ClinicalTrials.gov NCT02184715.

  3. Factors Influencing Institutional-Based Pediatric Rehabilitation Services among Caregivers of Children with Developmental Delay in Southwestern Rajasthan.

    PubMed

    Mishra, Kriti; Siddharth, V

    2018-01-01

    A limited number of caregivers of children with developmental delay access rehabilitation facilities in India. The study explored utilization of rehabilitation services at a tertiary care setup in southwestern Rajasthan and various factors influencing it. The aim of this study is to explore rehabilitation service utilization among children with developmental delay at a tertiary care setup and to ascertain factors that influence this pattern. This study was conducted at the department of physical medicine and rehabilitation at tertiary care setup. This was an observational study. Children with developmental delay who were advised institutional-based rehabilitation were identified over span of 1 year. Those who failed to return for rehabilitation after the first visit were interviewed telephonically. The interview had semi-structured open-ended questions about their reasons for inability to avail services. SPSS statistics 22 was used for descriptive analysis and correlation of variables. Of 230 children with developmental delay visiting department in 1-year duration, 48 took regular rehabilitation. Parents of 129 children with complete records were asked regarding discontinuation. Factors cited by majority were long distance from institute and service at hospital. Other reasons for discontinuation were related to belief system, family issues, time issues, socioeconomic factors, etc. Socioeconomic status was significantly associated with parental education (C = 0.488, P = 0.000) and financial issues. Location of family had significant association with long distance (C = 0.315, P = 0.000), parental education (C = 0.251, P = 0.003), and belief system (C = 0.265, P = 0.002). Distance from institute and quality of hospital service determined rehabilitation service use at a tertiary institute. Other factors such as socioeconomic status, family support, and social belief system must also be addressed while delivering institutional rehabilitation to children.

  4. Wiedemann-Steiner Syndrome With 2 Novel KMT2A Mutations.

    PubMed

    Min Ko, Jung; Cho, Jae So; Yoo, Yongjin; Seo, Jieun; Choi, Murim; Chae, Jong-Hee; Lee, Hye-Ran; Cho, Tae-Joon

    2017-02-01

    Wiedemann-Steiner syndrome is a rare genetic disorder characterized by short stature, hairy elbows, facial dysmorphism, and developmental delay. It can also be accompanied by musculoskeletal anomalies such as muscular hypotonia and small hands and feet. Mutations in the KMT2A gene have only recently been identified as the cause of Wiedemann-Steiner syndrome; therefore, only 16 patients from 15 families have been described, and new phenotypic features continue to be added. In this report, we describe 2 newly identified patients with Wiedemann-Steiner syndrome who presented with variable severity. One girl exhibited developmental dysplasia of the hip and fibromatosis colli accompanied by other clinical features, including facial dysmorphism, hypertrichosis, patent ductus arteriosus, growth retardation, and borderline intellectual disability. The other patient, a boy, showed severe developmental retardation with automatic self-mutilation, facial dysmorphism, and hypertrichosis at a later age. Exome sequencing analysis of these patients and their parents revealed a de novo nonsense mutation, p.Gln1978*, of KMT2A in the former, and a missense mutation, p.Gly1168Asp, in the latter, which molecularly confirmed the diagnosis of Wiedemann-Steiner syndrome.

  5. Germline mutations affecting the histone H4 core cause a developmental syndrome by altering DNA damage response and cell cycle control.

    PubMed

    Tessadori, Federico; Giltay, Jacques C; Hurst, Jane A; Massink, Maarten P; Duran, Karen; Vos, Harmjan R; van Es, Robert M; Scott, Richard H; van Gassen, Koen L I; Bakkers, Jeroen; van Haaften, Gijs

    2017-11-01

    Covalent modifications of histones have an established role as chromatin effectors, as they control processes such as DNA replication and transcription, and repair or regulate nucleosomal structure. Loss of modifications on histone N tails, whether due to mutations in genes belonging to histone-modifying complexes or mutations directly affecting the histone tails, causes developmental disorders or has a role in tumorigenesis. More recently, modifications affecting the globular histone core have been uncovered as being crucial for DNA repair, pluripotency and oncogenesis. Here we report monoallelic missense mutations affecting lysine 91 in the histone H4 core (H4K91) in three individuals with a syndrome of growth delay, microcephaly and intellectual disability. Expression of the histone H4 mutants in zebrafish embryos recapitulates the developmental anomalies seen in the patients. We show that the histone H4 alterations cause genomic instability, resulting in increased apoptosis and cell cycle progression anomalies during early development. Mechanistically, our findings indicate an important role for the ubiquitination of H4K91 in genomic stability during embryonic development.

  6. Analysing growth and development of plants jointly using developmental growth stages.

    PubMed

    Dambreville, Anaëlle; Lauri, Pierre-Éric; Normand, Frédéric; Guédon, Yann

    2015-01-01

    Plant growth, the increase of organ dimensions over time, and development, the change in plant structure, are often studied as two separate processes. However, there is structural and functional evidence that these two processes are strongly related. The aim of this study was to investigate the co-ordination between growth and development using mango trees, which have well-defined developmental stages. Developmental stages, determined in an expert way, and organ sizes, determined from objective measurements, were collected during the vegetative growth and flowering phases of two cultivars of mango, Mangifera indica. For a given cultivar and growth unit type (either vegetative or flowering), a multistage model based on absolute growth rate sequences deduced from the measurements was first built, and then growth stages deduced from the model were compared with developmental stages. Strong matches were obtained between growth stages and developmental stages, leading to a consistent definition of integrative developmental growth stages. The growth stages highlighted growth asynchronisms between two topologically connected organs, namely the vegetative axis and its leaves. Integrative developmental growth stages emphasize that developmental stages are closely related to organ growth rates. The results are discussed in terms of the possible physiological processes underlying these stages, including plant hydraulics, biomechanics and carbohydrate partitioning. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

    PubMed Central

    Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

    2017-01-01

    Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

  8. Can one hour per week of therapy lead to lasting changes in young children with autism?

    PubMed

    Vismara, Laurie A; Colombi, Costanza; Rogers, Sally J

    2009-01-01

    Deficits in attention, communication, imitation, and play skills reduce opportunities for children with autism to learn from natural interactive experiences that occur throughout the day. These developmental delays are already present by the time these children reach the toddler period. The current study provided a brief 12 week, 1 hour per week, individualized parent-child education program to eight toddlers newly diagnosed with autism. Parents learned to implement naturalistic therapeutic techniques from the Early Start Denver Model, which fuses developmental- and relationship-based approaches with Applied Behavior Analysis into their ongoing family routines and parent-child play activities. Results demonstrated that parents acquired the strategies by the fifth to sixth hour and children demonstrated sustained change and growth in social communication behaviors. Findings are discussed in relation to providing parents with the necessary tools to engage, communicate with, and teach their young children with autism beginning immediately after the diagnosis.

  9. Cornelia de Lange syndrome: a case study.

    PubMed

    Kalal, Goud Iravathy; Raina, Vimarsh P; Nayak, Veerabhadra S; Teotia, Pooja; Gupta, Bhushan V

    2009-02-01

    Cornelia de Lange syndrome (CDLS) is a relatively common multiple congenital anomaly/mental retardation disorder with an unknown genetic and molecular pathogenesis. The essential features of this developmental malformation syndrome are retardation in growth, developmental delay, various structural limb abnormalities, and distinctive facial features. Most cases are sporadic and are thought to result from a new dominant mutation. Consequently, hypotheses regarding the pathogenetic mechanisms underlying the two distinct phenotypes, classic and mild, are purely speculative. The recent discovery of molecular techniques and identification of the NIPBL gene has allowed etiologic diagnosis of this disorder. In this article, we describe a patient with CDLS in whom conventional cytogenetics, fluorescence in situ hybridization, and NIPBL gene mutation analysis determined an etiologic diagnosis, providing precise genetic counseling and facilitated the family to make an evidence-based decision for conception and also alleviated the extreme degree of anxiety associated with the thought of having a second child in this set of circumstances.

  10. Hormones and Human and Nonhuman Primate Growth.

    PubMed

    Bernstein, Robin Miriam

    2017-01-01

    The aim of this paper was to review information pertaining to the hormonal regulation of nonhuman primate growth, with specific focus on the growth hormone (GH)-insulin-like growth factor (IGF) axis and adrenal androgens. Hormones of the GH-IGF axis are consistently associated with measures of growth - linear, weight, or both - during the growth period; in adulthood, concentrations of IGF-I, IGF-binding protein-3, and GH-binding protein are not associated with any measures of size. Comparing patterns of dehydroepiandrosterone (DHEA) and DHEA sulfate (DHEAS) may be especially relevant for understanding whether the childhood stage of growth and development is unique to humans and perhaps other apes. Genetic, hormonal, and morphological data on adrenarche in other nonhuman primate species suggest that this endocrine transition is delayed in humans, chimpanzees, and possibly gorillas, while present very early in postnatal life in macaques. This suggests that although perhaps permitted by an extension of the pre-adolescent growth period, childhood builds upon existing developmental substrates rather than having been inserted de novo into an ancestral growth trajectory. Hormones can provide insight regarding the evolution of the human growth trajectory. © 2017 S. Karger AG, Basel.

  11. The effect of adding a home program to weekly institutional-based therapy for children with undefined developmental delay: a pilot randomized clinical trial.

    PubMed

    Tang, Mei-Hua; Lin, Chin-Kai; Lin, Wen-Hsien; Chen, Chao-Huei; Tsai, Sen-Wei; Chang, Yin-Yi

    2011-06-01

    Early rehabilitation for children with developmental delay without a defined etiology have included home and clinic programs, but no comparisons have been made and efficacy is uncertain. We compared a weekly visit for institutional-based therapy (IT) to IT plus a structured home activity program (HAP). Seventy children who were diagnosed with motor or global developmental delay (ages 6-48 months and mean developmental age 12.5 months) without defined etiology were recruited (including 45 males and 23 females). The outcomes included the comprehensive developmental inventory for infants and toddlers test and the pediatric evaluation of disability inventory. Children who received only IT improved in developmental level by 2.11 months compared with 3.11 months for those who received a combination of IT and HAP (p = 0.000). On all domains of the comprehensive developmental inventory for infants and toddlers test, except for self-help, children who participated in HAP showed greater improvements, including in cognition (p = 0.015), language (p = 0.010), motor (p = 0.000), and social (p = 0.038) domains. Except on the subdomain of self-care with caregiver assistance, the HAP group showed greater improvement in all the pediatric evaluation of disability inventory subdomains (p < 0.05). Early intervention programs are helpful for these children, and the addition of structured home activity programs may augment the effects on developmental progression. Copyright © 2011. Published by Elsevier B.V.

  12. The Differential Effects of the Use of Handwriting without Tears® Modified Gray Block Paper to Teach Two Preschool Students with Developmental Delays Capital Letter Writing Skills

    ERIC Educational Resources Information Center

    Griffith, Jessica; McLaughlin, T. F.; Neyman, Jen; Donica, Denise K.; Robison, Milena

    2013-01-01

    The purpose of this study was to evaluate and measure the effectiveness of Handwriting Without Tears (HWT) modified gray block paper with letter writing on two preschool students diagnosed with developmental delays in pre-academics. Two students were selected from a self-contained special education preschool classroom in the Pacific Northwest. All…

  13. Brief Report: Effects of Pressure Vest Usage on Engagement and Problem Behaviors of a Young Child with Developmental Delays

    ERIC Educational Resources Information Center

    Reichow, Brian; Barton, Erin E.; Good, Leslie; Wolery, Mark

    2009-01-01

    The purpose of this study was to examine the effects of wearing a pressure vest for a young boy with developmental delays. An A-B-A withdrawal design was used to examine the relation between wearing the pressure vest and child behaviors during a preschool art activity. Although the data showed moderate variability, no systematic differences were…

  14. Increasing the vocal responses of children with autism and developmental disabilities using manual sign mand training and prompt delay.

    PubMed

    Carbone, Vincent J; Sweeney-Kerwin, Emily J; Attanasio, Vivian; Kasper, Tamara

    2010-01-01

    The purpose of this study was to determine the effect of manual sign mand training combined with prompt delay and vocal prompting on the production of vocal responses in nonvocal children with developmental disabilities. A multiple baseline design across participants verified the effectiveness of this intervention. All participants showed increases in vocal responses following the implementation of the independent variables.

  15. Joint attention revisited: Finding strengths among children with autism.

    PubMed

    Hurwitz, Sarah; Watson, Linda R

    2016-07-01

    Differences in joint attention are prominent for some children with autism and are often used as an indicator of the disorder. This study examined the joint attention competencies of young children with autism who demonstrated joint attention ability and compared them to children with developmental delays. A total of 40 children with autism and developmental delays were matched pairwise based on mental and chronological age. Videos of children engaging in play were coded for the frequency and forms (eye contact, gestures, affect, etc.) of joint attention. Additionally, concurrent language was compared among children with autism (N = 32) by their joint attention ability. Children with autism spectrum disorder entered into joint attention significantly less often than children with developmental delays, but once engaged used the forms of joint attention similarly. For the matched pairs, there were no differences in language, but the children with autism who used joint attention had significantly better language than children with autism who did not (even after controlling for mental age). There is a group of young children with autism who can use joint attention but do so at lower frequencies than children with developmental delays. Possible reasons include difficulty disengaging attention and limited intrinsic social motivation to share. Adult persistence is recommended to encourage joint attention. © The Author(s) 2015.

  16. Development in children with achondroplasia: a prospective clinical cohort study.

    PubMed

    Ireland, Penelope J; Donaghey, Samantha; McGill, James; Zankl, Andreas; Ware, Robert S; Pacey, Verity; Ault, Jenny; Savarirayan, Ravi; Sillence, David; Thompson, Elizabeth; Townshend, Sharron; Johnston, Leanne M

    2012-06-01

    Achondroplasia is characterized by delays in the development of communication and motor skills. While previously reported developmental profiles exist across gross motor, fine motor, feeding, and communication skills, there has been no prospective study of development across multiple areas simultaneously. This Australasian population-based study utilized a prospective questionnaire to quantify developmental data for skills in children born from 2000 to 2009. Forty-eight families from Australia and New Zealand were asked to report every 3 months on their child's attainment of 41 milestones. Results include reference to previously available prospective information. Information from questionnaires was used to develop an achondroplasia-specific developmental recording form. The 25th, 50th, 75th, and 90th centiles were plotted to offer clear guidelines for development across gross motor, fine motor, feeding, and communication skills in children with achondroplasia. Consistent with results from previous research, children with achondroplasia are delayed in development of gross motor and ambulatory skills. Young children with achondroplasia demonstrate a number of unique movement strategies that appear compensatory for the biomechanical changes. While delays were seen in development of later communication items, there were fewer delays seen across development of early communication, fine motor, and feeding skills. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

  17. Short-term family-centered workshop for children with developmental delays enhances family functioning and satisfaction: A prospective clinical trial.

    PubMed

    Hsieh, Ru-Lan; Hsieh, Wen-Huei; Lee, Wen-Chung

    2016-08-01

    We investigated the clinical efficacy on family functioning and parental satisfaction of a short-term family-centered workshop for children with developmental delays.A total of 32 children with developmental delays and their parents participated in 2-hour weekly group therapy sessions over 6 weeks. The workshop was conducted by rehabilitation professionals and teachers using a family-centered multidisciplinary approach. Both before and after the 6-week workshop, the parents were administered the Pediatric Quality of Life Inventory (PedsQL) Family Impact Module, the PedsQL Healthcare Satisfaction Module, the Hospital Anxiety and Depression Scale, and the World Health Organization Quality of Life brief assessment instrument. Overall satisfaction with the workshop was also evaluated.Significant improvements were noted in physical aspect (P = 0.03), communication (P = 0.002), and daily activities (P = 0.04) in the PedsQL Family Impact Module, and in communication (P = 0.03) and technical skills (P = 0.05) in the PedsQL Healthcare Satisfaction Module. Overall satisfaction with the workshop was rated as very high. There was no significant effect on psychological distress or quality of life.Short-term family-centered workshops for children with developmental delays improved family functioning and the parental perception of satisfaction, including health care satisfaction.

  18. Distinct cerebellar foliation anomalies in a CHD7 haploinsufficient mouse model of CHARGE syndrome.

    PubMed

    Whittaker, Danielle E; Kasah, Sahrunizam; Donovan, Alex P A; Ellegood, Jacob; Riegman, Kimberley L H; Volk, Holger A; McGonnell, Imelda; Lerch, Jason P; Basson, M Albert

    2017-12-01

    Mutations in the gene encoding the ATP dependent chromatin-remodeling factor, CHD7 are the major cause of CHARGE (Coloboma, Heart defects, Atresia of the choanae, Retarded growth and development, Genital-urinary anomalies, and Ear defects) syndrome. Neurodevelopmental defects and a range of neurological signs have been identified in individuals with CHARGE syndrome, including developmental delay, lack of coordination, intellectual disability, and autistic traits. We previously identified cerebellar vermis hypoplasia and abnormal cerebellar foliation in individuals with CHARGE syndrome. Here, we report mild cerebellar hypoplasia and distinct cerebellar foliation anomalies in a Chd7 haploinsufficient mouse model. We describe specific alterations in the precise spatio-temporal sequence of fissure formation during perinatal cerebellar development responsible for these foliation anomalies. The altered cerebellar foliation pattern in Chd7 haploinsufficient mice show some similarities to those reported in mice with altered Engrailed, Fgf8 or Zic1 gene expression and we propose that mutations or polymorphisms in these genes may modify the cerebellar phenotype in CHARGE syndrome. Our findings in a mouse model of CHARGE syndrome indicate that a careful analysis of cerebellar foliation may be warranted in patients with CHARGE syndrome, particularly in patients with cerebellar hypoplasia and developmental delay. © 2017 The Authors. American Journal of Medical Genetics Part C Published by Wiley Periodicals, Inc.

  19. Predictors of receiving therapy among very low birth weight 2-year olds eligible for Part C early intervention in Wisconsin

    PubMed Central

    2013-01-01

    Background The Individuals with Disabilities Education Act (Part C) authorizes states to establish systems to provide early intervention services (e.g., therapy) for children at risk, with the incentive of federal financial support. This study examines family and neighborhood characteristics associated with currently utilizing physical, occupational, or speech therapy among very low birthweight (VLBW) 2-year-old children who meet Wisconsin eligibility requirements for early intervention services (EI) due to developmental delay. Methods This cross-sectional analysis used data from the Newborn Lung Project, a regional cohort study of VLBW infants hospitalized in Wisconsin’s newborn intensive care units during 2003–2004. We included the 176 children who were age two at follow-up, and met Wisconsin state eligibility requirements for EI based on developmental delay. Exact logistic regression was used to describe child and neighborhood socio-demographic correlates of parent-reported receipt of therapy. Results Among VLBW children with developmental delay, currently utilizing therapy was higher among children with Medicaid (aOR = 5.3, 95% CI: 1.3, 28.3) and concomitant developmental disability (aOR = 5.2, 95% CI: 2.1, 13.3) and lower for those living in a socially more disadvantaged neighborhood (aOR=0.48, 95% CI: 0.21, 0.98, per tertile). Conclusions Among a sample of VLBW 2-year olds with developmental delays who are EI-eligible in WI, 4 out of 5 were currently receiving therapy, per parent report. Participation in Medicaid positively influences therapy utilization. Children with developmental difficulties who live in socially disadvantaged neighborhoods are at highest risk for not receiving therapy. PMID:23845161

  20. RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

    PubMed Central

    Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

    2017-01-01

    Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

  1. What an otolaryngologist should know about evaluation of a child referred for delay in speech development.

    PubMed

    Tonn, Christopher R; Grundfast, Kenneth M

    2014-03-01

    Otolaryngologists are asked to evaluate children who a parent, physician, or someone else believes is slow in developing speech. Therefore, an otolaryngologist should be familiar with milestones for normal speech development, the causes of delay in speech development, and the best ways to help assure that children develop the ability to speak in a normal way. To provide information for otolaryngologists that is helpful in the evaluation and management of children perceived to be delayed in developing speech. Data were obtained via literature searches, online databases, textbooks, and the most recent national guidelines on topics including speech delay and language delay and the underlying disorders that can cause delay in developing speech. Emphasis was placed on epidemiology, pathophysiology, most common presentation, and treatment strategies. Most of the sources referenced were published within the past 5 years. Our article is a summary of major causes of speech delay based on reliable sources as listed herein. Speech delay can be the manifestation of a spectrum of disorders affecting the language comprehension and/or speech production pathways, ranging from disorders involving global developmental limitations to motor dysfunction to hearing loss. Determining the cause of a child's delay in speech production is a time-sensitive issue because a child loses valuable opportunities in intellectual development if his or her communication defect is not addressed and ameliorated with treatment. Knowing several key items about each disorder can help otolaryngologists direct families to the correct health care provider to maximize the child's learning potential and intellectual growth curve.

  2. Life cycle stage and water depth affect flooding-induced adventitious root formation in the terrestrial species Solanum dulcamara

    PubMed Central

    Zhang, Qian; Visser, Eric J. W.; de Kroon, Hans; Huber, Heidrun

    2015-01-01

    Background and Aims Flooding can occur at any stage of the life cycle of a plant, but often adaptive responses of plants are only studied at a single developmental stage. It may be anticipated that juvenile plants may respond differently from mature plants, as the amount of stored resources may differ and morphological changes can be constrained. Moreover, different water depths may require different strategies to cope with the flooding stress, the expression of which may also depend on developmental stage. This study investigated whether flooding-induced adventitious root formation and plant growth were affected by flooding depth in Solanum dulcamara plants at different developmental stages. Methods Juvenile plants without pre-formed adventitious root primordia and mature plants with primordia were subjected to shallow flooding or deep flooding for 5 weeks. Plant growth and the timing of adventitious root formation were monitored during the flooding treatments. Key Results Adventitious root formation in response to shallow flooding was significantly constrained in juvenile S. dulcamara plants compared with mature plants, and was delayed by deep flooding compared with shallow flooding. Complete submergence suppressed adventitious root formation until up to 2 weeks after shoots restored contact with the atmosphere. Independent of developmental stage, a strong positive correlation was found between adventitious root formation and total biomass accumulation during shallow flooding. Conclusions The potential to deploy an escape strategy (i.e. adventitious root formation) may change throughout a plant’s life cycle, and is largely dependent on flooding depth. Adaptive responses at a given stage of the life cycle thus do not necessarily predict how the plant responds to flooding in another growth stage. As variation in adventitious root formation also correlates with finally attained biomass, this variation may form the basis for variation in resistance to shallow flooding among plants. PMID:26105188

  3. Life cycle stage and water depth affect flooding-induced adventitious root formation in the terrestrial species Solanum dulcamara.

    PubMed

    Zhang, Qian; Visser, Eric J W; de Kroon, Hans; Huber, Heidrun

    2015-08-01

    Flooding can occur at any stage of the life cycle of a plant, but often adaptive responses of plants are only studied at a single developmental stage. It may be anticipated that juvenile plants may respond differently from mature plants, as the amount of stored resources may differ and morphological changes can be constrained. Moreover, different water depths may require different strategies to cope with the flooding stress, the expression of which may also depend on developmental stage. This study investigated whether flooding-induced adventitious root formation and plant growth were affected by flooding depth in Solanum dulcamara plants at different developmental stages. Juvenile plants without pre-formed adventitious root primordia and mature plants with primordia were subjected to shallow flooding or deep flooding for 5 weeks. Plant growth and the timing of adventitious root formation were monitored during the flooding treatments. Adventitious root formation in response to shallow flooding was significantly constrained in juvenile S. dulcamara plants compared with mature plants, and was delayed by deep flooding compared with shallow flooding. Complete submergence suppressed adventitious root formation until up to 2 weeks after shoots restored contact with the atmosphere. Independent of developmental stage, a strong positive correlation was found between adventitious root formation and total biomass accumulation during shallow flooding. The potential to deploy an escape strategy (i.e. adventitious root formation) may change throughout a plant's life cycle, and is largely dependent on flooding depth. Adaptive responses at a given stage of the life cycle thus do not necessarily predict how the plant responds to flooding in another growth stage. As variation in adventitious root formation also correlates with finally attained biomass, this variation may form the basis for variation in resistance to shallow flooding among plants. © The Author 2015. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Childhood cognitive development after fetal growth restriction.

    PubMed

    Llurba, E; Baschat, A A; Turan, O M; Harding, J; McCowan, L M

    2013-04-01

    To examine the relationship between prenatal umbilical artery (UA) and internal carotid artery (ICA) Doppler findings and cognitive development at 3 and 6 years in low-birth-weight children. This was a study of 209 low-birth-weight (< 10(th) centile) children born after 28 gestational weeks with UA resistance index (RI) measured within 2 weeks before delivery. Children with normal UA- and ICA-RI were defined as small-for-gestational age (SGA) and those with abnormal UA or ICA Doppler findings as having fetal growth restriction (FGR). Cognitive ability at 3 and 6 years' corrected age was assessed using the fourth edition of the Stanford-Binet Intelligence Scale (SBIS) and compared between SGA and FGR groups. An SBIS score < 85 was considered to indicate delayed development. The median gestational age at diagnosis of abnormal fetal growth was 36.6 (range, 28-41) weeks. There were 87 (41.6%) children classified as having FGR and 122 (58.4%) as SGA. The mean global SBIS score at 3 years was 109.4 (SD, 22.8) and at 6 years it was 110.5 (SD, 13.9). Overall, 22 (10.5%) children had delayed development at 3 years. Total SBIS scores and individual domain scores did not differ between FGR and SGA groups at 3 or 6 years and similar proportions in each group had delayed development. Abnormal prenatal UA and ICA Doppler findings are not associated with lower developmental scores in low-birth-weight children delivered in the third trimester of pregnancy. Copyright © 2013 ISUOG. Published by John Wiley & Sons, Ltd.

  5. Post-discharge body weight and neurodevelopmental outcomes among very low birth weight infants in Taiwan: A nationwide cohort study.

    PubMed

    Hsu, Chung-Ting; Chen, Chao-Huei; Lin, Ming-Chih; Wang, Teh-Ming; Hsu, Ya-Chi

    2018-01-01

    Premature infants are at high risk for developmental delay and cognitive dysfunction. Besides medical conditions, growth restriction is regarded as an important risk factor for cognitive and neurodevelopmental dysfunction throughout childhood and adolescence and even into adulthood. In this study, we analyzed the relationship between post-discharge body weight and psychomotor development using a nationwide dataset. This was a nationwide cohort study conducted in Taiwan. Total of 1791 premature infants born between 2007 and 2011 with a birth weight of less than 1500 g were enrolled into this multi-center study. The data were obtained from the Taiwan Premature Infant Developmental Collaborative Study Group. The growth and neurodevelopmental evaluations were performed at corrected ages of 6, 12 and 24 months. Post-discharge failure to thrive was defined as a body weight below the 3rd percentile of the standard growth curve for Taiwanese children by the corrected age. The prevalence of failure to thrive was 15.8%, 16.9%, and 12.0% at corrected ages of 6, 12, and 24 months, respectively. At corrected ages of 24 months, 12.9% had low Mental Developmental Index (MDI) scores (MDI<70), 17.8% had low Psychomotor Developmental Index (PDI) scores (PDI<70), 12.7% had cerebral palsy, and 29.5% had neurodevelopmental impairment. Post-discharge failure to thrive was significantly associated with poor neurodevelopmental outcomes. After controlling for potential confounding factors (small for gestational age, extra-uterine growth retardation at discharge, cerebral palsy, gender, mild intraventricular hemorrhage, persistent pulmonary hypertension of newborn, respiratory distress syndrome, chronic lung disease, hemodynamic significant patent ductus arteriosus, necrotizing enterocolitis, surfactant use and indomethacin use), post-discharge failure to thrive remained a risk factor. This observational study observed the association between lower body weight at corrected age of 6, 12, and 24 months and poor neurodevelopmental outcomes among VLBW premature infants. There are many adverse factors which can influence the neurodevelopment in NICU care. More studies are needed to elucidate the causal relationship.

  6. Post-discharge body weight and neurodevelopmental outcomes among very low birth weight infants in Taiwan: A nationwide cohort study

    PubMed Central

    Hsu, Chung-Ting; Chen, Chao-Huei; Wang, Teh-Ming; Hsu, Ya-Chi

    2018-01-01

    Background Premature infants are at high risk for developmental delay and cognitive dysfunction. Besides medical conditions, growth restriction is regarded as an important risk factor for cognitive and neurodevelopmental dysfunction throughout childhood and adolescence and even into adulthood. In this study, we analyzed the relationship between post-discharge body weight and psychomotor development using a nationwide dataset. Materials and methods This was a nationwide cohort study conducted in Taiwan. Total of 1791 premature infants born between 2007 and 2011 with a birth weight of less than 1500 g were enrolled into this multi-center study. The data were obtained from the Taiwan Premature Infant Developmental Collaborative Study Group. The growth and neurodevelopmental evaluations were performed at corrected ages of 6, 12 and 24 months. Post-discharge failure to thrive was defined as a body weight below the 3rd percentile of the standard growth curve for Taiwanese children by the corrected age. Results The prevalence of failure to thrive was 15.8%, 16.9%, and 12.0% at corrected ages of 6, 12, and 24 months, respectively. At corrected ages of 24 months, 12.9% had low Mental Developmental Index (MDI) scores (MDI<70), 17.8% had low Psychomotor Developmental Index (PDI) scores (PDI<70), 12.7% had cerebral palsy, and 29.5% had neurodevelopmental impairment. Post-discharge failure to thrive was significantly associated with poor neurodevelopmental outcomes. After controlling for potential confounding factors (small for gestational age, extra-uterine growth retardation at discharge, cerebral palsy, gender, mild intraventricular hemorrhage, persistent pulmonary hypertension of newborn, respiratory distress syndrome, chronic lung disease, hemodynamic significant patent ductus arteriosus, necrotizing enterocolitis, surfactant use and indomethacin use), post-discharge failure to thrive remained a risk factor. Conclusion This observational study observed the association between lower body weight at corrected age of 6, 12, and 24 months and poor neurodevelopmental outcomes among VLBW premature infants. There are many adverse factors which can influence the neurodevelopment in NICU care. More studies are needed to elucidate the causal relationship. PMID:29444139

  7. Chronic Effects of Fluoride Exposure on Growth, Metamorphosis, and Skeleton Development in Bufo gargarizans Larvae.

    PubMed

    Chai, Lihong; Wang, Hongyuan; Zhao, Hongfeng; Dong, Suiming

    2017-04-01

    Bufo gargarizans tadpoles were chronically exposed to waterborne fluoride at measured concentrations ranging from 0.4 to 61.2 mg F - /L for 70 days from Gosner stage 26 to completion of metamorphosis. The chronic exposure caused a concentration-dependent mortality in all tested fluoride concentrations. Total length, snout-to-vent length (SVL), body mass, and developmental stage of tadpoles were significantly inhibited at 42.6 mg F - /L. In addition, significant metamorphic delay and increase in size at completion of metamorphosis occurred after exposure to 19.8 mg F - /L. Moreover, 19.8 mg F - /L suppressed the bone mineralization of larvae at completion of metamorphosis. However, the bone mineralization could be enhanced by 4.1 mg F - /L. In conclusion, our results suggested that the presence of high concentrations of fluoride could increase mortality risk, delay metamorphosis, and suppress skeletal ossification in B. gargarizans larvae.

  8. Blocking VEGF signaling delays development of replacement teeth in zebrafish.

    PubMed

    Crucke, J; Huysseune, A

    2015-01-01

    The dentition in zebrafish is extremely and richly vascularized, but the function of the vasculature, in view of the continuous replacement of the teeth, remains elusive. Through application of SU5416, a vascular endothelial growth factor receptor inhibitor, we studied the role of the blood vessels in the dentition of the zebrafish. We were unable to show an effect on the development of first-generation teeth as well as first tooth replacement. However, in juvenile fish, a delay was observed in the developmental state of the replacement tooth compared with what was expected based on the maturation state of the functional tooth. Furthermore, we observed a difference between treated and nontreated fish in the distance between blood vessels and developing replacement teeth. In conclusion, our results provide support for a nutritive, rather than an inductive, function of the vasculature in the process of tooth development and replacement. © International & American Associations for Dental Research 2014.

  9. [Cornelia de Lange Syndrome and multiple hormonal deficiency, an unusual association. Clinical case].

    PubMed

    Mora-Bautista, Víctor M; Mendoza-Rojas, Víctor; Contreras-García, Gustavo A

    2017-06-01

    Cornelia de Lange syndrome is a genetic disease characterized by distinctive facial features, failure to thrive, microcephaly and several malformations associated. Its main endocrinological features are anomalies of the genitalia. We present a 13-year-old boy, who suffered from complicated aspiration pneumonia and showed Cornelia de Lange syndrome phenotype, with global developmental delay, suction-swallowing abnormalities, short stature and abnormal genitalia associated. His bone age was delayed, so he underwent full endocrinological panel. Central hypothyroidism, growth hormone deficiency and low luteinizing hormone-follicle-stimulating hormone levels were observed and multiple pituitary hormone deficiencies diagnosis was made. Basal cortisol, adrenocorticotropic hormone and prolactin levels were normal. He received thyroid hormonal substitution. Multiple pituitary hormone deficiencies are an unusual feature of De Lange syndrome. We suggest evaluating all different endocrine axes in these patients. Sociedad Argentina de Pediatría.

  10. Delayed phenotypic expression of growth hormone transgenesis during early ontogeny in Atlantic salmon (Salmo salar)?

    PubMed

    Moreau, Darek T R; Gamperl, A Kurt; Fletcher, Garth L; Fleming, Ian A

    2014-01-01

    Should growth hormone (GH) transgenic Atlantic salmon escape, there may be the potential for ecological and genetic impacts on wild populations. This study compared the developmental rate and respiratory metabolism of GH transgenic and non-transgenic full sibling Atlantic salmon during early ontogeny; a life history period of intense selection that may provide critical insight into the fitness consequences of escaped transgenics. Transgenesis did not affect the routine oxygen consumption of eyed embryos, newly hatched larvae or first-feeding juveniles. Moreover, the timing of early life history events was similar, with transgenic fish hatching less than one day earlier, on average, than their non-transgenic siblings. As the start of exogenous feeding neared, however, transgenic fish were somewhat developmentally behind, having more unused yolk and being slightly smaller than their non-transgenic siblings. Although such differences were found between transgenic and non-transgenic siblings, family differences were more important in explaining phenotypic variation. These findings suggest that biologically significant differences in fitness-related traits between GH transgenic and non-transgenic Atlantic salmon were less than family differences during the earliest life stages. The implications of these results are discussed in light of the ecological risk assessment of genetically modified animals.

  11. Using the Autism Diagnostic Interview-Revised and the Autism Diagnostic Observation Schedule with Young Children with Developmental Delay: Evaluating Diagnostic Validity

    ERIC Educational Resources Information Center

    Gray, Kylie M.; Tonge, Bruce J.; Sweeney, Deborah J.

    2008-01-01

    Few studies have focused on the validity of the ADI-R and ADOS in the assessment of preschool children with developmental delay. This study aimed to evaluate the diagnostic validity of the ADI-R and the ADOS in young children. Two-hundred and nine children aged 20-55 months participated in the study, 120 of whom received a diagnosis of autism.…

  12. Mitigating the Effects of Poverty and Crime: The Long-Term Effects of an Early Intervention Programme for Children Who Were Developmentally Delayed and Prenatally Exposed to Cocaine

    ERIC Educational Resources Information Center

    Ullery, Mary Anne; Gonzalez, Antonio; Katz, Lynne

    2016-01-01

    This study explores the long-term impact on participation in the Linda Ray Intervention Program (LRIP) for children (n = 54) who were developmentally delayed and prenatally exposed to cocaine. By identifying a group of programme graduates from a high crime/high poverty neighbourhood in Miami-Dade County using ArcGIS 10.2 software, a…

  13. Salivary Alpha Amylase and Cortisol Levels in Children with Global Developmental Delay and Their Relation with the Expectation of Dental Care and Behavior during the Intervention

    ERIC Educational Resources Information Center

    dos Santos, Marcio Jose Possari; Bernabe, Daniel Galera; Nakamune, Ana Claudia de Melo Stevanato; Perri, Silvia Helena Venturoli; de Aguiar, Sandra Maria Herondina Coelho Avila; de Oliveira, Sandra Helena Penha

    2012-01-01

    The purpose of this study was to analyze the alpha-amylase (sAA) and cortisol levels in children with Global developmental delay (GDD) before and after dental treatment and its association with the children's behavior during treatment. The morning salivary cortisol levels and activity of sAA of 33 children with GDD were evaluated before and after…

  14. De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

    PubMed

    Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

    2017-11-01

    Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Pericentric inversion of chromosome 11 (p14.3q21) associated with developmental delays, hypopigmented skin lesions and abnormal brain MRI findings - a new case report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zachor, D.A.; Lofton, M.

    1994-09-01

    We report 3 year old male, referred for evaluation of developmental delays. Pregnancy was complicated by oligohydramnios, proteinuria and prematurity. Medical history revealed: bilateral inguinal hernia, small scrotal sac, undescended testes, developmental delays and behavioral problems. The child had: microcephaly, facial dysmorphic features, single palmar creases, hypopigmented skin lesions of variable size, intermittent exotropia and small retracted testes. Neurological examination was normal. Cognitive level was at the average range with mild delay in his adaptive behavior. Expressive language delays and severe articulation disorder were noted, as well as clumsiness, poor control and precision of gross and fine motor skills. Chromosomalmore » analysis of peripheral leukocytes indicated that one of the number 11 chromosomes had undergone a pericentric inversion with breakpoints on the short (p) arm at band p14.3 and the long (q) arm at band q21. An MRI of the brain showed mild delay in myelinization pattern of white matter. Chromosome 11 inversion in other sites was associated with Beckwith-Wiedemann syndrome and several malignancies. To our knowledge this is the first description of inv(11)(p14.3q21) that is associated with microcephaly, dysmorphic features, hypopigmented skin lesions and speech delay. This inversion may disrupt the expression of the involved genes. However, additional cases with the same cytogenetic anomaly are needed to explore the phenotypic significance of this disorder.« less

  16. Performance of 2-year-old children after early surgery for congenital heart disease on the Bayley Scales of Infant and Toddler Development, Third Edition.

    PubMed

    Long, Suzanne H; Galea, Mary P; Eldridge, Beverley J; Harris, Susan R

    2012-08-01

    Previous research on developmental outcomes of infants with congenital heart disease (CHD) has shown delays in both cognitive and motor skills. To describe outcomes on the Bayley Scales of Infant and Toddler Development, 3rd edition (Bayley-III) for infants with CHD and to compare those findings to published results for similar samples of infants assessed on the 2nd edition of the Bayley Scales (BSID-II). Prospective cohort. Of 50 infants with CHD who participated in this longitudinal study (2006-2008) at the Royal Children's Hospital in Melbourne, Australia, 47 were assessed on the Bayley-III (median age=24.5 months), administered by a psychologist or neonatologist. Although neither assessor was blind to the CHD diagnosis, they were unaware of results of previous developmental assessments conducted in this longitudinal study. For the Bayley-III cognitive composite score, 17.0% of infants showed mild delays (1-2 SD below the mean), 2.1% had moderate delays (2-3 SD below the mean), and none had severe delays (greater than 3 SD below the mean). Motor composite scores showed mild delays in 10.9% of infants and moderate delays in 2.2%; none had severe motor delays. These findings differ from study results using the BSID-II in similar infants. The Bayley-III may underestimate developmental delay in 2-year-old children with CHD when compared to results of similar children tested at 12-36 months of age on the BSID-II. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Predictors of Developmental Outcomes of High-Risk and Developmentally Delayed Infants and Children Enrolled in a State Early Childhood Intervention Program

    ERIC Educational Resources Information Center

    Giannoni, Peggy P.; Kass, Philip H.

    2012-01-01

    A retrospective cohort study was conducted to identify child, maternal, family, and community factors associated with rate of developmental disability among children enrolled in the California Early Start Program. The cohort included 8,987 children considered at high risk for developmental disability due to medical risks and/or developmental…

  18. Comparison of developmental milestone attainment in early treated HIV-infected infants versus HIV-unexposed infants: a prospective cohort study.

    PubMed

    Benki-Nugent, Sarah; Wamalwa, Dalton; Langat, Agnes; Tapia, Kenneth; Adhiambo, Judith; Chebet, Daisy; Okinyi, Helen Moraa; John-Stewart, Grace

    2017-01-17

    Infant HIV infection is associated with delayed milestone attainment. The extent to which effective antiretroviral therapy (ART) prevents these delays is not well defined. Ages at attainment of milestones were compared between HIV-infected (initiated ART by age <5 months), and HIV-unexposed uninfected (HUU) infants. Kaplan Meier analyses were used to estimate and compare (log-rank tests) ages at milestones between groups. Adjusted analyses were performed using Cox proportional hazards models. Seventy-three HIV-infected on ART (median enrollment age 3.7 months) and 92 HUU infants (median enrollment age 1.6 months) were followed prospectively. HIV-infected infants on ART had delays in developmental milestone attainment compared to HUU: median age at attainment of sitting with support, sitting unsupported, walking with support, walking unsupported, monosyllabic speech and throwing toys were each delayed (all p-values <0.0005). Compared with HUU, the subset of HIV-infected infants with both virologic suppression and immune recovery at 6 months had delays for speech (delay: 2.0 months; P = 0.0002) and trend to later walking unsupported. Among HIV-infected infants with poor 6-month post-ART responses (lacking viral suppression and immune recovery) there were greater delays versus HUU for: walking unsupported (delay: 4.0 months; P = 0.0001) and speech (delay: 5.0 months; P < 0.0001). HIV infected infants with viral suppression on ART had better recovery of developmental milestones than those without suppression, however, deficits persisted compared to uninfected infants. Earlier ART may be required for optimized cognitive outcomes in perinatally HIV-infected infants. NCT00428116 ; January 22, 2007.

  19. Mother-Child Interaction and Resilience in Children with Early Developmental Risk

    PubMed Central

    Fenning, Rachel M.; Baker, Jason K.

    2014-01-01

    Although prenatal and genetic factors make strong contributions to the emergence of intellectual disability (ID), children's early environment may have the potential to alter developmental trajectories and to foster resilience in children with early risk. The present study examined mother-child interaction and the promotion of competence in 50 children with early developmental delays. Three related but distinct aspects of mother-child interaction were considered: maternal technical scaffolding, maternal positive-sensitivity, and mother-child dyadic pleasure. Children were classified as exhibiting undifferentiated delays at age three based upon performance on developmental assessments and the absence of known genetic syndromes. Mother-child interaction was assessed at age four through observational ratings of structured laboratory tasks and through naturalistic home observations. ID was identified at age five using the dual criteria of clinically significant delays in cognitive functioning and adaptive behavior. Maternal technical scaffolding and dyadic pleasure each uniquely predicted reduced likelihood of later ID, beyond the contributions of children's early developmental level and behavioral functioning. Follow-up analyses suggested that mother-child interaction was primarily important to resilience in the area of adaptive behavior, with scaffolding and dyadic pleasure differentially associated with particular sub-domains. Implications for theories of intellectual disability and for family-based early intervention and prevention efforts are discussed. PMID:22662771

  20. Engaging Pediatricians in Developmental Screening: The Effectiveness of Academic Detailing

    ERIC Educational Resources Information Center

    Honigfeld, Lisa; Chandhok, Laura; Spiegelman, Kenneth

    2012-01-01

    Use of formal developmental screening tools in the pediatric medical home improves early identification of children with developmental delays and disorders, including Autism Spectrum Disorders. A pilot study evaluated the impact of an academic detailing module in which trainers visited 43 pediatric primary care practices to provide education about…

  1. Developmental Changes in Cognitive and Behavioural Functioning of Adolescents with Fragile-X Syndrome

    ERIC Educational Resources Information Center

    Frolli, A.; Piscopo, S.; Conson, M.

    2015-01-01

    Background: Individuals with fragile-X syndrome exhibit developmental delay, hyperexcitation and social anxiety; they also show lack of attention and hyperactivity. Few studies have investigated whether levels of functioning change with increasing age. Here, we explored developmental changes across adolescence in the cognitive and behavioural…

  2. Neurodevelopmental outcomes in children with congenital heart disease: evaluation and management: a scientific statement from the American Heart Association.

    PubMed

    Marino, Bradley S; Lipkin, Paul H; Newburger, Jane W; Peacock, Georgina; Gerdes, Marsha; Gaynor, J William; Mussatto, Kathleen A; Uzark, Karen; Goldberg, Caren S; Johnson, Walter H; Li, Jennifer; Smith, Sabrina E; Bellinger, David C; Mahle, William T

    2012-08-28

    The goal of this statement was to review the available literature on surveillance, screening, evaluation, and management strategies and put forward a scientific statement that would comprehensively review the literature and create recommendations to optimize neurodevelopmental outcome in the pediatric congenital heart disease (CHD) population. A writing group appointed by the American Heart Association and American Academy of Pediatrics reviewed the available literature addressing developmental disorder and disability and developmental delay in the CHD population, with specific attention given to surveillance, screening, evaluation, and management strategies. MEDLINE and Google Scholar database searches from 1966 to 2011 were performed for English-language articles cross-referencing CHD with pertinent search terms. The reference lists of identified articles were also searched. The American College of Cardiology/American Heart Association classification of recommendations and levels of evidence for practice guidelines were used. A management algorithm was devised that stratified children with CHD on the basis of established risk factors. For those deemed to be at high risk for developmental disorder or disabilities or for developmental delay, formal, periodic developmental and medical evaluations are recommended. A CHD algorithm for surveillance, screening, evaluation, reevaluation, and management of developmental disorder or disability has been constructed to serve as a supplement to the 2006 American Academy of Pediatrics statement on developmental surveillance and screening. The proposed algorithm is designed to be carried out within the context of the medical home. This scientific statement is meant for medical providers within the medical home who care for patients with CHD. Children with CHD are at increased risk of developmental disorder or disabilities or developmental delay. Periodic developmental surveillance, screening, evaluation, and reevaluation throughout childhood may enhance identification of significant deficits, allowing for appropriate therapies and education to enhance later academic, behavioral, psychosocial, and adaptive functioning.

  3. Parental care mitigates carry-over effects of poor early conditions on offspring growth

    USGS Publications Warehouse

    Auer, Sonya K.; Martin, Thomas E.

    2017-01-01

    Poor developmental conditions can have long-lasting negative effects on offspring phenotypes, but impacts often differ among species. Contrasting responses may reflect disparities in experimental protocols among single-species studies or inherent differences among species in their sensitivity to early conditions and/or ability to mitigate negative impacts. We used a common experimental protocol to assess and compare the role of parental care in mitigating effects of poor early conditions on offspring among 4 sympatric bird species in the wild. We experimentally induced low incubation temperatures and examined effects on embryonic developmental rates, hatching success, nestling growth rates, and parental responses. We examined the generality of these effects across 4 species that differ in their phylogenetic history, breeding ecology, and life histories. We found that cooling led to delayed hatching in all species, but carry-over effects on offspring differed among species. Parents of some but not all species increased their offspring provisioning rates in response to experimental cooling with critical benefits for offspring growth rates. Our study shows for the first time that species exhibit clear differences in the degree to which they are affected by poor early conditions. Observed differences among species demonstrate that parental care is a critical mechanism for mitigating potential negative effects on offspring and suggest that parental responses may be constrained to varying degrees by ecology and life histories.

  4. Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development

    PubMed Central

    Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2003-01-01

    Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development. PMID:12754229

  5. Penguin chicks benefit from elevated yolk androgen levels under sibling competition.

    PubMed

    Poisbleau, Maud; Müller, Wendt; Carslake, David; Demongin, Laurent; Groothuis, Ton G G; Van Camp, Jeff; Eens, Marcel

    2012-01-01

    Crested penguins (genus Eudyptes) have a peculiar hatching pattern, with the first-laid egg (A-egg) hatching after the second-laid egg (B-egg) and chicks from A-eggs typically having a much lower survival probability. Maternal yolk androgens have been suggested to contribute to the competitive superiority of the B-chick in southern rockhopper penguins Eudyptes chrysocome, given their important role in mediating sibling competition in other species. We therefore increased the yolk androgen levels in freshly-laid eggs and examined the consequences for sibling competition--via effects on embryonic developmental times, chick growth and early survival. We placed one androgen-treated egg and one control egg into each foster nest, matching them for mass, laying date and laying order. The androgen treatment did not significantly affect embryonic developmental times or chick measurements at hatching. However, elevated yolk androgen levels benefitted chick growth in interaction with the number of siblings in a brood. Chicks from androgen-treated eggs had faster growth in the presence of a sibling than chicks from control eggs. Under these circumstances they also had a higher survival probability. Thus maternal androgens appear to reinforce the observed hatching pattern, facilitating brood reduction. This contrasts to most previous studies in other species where yolk androgens have been shown to compensate for the negative consequences of delayed hatching within the brood hierarchy.

  6. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  7. CDC Kerala 7: Effect of early language intervention among children 0-3 y with speech and language delay.

    PubMed

    Nair, M K C; Mini, A O; Leena, M L; George, Babu; Harikumaran Nair, G S; Bhaskaran, Deepa; Russell, Paul Swamidhas Sudhakar

    2014-12-01

    To assess the effect of systematic clinic and home based early language intervention program in children reporting to the early language intervention clinic with full partnership of specially trained developmental therapist and the parents. All babies between 0 and 3 y referred to Child Development Centre (CDC) Kerala for suspected speech/language delay were assessed and those without hearing impairment were screened first using Language Evaluation Scale Trivandrum (LEST) and assessed in detail using Receptive Expressive Emergent Language Scale (REELS). Those having language delay are enrolled into the early language intervention program for a period of 6 mo, 1 h at the CDC clinic once every month followed by home stimulation for rest of the month by the mother trained at CDC. Out of the total 455 children between 0 and 3 y, who successfully completed 6 mo intervention, the mean pre and post intervention language quotient (LQ) were 60.79 and 70.62 respectively and the observed 9.83 increase was statistically significant. The developmental diagnosis included developmental delay (62.4%), global developmental delay (18.5%), Trisomy and other chromosomal abnormalities (10.5%), microcephaly and other brain problems (9.9%), misarticulation (8.4%), autistic features (5.3%) and cleft palate and lip (3.3%) in the descending order. In the present study among 455 children between 0 and 3 y without hearing impairment, who successfully completed 6 mo early language intervention, the mean pre and post intervention LQ were 60.79 and 70.62 respectively and the observed 9.83 increase was statistically significant.

  8. The Effects of, Lined Paper, Prompting, Tracing, Rewards, and Fading to Increase Handwriting Performance and Legibility with Two Preschool Special Education Students Diagnosed with Developmental Delays, and Fine Motor Deficits

    ERIC Educational Resources Information Center

    Smith, Erin; McLaughlin, T. F.; Neyman, Jennifer; Rinaldi, Lisa

    2013-01-01

    This study was designed to examine the effects of tracing and fading prompts to improve the handwriting of two preschoolers both diagnosed as Developmentally Delayed (DD) and one of whom had fine motor goals. The study took place in a self-contained special education public preschool classroom located in the Pacific Northwest. The results showed…

  9. [An investigation of the imitation skills in children with autism spectrum disorder and their association with receptive-expressive language development].

    PubMed

    Turan, Figen; Ökçün Akçamuş, Meral Çilem

    2013-01-01

    This study aimed to compare imitation skills in children with autism spectrum disorder, and age-matched typically developing children and children with developmental delay, as well as to examine the association between imitation skills, and receptive and expressive language development in children with autism spectrum disorder. Imitation skills in children with autism spectrum disorder (n=18), and age-matched children with developmental delay (n=15) and typically developing children (n= 16) were assessed using the Motor Imitation Scale and Imitation Battery, and the differences in mean imitation scores between the groups were examined. Receptive language and expressive language development in the children with autism spectrum disorder were assessed using the Turkish Communicative Development Inventory (TCDI), and their association with imitation scores was explored. The children with autism spectrum disorder had significantly lower imitation scores than the children with developmental delay and typically developing children; however, there wasn't a significant difference in imitation scores between the children with developmental delay and typically developing children. A significant association between imitation scores, and receptive and expressive language development was observed in the children with autism spectrum disorder. The present findings indicate that deficient imitation skills are a distinctive feature of children with autism spectrum disorder and that imitation skills play a crucial role in children's language development.

  10. The first Korean patient with Potocki-Shaffer syndrome: a rare cause of multiple exostoses.

    PubMed

    Sohn, Young Bae; Yim, Shin-Young; Cho, Eun-Hae; Kim, Ok-Hwa

    2015-02-01

    Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered.

  11. Early neurotrophic pharmacotherapy rescues developmental delay and Alzheimer’s-like memory deficits in the Ts65Dn mouse model of Down syndrome

    PubMed Central

    Kazim, Syed Faraz; Blanchard, Julie; Bianchi, Riccardo; Iqbal, Khalid

    2017-01-01

    Down syndrome (DS), caused by trisomy 21, is the most common genetic cause of intellectual disability and is associated with a greatly increased risk of early-onset Alzheimer’s disease (AD). The Ts65Dn mouse model of DS exhibits several key features of the disease including developmental delay and AD-like cognitive impairment. Accumulating evidence suggests that impairments in early brain development caused by trisomy 21 contribute significantly to memory deficits in adult life in DS. Prenatal genetic testing to diagnose DS in utero, provides the novel opportunity to initiate early pharmacological treatment to target this critical period of brain development. Here, we report that prenatal to early postnatal treatment with a ciliary neurotrophic factor (CNTF) small-molecule peptide mimetic, Peptide 021 (P021), rescued developmental delay in pups and AD-like hippocampus-dependent memory impairments in adult life in Ts65Dn mice. Furthermore, this treatment prevented pre-synaptic protein deficit, decreased glycogen synthase kinase-3beta (GSK3β) activity, and increased levels of synaptic plasticity markers including brain derived neurotrophic factor (BNDF) and phosphorylated CREB, both in young (3-week-old) and adult (~ 7-month-old) Ts65Dn mice. These findings provide novel evidence that providing neurotrophic support during early brain development can prevent developmental delay and AD-like memory impairments in a DS mouse model. PMID:28368015

  12. Successful Growth Hormone Therapy in Cornelia de Lange Syndrome.

    PubMed

    de Graaf, Michael; Kant, Sarina G; Wit, Jan Maarten; Willem Redeker, Egbert Johan; Eduard Santen, Gijs Willem; Henriëtta Verkerk, Annemieke Johanna Maria; Uitterlinden, André Gerardus; Losekoot, Monique; Oostdijk, Wilma

    2017-12-15

    Cornelia de Lange syndrome (CdLS) is a both clinically and genetically heterogeneous syndrome. In its classical form, it is characterised by distinctive facial features, intra-uterine growth retardation, short stature, developmental delay, and anomalies in multiple organ systems. NIPBL, SMC1A, SMC3, RAD21 and HDAC8, all involved in the cohesin pathway, have been identified to cause CdLS. Growth hormone (GH) secretion has been reported as normal, and to our knowledge, there are no reports on the effect of recombinant human GH treatment in CdLS patients. We present a patient born small for gestational age with persistent severe growth retardation [height -3.4 standard deviation score (SDS)] and mild dysmorphic features, who was treated with GH from 4.3 years of age onward and was diagnosed 6 years later with CdLS using whole-exome sequencing. Treatment led to a height gain of 1.6 SDS over 8 years. Treatment was interrupted shortly due to high serum insulin-like growth factor-1 serum values. In conclusion, GH therapy may be effective and safe for short children with CdLS.

  13. Association of maternal depression with dietary intake, growth, and development of preterm infants: a cohort study in Beijing, China.

    PubMed

    Wang, Han; Zhou, Hong; Zhang, Yan; Wang, Yan; Sun, Jing

    2017-11-27

    This study aimed to explore the association of maternal depression with nutrient intake, growth, and development of preterm infants. A cohort study of 201 infants was conducted in Beijing. Based on the gestational age of an infant and status of the mother, the infants were divided into four groups: non-depression-fullterm (64), non-depression-preterm (70), depression-fullterm (36), and depression-preterm (31). Data on sociodemographic characteristics, nutritional intake, growth, and developmental status of children at 8 months (corrected ages) were collected using a quantitative questionnaire, a 24-Hour Dietary Recall, anthropometric measurements, and the Bayley-III scale. A multivariate analysis was used to evaluate the effects of maternal depression and preterm birth on infant growth and development. The energy, protein, and carbohydrate intake in the depression group was lower than the recommended amounts. The depression preterm groups indicated the lowest Z-scores for length and weight and the lowest Bayley-III scores. Preterm infants of depressed mothers are at high risks of poor growth and development delay.

  14. Successful Growth Hormone Therapy in Cornelia de Lange Syndrome

    PubMed Central

    de Graaf, Michael; Kant, Sarina G; Wit, Jan Maarten; Redeker, Egbert Johan Willem; Santen, Gijs Willem Eduard; Verkerk, Annemieke Johanna Maria Henriëtta; Uitterlinden, André Gerardus; Losekoot, Monique; Oostdijk, Wilma

    2017-01-01

    Cornelia de Lange syndrome (CdLS) is a both clinically and genetically heterogeneous syndrome. In its classical form, it is characterised by distinctive facial features, intra-uterine growth retardation, short stature, developmental delay, and anomalies in multiple organ systems. NIPBL, SMC1A, SMC3, RAD21 and HDAC8, all involved in the cohesin pathway, have been identified to cause CdLS. Growth hormone (GH) secretion has been reported as normal, and to our knowledge, there are no reports on the effect of recombinant human GH treatment in CdLS patients. We present a patient born small for gestational age with persistent severe growth retardation [height -3.4 standard deviation score (SDS)] and mild dysmorphic features, who was treated with GH from 4.3 years of age onward and was diagnosed 6 years later with CdLS using whole-exome sequencing. Treatment led to a height gain of 1.6 SDS over 8 years. Treatment was interrupted shortly due to high serum insulin-like growth factor-1 serum values. In conclusion, GH therapy may be effective and safe for short children with CdLS. PMID:28588001

  15. Identification of mutations in the PI3K-AKT-mTOR signalling pathway in patients with macrocephaly and developmental delay and/or autism.

    PubMed

    Yeung, Kit San; Tso, Winnie Wan Yee; Ip, Janice Jing Kun; Mak, Christopher Chun Yu; Leung, Gordon Ka Chun; Tsang, Mandy Ho Yin; Ying, Dingge; Pei, Steven Lim Cho; Lee, So Lun; Yang, Wanling; Chung, Brian Hon-Yin

    2017-01-01

    Macrocephaly, which is defined as a head circumference greater than or equal to + 2 standard deviations, is a feature commonly observed in children with developmental delay and/or autism spectrum disorder. Although PTEN is a well-known gene identified in patients with this syndromic presentation, other genes in the PI3K-AKT-mTOR signalling pathway have also recently been suggested to have important roles. The aim of this study is to characterise the mutation spectrum of this group of patients. We performed whole-exome sequencing of 21 patients with macrocephaly and developmental delay/autism spectrum disorder. Sources of genomic DNA included blood, buccal mucosa and saliva. Germline mutations were validated by Sanger sequencing, whereas somatic mutations were validated by droplet digital PCR. We identified ten pathogenic/likely pathogenic mutations in PTEN ( n  = 4), PIK3CA ( n  = 3), MTOR ( n  = 1) and PPP2R5D ( n  = 2) in ten patients. An additional PTEN mutation, which was classified as variant of unknown significance, was identified in a patient with a pathogenic PTEN mutation, making him harbour bi-allelic germline PTEN mutations. Two patients harboured somatic PIK3CA mutations, and the level of somatic mosaicism in blood DNA was low. Patients who tested positive for mutations in the PI3K-AKT-mTOR pathway had a lower developmental quotient than the rest of the cohort (DQ = 62.8 vs. 76.1, p = 0.021). Their dysmorphic features were non-specific, except for macrocephaly. Among the ten patients with identified mutations, brain magnetic resonance imaging was performed in nine, all of whom showed megalencephaly. We identified mutations in the PI3K-AKT-mTOR signalling pathway in nearly half of our patients with macrocephaly and developmental delay/autism spectrum disorder. These patients have subtle dysmorphic features and mild developmental issues. Clinically, patients with germline mutations are difficult to distinguish from patients with somatic mutations, and therefore, sequencing of buccal or saliva DNA is important to identify somatic mosaicism. Given the high diagnostic yield and the management implications, we suggest implementing comprehensive genetic testing in the PI3K-AKT-mTOR pathway in the clinical evaluation of patients with macrocephaly and developmental delay and/or autism spectrum disorder.

  16. Fetal Tissue Procurement for Karyotype Analysis: Clinician or Pathologist - Which is Better?

    PubMed

    Conant, Joanna L; Tang, Mary E; Waters, Brenda L

    2016-01-01

    Chromosomal abnormalities are detected in up to 13% of stillbirths and over 20% of those with developmental anomalies. These estimates may be low since up to 50% of samples fail to achieve a result due to microbial overgrowth or nonviability. Tissue for cytogenetics can be procured at bedside by the clinician or by the pathologist in the laboratory. With clinical collection, tissue is placed into culture media immediately, increasing chances of growth. However, collection competes for attention with other activities, which may result in microbial overgrowth or selection of maternal rather than fetal tissue. Laboratory procurement occurs in a controlled environment using sterile technique, but delay in collection may decrease viability. Our goal was to determine which collection method yields better results. We reviewed cases from 2007-2013 that had two samples submitted for cytogenetics, one from the clinician and one from the pathologist. Specimen source, delivery, collection, and culture setup times, harvest date, cell growth, microbial overgrowth, maternal contamination and final result were obtained from medical records and cytogenetic culture sheets. There was no difference in growth rate, maternal cell contamination, or reporting time between clinician- and pathologist-procured samples despite delay in collection time for laboratory samples. Clinical samples had more microbial overgrowth. Compared to samples collected at bedside, samples collected in the laboratory had a lower rate of microbial contamination with similar growth and maternal cell contamination rates, despite prolonged time to collection. Collecting samples both at bedside and in the laboratory is unnecessary.

  17. Comparative safety of antiepileptic drugs for neurological development in children exposed during pregnancy and breast feeding: a systematic review and network meta-analysis.

    PubMed

    Veroniki, Areti Angeliki; Rios, Patricia; Cogo, Elise; Straus, Sharon E; Finkelstein, Yaron; Kealey, Ryan; Reynen, Emily; Soobiah, Charlene; Thavorn, Kednapa; Hutton, Brian; Hemmelgarn, Brenda R; Yazdi, Fatemeh; D'Souza, Jennifer; MacDonald, Heather; Tricco, Andrea C

    2017-07-20

    Compare the safety of antiepileptic drugs (AEDs) on neurodevelopment of infants/children exposed in utero or during breast feeding. Systematic review and Bayesian random-effects network meta-analysis (NMA). MEDLINE, EMBASE and the Cochrane Central Register of Controlled Trials were searched until 27 April 2017. Screening, data abstraction and quality appraisal were completed in duplicate by independent reviewers. 29 cohort studies including 5100 infants/children. Monotherapy and polytherapy AEDs including first-generation (carbamazepine, clobazam, clonazepam, ethosuximide, phenobarbital, phenytoin, primidone, valproate) and newer-generation (gabapentin, lamotrigine, levetiracetam, oxcarbazepine, topiramate, vigabatrin) AEDs. Epileptic women who did not receive AEDs during pregnancy or breast feeding served as the control group. Cognitive developmental delay and autism/dyspraxia were primary outcomes. Attention-deficit hyperactivity disorder, language delay, neonatal seizures, psychomotor developmental delay and social impairment were secondary outcomes. The NMA on cognitive developmental delay (11 cohort studies, 933 children, 18 treatments) suggested that among all AEDs only valproate was statistically significantly associated with more children experiencing cognitive developmental delay compared with control (OR=7.40, 95% credible interval (CrI) 3.00 to 18.46). The NMA on autism (5 cohort studies, 2551 children, 12 treatments) suggested that oxcarbazepine (OR 13.51, CrI 1.28 to 221.40), valproate (OR 17.29, 95% CrI 2.40 to 217.60), lamotrigine (OR 8.88, CrI 1.28 to 112.00) and lamotrigine+valproate (OR 132.70, CrI 7.41 to 3851.00) were associated with significantly greater odds of developing autism compared with control. The NMA on psychomotor developmental delay (11 cohort studies, 1145 children, 18 treatments) found that valproate (OR 4.16, CrI 2.04 to 8.75) and carbamazepine+phenobarbital+valproate (OR 19.12, CrI 1.49 to 337.50) were associated with significantly greater odds of psychomotor delay compared with control. Valproate alone or combined with another AED is associated with the greatest odds of adverse neurodevelopmental outcomes compared with control. Oxcarbazepine and lamotrigine were associated with increased occurrence of autism. Counselling is advised for women considering pregnancy to tailor the safest regimen. PROSPERO database (CRD42014008925). © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  18. Comparative safety of antiepileptic drugs for neurological development in children exposed during pregnancy and breast feeding: a systematic review and network meta-analysis

    PubMed Central

    Veroniki, Areti Angeliki; Rios, Patricia; Cogo, Elise; Straus, Sharon E; Finkelstein, Yaron; Kealey, Ryan; Reynen, Emily; Soobiah, Charlene; Thavorn, Kednapa; Hutton, Brian; Hemmelgarn, Brenda R; Yazdi, Fatemeh; D'Souza, Jennifer; MacDonald, Heather; Tricco, Andrea C

    2017-01-01

    Objectives Compare the safety of antiepileptic drugs (AEDs) on neurodevelopment of infants/children exposed in utero or during breast feeding. Design and setting Systematic review and Bayesian random-effects network meta-analysis (NMA). MEDLINE, EMBASE and the Cochrane Central Register of Controlled Trials were searched until 27 April 2017. Screening, data abstraction and quality appraisal were completed in duplicate by independent reviewers. Participants 29 cohort studies including 5100 infants/children. Interventions Monotherapy and polytherapy AEDs including first-generation (carbamazepine, clobazam, clonazepam, ethosuximide, phenobarbital, phenytoin, primidone, valproate) and newer-generation (gabapentin, lamotrigine, levetiracetam, oxcarbazepine, topiramate, vigabatrin) AEDs. Epileptic women who did not receive AEDs during pregnancy or breast feeding served as the control group. Primary and secondary outcome measures Cognitive developmental delay and autism/dyspraxia were primary outcomes. Attention-deficit hyperactivity disorder, language delay, neonatal seizures, psychomotor developmental delay and social impairment were secondary outcomes. Results The NMA on cognitive developmental delay (11 cohort studies, 933 children, 18 treatments) suggested that among all AEDs only valproate was statistically significantly associated with more children experiencing cognitive developmental delay compared with control (OR=7.40, 95% credible interval (CrI) 3.00 to 18.46). The NMA on autism (5 cohort studies, 2551 children, 12 treatments) suggested that oxcarbazepine (OR 13.51, CrI 1.28 to 221.40), valproate (OR 17.29, 95% CrI 2.40 to 217.60), lamotrigine (OR 8.88, CrI 1.28 to 112.00) and lamotrigine+valproate (OR 132.70, CrI 7.41 to 3851.00) were associated with significantly greater odds of developing autism compared with control. The NMA on psychomotor developmental delay (11 cohort studies, 1145 children, 18 treatments) found that valproate (OR 4.16, CrI 2.04 to 8.75) and carbamazepine+phenobarbital+valproate (OR 19.12, CrI 1.49 to 337.50) were associated with significantly greater odds of psychomotor delay compared with control. Conclusions Valproate alone or combined with another AED is associated with the greatest odds of adverse neurodevelopmental outcomes compared with control. Oxcarbazepine and lamotrigine were associated with increased occurrence of autism. Counselling is advised for women considering pregnancy to tailor the safest regimen. Trial registration number PROSPERO database (CRD42014008925). PMID:28729328

  19. Developmental and Autism Screening: A Survey across Six States

    ERIC Educational Resources Information Center

    Arunyanart, Wirongrong; Fenick, Ada; Ukritchon, Supak; Imjaijitt, Worarachanee; Northrup, Veronika; Weitzman, Carol

    2012-01-01

    The American Academy of Pediatrics (AAP) recommends screening children for developmental delay and autism. Studies of current screening practice to date have been limited in scope and primarily focused on small, local samples. This study is designed to determine compliance with AAP screening recommendations: (1) developmental screening at 9, 18,…

  20. Use of Developmental Milestones in Pediatric Residency Training and Practice: Time to Rethink the Meaning of the Mean

    PubMed Central

    Sices, Laura

    2009-01-01

    Objective Pediatricians frequently report the use of developmental milestones in monitoring young children’s development, despite evidence that use of screening tools improves detection of developmental delays. Methods Core texts in the field of pediatrics and developmental-behavioral pediatrics were reviewed for content and presentation on child development. Most texts included and many focused on developmental milestones, many with an emphasis on 50th percentile milestone data. Problems and limitations in the use of 50th percentile milestones to monitor young children’s development and to identify children whose development is suspicious for delay, include questionable utility in clinical decision making and the potential to increase parental anxiety. Results The recommendation is made to reconsider a focus on 50th percentile milestone data in pediatric training and practice, in favor of measures that have better clinical utility and are more psychometrically sound. Conclusion A conceptual approach to the presentation of developmental milestones differentiates the use of the 10th, 50th, and 90th percentiles of age of achievement of skills, based on the clinical purpose of surveillance. PMID:17353732

  1. The Effect of Cognitive Restructuring on Delay of Gratification.

    ERIC Educational Resources Information Center

    Nisan, Mordecai; Koriat, Asher

    1984-01-01

    Two experiments evaluated predictions derived from a cognitive-developmental approach to delay of gratification. In the first, kindergarten children were asked to make a choice between a small immediate and a large delayed reward. In the second, children were presented with either an objective-rational or a subjective-emotional argument…

  2. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.

    2008-09-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND)more » 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression ({>=} 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans.« less

  3. The Efficacy of Parent Counseling and Support Groups on the Stress Levels, Self-Esteem and Degree of Coping of Parents of Developmentally Delayed or Handicapped Children Who Are Involved in an Infant Intervention Program.

    ERIC Educational Resources Information Center

    La Fountain, Rebecca; Geoffroy, Kevin

    This study was conducted to investigate the effect that a parent support group and a counseling group had on the stress levels, self-esteem, and degree of coping of parents (N=48) of developmentally delayed or handicapped infants enrolled in an infant intervention program. It was hypothesized that, compared to parents in the control group, parents…

  4. Developmental Immunotoxicity

    EPA Science Inventory

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  5. Development and characteristics of children with Usher syndrome and CHARGE syndrome.

    PubMed

    Dammeyer, Jesper

    2012-09-01

    Individuals with Usher syndrome or CHARGE syndrome are faced with a number of difficulties concerning hearing, vision, balance, and language development. The aim of the study is to describe the developmental characteristics of children with Usher syndrome and CHARGE syndrome, respectively. Data about the developmental characteristics of 26 children with Usher syndrome and 17 children with CHARGE syndrome was obtained. Associations between deafblindness (dual sensory loss), motor development (age of walking), language abilities, and intellectual outcome of these children were explored for each group independently. Both groups of children face a number of difficulties associated with vision, hearing, language, balance and intellectual outcome. Intellectual disability and/or language delay was found among 42% of the children with Usher syndrome and among 82% of the children with CHARGE syndrome. Intellectual disability was associated with language delay and age of walking for both groups. Even though Usher and CHARGE are two different genetic syndromes, both groups are challenged with a number of similar developmental delays. Clinicians need to be aware of several developmental issues in order to offer adequate support to children with Usher or CHARGE syndrome. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

    PubMed

    Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

    2012-07-01

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

  7. A Theoretical Approach to Understanding Population Dynamics with Seasonal Developmental Durations

    NASA Astrophysics Data System (ADS)

    Lou, Yijun; Zhao, Xiao-Qiang

    2017-04-01

    There is a growing body of biological investigations to understand impacts of seasonally changing environmental conditions on population dynamics in various research fields such as single population growth and disease transmission. On the other side, understanding the population dynamics subject to seasonally changing weather conditions plays a fundamental role in predicting the trends of population patterns and disease transmission risks under the scenarios of climate change. With the host-macroparasite interaction as a motivating example, we propose a synthesized approach for investigating the population dynamics subject to seasonal environmental variations from theoretical point of view, where the model development, basic reproduction ratio formulation and computation, and rigorous mathematical analysis are involved. The resultant model with periodic delay presents a novel term related to the rate of change of the developmental duration, bringing new challenges to dynamics analysis. By investigating a periodic semiflow on a suitably chosen phase space, the global dynamics of a threshold type is established: all solutions either go to zero when basic reproduction ratio is less than one, or stabilize at a positive periodic state when the reproduction ratio is greater than one. The synthesized approach developed here is applicable to broader contexts of investigating biological systems with seasonal developmental durations.

  8. Speech and Language Delay

    MedlinePlus

    ... the child just doesn’t want to talk). Cerebral palsy (a movement disorder caused by brain damage). Why ... staff Categories: Family Health, Kids and TeensTags: autism, cerebral palsy, child, developmental delay, hearing loss, teenager June 1, ...

  9. Array CGH Analysis and Developmental Delay: A Diagnostic Tool for Neurologists.

    PubMed

    Cameron, F; Xu, J; Jung, J; Prasad, C

    2013-11-01

    Developmental delay occurs in 1-3% of the population, with unknown etiology in approximately 50% of cases. Initial genetic work up for developmental delay previously included chromosome analysis and subtelomeric FISH (fluorescent in situ hybridization). Array Comparative Genomic Hybridization (aCGH) has emerged as a tool to detect genetic copy number changes and uniparental disomy and is the most sensitive test in providing etiological diagnosis in developmental delay. aCGH allows for the provision of prognosis and recurrence risks, improves access to resources, helps limit further investigations and may alter medical management in many cases. aCGH has led to the delineation of novel genetic syndromes associated with developmental delay. An illustrative case of a 31-year-old man with long standing global developmental delay and recently diagnosed 4q21 deletion syndrome with a deletion of 20.8 Mb genomic interval is provided. aCGH is now recommended as a first line test in children and adults with undiagnosed developmental delay and congenital anomalies. Puce d'hybridation génomique comparative et retard de développement : un outil diagnostic pour les neurologues. Le retard de développement survient chez 1 à 3% de la population et son étiologie est inconnue chez à peu près 50% des cas. L'évaluation génétique initiale pour un retard de développement incluait antérieurement une analyse chromosomique et une analyse par FISH (hybridation in situ en fluorescence) de régions subtélomériques. La puce d'hybridation génomique comparative (CGHa) est devenue un outil de détection des changements du nombre de copies géniques ainsi que de la disomie uniparentale et elle est le test le plus sensible pour fournir un diagnostic étiologique dans le retard de développement. Le CGHa permet d'offrir un pronostic et un risque de récurrence, améliore l'accès aux ressources, aide à limiter les évaluations et peut modifier le traitement médical dans bien des cas. Le CGHa a mené à la définition de nouveaux syndromes génétiques associés à un retard de développement. À titre d'exemple, nous décrivons le cas d'un homme âgé de 31 ans qui présentait un retard de développement global depuis longtemps et chez qui un syndrome associé à une délétion 4q21 a été diagnostiqué récemment, soit une délétion de 20,8 Mb. Le CGHa est maintenant recommandé comme test de première ligne chez les enfants et les adultes présentant un retard de développement et des anomalies congénitales.

  10. Prenatal exposure to a novel antipsychotic quetiapine: impact on neuro-architecture, apoptotic neurodegeneration in fetal hippocampus and cognitive impairment in young rats.

    PubMed

    Singh, K P; Tripathi, Nidhi

    2015-05-01

    Reports on prenatal exposure to some of the first generation antipsychotic drugs like, haloperidol, their effects on fetal neurotoxicity and functional impairments in the offspring, are well documented. But studies on in utero exposure to second generation antipsychotics, especially quetiapine, and its effects on fetal neurotoxicity, apoptotic neurodegeneration, postnatal developmental delay and neurobehavioral consequences are lacking. Therefore, the present study was undertaken to evaluate the effect of prenatal administration to equivalent therapeutic doses of quetiapine on neuro-architectural abnormalities, neurohistopathological changes, apoptotic neurodegeneration in fetal hippocampus, and postnatal development and growth as well as its long-lasting imprint on cognitive impairment in young-adult offspring. Pregnant Wistar rats (n=24) were exposed to selected doses (55 mg, 80 mg and 100mg/kg) of quetiapine, equivalent to human therapeutic doses, from gestation day 6 to 21 orally with control subjects. Half of the pregnant subjects of each group were sacrificed at gestation day 21 for histopathological, confocal and electron microscopic studies and rest of the dams were allowed to deliver naturally. Their pups were reared postnatally up to 10 weeks of age for neurobehavioral observations. In quetiapine treated groups, there was significant alterations in total and differential thickness of three typical layers of hippocampus associated with neuronal cells deficit and enhanced apoptotic neurodegeneration in the CA1 area of fetal hippocampus. Prenatally drug treated rat offspring displayed post-natal developmental delay till postnatal day 70, and these young-adult rats displayed cognitive impairment in Morris water maze and passive avoidance regimes as long-lasting impact of the drug. Therefore, quetiapine should be used with cautions considering its developmental neurotoxicological and neurobehavioral potential in animal model, rat. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Attainment of gross motor milestones in children with Down syndrome in Kosovo - developmental perspective.

    PubMed

    Beqaj, Samire; Jusaj, Njomza; Živković, Vujica

    2017-08-01

    Aim To investigate the age (in months) at which motor skills are developed in children with Down syndrome (DS), and compare it to the age of the development of the same skills in both, children with typical development (TD), and children with DS reported by four other studies. Methods Sixteen children (7 girls and 9 boys) were monthly assessed for the development of nineteen motor skills between 2008 and 2011. The mean ages when the skills were accomplished were presented using descriptive statistics. Independent T-samples test (significance < 0.05) was used to compare the mean developmental ages from our study with those seen in children with TD (Comparison 1) and also in children with DS reported by four other authors (Comparison 2a-2d). Results Children with DS developed at a significantly slower pace compared to children with TD (p=0.005). Generally, delay and variance of developmental age in children with DS increased chronologically with the complexity of the skills. No significant difference was found between developmental age in children from the present study and children with DS from other studies. Conclusion The rate of attainment of motor skills is delayed in children with DS in comparison to children with TD, however, the developmental sequence is the same. The delayed development is more prominent in more complex skills. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  12. EMOTIONAL AVAILABILITY IN EARLY MOTHER–CHILD INTERACTIONS FOR CHILDREN WITH AUTISM SPECTRUM DISORDERS, OTHER PSYCHIATRIC DISORDERS, AND DEVELOPMENTAL DELAY

    PubMed Central

    GUL, HESNA; EROL, NESE; AKIN, DUYGU PAMIR; GULLU, BELGİN USTUN; AKCAKİN, MELDA; ALPAS, BAŞAK; ÖNER, ÖZGÜR

    2016-01-01

    Emotional availability (EA) is a method to assess early parent–child dyadic interactions for emotional awareness, perception, experience, and expression between child and parent that describe global relational quality (Z. Biringen & M. Easterbrooks, 2012). The current study aimed to examine the effects of an infant’s diagnosis of autism spectrum disorders (ASDs), other psychiatric disorders (OPD), and developmental delay (DD) on the maternal EA Scale (EAS; Z. Biringen & M. Easterbrooks, 2012; Z. Biringen, J.L. Robinson, & R.N. Emde, 2000) scores and the relative contributions of infant’s age, gender, diagnosis, developmental level, and maternal education on EAS scores in a clinical Turkish sample. Three hundred forty-five infant–mother dyads participated in this study. Results of the research indicated that EAS adult scores were associated with maternal education and infant’s diagnosis whereas child scores were associated with infant’s age, diagnosis, and developmental level. Infants’ involvement and responsiveness to the mother were lower in the group with ASD. Children with OPD, particularly when their mothers have lower education, might be at increased risk of having problems in parent–child interactions. Young ASD subjects with developmental delay are in greatest need of support to increase reactions toward their mother. These findings underscore the importance of using all of the EA dimensions rather than only one measure on children in high-risk populations. PMID:26891759

  13. Early neurodevelopmental outcomes of infants with intestinal failure.

    PubMed

    So, Stephanie; Patterson, Catherine; Gold, Anna; Rogers, Alaine; Kosar, Christina; de Silva, Nicole; Burghardt, Karolina Maria; Avitzur, Yaron; Wales, Paul W

    2016-10-01

    The survival rate of infants and children with intestinal failure is increasing, necessitating a greater focus on their developmental trajectory. To evaluate neurodevelopmental outcomes in children with intestinal failure at 0-15months corrected age. Analysis of clinical, demographic and developmental assessment results of 33 children followed in an intestinal rehabilitation program between 2011 and 2014. Outcome measures included: Prechtl's Assessment of General Movements, Movement Assessment of Infants, Alberta Infant Motor Scale and Mullen Scales of Early Learning. Clinical factors were correlated with poorer developmental outcomes at 12-15months corrected age. Thirty-three infants (17 males), median gestational age 34weeks (interquartile range 29.5-36.0) with birth weight 1.98kg (interquartile range 1.17-2.50). Twenty-nine (88%) infants had abnormal General Movements. More than half had suspect or abnormal scores on the Alberta Infant Motor Scale and medium to high-risk scores for future neuromotor delay on the Movement Assessment of Infants. Delays were seen across all Mullen subscales, most notably in gross motor skills. Factors significantly associated with poorer outcomes at 12-15months included: prematurity, low birth weight, central nervous system co-morbidity, longer neonatal intensive care admission, necrotizing enterocolitis diagnosis, number of operations and conjugated hyperbilirubinemia. Multiple risk factors contribute to early developmental delay in children with intestinal failure, highlighting the importance of close developmental follow-up. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Detecting points as developmental delay based on the life-history development and urosome deformity of the harpacticoid copepod, Tigriopus japonicus sensu lato, following exposure to benzo(a)pyrene.

    PubMed

    Bang, Hyun Woo; Lee, Wonchoel; Kwak, Inn-Sil

    2009-09-01

    To identify ecotoxicological responses to an endocrine disrupter, benzo(a)pyrene, we examined the life-history of the harpacticoid copepod, Tigriopus japonicus sensu lato. Based on the life-history of copepods, survival rate of nauplii (NSR) and copepodites (CSR), copepodite emergence day (CED) and adult male emergence day (AMED), sex ratio (MER), brooding success rate (BSR), and first brooding day of adult females (FBD) were measured. Significant differences were observed in the survival and development of nauplii (NSR and CED) and sex ratio (MER) of exposed and non-exposed copepods. Moreover, high concentration of BaP can be lethal to copepodite and exhibited a delay of growth. In this study, the CED and AMED among ecotoxicological response based on life-history developments were delayed and the body characteristics decreased in response to exposure to benzo(a)pyrene. The dwarfism and urosome deformity of the T. japonicus s.l. was exhibited in response to chemical exposure. Specifically, the body characteristics and biomass of dwarf copepods that had been exposed to benzo(a)pyrene were 30% and 50% lower than the control group, respectively. The incidence of abnormal urosomes was divided into two types. The first deformity type was signs of shrinkage in the middle of the urosome or the entire urosome was narrower than those of the control organisms. In the second type, the anal somite and the distal side of the urosome had abnormally swelled. Taken together, the nauplii and copepodid development of T. japonicus s.l. can be used as a useful biomaker for detecting developmental delay based on their entire life-history. In addition, the urosome deformity was used a good potential monitoring tool invading various chemicals and environmental contamination into water system.

  15. Infant wellbeing at 2 years of age in the Growth Restriction Intervention Trial (GRIT): multicentred randomised controlled trial.

    PubMed

    Thornton, J G; Hornbuckle, J; Vail, A; Spiegelhalter, D J; Levene, M

    Although delivery is widely used for preterm babies failing to thrive in utero, the effect of altering delivery timing has never been assessed in a randomised controlled trial. We aimed to compare the effect of delivering early with delaying birth for as long as possible. 548 pregnant women were recruited by 69 hospitals in 13 European countries. Participants had fetal compromise between 24 and 36 weeks, an umbilical-artery doppler waveform recorded, and clinical uncertainty about whether immediate delivery was indicated. Before birth, 588 babies were randomly assigned to immediate delivery (n=296) or delayed delivery until the obstetrician was no longer uncertain (n=292). The main outcome was death or disability at or beyond 2 years of age. Disability was defined as a Griffiths developmental quotient of 70 or less or the presence of motor or perceptual severe disability. Analysis was by intention-to-treat. This trial has been assigned the International Standard Randomised Controlled Trial Number ISRCTN41358726. Primary outcomes were available on 290 (98%) immediate and 283 (97%) deferred deliveries. Overall rate of death or severe disability at 2 years was 55 (19%) of 290 immediate births, and 44 (16%) of 283 delayed births. With adjustment for gestational age and umbilical-artery doppler category, the odds ratio (95% CrI) was 1.1 (0.7-1.8). Most of the observed difference was in disability in babies younger than 31 weeks of gestation at randomisation: 14 (13%) immediate versus five (5%) delayed deliveries. No important differences in the median Griffiths developmental quotient in survivors was seen. The lack of difference in mortality suggests that obstetricians are delivering sick preterm babies at about the correct moment to minimise mortality. However, they could be delivering too early to minimise brain damage. These results do not lend support to the idea that obstetricians can deliver before terminal hypoxaemia to improve brain development.

  16. Homozygous variegate porphyria presenting with developmental and language delay in childhood.

    PubMed

    Pinder, V A E; Holden, S T; Deshpande, C; Siddiqui, A; Mellerio, J E; Wraige, E; Powell, A M

    2013-10-01

    Variegate porphyria is an autosomal dominant disorder that usually presents with photosensitivity and acute neurological crises in adulthood. It is caused by heterozygous mutations in the protoporphyrinogen oxidase gene (PPOX). A rarer variant, homozygous variegate porphyria (HVP), presents in childhood with recurrent skin blisters and scarring. More variable features of HVP are short stature, brachydactyly, nystagmus, epilepsy, developmental delay and mental retardation. We describe a child who presented with nystagmus, developmental delay and ataxia, combined with a photosensitive eruption. Analysis of porphyrins in plasma, urine and stool supported a clinical diagnosis of HVP. DNA from the patient showed that he is compound heterozygous for two novel missense mutations in the PPOX coding region: c.169G>C (p.Gly57Arg) and c.1259C>G (Pro420Arg). Interestingly, cranial magnetic resonance imaging showed an absence of myelin, a feature not previously reported in HVP, which expands the differential diagnosis of childhood hypomyelinating leucoencephalopathies. © 2013 British Association of Dermatologists.

  17. Service system and cognitive outcomes for young children with autism spectrum disorders in a rural area of Taiwan.

    PubMed

    Chu, Ching-Lin; Chiang, Chung-Hsin; Wu, Chin-Chin; Hou, Yuh-Ming; Liu, Jiun-Horng

    2017-07-01

    Chiayi is a rural county located in southwestern Taiwan, and the effectiveness of its early intervention service system for autism spectrum disorders was studied in detail. A total of 71 children with autism spectrum disorders ( n = 35) and developmental delay ( n = 36) aged 2.5 years were referred from the only Early Intervention Reporting and Referral Center in Chiayi and followed up at 4 years. Results showed relatively low and varied services of early intervention for both groups during two time-point periods and a relative lack of specific early intervention programs for children with autism spectrum disorders. It was found, however, that cognitive abilities were increased for autism spectrum disorders and developmental delay groups. Additionally, the Early Learning Score at the initial evaluation could contribute to the high learner autism spectrum disorders subgroup. Parental socio-economic level was also determined to benefit the high learner developmental delay subgroup.

  18. Elevational differences in developmental plasticity determine phenological responses of grasshoppers to recent climate warming.

    PubMed

    Buckley, Lauren B; Nufio, César R; Kirk, Evan M; Kingsolver, Joel G

    2015-06-22

    Annual species may increase reproduction by increasing adult body size through extended development, but risk being unable to complete development in seasonally limited environments. Synthetic reviews indicate that most, but not all, species have responded to recent climate warming by advancing the seasonal timing of adult emergence or reproduction. Here, we show that 50 years of climate change have delayed development in high-elevation, season-limited grasshopper populations, but advanced development in populations at lower elevations. Developmental delays are most pronounced for early-season species, which might benefit most from delaying development when released from seasonal time constraints. Rearing experiments confirm that population, elevation and temperature interact to determine development time. Population differences in developmental plasticity may account for variability in phenological shifts among adults. An integrated consideration of the full life cycle that considers local adaptation and plasticity may be essential for understanding and predicting responses to climate change. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  19. Why wait? Three mechanisms selecting for environment-dependent developmental delays.

    PubMed

    Scott, M F; Otto, S P

    2014-10-01

    Many species delay development unless particular environments or rare disturbance events occur. How can such a strategy be favoured over continued development? Typically, it is assumed that continued development (e.g. germination) is not advantageous in environments that have low juvenile/seedling survival (mechanism 1), either due to abiotic or competitive effects. However, it has not previously been shown how low early survival must be in order to favour environment-specific developmental delays for long-lived species. Using seed dormancy as an example of developmental delays, we identify a threshold level of seedling survival in 'bad' environments below which selection can favour germination that is limited to 'good' environments. This can be used to evaluate whether observed differences in seedling survival are sufficient to favour conditional germination. We also present mathematical models that demonstrate two other, often overlooked, mechanisms that can favour conditional germination in the absence of differences in seedling survival. Specifically, physiological trade-offs can make it difficult to have germination rates that are equally high in all environments (mechanism 2). We show that such trade-offs can either favour conditional germination or intermediate (mixed) strategies, depending on the trade-off shape. Finally, germination in every year increases the likelihood that some individuals are killed in population-scale disturbances before reproducing; it can thus be favourable to only germinate immediately after a disturbance (mechanism 3). We demonstrate how demographic data can be used to evaluate these selection pressures. By presenting these three mechanisms and the conditions that favour conditional germination in each case, we provide three hypotheses that can be tested as explanations for the evolution of environment-dependent developmental delays. © 2014 European Society for Evolutionary Biology. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  20. A plea for developmental motor screening in Canadian infants.

    PubMed

    Harris, Susan R

    2016-04-01

    Motor delays during infancy may be the first observable sign of a specific neurodevelopmental disability or of more global developmental delays. The earlier such disorders are identified, the sooner these infants can be referred for early intervention services. Although developmental motor screening is strongly recommended in other Western countries, Canada has yet to provide a developmental surveillance and screening program. Ideally, screening for motor disabilities should occur as part of the 12-month well-baby visit. In advance of that visit, parents can be provided with a parent-screening questionnaire that they can complete and bring with them to their 12-month office visit. Interpretation of the parent-completed questionnaire takes only 2 min to 3 min of the health care professional's time and, based on the results, can either reassure parents that their infant is developing typically, or lead to a referral for standardized motor screening or assessment by a paediatric physical or occupational therapist.

  1. Gesture Production in School vs. Clinical Samples of Children with Developmental Coordination Disorder (DCD) and Typically Developing Children

    ERIC Educational Resources Information Center

    Sinani, Charikleia; Sugden, David A.; Hill, Elisabeth L.

    2011-01-01

    Dyspraxia, a difficulty in executing an operationalised act, has been associated with Developmental Coordination Disorder (DCD). However, issues relating to the area such as comparisons across modalities, comparisons of school vs. clinical populations, and developmental delay vs. pathology have not been addressed in the same, comprehensive study.…

  2. Annotation: Early Intervention and Prevention of Self-Injurious Behaviour Exhibited by Young Children with Developmental Disabilities

    ERIC Educational Resources Information Center

    Richman, D. M.

    2008-01-01

    The ontogeny of self-injurious behaviour exhibited by young children with developmental delays or disabilities is due to a complex interaction between neurobiological and environmental variables. In this manuscript, the literature on emerging self-injury in the developmental disability population is reviewed with a focus on an operant conceptual…

  3. Speech Perception and Short-Term Memory Deficits in Persistent Developmental Speech Disorder

    ERIC Educational Resources Information Center

    Kenney, Mary Kay; Barac-Cikoja, Dragana; Finnegan, Kimberly; Jeffries, Neal; Ludlow, Christy L.

    2006-01-01

    Children with developmental speech disorders may have additional deficits in speech perception and/or short-term memory. To determine whether these are only transient developmental delays that can accompany the disorder in childhood or persist as part of the speech disorder, adults with a persistent familial speech disorder were tested on speech…

  4. Parent Training for Children With or at Risk for Developmental Delay: The Role of Parental Homework Completion

    PubMed Central

    Ros, Rosmary; Hernandez, Jennifer; Graziano, Paulo A.; Bagner, Daniel M.

    2015-01-01

    This study investigated the extent to which parental homework completion during behavioral parent training (BPT) for children with or at risk for developmental delay contributed to parenting and child outcomes. Parents of 48 children (Mage = 44.17 months, SD = 14.29; 73% male; 72% White) with developmental delay (IQ < 75) or at risk for developmental delay (due to premature birth) with co-occurring clinically elevated externalizing behavior problems received Parent-Child Interaction Therapy (PCIT) as part of two previously completed randomized controlled trials. Parental homework completion was measured using parental report of home practice of treatment skills collected weekly by therapists. Parents also reported on child externalizing behavior problems and levels of parenting stress, while parenting skills were observed during a 5-min child directed play and child compliance was observed during a 5-min cleanup situation. Results indicated that higher rates of parental homework completion predicted parenting outcomes (i.e., increased positive parenting skills and decreased levels of parenting stress) and child outcomes (i.e., lower levels of externalizing behavior problems). Additionally, although limited by temporal precedence, there was an indirect effect of reductions in parenting stress on the negative association between parental homework completion and child externalizing behavior problems. These findings highlight the importance of parents practicing skills learned during BPT for optimizing treatment outcome. Parenting stress was also identified as a potential mechanism by which high levels of parental homework completion contributed to reductions in child externalizing behavior problems. PMID:26763493

  5. Developmental delay and failure to thrive in a 7-month-old baby boy with spontaneous transient Graves' thyrotoxicosis: a case report.

    PubMed

    Yatsuga, Shuichi; Saikusa, Tomoko; Sasaki, Takako; Ushijima, Kikumi; Kitamura, Miyuki; Nishioka, Junko; Koga, Yasutoshi

    2016-08-10

    Thyroid dysfunction can induce developmental delay and failure to thrive in infancy. Congenital hypothyroidism is one of the common causes of these symptoms in infancy. By contrast, hyperthyroidism is a rare cause of these symptoms in infancy. A 7-month-old Japanese baby boy was examined for developmental delay and failure to thrive. Blood tests were performed, which showed low levels of thyroid-stimulating hormone (<0.01 μU/mL) and high levels of free thyroxine (2.14 pg/mL). He was referred to our hospital at 8 months of age. His height was 64 cm (-2.7 standard deviation) and his weight was 6085 g (-2.5 standard deviation). No goiter was detected on examination. His thyrotropin receptor antibody was slightly high (3.9 IU/L), whereas thyroid stimulating antibody, anti-thyroglobulin antibody, and thyroid peroxidase antibody were within normal range. These blood findings indicated hyperthyroidism, most likely Graves' disease. His free thyroxine level decreased in the first month after our examination. No increased vascularity of his thyroid gland was noted. The technetium uptake of his thyroid gland in scintigraphy was relatively increased compared to the intake of his salivary gland. We elected to observe rather than treat with anti-thyroid medications. We have to rule out spontaneous transient Graves' thyrotoxicosis when babies have symptoms of developmental delay and fail to thrive.

  6. Developmental outcomes in Malawian children with retinopathy-positive cerebral malaria.

    PubMed

    Boivin, Michael J; Gladstone, Melissa J; Vokhiwa, Maclean; Birbeck, Gretchen L; Magen, Jed G; Page, Connie; Semrud-Clikeman, Margaret; Kauye, Felix; Taylor, Terrie E

    2011-03-01

    To assess children with retinopathy-positive cerebral malaria (CM) for neurocognitive sequelae. Participants were selected from an ongoing exposure-control study. Eighty-three Malawian children averaging 4.4 years of age and diagnosed with retinopathy-positive CM were compared to 95 controls. Each child was classified as delayed or not using age-based norms for the Malawi Developmental Assessment Tool (MDAT) for developmental delay on the total scale and for the domains of gross motor, fine motor, language and social skills. Groups were also compared on the Achenbach Child Behaviour Checklist (CBCL) (1.5-5 years). Children with retinopathy-positive CM were delayed, relative to the comparison group, on MDAT total development (P = 0.028; odds ratio or OR = 2.13), with the greatest effects on language development (P = 0.003; OR = 4.93). The two groups did not differ significantly on the Achenbach CBCL internalizing and externalizing symptoms total scores. Stepwise regression demonstrated that coma duration, seizures while in hospital, platelet count and lactate level on admission were predictive of assessment outcomes for the children with retinopathy-positive CM. Children who suffer retinopathy-positive CM at preschool age are at greater risk of developmental delay, particularly with respect to language development. This confirms previous retrospective study findings with school-age children evaluated years after acute illness. The MDAT and the Achenbach CBCL proved sensitive to clinical indicators of severity of malarial illness. © 2010 Blackwell Publishing Ltd.

  7. Growth and development in children born very low birthweight

    PubMed Central

    Scharf, Rebecca J; Stroustrup, Annemarie; Conaway, Mark R; DeBoer, Mark D

    2017-01-01

    Objective To examine the relationships between growth (birth to age 2 years) and developmental outcomes in children born with very low birthweight (VLBW). Design Motor and mental development in children born with VLBW were regressed on anthropometric measurements at birth, 9 months and 2 years using multivariable regression. Setting The Early Childhood Longitudinal Study—Birth Cohort, a longitudinal cohort, community sample, designed to be representative of children born across the USA. Patients 950 children born with VLBW (<1500 g). Main Outcome Measures Motor and cognitive scores on the Bayley Scales at 9 months and 24 months chronological age. Results A high proportion of children exhibited poor growth, with length-for-age z-scores <−2 (ie, stunting) in 21.3% of children at 9 months (adjusted for prematurity) and 34.2% of children at 2 years. Compared with children having z-scores >−2, children with growth shortfalls in head circumference, length and weight had a higher adjusted OR (aOR) of low Bayley motor scores at 9 months and 2 years (aOR ranging from 1.8 to 3.3, all p<0.05), while low Bayley cognitive scores were predicted by 9-month deficits in length and weight (aOR 2.0 and 2.4, respectively, both p<0.01) and 2-year deficits in length and head circumference (aOR 2.9 and 2.8, both p<0.05). Conclusion Anthropometric measures of growth were linked to current and future neurodevelopmental outcomes in children born with VLBW. While careful length measures may be a particularly useful marker, deficits in all anthropometric measures were risk factors for developmental delays. PMID:26627552

  8. Growth and development in children born very low birthweight.

    PubMed

    Scharf, Rebecca J; Stroustrup, Annemarie; Conaway, Mark R; DeBoer, Mark D

    2016-09-01

    To examine the relationships between growth (birth to age 2 years) and developmental outcomes in children born with very low birthweight (VLBW). Motor and mental development in children born with VLBW were regressed on anthropometric measurements at birth, 9 months and 2 years using multivariable regression. The Early Childhood Longitudinal Study-Birth Cohort, a longitudinal cohort, community sample, designed to be representative of children born across the USA. 950 children born with VLBW (<1500 g). Motor and cognitive scores on the Bayley Scales at 9 months and 24 months chronological age. A high proportion of children exhibited poor growth, with length-for-age z-scores <-2 (ie, stunting) in 21.3% of children at 9 months (adjusted for prematurity) and 34.2% of children at 2 years. Compared with children having z-scores >-2, children with growth shortfalls in head circumference, length and weight had a higher adjusted OR (aOR) of low Bayley motor scores at 9 months and 2 years (aOR ranging from 1.8 to 3.3, all p<0.05), while low Bayley cognitive scores were predicted by 9-month deficits in length and weight (aOR 2.0 and 2.4, respectively, both p<0.01) and 2-year deficits in length and head circumference (aOR 2.9 and 2.8, both p<0.05). Anthropometric measures of growth were linked to current and future neurodevelopmental outcomes in children born with VLBW. While careful length measures may be a particularly useful marker, deficits in all anthropometric measures were risk factors for developmental delays. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  9. Developmental Care Rounds: An Interdisciplinary Approach to Support Developmentally Appropriate Care of Infants Born with Complex Congenital Heart Disease.

    PubMed

    Lisanti, Amy Jo; Cribben, Jeanne; Connock, Erin McManus; Lessen, Rachelle; Medoff-Cooper, Barbara

    2016-03-01

    Newborn infants with complex congenital heart disease are at risk for developmental delay. Developmental care practices benefit prematurely born infants in neonatal intensive care units. Cardiac intensive care units until recently had not integrated developmental care practices into their care framework. Interdisciplinary developmental care rounds in our center have helped in the promotion of developmentally supportive care for infants before and after cardiac surgery. This article discusses basic principles of developmental care, the role of each member of the interdisciplinary team on rounds, common developmental care practices integrated into care from rounds, and impacts to patients, families, and staff. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Maternal and developmental toxicity of the hallucinogenic plant-based beverage ayahuasca in rats.

    PubMed

    da Motta, Luciana Gueiros; de Morais, Juliana Alves; Tavares, Ana Carolina A M; Vianna, Leonora Maciel Sousa; Mortari, Marcia Renata; Amorim, Rivadávio Fernandes Batista; Carvalho, Rosângela R; Paumgartten, Francisco José R; Pic-Taylor, Aline; Caldas, Eloisa Dutra

    2018-04-01

    Rats were treated orally with ayahuasca (AYA) on gestation days (GD) 6-20 at doses corresponding to one-(1X) to eight-fold (8X) the average dose taken by a human adult in a religious ritual, and the pregnancy outcome evaluated on GD21. Rats treated with 4X and 8X doses died during the treatment period (44 and 52%), and those that survived showed kidney injury. Rats surviving the 8X dose showed neuronal loss in hippocampal regions and in the raphe nuclei, and those from the 2X dose neuronal loss in CA1. Delayed intrauterine growth, induced embryo deaths and increased occurrence of foetal anomalies were observed at the 8X dose. At non-lethal doses, AYA enhanced embryolethality and the incidence of foetal soft-tissue and skeleton anomalies. This study suggested that AYA is developmentally toxic and that its daily use by pregnant women may pose risks for the conceptus. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Use of information entropy measures of sitting postural sway to quantify developmental delay in infants

    PubMed Central

    Deffeyes, Joan E; Harbourne, Regina T; DeJong, Stacey L; Kyvelidou, Anastasia; Stuberg, Wayne A; Stergiou, Nicholas

    2009-01-01

    Background By quantifying the information entropy of postural sway data, the complexity of the postural movement of different populations can be assessed, giving insight into pathologic motor control functioning. Methods In this study, developmental delay of motor control function in infants was assessed by analysis of sitting postural sway data acquired from force plate center of pressure measurements. Two types of entropy measures were used: symbolic entropy, including a new asymmetric symbolic entropy measure, and approximate entropy, a more widely used entropy measure. For each method of analysis, parameters were adjusted to optimize the separation of the results from the infants with delayed development from infants with typical development. Results The method that gave the widest separation between the populations was the asymmetric symbolic entropy method, which we developed by modification of the symbolic entropy algorithm. The approximate entropy algorithm also performed well, using parameters optimized for the infant sitting data. The infants with delayed development were found to have less complex patterns of postural sway in the medial-lateral direction, and were found to have different left-right symmetry in their postural sway, as compared to typically developing infants. Conclusion The results of this study indicate that optimization of the entropy algorithm for infant sitting postural sway data can greatly improve the ability to separate the infants with developmental delay from typically developing infants. PMID:19671183

  12. Validity of False Belief Tasks in Blind Children

    ERIC Educational Resources Information Center

    Brambring, Michael; Asbrock, Doreen

    2010-01-01

    Previous studies have reported that congenitally blind children without any additional impairment reveal a developmental delay of at least 4 years in perspective taking based on testing first-order false-belief tasks. These authors interpret this delay as a sign of autism-like behavior. However, the delay may be caused by testing blind children…

  13. Comparison of Progressive Prompt Delay with and without Instructive Feedback

    ERIC Educational Resources Information Center

    Reichow, Brian; Wolery, Mark

    2011-01-01

    We examined the effectiveness and efficiency of 2 instructional arrangements using progressive prompt delay (PPD) with 3 young children with autism and 1 child with developmental delays. Specifically, we compared PPD with instructive feedback (IF) to PPD without IF in an adapted alternating treatment design. The results suggested that (a) children…

  14. Double trisomy (XXX+21 karyotype) in a six-year-old girl with down phenotype.

    PubMed

    Vergara-Mendez, Laura Daniela; Talero-Gutiérrez, Claudia; Velez-Van-Meerbeke, Alberto

    2018-03-01

    We describe a case of a six-year-old girl who presents multiple dysmorphic features characteristic of Down's syndrome. She has a significant general developmental delay, with a score that correspond to 32 months of developmental age. This delay is especially in language, with a very scant vocabulary. She communicates with some hand sign words or pointing, although her auditory responses in hearing test were normal. Two previous karyotype studies showed 47, XXX, +21 anomalies. This double trisomy is a rare condition described in isolated cases in the literature and none of these refers to the developmental aspects of these children (Balwan et al. 2008; Li et al. 2004; Park et al. 1995; Day et al. 1963).

  15. Effects of perfluorooctanoic acid (PFOA) on expression of ...

    EPA Pesticide Factsheets

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

  16. Progranulin regulates neurogenesis in the developing vertebrate retina.

    PubMed

    Walsh, Caroline E; Hitchcock, Peter F

    2017-09-01

    We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

  17. Developmental assessment of infants with biliary atresia: differences between boys and girls.

    PubMed

    Caudle, Susan E; Katzenstein, Jennifer M; Karpen, Saul; McLin, Valérie

    2012-10-01

    The aim of the present study was to investigate whether male and female infants with biliary atresia (BA) differ cognitively and to confirm previously documented developmental lags in infants with BA before liver transplantation. With the Mullen Scales of Early Learning, we examined 21 female and 12 male infants (ages 3-20 months) with BA, comparing scores across indices by sex and correlating Mullen Scales of Early Learning scores with standard clinical and biochemical parameters. Overall, both boys and girls were found to be vulnerable to developmental lags in the areas of expressive language (EL) and gross motor skills. In comparison with their male peers, girls were found to be weaker in the area of visual reception skills (P=0.05) with a trend found for EL (P=0.08). Girls were also found to have higher C-bilirubin levels and to be of shorter length. Growth parameters were found to be correlated with EL scores. International normalized ratio was found to be correlated with gross motor performance and with a trend also noted for fine motor skills. Age at Kasai predicted receptive language skills. As has been shown, infants with BA appear to be vulnerable to developmental lags before transplantation. In particular, female infants appear to be vulnerable to cognitive and skill delays in comparison with their male peers. C-bilirubin levels may play a role in this increased vulnerability for females.

  18. Delayed Phenotypic Expression of Growth Hormone Transgenesis during Early Ontogeny in Atlantic Salmon (Salmo salar)?

    PubMed Central

    Moreau, Darek T. R.; Gamperl, A. Kurt; Fletcher, Garth L.; Fleming, Ian A.

    2014-01-01

    Should growth hormone (GH) transgenic Atlantic salmon escape, there may be the potential for ecological and genetic impacts on wild populations. This study compared the developmental rate and respiratory metabolism of GH transgenic and non-transgenic full sibling Atlantic salmon during early ontogeny; a life history period of intense selection that may provide critical insight into the fitness consequences of escaped transgenics. Transgenesis did not affect the routine oxygen consumption of eyed embryos, newly hatched larvae or first-feeding juveniles. Moreover, the timing of early life history events was similar, with transgenic fish hatching less than one day earlier, on average, than their non-transgenic siblings. As the start of exogenous feeding neared, however, transgenic fish were somewhat developmentally behind, having more unused yolk and being slightly smaller than their non-transgenic siblings. Although such differences were found between transgenic and non-transgenic siblings, family differences were more important in explaining phenotypic variation. These findings suggest that biologically significant differences in fitness-related traits between GH transgenic and non-transgenic Atlantic salmon were less than family differences during the earliest life stages. The implications of these results are discussed in light of the ecological risk assessment of genetically modified animals. PMID:24763675

  19. Culture appropriate indicators for monitoring growth and development of urban and rural children below 6 years.

    PubMed

    Dixit, A; Govil, S; Patel, N V

    1992-03-01

    In this cross sectional study, 2000 apparently normal children aged 0-6 years (1200 urban and 800 rural), were nutritionally and developmentally assessed and their environment scrutinized for possible risk factors. Measurement of mid upper arm circumference (MUAC) using standard techniques revealed malnutrition in 44% of the rural and 24% of the urban children especially in the 2-6 years of age group. Culture appropriate indicators of psycho-social development picked up gross delays in gross motor (GM), vision and fine motor (V&FM) and language skills. Self help, concept hearing (SHCH) skills were recorded as normal while social skills were advanced particularly in the 0-2 years old urban group. By the use of the family protocols, low socio-economic status, malnutrition and 9 other risks factors have been generated for the urban group. No risk factor could be identified for the rural group. Better income emerged as the only real protective factor for the sample showing a direct positive relationship with the 45 skills tested, especially in the 2-6 years age group. Nineteen developmental skills were identified as powerful predictors of development. A prototype home based screening record was constructed for monitoring of growth and development which can be even used by minimally trained primary care worker.

  20. Fragile X syndrome and an isodicentric X chromosome in a woman with multiple anomalies, developmental delay, and normal pubertal development.

    PubMed

    Freedenberg, D L; Gane, L W; Richards, C S; Lampe, M; Hills, J; O'Connor, R; Manchester, D; Taylor, A; Tassone, F; Hulseberg, D; Hagerman, R J; Patil, S R

    1999-07-30

    We report on an individual with developmental delays, short stature, skeletal abnormalities, normal pubertal development, expansion of the fragile X triplet repeat, as well as an isodicentric X chromosome. S is a 19-year-old woman who presented for evaluation of developmental delay. Pregnancy was complicated by a threatened miscarriage. She was a healthy child with intellectual impairment noted in infancy. Although she had global delays, speech was noted to be disproportionately delayed with few words until age 3.5 years. Facial appearance was consistent with fragile X syndrome. Age of onset of menses was 11 years with normal breast development. A maternal male second cousin had been identified with fragile X syndrome based on DNA studies. The mother of this child (S's maternal first cousin) and the grandfather (S's maternal uncle) were both intellectually normal but were identified as carrying triplet expansions in the premutation range. S's mother had some school difficulties but was not identified as having global delays. Molecular analysis of S's fragile X alleles noted an expansion of more than 400 CGG repeats in one allele. Routine cytogenetic studies of peripheral blood noted the presence of an isodicentric X in 81of 86 cells scored. Five of 86 cells were noted to be 45,X. Cytogenetic fra(X) studies from peripheral blood showed that the structurally normal chromosome had the fragile site in approximately 16% of the cells. Analysis of maternal fragile X alleles identified an allele with an expansion to approximately 110 repeats. FMRP studies detected the expression of the protein in 24% of cells studied. To our knowledge, this is the first patient reported with an isodicentric X and fragile X syndrome. Whereas her clinical phenotype is suggestive of fragile X syndrome, her skeletal abnormalities may represent the presence of the isodicentric X. Treatment of S with 20 mg/day of Prozac improved her behavior. In the climate of cost con trol, this individual reinforces the recommendation of obtaining chromosomes on individuals with developmental delay even with a family history of fragile X syndrome. Copyright 1999 Wiley-Liss, Inc.

  1. Cochlear implant outcomes in children with motor developmental delay.

    PubMed

    Amirsalari, Susan; Yousefi, Jaleh; Radfar, Shokofeh; Saburi, Amin; Tavallaie, Seyed Abbas; Hosseini, Mohammad Javad; Noohi, Sima; Hassan Alifard, Mahdieh; Ajallouyean, Mohammad

    2012-01-01

    Multiple handicapped children and children with syndromes and conditions resulting additional disabilities such as cerebral palsy, global developmental delay and autistic spectrum disorder, are now not routinely precluded from receiving a cochlear implant. The primary focus of this study was to determine the effect of cochlear implants on the speech perception and intelligibility of deaf children with and without motor development delay. In a cohort study, we compared cochlear implant outcomes in two groups of deaf children with or without motor developmental delay (MDD). Among 262 children with pre-lingual profound hearing loss, 28 (10%) had a motor delay based on Gross Motor Function Classification (GMFC). Children with severe motor delays (classification scale levels 4 and 5) and cognitive delays were excluded. All children completed the Categories of Auditory Perception Scales (CAP) and Speech Intelligibility Rating (SIR) prior to surgery and 24 months after the device was activated. The mean age for the study population was 4.09 ± 1.86 years. In all 262 patients the mean CAP score after surgery (5.38 ± 0.043) had a marked difference in comparison with the mean score before surgery (0.482 ± 0.018) (P=0.001). The mean CAP score after surgery for MDD children was 5.03, and was 5.77 for normal motor development children (NMD). The mean SIR score after surgery for MDD children was 2.53, and was 2.66 for NMD children. The final results of CAP and SIR did not have significant difference between NMD children versus MDD children (P>0.05). Regarding to the result, we concluded that children with hearing loss and concomitant MDD as an additional disabilities can benefit from cochlear implantation similar to those of NMD. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  2. Beyond pragmatics: morphosyntactic development in autism.

    PubMed

    Eigsti, Inge-Marie; Bennetto, Loisa; Dadlani, Mamta B

    2007-07-01

    Language acquisition research in autism has traditionally focused on high-level pragmatic deficits. Few studies have examined grammatical abilities in autism, with mixed findings. The present study addresses this gap in the literature by providing a detailed investigation of syntactic and higher-level discourse abilities in verbal children with autism, age 5 years. Findings indicate clear language difficulties that go beyond what would be expected based on developmental level; specifically, syntactic delays, impairments in discourse management and increased production of non-meaningful words (jargon). The present study indicates a highly specific pattern of language impairments, and importantly, syntactic delays, in a group of children with autism carefully matched on lexical level and non-verbal mental age with children with developmental delays and typical development.

  3. An Examination of Specific Child Behavior Problems as Predictors of Parenting Stress among Families of Children with Pervasive Developmental Disorders

    ERIC Educational Resources Information Center

    Davis, Allyson L.; Neece, Cameron L.

    2017-01-01

    Introduction: Studies have shown that parents of children with pervasive developmental disorders (PDD) exhibit higher levels of stress than parents of typically developing children or children with other types of developmental delays (DD). This relationship appears to be mediated by elevated levels of behavior problems observed in children with…

  4. Genetics and the investigation of developmental delay/intellectual disability.

    PubMed

    Srour, Myriam; Shevell, Michael

    2014-04-01

    Global developmental delay and intellectual disabilities are common reasons for diagnostic assessment by paediatricians. There are a multiplicity of possible causes many of which have genetic, management and treatment implications for the child and family. Genetic causes are estimated to be responsible for approximately a quarter to one-half of identified cases. The multiplicity of individually rare genetic causes challenges the practitioner with respect to the selection of diagnostic tests and accurate diagnosis. To assist the practitioner practice guidelines have been formulated and these are reviewed and summarised in this particular article.

  5. Leopard spot retinal pigmentation in infancy indicating a peroxisomal disorder.

    PubMed

    Lyons, C J; Castano, G; McCormick, A Q; Applegarth, D

    2004-02-01

    Neonatal adrenoleucodystrophy (NALD) is a rare disorder resulting from abnormal peroxisomal biogenesis. Affected patients present in infancy with developmental delay, hypotonia, and seizures. Blindness and nystagmus are prominent features. The authors suggest a characteristic leopard spot pigmentary pattern in the peripheral retina to be diagnostic. Three patients are reported with this presentation; the characteristic retinal appearance resulted in early diagnosis for one of these. Leopard spot retinopathy in an infant with hypotonia, seizures, developmental delay, with or without dysmorphic features and hearing impairment, is a clue to the diagnosis of NALD.

  6. Developmental Risk and Goodness of Fit in the Mother-Child Relationship: Links to Parenting Stress and Children's Behaviour Problems.

    PubMed

    Newland, Rebecca P; Crnic, Keith A

    2017-01-01

    Despite the compelling nature of goodness of fit, empirical support has lagged for this construct. The present study examined an interactional approach to measuring goodness of fit and prospectively explored associations with mother-child relationship quality, child behavior problems, and parenting stress across the preschool period. In addition, as goodness of fit might be particularly important for children at developmental risk, the presence of early developmental delay was considered as a moderator of goodness of fit processes. Children with ( n = 110) and without ( n = 137) developmental delays and their mothers were coded while interacting in the lab at child age 36 months and during naturalistic home observations at child ages 36 and 48 months. Mothers also completed questionnaires at child age 60 months. Results highlight the effects of child developmental risk as a moderator of mother-child goodness of fit processes across the preschool period. There was also evidence that the goodness of fit between maternal scaffolding and child activity level at 36 months influenced both mother and child functioning at 60 months. Findings call for more precise models and expanded developmental perspectives to fully capture the transactional and dynamic nature of goodness of fit.

  7. Developmental timing differences underlie armor loss across threespine stickleback populations.

    PubMed

    Currey, Mark C; Bassham, Susan; Perry, Stephen; Cresko, William A

    2017-11-01

    Comparing ontogenetic patterns within a well-described evolutionary context aids in inferring mechanisms of change, including heterochronies or deletion of developmental pathways. Because selection acts on phenotypes throughout ontogeny, any within-taxon developmental variation has implications for evolvability. We compare ontogenetic order and timing of locomotion and defensive traits in three populations of threespine stickleback that have evolutionarily divergent adult forms. This analysis adds to the growing understanding of developmental genetic mechanisms of adaptive change in this evolutionary model species by delineating when chondrogenesis and osteogenesis in two derived populations begin to deviate from the developmental pattern in their immediate ancestors. We found that differences in adult defensive morphologies arise through abolished or delayed initiation of these traits rather than via an overall heterochronic shift, that intra-population ontogenetic variation is increased for some derived traits, and that altered armor developmental timing differentiates the derived populations from each other despite parallels in adult lateral plate armor phenotypes. We found that changes in ossified elements of the pelvic armor are linked to delayed and incomplete development of an early-forming pelvic cartilage, and that this disruption likely presages the variable pelvic vestiges documented in many derived populations. © 2017 Wiley Periodicals, Inc.

  8. Recognition of clinical characteristics for population-based surveillance of fetal alcohol syndrome.

    PubMed

    Andrews, Jennifer G; Galindo, Maureen K; Meaney, F John; Benavides, Argelia; Mayate, Linnette; Fox, Deborah; Pettygrove, Sydney; O'Leary, Leslie; Cunniff, Christopher

    2018-06-01

    The diagnosis of fetal alcohol syndrome (FAS) rests on identification of characteristic facial, growth, and central nervous system (CNS) features. Public health surveillance of FAS depends on documentation of these characteristics. We evaluated if reporting of FAS characteristics is associated with the type of provider examining the child. We analyzed cases aged 7-9 years from the Fetal Alcohol Syndrome Surveillance Network II (FASSNetII). We included cases whose surveillance records included the type of provider (qualifying provider: developmental pediatrician, geneticist, neonatologist; other physician; or other provider) who evaluated the child as well as the FAS diagnostic characteristics (facial dysmorphology, CNS impairment, and/or growth deficiency) reported by the provider. A total of 345 cases were eligible for this analysis. Of these, 188 (54.5%) had adequate information on type of provider. Qualifying physicians averaged more than six reported FAS characteristics while other providers averaged less than five. Qualifying physicians reported on facial characteristics and developmental delay more frequently than other providers. Also, qualifying physicians reported on all three domains of characteristics (facial, CNS, and growth) in 97% of cases while others reported all three characteristics on two thirds of cases. Documentation in medical records during clinical evaluations for FAS is lower than optimal for cross-provider communication and surveillance purposes. Lack of documentation limits the quality and quantity of information in records that serve as a major source of data for public health surveillance systems. © 2018 Wiley Periodicals, Inc.

  9. What is the value of growth hormone therapy in Prader Willi syndrome?

    PubMed

    Bridges, Nicola

    2014-02-01

    Prader Willi syndrome (PWS) is a genetic condition caused by loss of the paternal copy of a region of imprinted genes on chromosome 15. There is severe muscular hypotonia in the neonatal period, with the onset of hyperphagia and food-seeking behaviour in childhood. All individuals with PWS have developmental delay. Without careful control of food intake and the food environment, individuals with PWS become morbidly obese and are likely to die as young adults from the complications of obesity. The aims of growth hormone (GH) treatment in PWS are distinct from the use of GH in other conditions-although GH does increase final height in PWS, the main benefits of treatment are improved body composition and better exercise capacity, which can help with the aim of preventing obesity. GH trials in PWS have demonstrated improved muscle bulk, reduced fat mass and increased levels of physical activity. GH has also been demonstrated to improve attainment of developmental and cognitive milestones in children with PWS. GH treatment appears to change respiratory status in PWS, possibly because of growth of lymphoid tissue at the start of treatment. Respiratory assessment is recommended prior to, and just after starting GH treatment. Ideal age for starting GH is not clear, although there has been a trend towards starting at younger ages. It may be that GH treatment in childhood confers benefits into adult life. There are less data to support continuing GH treatment into adult life.

  10. The study on achievement of motor milestones and associated factors among children in rural North India

    PubMed Central

    Gupta, Arti; Kalaivani, Mani; Gupta, Sanjeev Kumar; Rai, Sanjay K.; Nongkynrih, Baridalyne

    2016-01-01

    Background: Nearly 14% of children worldwide do not reach their developmental potential in early childhood. The early identification of delays in achieving milestones is critical. The World Health Organization (WHO) has developed normal age ranges for the achievement of motor milestones by healthy children. This study aimed to assess the gross motor developmental achievements and associated factors among children in rural India. Materials and Methods: A cross-sectional study was conducted with rural children in North India. A pretested questionnaire was used to collect the data. The median age at the time of the highest observed milestone was calculated and compared with the WHO windows of achievement. Results: Overall, 221 children aged 4–18 months were included in the study. The median age of motor development exhibited a 0.1–2.1-month delay compared to the WHO median age of motor milestone achievement. The prevalence of the gross motor milestone achievements for each of the six milestones ranged from 91.6% to 98.4%. Developmental delay was observed in 6.3% of the children. After adjusting for different variables, children with birth order of second or more were found to be significantly associated with the timely achievement of gross motor milestones. Conclusion: The apparently healthy children of the rural area of Haryana achieved gross motor milestones with some delay with respect to the WHO windows of achievement. Although the median value of this delay was low, awareness campaigns should be implemented to promote timely identification of children with development delays. PMID:27843845

  11. Natural history of rhizomelic chondrodysplasia punctata.

    PubMed

    White, Amy L; Modaff, Peggy; Holland-Morris, Francesca; Pauli, Richard M

    2003-05-01

    Rhizomelic chondrodysplasia punctata (RCP) is a rare autosomal recessive disorder with many associated medical complications. Prior to this study, natural history information about RCP was limited and based on experiences with small populations of affected individuals. We delineate the natural history of RCP through systematic analysis of 35 previously unreported individuals (as well as review of 62 literature cases with respect to survival and cause of death). Survival, growth, and developmental expectations and medical needs are summarized based upon experience with this population. Survival is greater among this population than previously reported, with 90% surviving up to 1 year and 50% surviving up to 6 years. Cause of death is most often respiratory problem. All infants with RCP have joint contractures, bilateral cataracts, and severe growth and psychomotor delays. Recommendations for health supervision of children with RCP and for parental counseling are presented. Copyright 2003 Wiley-Liss, Inc.

  12. Early childhood neurodevelopment after intrauterine growth restriction: a systematic review.

    PubMed

    Levine, Terri A; Grunau, Ruth E; McAuliffe, Fionnuala M; Pinnamaneni, RagaMallika; Foran, Adrienne; Alderdice, Fiona A

    2015-01-01

    Children who experienced intrauterine growth restriction (IUGR) may be at increased risk for adverse developmental outcomes in early childhood. The objective of this study was to carry out a systematic review of neurodevelopmental outcomes from 6 months to 3 years after IUGR. PubMed, Embase, PsycINFO, Maternity and Infant Care, and CINAHL databases were searched by using the search terms intrauterine, fetal, growth restriction, child development, neurodevelopment, early childhood, cognitive, motor, speech, language. Studies were eligible for inclusion if participants met specified criteria for growth restriction, follow-up was conducted within 6 months to 3 years, methods were adequately described, non-IUGR comparison groups were included, and full English text of the article was available. A specifically designed data extraction form was used. The methodological quality of included studies was assessed using well-documented quality-appraisal guidelines. Of 731 studies reviewed, 16 were included. Poorer neurodevelopmental outcomes after IUGR were described in 11. Ten found motor, 8 cognitive, and 7 language delays. Other delays included social development, attention, and adaptive behavior. Only 8 included abnormal Doppler parameters in their definitions of IUGR. Evidence suggests that children are at risk for poorer neurodevelopmental outcomes following IUGR from 6 months to 3 years of age. The heterogeneity of primary outcomes, assessment measures, adjustment for confounding variables, and definitions of IUGR limits synthesis and interpretation. Sample sizes in most studies were small, and some examined preterm IUGR children without including term IUGR or AGA comparison groups, limiting the value of extant studies. Copyright © 2015 by the American Academy of Pediatrics.

  13. Individual Differences in Maternal Stress, Child Temperament and Mother-Child Interaction with Developmentally Delayed Preschoolers.

    ERIC Educational Resources Information Center

    Marcovitch, Sharon; And Others

    Parental stress and supports, child temperament and mother-child interaction in free play were assessed in three groups of families of delayed preschoolers: 40 children with Down's Syndrome, 29 children with neurological impairments, and 40 children with delayed development of unknown etiology. In addition to a number of instruments completed by…

  14. Alagille syndrome with deletion 20p12.2-p12.3 and hypoplastic left heart.

    PubMed

    Robert, Marie Leema P; Lopez, Tony; Crolla, John; Huang, Shuwen; Owen, Carol; Burvill-Holmes, Lisa; Stumper, Oliver; Turnpenny, Peter D

    2007-10-01

    We report a male patient born at 37-weeks gestation, weighing 1.885 kg (<0.4th centile). Shortly after birth, he was diagnosed with hypoplastic left heart syndrome for which he underwent a Norwood procedure. Subsequently, he developed problems with failure to thrive and developmental delay. At the age of 4 years his delay in growth and development led to further investigations, which revealed a small de-novo interstitial deletion of chromosome 20p12.2. JAGGED1 haploinsufficiency was confirmed by fluorescence in situ hybridization. Array-comparative genomic hybridization analysis confirmed and quantified an approximate 5.4 Mb interstitial deletion involving the chromosomal region 20p12.2-p12.3. This precise interstitial deletion has not been previously reported. Further clinical evaluation revealed posterior embryotoxon and butterfly vertebrae. He has normal liver function tests, facial features consistent with Alagille syndrome, and mild learning difficulties. To our knowledge this is the first report of Alagille syndrome associated with hypoplastic left heart syndrome.

  15. Optimism and positive and negative feelings in parents of young children with developmental delay.

    PubMed

    Kurtz-Nelson, E; McIntyre, L L

    2017-07-01

    Parents' positive and negative feelings about their young children influence both parenting behaviour and child problem behaviour. Research has not previously examined factors that contribute to positive and negative feelings in parents of young children with developmental delay (DD). The present study sought to examine whether optimism, a known protective factor for parents of children with DD, was predictive of positive and negative feelings for these parents. Data were collected from 119 parents of preschool-aged children with developmental delay. Two separate hierarchical linear regression analyses were conducted to determine if optimism significantly predicted positive feelings and negative feelings and whether optimism moderated relations between parenting stress and parent feelings. Increased optimism was found to predict increased positive feelings and decreased negative feelings after controlling for child problem behaviour and parenting stress. In addition, optimism was found to moderate the relation between parenting stress and positive feelings. Results suggest that optimism may impact how parents perceive their children with DD. Future research should examine how positive and negative feelings impact positive parenting behaviour and the trajectory of problem behaviour specifically for children with DD. © 2017 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.

  16. Neuroanatomy of Individual Differences in Language in Adult Males with Autism

    PubMed Central

    Lai, Meng-Chuan; Lombardo, Michael V.; Ecker, Christine; Chakrabarti, Bhismadev; Suckling, John; Bullmore, Edward T.; Happé, Francesca; Murphy, Declan G. M.; Baron-Cohen, Simon

    2015-01-01

    One potential source of heterogeneity within autism spectrum conditions (ASC) is language development and ability. In 80 high-functioning male adults with ASC, we tested if variations in developmental and current structural language are associated with current neuroanatomy. Groups with and without language delay differed behaviorally in early social reciprocity, current language, but not current autistic features. Language delay was associated with larger total gray matter (GM) volume, smaller relative volume at bilateral insula, ventral basal ganglia, and right superior, middle, and polar temporal structures, and larger relative volume at pons and medulla oblongata in adulthood. Despite this heterogeneity, those with and without language delay showed significant commonality in morphometric features when contrasted with matched neurotypical individuals (n = 57). In ASC, better current language was associated with increased GM volume in bilateral temporal pole, superior temporal regions, dorsolateral fronto-parietal and cerebellar structures, and increased white matter volume in distributed frontal and insular regions. Furthermore, current language–neuroanatomy correlation patterns were similar across subgroups with or without language delay. High-functioning adult males with ASC show neuroanatomical variations associated with both developmental and current language characteristics. This underscores the importance of including both developmental and current language as specifiers for ASC, to help clarify heterogeneity. PMID:25249409

  17. Histone deacetylases regulate multicellular development in the social amoeba Dictyostelium discoideum.

    PubMed

    Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand

    2009-09-04

    Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.

  18. Developmental Delays in Executive Function from 3 to 5 Years of Age Predict Kindergarten Academic Readiness.

    PubMed

    Willoughby, Michael T; Magnus, Brooke; Vernon-Feagans, Lynne; Blair, Clancy B

    Substantial evidence has established that individual differences in executive function (EF) in early childhood are uniquely predictive of children's academic readiness at school entry. The current study tested whether growth trajectories of EF across the early childhood period could be used to identify a subset of children who were at pronounced risk for academic impairment in kindergarten. Using data that were collected at the age 3, 4, and 5 home assessments in the Family Life Project ( N = 1,120), growth mixture models were used to identify 9% of children who exhibited impaired EF performance (i.e., persistently low levels of EF that did not show expected improvements across time). Compared to children who exhibited typical trajectories of EF, the delayed group exhibited substantial impairments in multiple indicators of academic readiness in kindergarten (Cohen's ds = 0.9-2.7; odds ratios = 9.8-23.8). Although reduced in magnitude following control for a range of socioeconomic and cognitive (general intelligence screener, receptive vocabulary) covariates, moderate-sized group differences remained (Cohen's ds = 0.2-2.4; odds ratios = 3.9-5.4). Results are discussed with respect to the use of repeated measures of EF as a method of early identification, as well as the resulting translational implications of doing so.

  19. Development and validation of Trivandrum Development Screening Chart for children aged 0-6 years [TDSC (0-6)].

    PubMed

    Nair, M K C; Nair, G S Harikumaran; George, Babu; Suma, N; Neethu, C; Leena, M L; Russell, Paul Swamidhas Sudhakar

    2013-11-01

    To develop and validate a simple screening tool for identifying developmental delay among children of 0-6 y of age in the community. The 51-items of Trivandrum Development Screening Chart for children of 0-6 y [TDSC (0-6 y)], were carefully prepared from the norms in various existing developmental charts/scales, by experts keeping in mind the face validity and content validity. The criterion validity was assessed in a community sample of 1,183 children of 0-6 y with a mean age of 35.38 mo (SD of 19.25) including 597 (50.46%) boys and 586 (49.54%) girls. TDSC (0-6 y) was validated against Denver Developmental Screening Test (DDST) as the 'Reference Standard'. When one item delay in TDSC (0-6 y) was considered as 'TDSC delay' (test positive), the sensitivity and specificity of TDSC (0-6 y) was found to be 84.62% (95% CI: 71.92-93.12) and 90.8% (95% CI: 88.97-92.43) respectively with a Negative Predictive Value of 99.23% (95% CI: 98.48-99.67) and LR (negative) of 0.17(95% CI: 0.09-0.32). The test-retest and inter-rater reliability [an interclass correlation (ICC) of 0.77 for test-retest and ICC of 0.97 for inter-rater] were good and acceptable. TDSC (0-6 y) is a simple, reliable and valid screening tool for use in the community to identify children between 0 and 6 y with developmental delay, enabling early intervention practices.

  20. Parent Training for Children With or at Risk for Developmental Delay: The Role of Parental Homework Completion.

    PubMed

    Ros, Rosmary; Hernandez, Jennifer; Graziano, Paulo A; Bagner, Daniel M

    2016-01-01

    This study investigated the extent to which parental homework completion during behavioral parent training (BPT) for children with or at risk for developmental delay contributed to parenting and child outcomes. Parents of 48 children (Mage=44.17 months, SD=14.29; 73% male; 72% White) with developmental delay (IQ<75) or at risk for developmental delay (due to premature birth) with co-occurring clinically elevated externalizing behavior problems received Parent-Child Interaction Therapy (PCIT) as part of two previously completed randomized controlled trials. Parental homework completion was measured using parental report of home practice of treatment skills collected weekly by therapists. Parents also reported on child externalizing behavior problems and levels of parenting stress, while parenting skills were observed during a 5-min child directed play and child compliance was observed during a 5-min cleanup situation. Results indicated that higher rates of parental homework completion predicted parenting outcomes (i.e., increased positive parenting skills and decreased levels of parenting stress) and child outcomes (i.e., lower levels of externalizing behavior problems). Additionally, although limited by temporal precedence, there was an indirect effect of reductions in parenting stress on the negative association between parental homework completion and child externalizing behavior problems. These findings highlight the importance of parents practicing skills learned during BPT for optimizing treatment outcome. Parenting stress was also identified as a potential mechanism by which high levels of parental homework completion contributed to reductions in child externalizing behavior problems. Copyright © 2015. Published by Elsevier Ltd.

  1. In utero azathioprine exposure and increased utilization of special educational services in children born to mothers with systemic lupus erythematosus

    PubMed Central

    Marder, Wendy; Ganser, Martha A; Romero, Vivian; Hyzy, Margaret A; Gordon, Caroline; McCune, WJ; Somers, Emily C

    2012-01-01

    Objective Azathioprine (AZA) is recognized among immunosuppressive medications as relatively safe during pregnancy for women with systemic lupus erythematosus (SLE) requiring aggressive treatment. This pilot study aimed to determine whether SLE therapy during pregnancy was associated with developmental delays in offspring. Methods This cohort study included SLE patients with at least one live birth post-diagnosis. Medical histories were obtained via interviews and chart review. Multiple logistic regression was used to examine associations between SLE therapy during pregnancy and maternal report of special educational (SE) requirements (as proxy for developmental delays) among offspring. Propensity scoring (incorporating corticosteroid use, lupus flare, and lupus nephritis) was used to account for disease severity. Results Of 60 eligible offspring from 38 mothers, 15 required SE services, the most common indication for which was speech delay. 7 of the 13 (54%) children with in utero AZA exposure utilized SE services versus 8 of 47 (17%) non-exposed (p<0.05). After adjustment for pregnancy duration, small for gestational age, propensity score, maternal education and antiphospholipid antibody syndrome, AZA was significantly associated with SE utilization occurring from age 2 onward (OR 6.6, 95% CI 1.0, 43.3), and bordered significance for utilization at any age or age <2 years. Conclusions AZA exposure during SLE pregnancy was independently associated with increased SE utilization in offspring, after controlling for confounders. Further research is indicated to fully characterize developmental outcomes among offspring with in utero AZA exposure. Vigilance and early interventions for suspected developmental delays among exposed offspring may be warranted. PMID:23139238

  2. Positive Parenting Practices, Health Disparities, and Developmental Progress.

    PubMed

    Shah, Reshma; Sobotka, Sarah A; Chen, Yi-Fan; Msall, Michael E

    2015-08-01

    To describe interactive activities between parents and young children in a nationally representative sample. We hypothesized that the frequency of participation in interactive activities would be different across economic strata and would be associated with developmental delay. Children 4 to 36 months of age were identified by using The National Survey of Children's Health 2011-2012. Interactive caregiving practices were reported by poverty status. Developmental concerns were derived from caregiver responses and scoring of the Parents Evaluation of Developmental Status. Multivariable logistic regressions with weighting were used to explore the effect of interactive practices on risk for developmental delay across poverty levels. Covariates including age, gender, insurance type, maternal education, parenting stress, and ethnicity were adjusted in the models. In our sample (n = 12,642), caregivers with the lowest income versus highest income reported lower participation in reading (33% vs 64%; P < .0001), singing or telling stories (52% vs 77%, P < .0001), and taking their child on an outing (13% vs 22%, P < .0001). Less frequent participation in interactive activities during the week were associated with increased risk of developmental delay among low-income families (Reading odds ratio [OR] 1.57, 95% confidence interval [CI] 1.15-2.13; Singing songs/Telling Stories OR 1.66, 95% CI 1.15-2.40; Outings OR 1.48, 95% CI 1.11-1.97). Despite evidence emphasizing the protective effects of supportive parenting practices on early child development, our work demonstrates significant disparities in parenting practices that promote early child development between economically advantaged and disadvantaged parents. Innovative population-level strategies that enrich parenting practices for vulnerable children in early childhood are needed. Copyright © 2015 by the American Academy of Pediatrics.

  3. Early childhood development in deprived urban settlements.

    PubMed

    Nair, M K C; Radhakrishnan, S Rekha

    2004-03-01

    Poverty, the root cause of the existence of slums or settlement colonies in urban areas has a great impact on almost all aspects of life of the urban poor, especially the all-round development of children. Examples from countries, across the globe provide evidence of improved early child development, made possible through integrated slum improvement programs, are few in numbers. The observed 2.5% prevalence of developmental delay in the less than 2 year olds of deprived urban settlements, the presence of risk factors for developmental delay like low birth weight, birth asphyxia, coupled with poor environment of home and alternate child care services, highlights the need for simple cost effective community model for promoting early child development. This review on early child development focuses on the developmental status of children in the deprived urban settlements, who are yet to be on the priority list of Governments and international agencies working for the welfare of children, the contributory nature-nurture factors and replicable working models like infant stimulation, early detection of developmental delay in infancy itself, developmental screening of toddlers, skill assessment for preschool children, school readiness programs, identification of mental sub-normality and primary education enhancement program for primary school children. Further, the review probes feasible intervention strategies through community owned early child care and development facilities, utilizing existing programs like ICDS, Urban Basic Services and by initiating services like Development Friendly Well Baby Clinics, Community Extension services, Child Development Referral Units at district hospitals and involving trained manpower like anganwadi/creche workers, public health nurses and developmental therapists. With the decentralization process the local self-government at municipalities and city corporations are financially equipped to be the prime movers to initiate, monitor and promote early child development programs, to emerge as a part and parcel of community owned sustainable development process.

  4. The Role of Developmental Screening Practices in Early Diagnosis of Autism Spectrum Disorders: An Analysis of All-Payer Claims Data in New Hampshire

    ERIC Educational Resources Information Center

    Humphreys, Betsy P.

    2013-01-01

    Universal developmental screening during pediatric well child care detects early delays in development and is a critical gateway to early intervention for young children at risk for Autism Spectrum Disorders (ASD). Developmental screening practices are highly variable, and few studies have examined screening utilization for children at risk for…

  5. Rourke Baby Record 2014: Evidence-based tool for the health of infants and children from birth to age 5.

    PubMed

    Riverin, Bruno; Li, Patricia; Rourke, Leslie; Leduc, Denis; Rourke, James

    2015-11-01

    To update the 2011 edition of the Rourke Baby Record (RBR) by reviewing current best evidence on health supervision of infants and children from birth to 5 years of age. The quality of evidence was rated with the former (until 2006) Canadian Task Force on Preventive Health Care classification system and GRADE (grading of recommendations, assessment, development, and evaluation) approach. New evidence has been incorporated into the 2014 RBR recommendations related to growth monitoring, nutrition, education and advice, development, physical examination, and immunization. Growth is monitored with the World Health Organization growth charts that were revised in 2014. Infants' introduction to solid foods should be based on infant readiness and include iron-containing food products. Delaying introduction to common food allergens is not currently recommended to prevent food allergies. At 12 months of age, use of an open cup instead of a sippy cup should be promoted. The education and advice section counsels on injuries from unstable furniture and on the use of rear-facing car seats until age 2, and also includes information on healthy sleep habits, prevention of child maltreatment, family healthy active living and sedentary behaviour, and oral health. The education and advice section has also added a new environmental health category to account for the effects of environmental hazards on child health. The RBR uses broad developmental surveillance to recognize children who might be at risk of developmental delays. Verifying tongue mobility and patency of the anus is included in the physical examination during the first well-baby visit. The 2014 RBR also provides updates regarding the measles-mumps-rubella, live attenuated influenza, and human papillomavirus vaccines. The 2014 RBR is the most recent update of a longstanding evidence-based, practical knowledge translation tool with related Web-based resources to be used by both health care professionals and parents for preventive health care during early childhood. The 2014 RBR is endorsed by the Canadian Paediatric Society, the College of Family Physicians of Canada, and the Dietitians of Canada. National and Ontario versions of the RBR are available in English and French. Copyright© the College of Family Physicians of Canada.

  6. Rourke Baby Record 2014

    PubMed Central

    Riverin, Bruno; Li, Patricia; Rourke, Leslie; Leduc, Denis; Rourke, James

    2015-01-01

    Abstract Objective To update the 2011 edition of the Rourke Baby Record (RBR) by reviewing current best evidence on health supervision of infants and children from birth to 5 years of age. Quality of evidence The quality of evidence was rated with the former (until 2006) Canadian Task Force on Preventive Health Care classification system and GRADE (grading of recommendations, assessment, development, and evaluation) approach. Main message New evidence has been incorporated into the 2014 RBR recommendations related to growth monitoring, nutrition, education and advice, development, physical examination, and immunization. Growth is monitored with the World Health Organization growth charts that were revised in 2014. Infants’ introduction to solid foods should be based on infant readiness and include iron-containing food products. Delaying introduction to common food allergens is not currently recommended to prevent food allergies. At 12 months of age, use of an open cup instead of a sippy cup should be promoted. The education and advice section counsels on injuries from unstable furniture and on the use of rear-facing car seats until age 2, and also includes information on healthy sleep habits, prevention of child maltreatment, family healthy active living and sedentary behaviour, and oral health. The education and advice section has also added a new environmental health category to account for the effects of environmental hazards on child health. The RBR uses broad developmental surveillance to recognize children who might be at risk of developmental delays. Verifying tongue mobility and patency of the anus is included in the physical examination during the first well-baby visit. The 2014 RBR also provides updates regarding the measles-mumps-rubella, live attenuated influenza, and human papillomavirus vaccines. Conclusion The 2014 RBR is the most recent update of a longstanding evidence-based, practical knowledge translation tool with related Web-based resources to be used by both health care professionals and parents for preventive health care during early childhood. The 2014 RBR is endorsed by the Canadian Paediatric Society, the College of Family Physicians of Canada, and the Dietitians of Canada. National and Ontario versions of the RBR are available in English and French. PMID:26564653

  7. Beneficial microbes affect endogenous mechanisms controlling root development

    PubMed Central

    Verbon, Eline H.; Liberman, Louisa M.

    2016-01-01

    Plants have incredible developmental plasticity, enabling them to respond to a wide range of environmental conditions. Among these conditions is the presence of plant growth-promoting rhizobacteria (PGPR) in the soil. Recent studies show that PGPR affect root growth and development within Arabidopsis thaliana root. These effects lead to dramatic changes in root system architecture, that significantly impact aboveground plant growth. Thus, PGPR may promote shoot growth via their effect on root developmental programs. This review focuses on contextualizing root developmental changes elicited by PGPR in light of our understanding of plant-microbe interactions and root developmental biology. PMID:26875056

  8. Association Between Moderate and Late Preterm Birth and Neurodevelopment and Social-Emotional Development at Age 2 Years.

    PubMed

    Cheong, Jeanie L; Doyle, Lex W; Burnett, Alice C; Lee, Katherine J; Walsh, Jennifer M; Potter, Cody R; Treyvaud, Karli; Thompson, Deanne K; Olsen, Joy E; Anderson, Peter J; Spittle, Alicia J

    2017-04-03

    Moderate and late preterm (MLPT) births comprise most preterm infants. Therefore, long-term developmental concerns in this population potentially have a large public health influence. While there are increasing reports of developmental problems in MLPT children, detail is lacking on the precise domains that are affected. To compare neurodevelopment and social-emotional development between MLPT infants and term-born control infants at age 2 years. This investigation was a prospective longitudinal cohort study at a single tertiary hospital. Participants were MLPT infants (32-36 weeks' completed gestation) and healthy full-term controls (≥37 weeks' gestation) recruited at birth. During a 3-year period between December 7, 2009, and November 7, 2012, MLPT infants were recruited at birth from the neonatal unit and postnatal wards of the Royal Women's Hospital, Melbourne, Australia. The term control recruitment extended to March 26, 2014. The dates of the data developmental assessments were February 23, 2012, to April 8, 2016. Moderate and late preterm birth. Cerebral palsy, blindness, and deafness assessed by a pediatrician; cognitive, language, and motor development assessed using the Bayley Scales of Infant Development-Third Edition (developmental delay was defined as less than -1 SD relative to the mean in controls in any domain of the scales); and social-emotional and behavioral problems assessed by a parent questionnaire (Infant Toddler Social Emotional Assessment). Outcomes were compared between birth groups using linear and logistic regression, adjusted for social risk. In total, 198 MLPT infants (98.5% of 201 recruited) and 183 term-born controls (91.0% of 201 recruited) were assessed at 2 years' corrected age. Compared with controls, MLPT children had worse cognitive, language, and motor development at age 2 years, with adjusted composite score mean differences of -5.3 (95% CI, -8.2 to -2.4) for cognitive development, -11.4 (95% CI, -15.3 to -7.5) for language development, and -7.3 (95% CI, -10.6 to -3.9) for motor development. The odds of developmental delay were higher in the MLPT group compared with controls, with adjusted odds ratios of 1.8 (95% CI, 1.1-3.0) for cognitive delay, 3.1 (95% CI, 1.8-5.2) for language delay, and 2.4 (95% CI, 1.3-4.5) for motor delay. Overall social-emotional competence was worse in MLPT children compared with controls (t statistic mean difference, -3.6 (95% CI, -5.8 to -1.4), but other behavioral domains were similar. The odds of being at risk for social-emotional competence were 3.9 (95% CI, 1.4-10.9) for MLPT children compared with controls. Moderate and late preterm children exhibited developmental delay compared with their term-born peers, most marked in the language domain. This knowledge of developmental needs in MLPT infants will assist in targeting surveillance and intervention.

  9. Nerve-muscle interactions during flight muscle development in Drosophila

    NASA Technical Reports Server (NTRS)

    Fernandes, J. J.; Keshishian, H.

    1998-01-01

    During Drosophila pupal metamorphosis, the motoneurons and muscles differentiate synchronously, providing an opportunity for extensive intercellular regulation during synapse formation. We examined the existence of such interactions by developmentally delaying or permanently eliminating synaptic partners during the formation of indirect flight muscles. When we experimentally delayed muscle development, we found that although adult-specific primary motoneuron branching still occurred, the higher order (synaptic) branching was suspended until the delayed muscle fibers reached a favourable developmental state. In reciprocal experiments we found that denervation caused a decrease in the myoblast pool. Furthermore, the formation of certain muscle fibers (dorsoventral muscles) was specifically blocked. Exceptions were the adult muscles that use larval muscle fibers as myoblast fusion targets (dorsal longitudinal muscles). However, when these muscles were experimentally compelled to develop without their larval precursors, they showed an absolute dependence on the motoneurons for their formation. These data show that the size of the myoblast pool and early events in fiber formation depend on the presence of the nerve, and that, conversely, peripheral arbor development and synaptogenesis is closely synchronized with the developmental state of the muscle.

  10. De novo PHIP-predicted deleterious variants are associated with developmental delay, intellectual disability, obesity, and dysmorphic features.

    PubMed

    Webster, Emily; Cho, Megan T; Alexander, Nora; Desai, Sonal; Naidu, Sakkubai; Bekheirnia, Mir Reza; Lewis, Andrea; Retterer, Kyle; Juusola, Jane; Chung, Wendy K

    2016-11-01

    Using whole-exome sequencing, we have identified novel de novo heterozygous pleckstrin homology domain-interacting protein ( PHIP ) variants that are predicted to be deleterious, including a frameshift deletion, in two unrelated patients with common clinical features of developmental delay, intellectual disability, anxiety, hypotonia, poor balance, obesity, and dysmorphic features. A nonsense mutation in PHIP has previously been associated with similar clinical features. Patients with microdeletions of 6q14.1, including PHIP , have a similar phenotype of developmental delay, intellectual disability, hypotonia, and obesity, suggesting that the phenotype of our patients is a result of loss-of-function mutations. PHIP produces multiple protein products, such as PHIP1 (also known as DCAF14), PHIP, and NDRP. PHIP1 is one of the multiple substrate receptors of the proteolytic CUL4-DDB1 ubiquitin ligase complex. CUL4B deficiency has been associated with intellectual disability, central obesity, muscle wasting, and dysmorphic features. The overlapping phenotype associated with CUL4B deficiency suggests that PHIP mutations cause disease through disruption of the ubiquitin ligase pathway.

  11. 11p15 duplication and 13q34 deletion with Beckwith-Wiedemann syndrome and factor VII deficiency.

    PubMed

    Jurkiewicz, Dorota; Kugaudo, Monika; Tańska, Anna; Wawrzkiewicz-Witkowska, Angelika; Tomaszewska, Agnieszka; Kucharczyk, Marzena; Cieślikowska, Agata; Ciara, Elżbieta; Krajewska-Walasek, Małgorzata

    2015-06-01

    Here we report a patient with 11p15.4p15.5 duplication and 13q34 deletion presenting with Beckwith-Wiedemann syndrome (BWS) and moderate deficiency of factor VII (FVII). The duplication was initially diagnosed on methylation-sensitive multiplex ligation-dependent probe amplification. Array comparative genome hybridization confirmed its presence and indicated a 13q34 distal deletion. The patient's clinical symptoms, including developmental delay and facial dysmorphism, were typical of BWS with paternal 11p15 trisomy. Partial 13q monosomy in this patient is associated with moderate deficiency of FVII and may also overlap with a few symptoms of paternal 11p15 trisomy such as developmental delay and some facial features. To our knowledge this is the first report of 11p15.4p15.5 duplication associated with deletion of 13q34 and FVII deficiency. Moreover, this report emphasizes the importance of detailed clinical as well as molecular examinations in patients with BWS features and developmental delay. © 2015 Japan Pediatric Society.

  12. A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay.

    PubMed

    Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming

    2016-01-01

    Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

  13. Cytogenetic Studies of Rwandan Pediatric Patients Presenting with Global Developmental Delay, Intellectual Disability and/or Multiple Congenital Anomalies

    PubMed Central

    Uwineza, Annette; Hitayezu, Janvier; Jamar, Mauricette; Caberg, Jean-Hubert; Murorunkwere, Seraphine; Janvier, Ndinkabandi; Bours, Vincent

    2016-01-01

    Global developmental delay (GDD) is defined as a significant delay in two or more developmental domains: gross or fine motor, speech/language, cognitive, social/personal and activities of daily living. Many of these children will go on to be diagnosed with intellectual disability (ID), which is most commonly defined as having an IQ <75 in addition to impairment in adaptive functioning. Cytogenetic studies have been performed in 664 Rwandan pediatric patients presenting GDD/ID and/or multiple congenital abnormalities (MCA). Karyotype analysis was performed in all patients and revealed 260 chromosomal abnormalities. The most frequent chromosomal abnormality was Down syndrome and then Edward syndrome and Patau syndrome. Other identified chromosomal abnormalities included 47,XX,+del(9)(q11), 46,XY,del(13)(q34) and 46,XX,der(22)t(10;22)(p10;p10)mat. In conclusion, our results highlight the high frequency of cytogenetically detectable abnormalities in this series, with implications for the burden on the healthcare. This study demonstrates the importance of cytogenetic analysis in patients with GDD/ID and MCA. PMID:26507407

  14. Characterization of a complex chromosomal rearrangement using chromosome, FISH, and microarray assays in a girl with multiple congenital abnormalities and developmental delay.

    PubMed

    Hemmat, Morteza; Yang, Xiaojing; Chan, Patricia; McGough, Robert A; Ross, Leslie; Mahon, Loretta W; Anguiano, Arturo L; Boris, Wang T; Elnaggar, Mohamed M; Wang, Jia-Chi J; Strom, Charles M; Boyar, Fatih Z

    2014-01-01

    Complex chromosomal rearrangements (CCRs) are balanced or unbalanced structural rearrangements involving three or more cytogenetic breakpoints on two or more chromosomal pairs. The phenotypic anomalies in such cases are attributed to gene disruption, superimposed cryptic imbalances in the genome, and/or position effects. We report a 14-year-old girl who presented with multiple congenital anomalies and developmental delay. Chromosome and FISH analysis indicated a highly complex chromosomal rearrangement involving three chromosomes (3, 7 and 12), seven breakpoints as a result of one inversion, two insertions, and two translocations forming three derivative chromosomes. Additionally, chromosomal microarray study (CMA) revealed two submicroscopic deletions at 3p12.3 (467 kb) and 12q13.12 (442 kb). We postulate that microdeletion within the ROBO1 gene at 3p12.3 may have played a role in the patient's developmental delay, since it has potential activity-dependent role in neurons. Additionally, factors other than genomic deletions such as loss of function or position effects may also contribute to the abnormal phenotype in our patient.

  15. Neurobehavioral development in Joubert syndrome.

    PubMed

    Gitten, J; Dede, D; Fennell, E; Quisling, R; Maria, B L

    1998-08-01

    Research on children with Joubert syndrome has focused on brain structural abnormalities and associated clinical symptoms. The degree of developmental delay has not been objectively reported. We investigated the neurobehavioral development of children with Joubert syndrome through neurobehavioral assessment in the largest sample to date. Thirty-two parents of children with Joubert syndrome completed the Child Development Inventory and magnetic resonance imaging (MRI) data was gathered on 17 of these children. Results indicate that 94% were severely impaired according to the Child Development Inventory, with age being positively correlated with degree of neurobehavioral impairment. The average developmental age of our sample was 19 months (63% below chronological age). Severity of illness as measured by the General Development scale of the Child Development Inventory and severity of illness as measured by MRI (overall severity rating) did not yield consistent data regarding severity of the midbrain and cerebellar malformations. Similarly, markers of abnormal cerebral development such as cortical atrophy and delayed myelination were independent of severity of illness ratings on the Child Development Inventory. The degree of developmental delay in Joubert syndrome and the severity of gross central nervous system malformations appear independent.

  16. 2q24 deletion in a 9-month old girl with anal atresia, hearing impairment, and hypotonia.

    PubMed

    Zhao, Peiwei; Mao, Bing; Cai, Xiaonan; Jiang, Jun; Liu, Zhisheng; Lin, Jun; He, Xuelian

    2018-06-01

    Deletion of 2q24.2 is a rare cytogenetic aberration in patients, exhibiting heterogeneous clinical features, and common phenotypes included developmental delay, intellectual disability, hypotonia, and mild dysmorphic features. Hearing impairment and anal atresia are rarely described. Here we described a 9-month-old female patient with hypotonia in all four limbs, developmental delay, and intellectual disability. In addition, congenital anal atresia was diagnosed and treated after birth, and hearing impairment was found in right ear. Single nucleotide polymorphisms (SNP) array detected a 5.2 Mb deletion on 2q24.2q24.3, including 19 genes (ITGB6; TBR1; SLC4A10; KCNH7 SCN3A; SCN2A et al.). Among these genes, it is affirmative that TBR1 is a causative gene for intellectual disability; however, the pathogenic genes of other phenotypes remain unclear. We briefly review the knowledge of genes likely involved in these clinical features, including hearing impairment, anal atresia, and developmental delay. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Simulated developmental and reproductive impacts on amphibian populations and implications for assessing long-term effects

    EPA Science Inventory

    Fish endpoints measured in early life stage toxicity tests are often used as representative of larval amphibian sensitivity in Ecological Risk Assessment (ERA). This application potentially overlooks the impact of developmental delays on amphibian metamorphosis, and thereby red...

  18. Chronic Overeating without Obesity in Children with Developmental Disabilities: Description of a New Syndrome.

    ERIC Educational Resources Information Center

    Ayoob, Keith-Thomas; And Others

    1994-01-01

    Thirteen children (ages 3.1 to 5.2 years) referred for developmental delay and excessive eating (without obesity) were evaluated. Commonalities included being in foster care, prenatal drug exposure, and abnormally withdrawn and/or aggressive behavior. (Author/DB)

  19. An Evaluation of Constant Time Delay and Simultaneous Prompting Procedures in Skill Acquisition for Young Children with Autism

    ERIC Educational Resources Information Center

    Brandt, Julie A. Ackerlund; Weinkauf, Sara; Zeug, Nicole; Klatt, Kevin P.

    2016-01-01

    Previous research has shown that various prompting procedures are effective in teaching skills to children and adults with developmental disabilities. Simultaneous prompting includes proving a prompt immediately following an instruction; whereas constant time-delay procedures include a set time delay (i.e., 5 s or 10 s) prior to delivering a…

  20. A Transagency Approach to Enabling Access to Parent-Based Intervention for Language Delay in Areas of Social Disadvantage: A Service Evaluation

    ERIC Educational Resources Information Center

    Gibbard, Deborah; Smith, Clare

    2016-01-01

    Primary language delay remains one of the most prevalent developmental delays in early childhood, particularly in disadvantaged areas. Previous research has established language difficulties and social disadvantage being particular risk factors for adverse outcomes later in life. To help prevent low educational achievement and poorer outcomes,…

  1. The science of early adversity: is there a role for large institutions in the care of vulnerable children?

    PubMed

    Berens, Anne E; Nelson, Charles A

    2015-07-25

    It has been more than 80 years since researchers in child psychiatry first documented developmental delays among children separated from family environments and placed in orphanages or other institutions. Informed by such findings, global conventions, including the 1989 UN Convention on the Rights of the Child, assert a child's right to care within a family-like environment that offers individualised support. Nevertheless, an estimated 8 million children are presently growing up in congregate care institutions. Common reasons for institutionalisation include orphaning, abandonment due to poverty, abuse in families of origin, disability, and mental illness. Although the practice remains widespread, a robust body of scientific work suggests that institutionalisation in early childhood can incur developmental damage across diverse domains. Specific deficits have been documented in areas including physical growth, cognitive function, neurodevelopment, and social-psychological health. Effects seem most pronounced when children have least access to individualised caregiving, and when deprivation coincides with early developmental sensitive periods. Offering hope, early interventions that place institutionalised children into families have afforded substantial recovery. The strength of scientific evidence imparts urgency to efforts to achieve deinstitutionalisation in global child protection sectors, and to intervene early for individual children experiencing deprivation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. American College of Medical Genetics guideline on the cytogenetic evaluation of the individual with developmental delay or mental retardation

    PubMed Central

    Shaffer, Lisa G.

    2005-01-01

    The following are the recommendations of the American College of Medical Genetics (ACMG) Professional Practice and Guidelines Committee, which was convened to assist health care professionals in making decisions regarding cytogenetic diagnostic testing and counseling for mental retardation (MR) and developmental delay (DD). This document reviews available evidence concerning the value of conventional and molecular cytogenetic testing for the identification of chromosomal anomalies that play a role in the etiology of MR/DD, and, based on this evidence, specific recommendations for each method of testing are provided. PMID:16301868

  3. Effects of free-air CO2 and temperature enrichment on soybean growth and development

    NASA Astrophysics Data System (ADS)

    Ruiz Vera, U. M.; Bernacchi, C. J.

    2012-12-01

    According to the growing degree days approach, the progression of plant developmental stages requires certain accumulation of heat; therefore greenhouse gas-induced warming of the atmosphere could contribute to more rapid plant development. However, the influence of rising carbon dioxide concentration ([CO2]) on development of crops is uncertain, accelerating and other times delaying certain developmental stages. In soybean, the increase of [CO2] is shown to delay reproductive development, which is attributed to a higher investment of resources into extra nodes. The combined effects of elevated temperature and [CO2] can have significant changes in the progression through development that can influence on total grain production, carbon uptake, and susceptibility to early end-of-season frosts. We designed the Temperature by Free Air CO2 Enrichment (T-FACE) experiment to test over two growing seasons (2009 and 2011) and under field conditions the impact of increased temperature and/or [CO2] on soybean. The heated T-FACE subplots were situated in the larger FACE plots at 385 or 585 ppm of [CO2] and subjected to either ambient or heated (+~3.5°C) temperatures. The experiment is full factorial with ambient temperature and [CO2] (control), elevated temperature (eT), elevated [CO2] (eC) and combined (eT+eC) treatments. We hypothesized that soybean grown (1) under elevated [CO2] will produce more nodes than control, (2) under high temperature will produce nodes faster than control and (3) under both elevated temperature and [CO2] will produce more nodes in less time than control. For reproductive development, we hypothesized that (1) reproductive development will initiate simultaneously regardless of increased [CO2] or temperature because soybean reproduction is triggered by day length, (2) elevated temperature will accelerate the progression through key reproductive stages and (3) the delay in soybean reproductive development by elevated [CO2] will be ameliorated by the raise in temperature. Soybean developmental stages were recorded on six plants per subplot three times per week from emergence to senescence. In 2009, no temperature effect was detected on the vegetative development, but in 2011 temperature accelerates node formation. Elevated [CO2] was not significant on vegetative development, however plants under this effect produced more nodes than control. Reproductive development was delayed by elevated [CO2]. High temperature accelerated reproductive stages only in 2009, ameliorating the effect of elevated [CO2] in eT+eC. In 2011 elevated temperature delayed reproductive stages, a response that could be related with stress imposed by the weather conditions of that season. In the Midwest, the soybean cultivars generally mature before the first frost of the year avoiding seed damage. The delayed in soybean maturation by the increasing of [CO2] could potentially reduce yield; however the increase of temperature could diminish this risk by mitigating this delay. Alternatively, the more rapid progression through the reproductive stages could decrease the translocation of resources to pods, thereby negatively impacting yields. Using soybean as a model for leguminous C3 species suggested implications could arise for yield in crop plants and reproductive fitness in native vegetation.

  4. A rare case of sterol-C4-methyl oxidase deficiency in a young Italian male: Biochemical and molecular characterization.

    PubMed

    Frisso, Giulia; Gelzo, Monica; Procopio, Elena; Sica, Concetta; Lenza, Maria Pia; Dello Russo, Antonio; Donati, Maria Alice; Salvatore, Francesco; Corso, Gaetano

    2017-08-01

    Inborn defects of cholesterol biosynthesis are metabolic disorders presenting with multi-organ and tissue anomalies. An autosomal recessive defect involving the demethylating enzyme C4-methyl sterol (SC4MOL) has been reported in only 4 patients so far. In infancy, all patients were affected by microcephaly, bilateral congenital cataracts, growth delay, psoriasiform dermatitis, immune dysfunction, and intellectual disability. Herein, we describe a new case of SC4MOL deficiency in which a 19-year-old Italian male was affected by bilateral congenital cataracts, growth delay and learning disabilities, behavioral disorders and small stature, but not microcephaly. Our patient had abundant scalp dandruff, without other skin manifestations. Analysis of the blood sterol profile showed accumulation of C4-monomethyl and C4-dimethyl sterols suggesting a deficiency of the SC4MOL enzyme. Sequencing of the MSMO1 gene (also known as the "SC4MOL" gene) confirmed mutations in each allele (c.731A>G, p.Y244C, which is already known, and c.605G>A, p.G202E, which is a novel variant). His father carried c.731A>G mutation, whereas his mother carried c.605G>A. Thus, the combination of multiple skills and methodologies, in particular, blood sterol profiling and genetic analysis, led to the diagnosis of a new case of a very rare defect of cholesterol biosynthesis. Consequently, we suggest that these two analyses should be performed as soon as possible in all undiagnosed patients affected by bilateral cataracts and developmental delay. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Epidermal growth factor receptor expression is related to post-mitotic events in cerebellar development: regulation by thyroid hormone.

    PubMed

    Carrasco, Emilce; Blum, Mariann; Weickert, Cynthia Shannon; Casper, Diana

    2003-01-10

    It has been established that thyroid hormone and neurotrophic factors both orchestrate developmental events in the brain. However, it is not clear how these two influences are related. In this study, we investigated the effects of thyroid hormone on cerebellar development and the coincident expression of transforming growth factor-alpha (TGF-alpha), a ligand in the epidermal growth factor (EGF) family, and the epidermal growth factor receptor (EGFR). Profiles of thyroid hormone expression were measured in postnatal animals and were found to peak at postnatal day 15 (P15). These levels dropped below detectable levels when mice were made hypothyroid with propylthiouracil (PTU). TGF-alpha and EGFR expression, as determined by RNAse protection assay, was maximal at P6 in normal animals, but remained low in hypothyroid animals, suggesting that thyroid hormone was responsible for their induction. In situ hybridization and immunohistochemical analysis of EGFR expression revealed that this receptor was present on granule cells within the inner zone of the external granule cell layer (EGL), suggesting that EGFR-ligands were not inducing granule cell proliferation. The persistence of EGFR expression on migrating granule cells and subsequent down-regulation of expression in the internal granule cell layer (IGL) implicates a role for EGFR-ligands in differentiation and/or migration. In hypothyroid animals, we observed a delayed progression of granule cell migration, consistent with the persistence of EGFR labeling in the EGL, and in the 'pile-up' of labeled cells at the interface between the molecular layer and the Purkinje cell layer. Taken together, these results implicate thyroid hormone in the coordinated expression of TGF-alpha and EGFR, which are positioned to play a role in post-mitotic developmental events in the cerebellum.

  6. Developmental and functional outcomes in children with global developmental delay or developmental language impairment.

    PubMed

    Shevell, Michael; Majnemer, Annette; Platt, Robert W; Webster, Richard; Birnbaum, Rena

    2005-10-01

    Preschool children diagnosed with either global developmental delay (GDD) or developmental language impairment (DLI) were reassessed during their early school years with standardized developmental (Battelle Developmental Inventory [BDI]) and functional (Vineland Adaptive Behavior Scale [VABS]) outcome measures. Of an original cohort of 99 children with GDD and 70 children with DLI assessed and diagnosed at a mean age of 3 years 5 months (SD 1.1) and 3 years 7 months (SD 0.7) respectively, 48 children (34 [71%] males) with GDD and 43 children (36 [84%] males) with DLI were reassessed at a mean age of 7 years 4 months (SD 0.9) and 7 years 5 months (SD 0.7) respectively. The overall total mean BDI score for children with GDD was 66.4 (SD 4.3) versus 71.9 (SD 8.2) for children with DLI (p=0.002). On each subdomain of the BDI, except communication, mean scores for the GDD group were significantly lower than for the DLI group (p<0.05). Similarly, the VABS total score for the GDD group was significantly lower than for the DLI group (p<0.001). For each subdomain of the VABS, the GDD group scored significantly lower than the DLI group (p<0.001). The proportion of children falling below meaningful cut-offs on the outcome measures selected was significantly higher for those initially diagnosed with GDD. Preschool diagnosis of either GDD or DLI has later prognostic validity with regard to persisting developmental and functional deficits.

  7. Efficacy of the Multidisciplinary Evaluation for Preschoolers with Suspected Developmental Delays.

    ERIC Educational Resources Information Center

    Klein, Evelyn R.; Stull, Judith

    At the Temple University Center for Research in Human Development and Education, Pennsylvania's largest independent multidisciplinary evaluation program, approximately 300 preschool aged children are evaluated annually to determine developmental performance in the areas of cognition, speech-language, gross and fine motor skills, social-emotional…

  8. Teaching Individuals with Developmental Delays: Basic Intervention Techniques.

    ERIC Educational Resources Information Center

    Lovaas, O. Ivar

    This teaching manual for treatment of children with developmental disabilities is divided into seven sections that address: (1) basic concepts; (2) transition into treatment; (3) early learning concepts; (4) expressive language; (5) strategies for visual learners; (6) programmatic considerations; and (7) organizational and legal issues. Among…

  9. Down Syndrome = Sindrome de Down.

    ERIC Educational Resources Information Center

    Pueschel, S. M.; Glasgow, R. E.

    Presented both in English and Spanish, the brochure is primarily concerned with biological and developmental characteristics of the person with Down's syndrome. An emphasis is on the valuable humanizing influence these individuals have on society. Brief sections in the document discuss the delayed developmental aspects of Down's syndrome; the…

  10. Romantic Relationship Patterns in Young Adulthood and Their Developmental Antecedents

    ERIC Educational Resources Information Center

    Rauer, Amy J.; Pettit, Gregory S.; Lansford, Jennifer E.; Bates, John E.; Dodge, Kenneth A.

    2013-01-01

    The delayed entry into marriage that characterizes modern society raises questions about young adults' romantic relationship trajectories and whether patterns found to characterize adolescent romantic relationships persist into young adulthood. The current study traced developmental transitions into and out of romantic relationships from age…

  11. Incremental Validity in the Clinical Assessment of Early Childhood Development

    ERIC Educational Resources Information Center

    Liu, Xin; Zhou, Xiaobin; Lackaff, Julie

    2013-01-01

    The authors demonstrate the increment of clinical validity in early childhood assessment of physical impairment (PI), developmental delay (DD), and autism (AUT) using multiple standardized developmental screening measures such as performance measures and parent and teacher rating scales. Hierarchical regression and sensitivity/specificity analyses…

  12. Autistic Features in Young Children with Significant Cognitive Impairment: Autism or Mental Retardation?

    ERIC Educational Resources Information Center

    Vig, Susan; Jedrysek, Eleonora

    1999-01-01

    Examines issues in the differential diagnosis of autism in preschool children with significant cognitive impairment, including the use of traditional diagnostic guidelines for preschoolers with developmental delays, developmental changes in behavioral characteristics, involvement of cognitive factors in symptom expression, overlap between autism…

  13. Children at Risk for Developmental Delay Can Be Recognised by Stunting, Being Underweight, Ill Health, Little Maternal Schooling or High Gravidity

    ERIC Educational Resources Information Center

    Abubakar, Amina; Holding, Penny; Van de Vijver, Fons J. R.; Newton, Charles; Van Baar, Anneloes

    2010-01-01

    Aims: To investigate markers of risk status that can be easily monitored in resource-limited settings for the identification of children in need of early developmental intervention. Methods: Eighty-five children in Kilifi, Kenya, aged between 2 and 10 months at recruitment, were involved in a 10-month follow-up. Data on developmental outcome were…

  14. Developmental Risk and Goodness of Fit in the Mother–Child Relationship: Links to Parenting Stress and Children’s Behaviour Problems

    PubMed Central

    Newland, Rebecca P.; Crnic, Keith A.

    2016-01-01

    Despite the compelling nature of goodness of fit, empirical support has lagged for this construct. The present study examined an interactional approach to measuring goodness of fit and prospectively explored associations with mother-child relationship quality, child behavior problems, and parenting stress across the preschool period. In addition, as goodness of fit might be particularly important for children at developmental risk, the presence of early developmental delay was considered as a moderator of goodness of fit processes. Children with (n = 110) and without (n = 137) developmental delays and their mothers were coded while interacting in the lab at child age 36 months and during naturalistic home observations at child ages 36 and 48 months. Mothers also completed questionnaires at child age 60 months. Results highlight the effects of child developmental risk as a moderator of mother-child goodness of fit processes across the preschool period. There was also evidence that the goodness of fit between maternal scaffolding and child activity level at 36 months influenced both mother and child functioning at 60 months. Findings call for more precise models and expanded developmental perspectives to fully capture the transactional and dynamic nature of goodness of fit. PMID:28943806

  15. Developmental excitatory-to-inhibitory GABA polarity switch is delayed in Ts65Dn mice, a genetic model of Down syndrome.

    PubMed

    Lysenko, Larisa V; Kim, Jeesun; Madamba, Francisco; Tyrtyshnaia, Anna A; Ruparelia, Aarti; Kleschevnikov, Alexander M

    2018-07-01

    Down syndrome (DS) is the most frequent genetic cause of developmental abnormalities leading to intellectual disability. One notable phenomenon affecting the formation of nascent neural circuits during late developmental periods is developmental switch of GABA action from depolarizing to hyperpolarizing mode. We examined properties of this switch in DS using primary cultures and acute hippocampal slices from Ts65Dn mice, a genetic model of DS. Cultures of DIV3-DIV13 Ts65Dn and control normosomic (2 N) neurons were loaded with FURA-2 AM, and GABA action was assessed using local applications. In 2 N cultures, the number of GABA-activated cells dropped from ~100% to 20% between postnatal days 3-13 (P3-P13) reflecting the switch in GABA action polarity. In Ts65Dn cultures, the timing of this switch was delayed by 2-3 days. Next, microelectrode recordings of multi-unit activity (MUA) were performed in CA3 slices during bath application of the GABA A agonist isoguvacine. MUA frequency was increased in P8-P12 and reduced in P14-P22 slices reflecting the switch of GABA action from excitatory to inhibitory mode. The timing of this switch was delayed in Ts65Dn by approximately 2 days. Finally, frequency of giant depolarizing potentials (GDPs), a form of primordial neural activity, was significantly increased in slices from Ts65Dn pups at P12 and P14. These experimental evidences show that GABA action polarity switch is delayed in Ts65Dn model of DS, and that these changes lead to a delay in maturation of nascent neural circuits. These alterations may affect properties of neural circuits in adult animals and, therefore, represent a prospective target for pharmacotherapy of cognitive impairment in DS. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Neuropsychological functioning of siblings of children with autism, siblings of children with developmental language delay, and siblings of children with mental retardation of unknown genetic etiology.

    PubMed

    Pilowsky, Tammy; Yirmiya, Nurit; Gross-Tsur, Varda; Shalev, Ruth S

    2007-03-01

    Neuropsychological functioning of 30 siblings of children with autism (AU-S), 28 siblings of children with mental retardation of (MR-S), and 30 siblings of children with developmental language delay (DLD-S) was compared. Two siblings, both AU-S, received diagnoses of pervasive developmental disorder (PDD). More siblings with cognitive disabilities were found in DLD-S than in AU-S. However, these differences disappeared after excluding diagnosed siblings or after accounting for family membership. In sum, despite the elevated incidence of PDD among AU-S, the neuropsychological functioning of the remaining siblings did not convey specific characteristics related to the genetic risk associated with autism, in contrast to the cognitive functioning of the DLD-S, which did reflect a genetic risk.

  17. Use of the Modified Checklist for Autism, Revised with Follow up-Albanian to Screen for ASD in Albania

    PubMed Central

    Brennan, Laura; Fein, Deborah; Como, Ariel; Rathwell, Iris Carcani; Chen, Chi-Ming

    2016-01-01

    The Modified Checklist for Autism in Toddlers Revised-Albanian screener (M-CHAT-R/-A) was used to screen 2,594 toddlers, aged 16-30 months, at well-child visits. Two hundred fifty three (9.75%) screened positive; follow up on failed items were conducted by phone with 127 (50%); the remainder were lost to follow-up. Twenty-six toddlers (21%) continued to screen positive; 19 received full evaluations, which assessed for ASD with the Autism Diagnostic Observation Schedule and developmental delays with the Parents Assessment of Developmental Status – Developmental Milestones. All evaluated children had significant delays; 17 of the 19 met criteria for Autism/ASD. Removal of three items improved performance. Although Albania and the US are quite different in culture and language, key features of autism appeared very similar. PMID:27491423

  18. A developmental screening tool for toddlers with multiple domains based on Rasch analysis.

    PubMed

    Hwang, Ai-Wen; Chou, Yeh-Tai; Hsieh, Ching-Lin; Hsieh, Wu-Shiun; Liao, Hua-Fang; Wong, Alice May-Kuen

    2015-01-01

    Using multidomain developmental screening tools is a feasible method for pediatric health care professionals to identify children at risk of developmental problems in multiple domains simultaneously. The purpose of this study was to develop a Rasch-based tool for Multidimensional Screening in Child Development (MuSiC) for children aged 0-3 years. The MuSic was developed by constructing items bank based on three commonly used screening tools, validating with developmental status (at risk for delay or not) on five developmental domains. Parents of a convenient sample of 632 children (aged 3-35.5 months) with and without developmental delays responded to items from the three screening tools funded by health authorities in Taiwan. Item bank was determined by item fit of Rasch analysis for each of the five developmental domains (cognitive skills, language skills, gross motor skills, fine motor skills, and socioadaptive skills). Children's performance scores in logits derived in Rasch analysis were validated with developmental status for each domain using the area under receiver operating characteristic curves. MuSiC, a 75-item developmental screening tool for five domains, was derived. The diagnostic validity of all five domains was acceptable for all stages of development, except for the infant stage (≤11 months and 15 days). MuSiC can be applied simultaneously to well-child care visits as a universal screening tool for children aged 1-3 years on multiple domains. Items with sound validity for infants need to be further developed. Copyright © 2014. Published by Elsevier B.V.

  19. Children with developmental and behavioural concerns in Singapore.

    PubMed

    Lian, Wee Bin; Ho, Selina Kah Ying; Choo, Sylvia Hean Tean; Shah, Varsha Atul; Chan, Daisy Kwai Lin; Yeo, Cheo Lian; Ho, Lai Yun

    2012-07-01

    Childhood developmental and behavioural disorders (CDABD) have been increasingly recognised in recent years. This study evaluated the profiles and outcomes of children referred for developmental and behavioural concerns to a tertiary child developmental centre in Singapore. This is the first such regional database. Baseline information, obtained through a questionnaire, together with history at first consultation, provided information for referral, demographic and presentation profiles. Clinical formulations were then made. Definitive developmental and medical diagnoses, as well as outcomes based on clinical assessment and standardised testing, were recorded at one year post first consultation. Out of 1,304 referrals between January 1, 2003 and December 1, 2004, 45% were 2-4 years old and 74% were boys. The waiting time from referral to first consultation exceeded four months in 52% of children. Following clinical evaluation, 7% were found to be developmentally appropriate. The single most common presenting concern was speech and language (S&L) delay (29%). The most common clinical developmental diagnosis was autism spectrum disorder (ASD) (30%), followed by isolated S&L disorder, global developmental delay (GDD) and cognitive impairment (CI). Recommendations included S&L therapy (57%), occupational therapy (50%) and psychological/behavioural services (40%). At one year, ASD remained the most common definitive developmental diagnosis (31%), followed by S&L disorder, CI and GDD. Most were children with high-prevalence, low-moderate severity disorders who could potentially achieve fair-good prognosis with early intervention. Better appreciation of the profile and outcome of children with CDABD in Singapore could enable better resource planning for diagnosis and intervention.

  20. Assessment of child psychomotor development in population groups as a positive health indicator.

    PubMed

    Lejarraga, Horacio; Kelmansky, Diana M; Passcucci, María C; Masautis, Alicia; Insua, Iván; Lejarraga, Celina; Nunes, Fernando

    2016-02-01

    It is necessary to use health indicators describing the conditions of all individuals in a population, not just of those who have a disease or die. To introduce a method to collect population indicators of psychomotor development in children younger than 6 years old and show its results. Data were obtained from a cross-sectional assessment regarding compliance with 13 developmental milestones (selected from the national reference) conducted in 5465 children using five surveys administered by the Matanza-Riachuelo River Basin Authority in areas of this basin where a high proportion of families with unmet basic needs live. For each survey, a logistic regression analysis was used to estimate the median age at attainment of the 13 developmental milestones. A linear regression model between the estimated age at attainment of the 13 milestones was adjusted for each survey based on the corresponding age at attainment of the national reference. Based on this model, three indicators were defined: overall developmental quotient, developmental quotient at 4 years old, and developmental trend. Results from the five surveys ranged between 0.74 and 0.85, 0.88 and 0.81, and -0.15 and -0.26 for the overall developmental quotient, developmental quotient at 4 years old, and developmental trend, respectively. A distinct developmental delay and an increasing trend in delay with age were observed. Indicators are easily interpreted and related to social indicators (unmet basic needs, etc.). Collecting the information necessary to make estimations takes little time and can be applied to population groups, but not on an individual level. Sociedad Argentina de Pediatría.

  1. Inequality in early childhood neurodevelopment in six poor rural counties of China: a decomposition analysis.

    PubMed

    Zhang, Cuihong; Zhao, Chunxia; Liu, Xiangyu; Wei, Qianwei; Luo, Shusheng; Guo, Sufang; Zhang, Jingxu; Wang, Xiaoli; Scherpbier, Robert W

    2017-12-08

    Previous studies about inequality in children's health focused more on physical health than the neurodevelopment. In this study, we aimed to evaluate the inequality in early childhood neurodevelopment in poor rural China and explore the contributions of socioeconomic factors to the inequality. Information of 2120 children aged 0 to 35 months and their households in six poor rural counties of China was collected during July - September, 2013. Age and Stages Questionnaire-Chinese version, concentration index and decomposition analysis were used to assess the neurodevelopment of early childhood, measure its inequality and evaluate the contributions of socioeconomic factors to the inequality, respectively. The prevalence of suspected developmental delay in children under 35 months of age in six poor rural counties of China was nearly 40%, with the concentration index of -0.0877. Household economic status, caregivers' depressive symptoms, learning material and family support for learning were significantly associated with children's suspected developmental delay, and explained 34.1, 14.1, 8.9 and 7.0% of the inequality in early childhood neurodevelopment, respectively. The early childhood neurodevelopment in the surveyed area is poor and unfair. Factors including household economic status, caregivers' depressive symptoms, learning material and family support for learning are significantly associated with children's suspected developmental delay and early developmental inequality. The results highlight the urgent need of monitoring child neurodevelopment in poor rural areas. Interventions targeting the caregivers' depressive symptoms, providing learning material and developmental appropriate stimulating activities may help improve early childhood neurodevelopment and reduce its inequality.

  2. Inhibition of transforming growth factor-β attenuates brain injury and neurological deficits in a rat model of germinal matrix hemorrhage.

    PubMed

    Manaenko, Anatol; Lekic, Tim; Barnhart, Margaret; Hartman, Richard; Zhang, John H

    2014-03-01

    Transforming growth factor-β (TGF-β) overproduction and activation of the TGF-β pathway are associated with the development of brain injury following germinal matrix hemorrhage (GMH) in premature infants. We examined the effects of GMH on the level of TGF-β1 in a novel rat collagenase-induced GMH model and determined the effect of inhibition of the TGF receptor I. In total, 92 seven-day old (P7) rats were used. Time-dependent effects of GMH on the level of TGF-β1 and TGF receptor I were evaluated by Western blot. A TGF receptor I inhibitor (SD208) was administered daily for 3 days, starting either 1 hour or 3 days after GMH induction. The effects of GMH and SD208 on the TGF-β pathway were evaluated by Western blot at day 3. The effects of GMH and SD208 on cognitive and motor function were also assessed. The effects of TGF receptor I inhibition by SD208 on GMH-induced brain injury and underlying molecular pathways were investigated by Western blot, immunofluorescence, and morphology studies 24 days after GMH. GMH induced significant delay in development, caused impairment in both cognitive and motor functions, and resulted in brain atrophy in rat subjects. GMH also caused deposition of both vitronectin (an extracellular matrix protein) and glial fibrillary acidic protein in perilesion areas, associated with development of hydrocephalus. SD208 ameliorated GMH-induced developmental delay, improved cognitive and motor functions, and attenuated body weight loss. SD208 also decreased vitronectin and glial fibrillary acidic protein deposition and decreased GMH-induced brain injury. Increased level of TGF-β1 and activation of the TGF-β pathway associate with the development of brain injury after GMH. SD208 inhibits GMH-induced activation of the TGF-β pathway and leads to an improved developmental profile, partial recovery of cognitive and motor functions, and attenuation of GMH-induced brain atrophy and hydrocephalus.

  3. Homozygous EEF1A2 mutation causes dilated cardiomyopathy, failure to thrive, global developmental delay, epilepsy and early death.

    PubMed

    Cao, Siqi; Smith, Laura L; Padilla-Lopez, Sergio R; Guida, Brandon S; Blume, Elizabeth; Shi, Jiahai; Morton, Sarah U; Brownstein, Catherine A; Beggs, Alan H; Kruer, Michael C; Agrawal, Pankaj B

    2017-09-15

    Eukaryotic elongation factor 1A (EEF1A), is encoded by two distinct isoforms, EEF1A1 and EEF1A2; whereas EEF1A1 is expressed almost ubiquitously, EEF1A2 expression is limited such that it is only detectable in skeletal muscle, heart, brain and spinal cord. Currently, the role of EEF1A2 in normal cardiac development and function is unclear. There have been several reports linking de novo dominant EEF1A2 mutations to neurological issues in humans. We report a pair of siblings carrying a homozygous missense mutation p.P333L in EEF1A2 who exhibited global developmental delay, failure to thrive, dilated cardiomyopathy and epilepsy, ultimately leading to death in early childhood. A third sibling also died of a similar presentation, but DNA was unavailable to confirm the mutation. Functional genomic analysis was performed in S. cerevisiae and zebrafish. In S. cerevisiae, there was no evidence for a dominant-negative effect. Previously identified putative de novo mutations failed to complement yeast strains lacking the EEF1A ortholog showing a major growth defect. In contrast, the introduction of the mutation seen in our family led to a milder growth defect. To evaluate its function in zebrafish, we knocked down eef1a2 expression using translation blocking and splice-site interfering morpholinos. EEF1A2-deficient zebrafish had skeletal muscle weakness, cardiac failure and small heads. Human EEF1A2 wild-type mRNA successfully rescued the morphant phenotype, but mutant RNA did not. Overall, EEF1A2 appears to be critical for normal heart function in humans, and its deficiency results in clinical abnormalities in neurologic function as well as in skeletal and cardiac muscle defects. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. CAD mutations and uridine-responsive epileptic encephalopathy.

    PubMed

    Koch, Johannes; Mayr, Johannes A; Alhaddad, Bader; Rauscher, Christian; Bierau, Jörgen; Kovacs-Nagy, Reka; Coene, Karlien L M; Bader, Ingrid; Holzhacker, Monika; Prokisch, Holger; Venselaar, Hanka; Wevers, Ron A; Distelmaier, Felix; Polster, Tilman; Leiz, Steffen; Betzler, Cornelia; Strom, Tim M; Sperl, Wolfgang; Meitinger, Thomas; Wortmann, Saskia B; Haack, Tobias B

    2017-02-01

    Unexplained global developmental delay and epilepsy in childhood pose a major socioeconomic burden. Progress in defining the molecular bases does not often translate into effective treatment. Notable exceptions include certain inborn errors of metabolism amenable to dietary intervention. CAD encodes a multifunctional enzyme involved in de novo pyrimidine biosynthesis. Alternatively, pyrimidines can be recycled from uridine. Exome sequencing in three families identified biallelic CAD mutations in four children with global developmental delay, epileptic encephalopathy, and anaemia with anisopoikilocytosis. Two died aged 4 and 5 years after a neurodegenerative disease course. Supplementation of the two surviving children with oral uridine led to immediate cessation of seizures in both. A 4-year-old female, previously in a minimally conscious state, began to communicate and walk with assistance after 9 weeks of treatment. A 3-year-old female likewise showed developmental progress. Blood smears normalized and anaemia resolved. We establish CAD as a gene confidently implicated in this neurometabolic disorder, characterized by co-occurrence of global developmental delay, dyserythropoietic anaemia and seizures. While the natural disease course can be lethal in early childhood, our findings support the efficacy of uridine supplementation, rendering CAD deficiency a treatable neurometabolic disorder and therefore a potential condition for future (genetic) newborn screening. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. "When Did I Learn and When Shall I Act?": The Developmental Relationship between Episodic Future Thinking and Memory

    ERIC Educational Resources Information Center

    Naito, Mika; Suzuki, Toshiko

    2011-01-01

    This study investigated the development of the ability to reflect on one's personal past and future. A total of 64 4- to 6-year-olds received tasks of delayed self-recognition, source memory, delay of gratification, and a newly developed task of future-oriented action timing. Although children's performance on delayed self-recognition, source…

  6. The Effects of Embedded Skill Instruction on the Acquisition of Target and Nontarget Skills in Preschoolers with Developmental Delays.

    ERIC Educational Resources Information Center

    Daugherty, Stefanie; Grisham-Brown, Jennifer; Hemmeter, Mary Louise

    2001-01-01

    In the current study, a constant time delay (CTD) procedure was embedded in classroom activities and routines to teach counting to three preschool children with speech and language delays. CTD was effective in teaching numbers to all three children. One child out of two also was able to acquire non-target information. (Contains references.) (CR)

  7. Hydrocephalus and arthrogryposis in an immunocompetent mouse model of ZIKA teratogeny: A developmental study

    PubMed Central

    Xavier-Neto, Jose; Carvalho, Murilo; Pascoalino, Bruno dos Santos; Cardoso, Alisson Campos; Costa, Ângela Maria Sousa; Pereira, Ana Helena Macedo; Santos, Luana Nunes; Saito, Ângela; Marques, Rafael Elias; Smetana, Juliana Helena Costa; Consonni, Silvio Roberto; Bandeira, Carla; Costa, Vivian Vasconcelos; Bajgelman, Marcio Chaim; de Oliveira, Paulo Sérgio Lopes; Cordeiro, Marli Tenorio; Gonzales Gil, Laura Helena Vega; Pauletti, Bianca Alves; Granato, Daniela Campos; Paes Leme, Adriana Franco; Freitas-Junior, Lucio; Holanda de Freitas, Carolina Borsoi Moraes; Teixeira, Mauro Martins; Bevilacqua, Estela; Franchini, Kleber

    2017-01-01

    The teratogenic mechanisms triggered by ZIKV are still obscure due to the lack of a suitable animal model. Here we present a mouse model of developmental disruption induced by ZIKV hematogenic infection. The model utilizes immunocompetent animals from wild-type FVB/NJ and C57BL/6J strains, providing a better analogy to the human condition than approaches involving immunodeficient, genetically modified animals, or direct ZIKV injection into the brain. When injected via the jugular vein into the blood of pregnant females harboring conceptuses from early gastrulation to organogenesis stages, akin to the human second and fifth week of pregnancy, ZIKV infects maternal tissues, placentas and embryos/fetuses. Early exposure to ZIKV at developmental day 5 (second week in humans) produced complex manifestations of anterior and posterior dysraphia and hydrocephalus, as well as severe malformations and delayed development in 10.5 days post-coitum (dpc) embryos. Exposure to the virus at 7.5–9.5 dpc induces intra-amniotic hemorrhage, widespread edema, and vascular rarefaction, often prominent in the cephalic region. At these stages, most affected embryos/fetuses displayed gross malformations and/or intrauterine growth restriction (IUGR), rather than isolated microcephaly. Disrupted conceptuses failed to achieve normal developmental landmarks and died in utero. Importantly, this is the only model so far to display dysraphia and hydrocephalus, the harbinger of microcephaly in humans, as well as arthrogryposis, a set of abnormal joint postures observed in the human setting. Late exposure to ZIKV at 12.5 dpc failed to produce noticeable malformations. We have thus characterized a developmental window of opportunity for ZIKV-induced teratogenesis encompassing early gastrulation, neurulation and early organogenesis stages. This should not, however, be interpreted as evidence for any safe developmental windows for ZIKV exposure. Late developmental abnormalities correlated with damage to the placenta, particularly to the labyrinthine layer, suggesting that circulatory changes are integral to the altered phenotypes. PMID:28231241

  8. Evaluation of Cognitive Function of Children with Developmental Disabilities by means of Button-Press Task

    NASA Astrophysics Data System (ADS)

    Nakazono, Shogo; Kobori, Satoshi

    The button-press task means that the subject observes a moving target and presses a button to stop it when the target enters a specified area on a computer display. Subjects perform normal task, suppressed task and delayed task. In the suppressed task, the moving target disappears at some point during the trial. In the delayed task, there is some lag time between the time of pressing button and of stopping target. In these tasks, subjects estimate the movement of the target, and press the button considering his/her own reaction time. In our previous study, we showed that cognitive and motor function was able to be evaluated by these tasks. In this study, we examined error data of children with developmental disabilities to evaluate the cognitive function, and investigated the learning processes. Moreover, we discussed the developmental stages by comparing the children with disabilities to normal control children, and we clarified the behavior characteristics of children with developmental disabilities. Asa result, it was shown that our evaluation method and system for the button-press task were effective to evaluate cognitive ability of children with developmental disabilities.

  9. Simple Steps for Teaching Prepositions to Students with Autism and Other Developmental Disabilities

    ERIC Educational Resources Information Center

    Hicks, S. Christy; Rivera, Christopher J.; Patterson, Dawn R.

    2016-01-01

    The acquisition of receptive and expressive language skills by students with autism and developmental disabilities (DD) is often delayed, thus making the process of communicating with others challenging. Some students develop language skills incidentally through conversations with their families and peers, but others require instruction in…

  10. Classical Conditioning of Profoundly Retarded, Multiply Handicapped Children.

    ERIC Educational Resources Information Center

    Hogg, J.; And Others

    1979-01-01

    Conditioning was established for the two most developmentally advanced Ss, and the intermediate pair showed different patterns of orienting response to the conditioned stimulus but no evidence of conditioning. The fifth and most developmentally delayed child did not respond to the stimuli. Journal Availability: J. B. Lippincott Co., East…

  11. Effectiveness of Emotion Recognition Training for Young Children with Developmental Delays

    ERIC Educational Resources Information Center

    Downs, Andrew; Strand, Paul

    2008-01-01

    Emotion recognition is a basic skill that is thought to facilitate development of social and emotional competence. There is little research available examining whether therapeutic or instructional interventions can improve the emotion recognition skill of young children with various developmental disabilities. Sixteen preschool children with…

  12. Authentic Assessment for Early Childhood Intervention Best Practices. The Guilford School Practitioner Series

    ERIC Educational Resources Information Center

    Bagnato, Stephen J.; Elliott Stephen N., Ed.; Witt, Joseph, C., Ed.

    2007-01-01

    Meeting a crucial need, this book provides clear recommendations for authentic developmental assessment of children from infancy to age 6, including those with developmental delays and disabilities. It describes principles and strategies for collecting information about children's everyday activities in the home, preschool, and community, which…

  13. Developmental Exposure to an Environmental PCB Mixture Delays the Propagation of Kindling in the Amygdala

    EPA Science Inventory

    Developmental PCB exposure impairs hearing and induces brainstem audiogenic seizures in adult offspring. The degree to which this enhanced susceptibility to seizure is manifest in other brain regions has not been examined. Thus, electrical kindling of the amygdala was used to eva...

  14. A Developmental and Genetic Classification for Malformations of Cortical Development: Update 2012

    ERIC Educational Resources Information Center

    Barkovich, A. James; Guerrini, Renzo; Kuzniecky, Ruben I.; Jackson, Graeme D.; Dobyns, William B.

    2012-01-01

    Malformations of cerebral cortical development include a wide range of developmental disorders that are common causes of neurodevelopmental delay and epilepsy. In addition, study of these disorders contributes greatly to the understanding of normal brain development and its perturbations. The rapid recent evolution of molecular biology, genetics…

  15. Serving Rural Families of Developmentally Disabled in a Cost-Effective Manner.

    ERIC Educational Resources Information Center

    Hedge, Russell; Johnson, Willard

    Providing cost-effective services in 15 counties of Southeast Kansas, the Infant and Early Childhood Intervention Program (IECIP) teaches parents to provide daily one-to-one therapy in gross and fine perceptual motor development, speech and language development, social adjustment, and behavior management for developmentally delayed children from…

  16. The Abusive Environment and the Child's Adaptation.

    ERIC Educational Resources Information Center

    Martin, Harold P.

    The biologic and developmental problems of abused children are usually thought of etiologically in relation to the physical trauma which has been suffered. Indeed, physical trauma can cause death, brain damage, developmental delays and deviations in personality development. The environment in which the abused child grows and develops is a most…

  17. Developmental Status and Intimacy in Adult Survivors of Childhood Cancer.

    ERIC Educational Resources Information Center

    Zevon, Michael A.; Corn, Barbara; Lowrie, Geoffrey; Green, Daniel M.

    Whereas aggressive multimodal therapies are responsible for improved survival rates of children and adolescents diagnosed with cancer, concern has grown regarding the potential for adverse and delayed developmental effects resulting from these treatments. In light of this concern, this study assessed 207 adult survivors of childhood cancer in…

  18. Thinking about Feelings: Emotion Focus in the Parenting of Children with Early Developmental Risk

    ERIC Educational Resources Information Center

    Baker, J. K.; Crnic, K. A.

    2009-01-01

    Background: Children with developmental delays exhibit more difficulty with certain emotional processes than their typically developing peers, which seems to partially account for the increased risk for the development of social problems in this population. Despite considerable study with typically developing populations, research on parental…

  19. Sonoma Developmental Curriculum: Instructional Programs. Volume II.

    ERIC Educational Resources Information Center

    Adams, Patrick, Ed.; And Others

    The guide presents instructional materials for teaching developmentally delayed children from birth to 6 years old. The following five instructional areas are covered (with sample activities in parentheses): gross motor (demonstrates a tonic-neck reflex, demonstrates ability to bear almost full weight, and crawls backward down three steps); fine…

  20. Emplotting children's lives: developmental delay vs. disability.

    PubMed

    Landsman, Gail

    2003-05-01

    While it is increasingly possible to envision "perfect" babies, it is not always the case that reproduction actually proceeds according to individual will; for example, there has been no recent reduction in rates of childhood disability. Nevertheless, in most studies of new reproductive technologies, the birth of those children whom few would actively choose-"defective" or disabled infants-is presented only in hypothetical terms. This paper argues for expanding the domain of reproduction to include research on the parenting of children with disabilities. Based on a qualitative research project carried out at a hospital-based newborn follow-up program that serves as an evaluation site determining eligibility for early intervention services for infants and young children with disabilities, this paper focuses on a particular part of women's experience of acquiring new knowledge about personhood and disability, that is, on the period of time when a woman has recently had confirmed that reproduction has, in her case, gone awry. Disability in many cultures, including the United States, diminishes personhood. I suggest that American mothers' narratives, by utilizing the concept of developmental delay, can assert personhood, or rather, the potential for its future attainment; in doing so, they justify ongoing nurturance of a disabled child in spite of negative attitudes about disability. A particular case of one mother's emplotment of her child's life within a story of developmental delay, in competition with the physician's story of disability, is analyzed. The paper concludes with reflections on how stories of developmental delay told by mothers just encountering a diagnosis of disability may differ from the stories told by those who have experienced mothering a disabled child over time, and on the implications of these differences for the cultural construction of personhood in the United States.

Top