The gene expression database for mouse development (GXD): putting developmental expression information at your fingertips.

PubMed

Smith, Constance M; Finger, Jacqueline H; Kadin, James A; Richardson, Joel E; Ringwald, Martin

2014-10-01

Because molecular mechanisms of development are extraordinarily complex, the understanding of these processes requires the integration of pertinent research data. Using the Gene Expression Database for Mouse Development (GXD) as an example, we illustrate the progress made toward this goal, and discuss relevant issues that apply to developmental databases and developmental research in general. Since its first release in 1998, GXD has served the scientific community by integrating multiple types of expression data from publications and electronic submissions and by making these data freely and widely available. Focusing on endogenous gene expression in wild-type and mutant mice and covering data from RNA in situ hybridization, in situ reporter (knock-in), immunohistochemistry, reverse transcriptase-polymerase chain reaction, Northern blot, and Western blot experiments, the database has grown tremendously over the years in terms of data content and search utilities. Currently, GXD includes over 1.4 million annotated expression results and over 260,000 images. All these data and images are readily accessible to many types of database searches. Here we describe the data and search tools of GXD; explain how to use the database most effectively; discuss how we acquire, curate, and integrate developmental expression information; and describe how the research community can help in this process. Copyright © 2014 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

Transcriptome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing

PubMed Central

Shen, Yingjia; Venu, R.C.; Nobuta, Kan; Wu, Xiaohui; Notibala, Varun; Demirci, Caghan; Meyers, Blake C.; Wang, Guo-Liang; Ji, Guoli; Li, Qingshun Q.

2011-01-01

Polyadenylation sites mark the ends of mRNA transcripts. Alternative polyadenylation (APA) may alter sequence elements and/or the coding capacity of transcripts, a mechanism that has been demonstrated to regulate gene expression and transcriptome diversity. To study the role of APA in transcriptome dynamics, we analyzed a large-scale data set of RNA “tags” that signify poly(A) sites and expression levels of mRNA. These tags were derived from a wide range of tissues and developmental stages that were mutated or exposed to environmental treatments, and generated using digital gene expression (DGE)–based protocols of the massively parallel signature sequencing (MPSS-DGE) and the Illumina sequencing-by-synthesis (SBS-DGE) sequencing platforms. The data offer a global view of APA and how it contributes to transcriptome dynamics. Upon analysis of these data, we found that ∼60% of Arabidopsis genes have multiple poly(A) sites. Likewise, ∼47% and 82% of rice genes use APA, supported by MPSS-DGE and SBS-DGE tags, respectively. In both species, ∼49%–66% of APA events were mapped upstream of annotated stop codons. Interestingly, 10% of the transcriptomes are made up of APA transcripts that are differentially distributed among developmental stages and in tissues responding to environmental stresses, providing an additional level of transcriptome dynamics. Examples of pollen-specific APA switching and salicylic acid treatment-specific APA clearly demonstrated such dynamics. The significance of these APAs is more evident in the 3034 genes that have conserved APA events between rice and Arabidopsis. PMID:21813626

Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

PubMed

Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

2017-01-01

Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

Developmental and Individual Differences in the Neural Processing of Dynamic Expressions of Pain and Anger

PubMed Central

Missana, Manuela; Grigutsch, Maren; Grossmann, Tobias

2014-01-01

We examined the processing of facial expressions of pain and anger in 8-month-old infants and adults by measuring event-related brain potentials (ERPs) and frontal EEG alpha asymmetry. The ERP results revealed that while adults showed a late positive potential (LPP) to emotional expressions that was enhanced to pain expressions, reflecting increased evaluation and emotional arousal to pain expressions, infants showed a negative component (Nc) to emotional expressions that was enhanced to angry expressions, reflecting increased allocation of attention to angry faces. Moreover, infants and adults showed opposite patterns in their frontal asymmetry responses to pain and anger, suggesting developmental differences in the motivational processes engendered by these facial expressions. These findings are discussed in the light of associated individual differences in infant temperament and adult dispositional empathy. PMID:24705497

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

PubMed

Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

PubMed Central

Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

PubMed

Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

2015-03-01

Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Neuronal expression of fibroblast growth factor receptors in zebrafish.

PubMed

Rohs, Patricia; Ebert, Alicia M; Zuba, Ania; McFarlane, Sarah

2013-12-01

Fibroblast growth factor (FGF) signaling is important for a host of developmental processes such as proliferation, differentiation, tissue patterning, and morphogenesis. In vertebrates, FGFs signal through a family of four fibroblast growth factor receptors (FGFR 1-4), one of which is duplicated in zebrafish (FGFR1). Here we report the mRNA expression of the five known zebrafish fibroblast growth factor receptors at five developmental time points (24, 36, 48, 60, and 72h postfertilization), focusing on expression within the central nervous system. We show that the receptors have distinct and dynamic expression in the developing zebrafish brain, eye, inner ear, lateral line, and pharynx. In many cases, the expression patterns are similar to those of homologous FGFRs in mouse, chicken, amphibians, and other teleosts. Copyright © 2013 Elsevier B.V. All rights reserved.

The developmental dynamics of the Populus stem transcriptome.

PubMed

Chao, Qing; Gao, Zhi-Fang; Zhang, Dong; Zhao, Biligen-Gaowa; Dong, Feng-Qin; Fu, Chun-Xiang; Liu, Li-Jun; Wang, Bai-Chen

2018-05-31

The Populus shoot undergoes primary growth (longitudinal growth) followed by secondary growth (radial growth), which produces biomass that is an important source of energy worldwide. We adopted joint PacBio Iso-Seq and RNA-seq analysis to identify differentially expressed transcripts along a developmental gradient from the shoot apex to the fifth internode of Populus Nanlin895. We obtained 87,150 full-length transcripts, including 2,081 new isoforms and 62,058 new alternatively spliced isoforms, most of which were produced by intron retention, that were used to update the Populus annotation. Among these novel isoforms, there are 1,187 long noncoding RNAs and 356 fusion genes. Using this annotation, we found 15,838 differentially expressed transcripts along the shoot developmental gradient, of which 1,216 were transcription factors (TFs). Only a few of these genes were reported previously. The differential expression of these TFs suggests that they may play important roles in primary and secondary growth. AP2, ARF, YABBY and GRF TFs are highly expressed in the apex, whereas NAC, bZIP, PLATZ and HSF TFs are likely to be important for secondary growth. Overall, our findings provide evidence that long-read sequencing can complement short-read sequencing for cataloging and quantifying eukaryotic transcripts and increase our understanding of the vital and dynamic process of shoot development. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The Development of Rhythmic Attending in Auditory Sequences: Attunement, Referent Period, Focal Attending.

ERIC Educational Resources Information Center

Drake, Carolyn; Jones, Mari Riess; Baruch, Clarisse

2000-01-01

Extends dynamic attending theory to developmental questions concerning tempo and time hierarchies. Compares performance of 4- to 10-year-olds, and adults on dynamic attending activities. Suggests that growth trends could be expressed in terms of listeners' engagement of slower attending oscillators with age and musical experience, accompanied by…

Visualization of Notch signaling oscillation in cells and tissues.

PubMed

Shimojo, Hiromi; Harima, Yukiko; Kageyama, Ryoichiro

2014-01-01

The Notch signaling effectors Hes1 and Hes7 exhibit oscillatory expression with a period of about 2-3 h during embryogenesis. Hes1 oscillation is important for proliferation and differentiation of neural stem cells, whereas Hes7 oscillation regulates periodic formation of somites. Continuous expression of Hes1 and Hes7 inhibits these developmental processes. Thus, expression dynamics are very important for gene functions, but it is difficult to distinguish between oscillatory and persistent expression by conventional methods such as in situ hybridization and immunostaining. Here, we describe time-lapse imaging methods using destabilized luciferase reporters and a highly sensitive cooled charge-coupled device camera, which can monitor dynamic gene expression. Furthermore, the expression of two genes can be examined simultaneously by a dual reporter system using two-color luciferase reporters. Time-lapse imaging analyses reveal how dynamically gene expression changes in many biological events.

Extracellular matrix influence in Streptococcus mutans gene expression in a cariogenic biofilm.

PubMed

Florez Salamanca, E J; Klein, M I

2018-04-01

Caries etiology is biofilm-diet-dependent. Biofilms are highly dynamic and structured microbial communities enmeshed in a three-dimensional extracellular matrix. The study evaluated the expression dynamics of Streptococcus mutans genes associated with exopolysaccharides (EPS) (gtfBCD, gbpB, dexA), lipoteichoic acids (LTA) (dltABCD, SMU_775c) and extracellular DNA (eDNA) (lytST, lrgAB, ccpA) during matrix development within a mixed-species biofilm of S. mutans, Actinomyces naeslundii and Streptococcus gordonii. Mixed-species biofilms using S. mutans strains UA159 or ΔgtfB formed on saliva-coated hydroxyapatite discs were submitted to a nutritional challenge (providing an abundance of sucrose and starch). Biofilms were removed at eight developmental stages for gene expression analysis by quantitative polymerase chain reaction. The pH of spent culture media remained acidic throughout the experimental periods, being lower after sucrose and starch exposure. All genes were expressed at all biofilm developmental phases. EPS- and LTA-associated genes had a similar expression profile for both biofilms, presenting lower levels of expression at 67, 91 and 115 hours and a peak of expression at 55 hours, but having distinct expression magnitudes, with lower values for ΔgtfB (eg, fold-difference of ~382 for gtfC and ~16 for dltB at 43 hours). The eDNA-associated genes presented different dynamics of expression between both strains. In UA159 biofilms lrgA and lrgB genes were highly expressed at 29 hours (which were ~13 and ~5.4 times vs ΔgtfB, respectively), whereas in ΔgtfB biofilms an inverse relationship between lytS and lrgA and lrgB expression was detected. Therefore, the deletion of gtfB influences dynamics and magnitude of expression of genes associated with matrix main components. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis

PubMed Central

Han, Yu; Wan, Huihua; Cheng, Tangren; Wang, Jia; Yang, Weiru; Pan, Huitang; Zhang, Qixiang

2017-01-01

The developmental process that produces the ornate petals of the China rose (Rosa chinensis) is complex and is thought to depend on the balanced expression of a functionally diverse array of genes; however, the molecular basis of rose petal development is largely unknown. Here, petal growth of the R. chinensis cultivar ‘Old Blush’ was divided into four developmental stages, and RNA-seq technology was used to analyse the dynamic changes in transcription that occur as development progresses. In total, 598 million clean reads and 61,456 successfully annotated unigenes were obtained. Differentially expressed gene (DEG) analysis comparing the transcriptomes of the developmental stages resulted in the identification of several potential candidate genes involved in petal development. DEGs involved in anthocyanin biosynthesis, petal expansion, and phytohormone pathways were considered in depth, in addition to several candidate transcription factors. These results lay a foundation for future studies on the regulatory mechanisms underlying rose petal development and may be used in molecular breeding programs aimed at generating ornamental rose lines with desirable traits. PMID:28225056

Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

PubMed Central

Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

2012-01-01

The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

A C. trachomatis Cloning Vector and the Generation of C. trachomatis Strains Expressing Fluorescent Proteins under the Control of a C. trachomatis Promoter

PubMed Central

Agaisse, Hervé; Derré, Isabelle

2013-01-01

Here we describe a versatile cloning vector for conducting genetic experiments in C. trachomatis. We successfully expressed various fluorescent proteins (i.e. GFP, mCherry and CFP) from C. trachomatis regulatory elements (i.e. the promoter and terminator of the incDEFG operon) and showed that the transformed strains produced wild type amounts of infectious particles and recapitulated major features of the C. trachomatis developmental cycle. C. trachomatis strains expressing fluorescent proteins are valuable tools for studying the C. trachomatis developmental cycle. For instance, we show the feasibility of investigating the dynamics of inclusion fusion and interaction with host proteins and organelles by time-lapse video microscopy. PMID:23441233

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

PubMed Central

Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

2011-01-01

PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

Dynamic Assessment for 3- and 4-Year-Old Children Who Use Augmentative and Alternative Communication: Evaluating Expressive Syntax

ERIC Educational Resources Information Center

Binger, Cathy; Kent-Walsh, Jennifer; King, Marika

2017-01-01

Purpose: The developmental readiness to produce early sentences with an iPad communication application was assessed with ten 3- and 4-year-old children with severe speech disorders using graduated prompting dynamic assessment (DA) techniques. The participants' changes in performance within the DA sessions were evaluated, and DA performance was…

The predictive capacity of perceived expressed emotion as a dynamic entity of adolescents from the general community.

PubMed

Hale, William W; Raaijmakers, Quinten A W; van Hoof, Anne; Meeus, Wim H J

2011-06-01

In previous studies, it has been demonstrated that high parental expressed emotion (EE) is predictive of depressive, aggressive and delinquency symptoms of adolescents. Two issues have received much less prominence in EE research, these being studies of adolescent perceived EE and the measurement of the EE as a dynamic, developmental construct. This 4-year, three-wave, longitudinal study of perceived EE of adolescents from the general community examines if adolescent perceived EE measured with the traditional, one-measurement EE approach as well as adolescent perceived EE measured with a repeated measured, dynamic EE approach can predict adolescent depressive, aggressive and delinquency symptoms. Dutch adolescents (N = 285; 51% girls; M = 13 years) from the general community were prospectively studied annually for 4 years. At all waves, the adolescents completed the Level of Expressed Emotion (LEE) questionnaire and at the final wave also completed self-rated measures of depressive, aggressive and delinquent symptoms. Growth models were used to predict adolescent symptoms from adolescent perceived EE. Growth models significantly predicted adolescent depressive, aggressive and delinquency symptoms from adolescent perceived EE. This study of the LEE demonstrates that developmental characteristics of EE are predictive of adolescents' symptoms. These findings hold implications for current EE intervention therapies and the conceptualization of EE.

Developmental expression of Toll‑like receptors in the guinea pig lung.

PubMed

Ma, Lingjie; Yang, Jiali; Yang, Li; Shi, Juan; Xue, Jing; Li, Yong; Liu, Xiaoming

2017-03-01

The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

Developmental metaplasticity in neural circuit codes of firing and structure.

PubMed

Baram, Yoram

2017-01-01

Firing-rate dynamics have been hypothesized to mediate inter-neural information transfer in the brain. While the Hebbian paradigm, relating learning and memory to firing activity, has put synaptic efficacy variation at the center of cortical plasticity, we suggest that the external expression of plasticity by changes in the firing-rate dynamics represents a more general notion of plasticity. Hypothesizing that time constants of plasticity and firing dynamics increase with age, and employing the filtering property of the neuron, we obtain the elementary code of global attractors associated with the firing-rate dynamics in each developmental stage. We define a neural circuit connectivity code as an indivisible set of circuit structures generated by membrane and synapse activation and silencing. Synchronous firing patterns under parameter uniformity, and asynchronous circuit firing are shown to be driven, respectively, by membrane and synapse silencing and reactivation, and maintained by the neuronal filtering property. Analytic, graphical and simulation representation of the discrete iteration maps and of the global attractor codes of neural firing rate are found to be consistent with previous empirical neurobiological findings, which have lacked, however, a specific correspondence between firing modes, time constants, circuit connectivity and cortical developmental stages. Copyright © 2016 Elsevier Ltd. All rights reserved.

A framework for analyzing the relationship between gene expression and morphological, topological, and dynamical patterns in neuronal networks.

PubMed

de Arruda, Henrique Ferraz; Comin, Cesar Henrique; Miazaki, Mauro; Viana, Matheus Palhares; Costa, Luciano da Fontoura

2015-04-30

A key point in developmental biology is to understand how gene expression influences the morphological and dynamical patterns that are observed in living beings. In this work we propose a methodology capable of addressing this problem that is based on estimating the mutual information and Pearson correlation between the intensity of gene expression and measurements of several morphological properties of the cells. A similar approach is applied in order to identify effects of gene expression over the system dynamics. Neuronal networks were artificially grown over a lattice by considering a reference model used to generate artificial neurons. The input parameters of the artificial neurons were determined according to two distinct patterns of gene expression and the dynamical response was assessed by considering the integrate-and-fire model. As far as single gene dependence is concerned, we found that the interaction between the gene expression and the network topology, as well as between the former and the dynamics response, is strongly affected by the gene expression pattern. In addition, we observed a high correlation between the gene expression and some topological measurements of the neuronal network for particular patterns of gene expression. To our best understanding, there are no similar analyses to compare with. A proper understanding of gene expression influence requires jointly studying the morphology, topology, and dynamics of neurons. The proposed framework represents a first step towards predicting gene expression patterns from morphology and connectivity. Copyright © 2015. Published by Elsevier B.V.

The RNA-Seq-based high resolution gene expression atlas of chickpea (Cicer arietinum L.) reveals dynamic spatio-temporal changes associated with growth and development.

PubMed

Kudapa, Himabindu; Garg, Vanika; Chitikineni, Annapurna; Varshney, Rajeev K

2018-04-10

Chickpea is one of the world's largest cultivated food legumes and is an excellent source of high-quality protein to the human diet. Plant growth and development are controlled by programmed expression of a suite of genes at the given time, stage, and tissue. Understanding how the underlying genome sequence translates into specific plant phenotypes at key developmental stages, information on gene expression patterns is crucial. Here, we present a comprehensive Cicer arietinum Gene Expression Atlas (CaGEA) across different plant developmental stages and organs covering the entire life cycle of chickpea. One of the widely used drought tolerant cultivars, ICC 4958 has been used to generate RNA-Seq data from 27 samples at 5 major developmental stages of the plant. A total of 816 million raw reads were generated and of these, 794 million filtered reads after quality control (QC) were subjected to downstream analysis. A total of 15,947 unique number of differentially expressed genes across different pairwise tissue combinations were identified. Significant differences in gene expression patterns contributing in the process of flowering, nodulation, and seed and root development were inferred in this study. Furthermore, differentially expressed candidate genes from "QTL-hotspot" region associated with drought stress response in chickpea were validated. © 2018 The Authors. Plant, Cell & Environment Published by John Wiley & Sons Ltd.

Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

PubMed Central

Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

2012-01-01

Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to discover whether there are rules or regularities governing development and evolution of complex multi-cellular organisms. PMID:22807664

Differential gene expression in notochord and nerve cord fate segregation in the Ciona intestinalis embryo.

PubMed

Kobayashi, Kenji; Yamada, Lixy; Satou, Yutaka; Satoh, Nori

2013-09-01

During early embryogenesis, embryonic cells gradually restrict their developmental potential and are eventually destined to give rise to one type of cells. Molecular mechanisms underlying developmental fate restriction are one of the major research subjects within developmental biology. In this article, this subject was addressed by combining blastomere isolation with microarray analysis. During the 6th cleavage of the Ciona intestinalis embryo, from the 32-cell to the 64-cell stage, four mother cells divide into daughter cells with two distinct fates, one giving rise to notochord precursor cells and the other to nerve cord precursors. Approximately 2,200 each of notochord and nerve cord precursor cells were isolated, and their mRNA expression profiles were compared by microarray. This analysis identified 106 and 68 genes, respectively, that are differentially expressed in notochord and nerve cord precursor cells. These included not only genes for transcription factors and signaling molecules but also those with generalized functions observed in many types of cells. In addition, whole-mount in situ hybridization showed dynamic spatial expression profiles of these genes during segregation of the two fates: partitioning of transcripts present in the mother cells into either type of daughter cells, and initiation of preferential gene expression in either type of cells. Copyright © 2013 Wiley Periodicals, Inc.

A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

PubMed

Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

2013-11-06

Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

Developmental ecology of annual killifish Millerichthys robustus (Cyprinodontiformes: Cynolebiidae).

PubMed

Domínguez-Castanedo, Omar; Valdesalici, Stefano; Rosales-Torres, Ana María

2017-11-01

Populations of annual killifishes persist in temporary water bodies over the dry season through the expression of diapause in their drought-resistant embryos. Environmental cues may influence expression of the diapause phenotype during embryonic incubation. Millerichthys robustus is the only annual killifish distributed in North America. The aim of this review is to analyze the ecology of M. robustus development and contrast this with that of annual killifishes in austral locations. The temporary water bodies inhabited by M. robustus present the following environmental conditions: flood, drought, and humidity. During the flooding period, the environment presents the lowest temperatures, shortest photoperiod, and highest precipitation, and embryos were found in diapause I. The drought period features the highest temperatures and lowest precipitation, and embryos were found in diapause II. In contrast, during the humid period at the beginning of the rainy season, embryos were found in diapause I, II, and III, associated with the longer photoperiod and high temperatures. These dynamics of the diapause phenotypes can be explained by a combination of the strategies of phenotypic plasticity during flood and drought periods, and bet-hedging during the humid period. Moreover, the microenvironmental conditions in which embryos were buried could influence developmental trajectories. Developmental Dynamics 246:802-806, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Dynamics of venom composition across a complex life cycle

PubMed Central

Macrander, Jason; Fridrich, Arie; Modepalli, Vengamanaidu; Reitzel, Adam M; Sunagar, Kartik

2018-01-01

Little is known about venom in young developmental stages of animals. The appearance of toxins and stinging cells during early embryonic stages in the sea anemone Nematostella vectensis suggests that venom is already expressed in eggs and larvae of this species. Here, we harness transcriptomic, biochemical and transgenic tools to study venom production dynamics in Nematostella. We find that venom composition and arsenal of toxin-producing cells change dramatically between developmental stages of this species. These findings can be explained by the vastly different interspecific interactions of each life stage, as individuals develop from a miniature non-feeding mobile planula to a larger sessile polyp that predates on other animals and interact differently with predators. Indeed, behavioral assays involving prey, predators and Nematostella are consistent with this hypothesis. Further, the results of this work suggest a much wider and dynamic venom landscape than initially appreciated in animals with a complex life cycle. PMID:29424690

mirEX: a platform for comparative exploration of plant pri-miRNA expression data.

PubMed

Bielewicz, Dawid; Dolata, Jakub; Zielezinski, Andrzej; Alaba, Sylwia; Szarzynska, Bogna; Szczesniak, Michal W; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia; Karlowski, Wojciech M

2012-01-01

mirEX is a comprehensive platform for comparative analysis of primary microRNA expression data. RT-qPCR-based gene expression profiles are stored in a universal and expandable database scheme and wrapped by an intuitive user-friendly interface. A new way of accessing gene expression data in mirEX includes a simple mouse operated querying system and dynamic graphs for data mining analyses. In contrast to other publicly available databases, the mirEX interface allows a simultaneous comparison of expression levels between various microRNA genes in diverse organs and developmental stages. Currently, mirEX integrates information about the expression profile of 190 Arabidopsis thaliana pri-miRNAs in seven different developmental stages: seeds, seedlings and various organs of mature plants. Additionally, by providing RNA structural models, publicly available deep sequencing results, experimental procedure details and careful selection of auxiliary data in the form of web links, mirEX can function as a one-stop solution for Arabidopsis microRNA information. A web-based mirEX interface can be accessed at http://bioinfo.amu.edu.pl/mirex.

Dynamic expression of ancient and novel molluscan shell genes during ecological transitions

PubMed Central

Jackson, Daniel J; Wörheide, Gert; Degnan, Bernard M

2007-01-01

Background The Mollusca constitute one of the most morphologically and ecologically diverse metazoan phyla, occupying a wide range of marine, terrestrial and freshwater habitats. The evolutionary success of the molluscs can in part be attributed to the evolvability of the external shell. Typically, the shell first forms during embryonic and larval development, changing dramatically in shape, colour and mineralogical composition as development and maturation proceeds. Major developmental transitions in shell morphology often correlate with ecological transitions (e.g. from a planktonic to benthic existence at metamorphosis). While the genes involved in molluscan biomineralisation are beginning to be identified, there is little understanding of how these are developmentally regulated, or if the same genes are operational at different stages of the mollusc's life. Results Here we relate the developmental expression of nine genes in the tissue responsible for shell production – the mantle – to ecological transitions that occur during the lifetime of the tropical abalone Haliotis asinina (Vetigastropoda). Four of these genes encode evolutionarily ancient proteins, while four others encode secreted proteins with little or no identity to known proteins. Another gene has been previously described from the mantle of another haliotid vetigastropod. All nine genes display dynamic spatial and temporal expression profiles within the larval shell field and juvenile mantle. Conclusion These expression data reflect the regulatory complexity that underlies molluscan shell construction from larval stages to adulthood, and serves to highlight the different ecological demands placed on each stage. The use of both ancient and novel genes in all stages of shell construction also suggest that a core set of shell-making genes was provided by a shared metazoan ancestor, which has been elaborated upon to produce the range of molluscan shell types we see today. PMID:17845714

Generation of a transgenic medaka (Oryzias latipes) strain for visualization of nuclear dynamics in early developmental stages.

PubMed

Inoue, Takanobu; Iida, Atsuo; Maegawa, Shingo; Sehara-Fujisawa, Atsuko; Kinoshita, Masato

2016-12-01

In this study, we verified nuclear transport activity of an artificial nuclear localization signal (aNLS) in medaka fish (Oryzias latipes). We generated a transgenic medaka strain expresses the aNLS tagged enhanced green fluorescent protein (EGFP) driven by a medaka beta-actin promoter. The aNLS-EGFP was accumulated in the nuclei of somatic tissues and yolk nuclei of oocytes, but undetectable in the spermatozoa. The fluorescent signal was observed from immediately after fertilization by a maternal contribution. Furthermore, male and female pronuclei were visualized in fertilized eggs, and nuclear dynamics of pronuclear fusion and subsequent cleavage were captured by time-lapse imaging. In contrast, SV40NLS exhibited no activity of nuclear transport in early embryos. In conclusion, the aNLS possesses a strong nuclear localization activity and is a useful probe for fluorescent observation of the pronuclei and nuclei in early developmental stage of medaka. © 2016 Japanese Society of Developmental Biologists.

Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken.

PubMed

Yokoyama, Shigetoshi; Hashimoto, Megumi; Shimizu, Hirohito; Ueno-Kudoh, Hiroe; Uchibe, Kenta; Kimura, Ichiro; Asahara, Hiroshi

2008-02-01

The Caenorhabditis elegans heterochronic gene lin-28 regulates developmental timing in the nematode trunk. We report the dynamic expression patterns of Lin-28 homologues in mouse and chick embryos. Whole mount in situ hybridization revealed specific and intriguing expression patterns of Lin-28 in the developing mouse and chick limb bud. Mouse Lin-28 expression was detected in both the forelimb and hindlimb at E9.5, but disappeared from the forelimb at E10.5, and finally from the forelimb and hindlimb at E11.5. Chicken Lin-28, which was first detected in the limb primordium at stage 15/16, was also downregulated as the stage proceeded. The amino acid sequences of mouse and chicken Lin-28 genes are highly conserved and the similar expression patterns of Lin-28 during limb development in mouse and chicken suggest that this heterochronic gene is also conserved during vertebrate limb development.

Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling.

PubMed

Prpic, Nikola-Michael; Janssen, Ralf; Wigand, Barbara; Klingler, Martin; Damen, Wim G M

2003-12-01

Leg development in Drosophila has been studied in much detail. However, Drosophila limbs form in the larva as imaginal discs and not during embryogenesis as in most other arthropods. Here, we analyze appendage genes in the spider Cupiennius salei and the beetle Tribolium castaneum. Differences in decapentaplegic (dpp) expression suggest a different mode of distal morphogen signaling suitable for the specific geometry of growing limb buds. Also, expression of the proximal genes homothorax (hth) and extradenticle (exd) is significantly altered: in the spider, exd is restricted to the proximal leg and hth expression extends distally, while in insects, exd is expressed in the entire leg and hth is restricted to proximal parts. This reversal of spatial specificity demonstrates an evolutionary shift, which is nevertheless compatible with a conserved role of this gene pair as instructor of proximal fate. Different expression dynamics of dachshund and Distal-less point to modifications in the regulation of the leg gap gene system. We comment on the significance of this finding for attempts to homologize leg segments in different arthropod classes. Comparison of the expression profiles of H15 and optomotor-blind to the Drosophila patterns suggests modifications also in the dorsal-ventral patterning system of the legs. Together, our results suggest alterations in many components of the leg developmental system, namely proximal-distal and dorsal-ventral patterning, and leg segmentation. Thus, the leg developmental system exhibits a propensity to evolutionary change, which probably forms the basis for the impressive diversity of arthropod leg morphologies.

Function and Evolution of DNA Methylation in Nasonia vitripennis

PubMed Central

Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

2013-01-01

The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

PubMed Central

Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

PubMed

Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

Genetic variation of growth dynamics in maize (Zea mays L.) revealed through automated non-invasive phenotyping.

PubMed

Muraya, Moses M; Chu, Jianting; Zhao, Yusheng; Junker, Astrid; Klukas, Christian; Reif, Jochen C; Altmann, Thomas

2017-01-01

Hitherto, most quantitative trait loci of maize growth and biomass yield have been identified for a single time point, usually the final harvest stage. Through this approach cumulative effects are detected, without considering genetic factors causing phase-specific differences in growth rates. To assess the genetics of growth dynamics, we employed automated non-invasive phenotyping to monitor the plant sizes of 252 diverse maize inbred lines at 11 different developmental time points; 50 k SNP array genotype data were used for genome-wide association mapping and genomic selection. The heritability of biomass was estimated to be over 71%, and the average prediction accuracy amounted to 0.39. Using the individual time point data, 12 main effect marker-trait associations (MTAs) and six pairs of epistatic interactions were detected that displayed different patterns of expression at various developmental time points. A subset of them also showed significant effects on relative growth rates in different intervals. The detected MTAs jointly explained up to 12% of the total phenotypic variation, decreasing with developmental progression. Using non-parametric functional mapping and multivariate mapping approaches, four additional marker loci affecting growth dynamics were detected. Our results demonstrate that plant biomass accumulation is a complex trait governed by many small effect loci, most of which act at certain restricted developmental phases. This highlights the need for investigation of stage-specific growth affecting genes to elucidate important processes operating at different developmental phases. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Head regeneration in hemichordates is not a strict recapitulation of development

PubMed Central

Luttrell, Shawn M.; Gotting, Kirsten; Ross, Eric; Alvarado, Alejandro Sánchez

2016-01-01

Background: Head or anterior body part regeneration is commonly associated with protostome, but not deuterostome invertebrates. However, it has been shown that the solitary hemichordate Ptychodera flava possesses the remarkable capacity to regenerate their entire nervous system, including their dorsal neural tube and their anterior head‐like structure, or proboscis. Hemichordates, also known as acorn worms, are marine invertebrate deuterostomes that have retained chordate traits that were likely present in the deuterostome ancestor, placing these animals in a vital position to study regeneration and chordate evolution. All acorn worms have a tripartite body plan, with an anterior proboscis, middle collar region, and a posterior trunk. The collar houses a hollow, dorsal neural tube in ptychoderid hemichordates and numerous chordate genes involved in brain and spinal cord development are expressed in a similar anterior–posterior spatial arrangement along the body axis. Results: We have examined anterior regeneration in the hemichordate Ptychodera flava and report the spatial and temporal morphological changes that occur. Additionally, we have sequenced, assembled, and analyzed the transcriptome for eight stages of regenerating P. flava, revealing significant differential gene expression between regenerating and control animals. Conclusions: Importantly, we have uncovered developmental steps that are regeneration‐specific and do not strictly follow the embryonic program. Developmental Dynamics 245:1159–1175, 2016. © 2016 The Authors. Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists PMID:27649280

Transcriptome Dynamics during Maize Endosperm Development

PubMed Central

Feng, Jiaojiao; Xu, Shutu; Wang, Lei; Li, Feifei; Li, Yibo; Zhang, Renhe; Zhang, Xinghua; Xue, Jiquan; Guo, Dongwei

2016-01-01

The endosperm is a major organ of the seed that plays vital roles in determining seed weight and quality. However, genome-wide transcriptome patterns throughout maize endosperm development have not been comprehensively investigated to date. Accordingly, we performed a high-throughput RNA sequencing (RNA-seq) analysis of the maize endosperm transcriptome at 5, 10, 15 and 20 days after pollination (DAP). We found that more than 11,000 protein-coding genes underwent alternative splicing (AS) events during the four developmental stages studied. These genes were mainly involved in intracellular protein transport, signal transmission, cellular carbohydrate metabolism, cellular lipid metabolism, lipid biosynthesis, protein modification, histone modification, cellular amino acid metabolism, and DNA repair. Additionally, 7,633 genes, including 473 transcription factors (TFs), were differentially expressed among the four developmental stages. The differentially expressed TFs were from 50 families, including the bZIP, WRKY, GeBP and ARF families. Further analysis of the stage-specific TFs showed that binding, nucleus and ligand-dependent nuclear receptor activities might be important at 5 DAP, that immune responses, signalling, binding and lumen development are involved at 10 DAP, that protein metabolic processes and the cytoplasm might be important at 15 DAP, and that the responses to various stimuli are different at 20 DAP compared with the other developmental stages. This RNA-seq analysis provides novel, comprehensive insights into the transcriptome dynamics during early endosperm development in maize. PMID:27695101

[Expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain].

PubMed

Zhang, Wei; Fan, Li-mei; Li, Lin-lin; Peng, Zheng-yu

2014-01-01

To investigate the expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain. Brain samples were collected from mice with different developmental stages: 9, 12, 14 d before birth (E9, E12, E14) and 1 d, 3 weeks and 3 months after birth. The expression of NSSR1 in mouse brain at different developmental stages was detected by Western blot and the distribution of NSSR1 was analyzed by immunohistochemical staining. The expression and distribution of NSSR1 in mouse brain were compared among embryos, neonatal and adult animals. During embryogenesis, the expression of NSSR1 proteins increases significantly from 0.186(E9) to 0.445(E14) and reached a high level after birth. Immunohistochemical analysis showed that in E12 embryos, NSSR1 was specifically distributed in the marginal and mantle layers. The expression of NSSR1 in hippocampus was very low in neonatal animals but stronger in adults. In cerebellar cortex, NSSR1 was widely expressed in purkinje and granule cells of adult animals, but mainly expressed in Purkinje cells in neonates. The expression of NSSR1 is regulated by the development of mouse brain and presents dynamic changes.

Parental effects in ecology and evolution: mechanisms, processes and implications

PubMed Central

Badyaev, Alexander V.; Uller, Tobias

2009-01-01

As is the case with any metaphor, parental effects mean different things to different biologists—from developmental induction of novel phenotypic variation to an evolved adaptation, and from epigenetic transference of essential developmental resources to a stage of inheritance and ecological succession. Such a diversity of perspectives illustrates the composite nature of parental effects that, depending on the stage of their expression and whether they are considered a pattern or a process, combine the elements of developmental induction, homeostasis, natural selection, epigenetic inheritance and historical persistence. Here, we suggest that by emphasizing the complexity of causes and influences in developmental systems and by making explicit the links between development, natural selection and inheritance, the study of parental effects enables deeper understanding of developmental dynamics of life cycles and provides a unique opportunity to explicitly integrate development and evolution. We highlight these perspectives by placing parental effects in a wider evolutionary framework and suggest that far from being only an evolved static outcome of natural selection, a distinct channel of transmission between parents and offspring, or a statistical abstraction, parental effects on development enable evolution by natural selection by reliably transferring developmental resources needed to reconstruct, maintain and modify genetically inherited components of the phenotype. The view of parental effects as an essential and dynamic part of an evolutionary continuum unifies mechanisms behind the origination, modification and historical persistence of organismal form and function, and thus brings us closer to a more realistic understanding of life's complexity and diversity. PMID:19324619

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

Transcriptome analyses reveal genotype- and developmental stage-specific molecular responses to drought and salinity stresses in chickpea

PubMed Central

Garg, Rohini; Shankar, Rama; Thakkar, Bijal; Kudapa, Himabindu; Krishnamurthy, Lakshmanan; Mantri, Nitin; Varshney, Rajeev K.; Bhatia, Sabhyata; Jain, Mukesh

2016-01-01

Drought and salinity are the major factors that limit chickpea production worldwide. We performed whole transcriptome analyses of chickpea genotypes to investigate the molecular basis of drought and salinity stress response/adaptation. Phenotypic analyses confirmed the contrasting responses of the chickpea genotypes to drought or salinity stress. RNA-seq of the roots of drought and salinity related genotypes was carried out under control and stress conditions at vegetative and/or reproductive stages. Comparative analysis of the transcriptomes revealed divergent gene expression in the chickpea genotypes at different developmental stages. We identified a total of 4954 and 5545 genes exclusively regulated in drought-tolerant and salinity-tolerant genotypes, respectively. A significant fraction (~47%) of the transcription factor encoding genes showed differential expression under stress. The key enzymes involved in metabolic pathways, such as carbohydrate metabolism, photosynthesis, lipid metabolism, generation of precursor metabolites/energy, protein modification, redox homeostasis and cell wall component biogenesis, were affected by drought and/or salinity stresses. Interestingly, transcript isoforms showed expression specificity across the chickpea genotypes and/or developmental stages as illustrated by the AP2-EREBP family members. Our findings provide insights into the transcriptome dynamics and components of regulatory network associated with drought and salinity stress responses in chickpea. PMID:26759178

Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

PubMed

Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

2016-03-15

Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

Dynamic gene and protein expression patterns of the autism-associated met receptor tyrosine kinase in the developing mouse forebrain.

PubMed

Judson, Matthew C; Bergman, Mica Y; Campbell, Daniel B; Eagleson, Kathie L; Levitt, Pat

2009-04-10

The establishment of appropriate neural circuitry depends on the coordination of multiple developmental events across space and time. These events include proliferation, migration, differentiation, and survival-all of which can be mediated by hepatocyte growth factor (HGF) signaling through the Met receptor tyrosine kinase. We previously found a functional promoter variant of the MET gene to be associated with autism spectrum disorder, suggesting that forebrain circuits governing social and emotional function may be especially vulnerable to developmental disruptions in HGF/Met signaling. However, little is known about the spatiotemporal distribution of Met expression in the forebrain during the development of such circuits. To advance our understanding of the neurodevelopmental influences of Met activation, we employed complementary Western blotting, in situ hybridization, and immunohistochemistry to comprehensively map Met transcript and protein expression throughout perinatal and postnatal development of the mouse forebrain. Our studies reveal complex and dynamic spatiotemporal patterns of expression during this period. Spatially, Met transcript is localized primarily to specific populations of projection neurons within the neocortex and in structures of the limbic system, including the amygdala, hippocampus, and septum. Met protein appears to be principally located in axon tracts. Temporally, peak expression of transcript and protein occurs during the second postnatal week. This period is characterized by extensive neurite outgrowth and synaptogenesis, supporting a role for the receptor in these processes. Collectively, these data suggest that Met signaling may be necessary for the appropriate wiring of forebrain circuits, with particular relevance to the social and emotional dimensions of behavior. (c) 2009 Wiley-Liss, Inc.

Dynamics of DNA methylation and Histone H4 acetylation during floral bud differentiation in azalea

PubMed Central

2010-01-01

Background The ability to control the timing of flowering is a key strategy for planning production in ornamental species such as azalea, however it requires a thorough understanding of floral transition. Floral transition is achieved through a complex genetic network and regulated by multiple environmental and endogenous cues. Dynamic changes between chromatin states facilitating or inhibiting DNA transcription regulate the expression of floral induction pathways in response to environmental and developmental signals. DNA methylation and histone modifications are involved in controlling the functional state of chromatin and gene expression. Results The results of this work indicate that epigenetic mechanisms such as DNA methylation and histone H4 acetylation have opposite and particular dynamics during the transition from vegetative to reproductive development in the apical shoots of azalea. Global levels of DNA methylation and histone H4 acetylation as well as immunodetection of 5-mdC and acetylated H4, in addition to a morphological study have permitted the delimitation of four basic phases in the development of the azalea bud and allowed the identification of a stage of epigenetic reprogramming which showed a sharp decrease of whole DNA methylation similar to that is defined in other developmental processes in plants and in mammals. Conclusion The epigenetic control and reorganization of chromatin seem to be decisive for coordinating floral development in azalea. DNA methylation and H4 deacetylation act simultaneously and co-ordinately, restructuring the chromatin and regulating the gene expression during soot apical meristem development and floral differentiation. PMID:20067625

Childhood Behavior Problems as They Relate to a Dynamic Model of Psycho-Social Development. Volume 2, Number 4.

ERIC Educational Resources Information Center

Barnard, James W.

The paper relates the development of childhood behavior problems to a developmental theory of the acquisition of psycho-social skills in children. The influence of Eric Erikson (1950) on the ideas expressed is acknowledged. It is stated that each of the major types of behavior problems (withdrawal, impulsivity, dependence) results from a major…

Using Dynamic Assessment to Evaluate the Expressive Syntax of Children who use Augmentative and Alternative Communication

PubMed Central

King, Marika R.; Binger, Cathy; Kent-Walsh, Jennifer

2015-01-01

The developmental readiness of four 5-year-old children to produce basic sentences using graphic symbols on an augmentative and alternative communication (AAC) device during a dynamic assessment (DA) task was examined. Additionally, the ability of the DA task to predict performance on a subsequent experimental task was evaluated. A graduated prompting framework was used during DA. Measures included amount of support required to produce the targets, modifiability (change in participant performance) within a DA session, and predictive validity of DA. Participants accurately produced target structures with varying amounts of support. Modifiability within DA sessions was evident for some participants, and partial support was provided for the measures of predictive validity. These initial results indicate that DA may be a viable way to measure young children’s developmental readiness to learn how to sequence simple, rule-based messages via aided AAC. PMID:25621928

Neutrality and Robustness in Evo-Devo: Emergence of Lateral Inhibition

PubMed Central

Munteanu, Andreea; Solé, Ricard V.

2008-01-01

Embryonic development is defined by the hierarchical dynamical process that translates genetic information (genotype) into a spatial gene expression pattern (phenotype) providing the positional information for the correct unfolding of the organism. The nature and evolutionary implications of genotype–phenotype mapping still remain key topics in evolutionary developmental biology (evo-devo). We have explored here issues of neutrality, robustness, and diversity in evo-devo by means of a simple model of gene regulatory networks. The small size of the system allowed an exhaustive analysis of the entire fitness landscape and the extent of its neutrality. This analysis shows that evolution leads to a class of robust genetic networks with an expression pattern characteristic of lateral inhibition. This class is a repertoire of distinct implementations of this key developmental process, the diversity of which provides valuable clues about its underlying causal principles. PMID:19023404

Genome-wide dynamics of alternative polyadenylation in rice

PubMed Central

Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

2016-01-01

Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

EPA Science Inventory

Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

Genome-wide expression profiling of in vivo-derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

PubMed Central

Kabani, Sarah; Fenn, Katelyn; Ross, Alan; Ivens, Al; Smith, Terry K; Ghazal, Peter; Matthews, Keith

2009-01-01

Background Trypanosomes undergo extensive developmental changes during their complex life cycle. Crucial among these is the transition between slender and stumpy bloodstream forms and, thereafter, the differentiation from stumpy to tsetse-midgut procyclic forms. These developmental events are highly regulated, temporally reproducible and accompanied by expression changes mediated almost exclusively at the post-transcriptional level. Results In this study we have examined, by whole-genome microarray analysis, the mRNA abundance of genes in slender and stumpy forms of T.brucei AnTat1.1 cells, and also during their synchronous differentiation to procyclic forms. In total, five biological replicates representing the differentiation of matched parasite populations derived from five individual mouse infections were assayed, with RNAs being derived at key biological time points during the time course of their synchronous differentiation to procyclic forms. Importantly, the biological context of these mRNA profiles was established by assaying the coincident cellular events in each population (surface antigen exchange, morphological restructuring, cell cycle re-entry), thereby linking the observed gene expression changes to the well-established framework of trypanosome differentiation. Conclusion Using stringent statistical analysis and validation of the derived profiles against experimentally-predicted gene expression and phenotypic changes, we have established the profile of regulated gene expression during these important life-cycle transitions. The highly synchronous nature of differentiation between stumpy and procyclic forms also means that these studies of mRNA profiles are directly relevant to the changes in mRNA abundance within individual cells during this well-characterised developmental transition. PMID:19747379

The miRNAome dynamics during developmental and metabolic reprogramming of tomato root infected with potato cyst nematode.

PubMed

Koter, Marek D; Święcicka, Magdalena; Matuszkiewicz, Mateusz; Pacak, Andrzej; Derebecka, Natalia; Filipecki, Marcin

2018-03-01

Cyst-forming plant-parasitic nematodes are pests threatening many crops. By means of their secretions cyst nematodes induce the developmental and metabolic reprogramming of host cells that lead to the formation of a syncytium, which is the sole food source for growing nematodes. The in depth micro RNA (miRNA) dynamics in the syncytia induced by Globodera rostochiensis in tomato roots was studied. The miRNAomes were obtained from syncytia covering the early and intermediate developmental stages, and were the subject of differential expression analysis. The expression of 1235 miRNAs was monitored. The fold change (log 2 FC) ranged from -7.36 to 8.38, indicating that this transcriptome fraction was very variable. Moreover, we showed that the DE (differentially expressed) miRNAs do not fully overlap between the selected time points, suggesting infection stage specific regulation by miRNA. The correctness of RNA-seq expression profiling was confirmed by qRT-PCR (quantitative Real Time Polymerase Chain Reaction) for seven miRNA species. Down- and up-regulated miRNA species, including their isomiRs, were further used to identify their potential targets. Among them there are a large number of transcription factors linked to different aspects of plant development belonging to gene families, such as APETALA2 (AP2), SQUAMOSA (MADS-box), MYB, GRAS, and AUXIN RESPONSE FACTOR (ARF). The substantial portion of potential target genes belong to the NB-LRR and RLK (RECEPTOR-LIKE KINASE) families, indicating the involvement of miRNA mediated regulation in defense responses. We also collected the evidence for target cleavage in the case of 29 miRNAs using one of three alternative methods: 5' RACE (5' Rapid Amplification of cDNA Ends), a search of tasiRNA within our datasets, and the meta-analysis of tomato degradomes in the GEO (Gene Expression Omnibus) database. Eight target transcripts showed a negative correlation with their respective miRNAs at two or three time points. These results indicate a large regulatory potential for miRNAs in tuning the development and defense responses. Copyright © 2017 Elsevier B.V. All rights reserved.

Accelerated Evolution of Developmentally Biased Genes in the Tetraphenic Ant Cardiocondyla obscurior.

PubMed

Schrader, Lukas; Helanterä, Heikki; Oettler, Jan

2017-03-01

Plastic gene expression underlies phenotypic plasticity and plastically expressed genes evolve under different selection regimes compared with ubiquitously expressed genes. Social insects are well-suited models to elucidate the evolutionary dynamics of plastic genes for their genetically and environmentally induced discrete polymorphisms. Here, we study the evolution of plastically expressed genes in the ant Cardiocondyla obscurior-a species that produces two discrete male morphs in addition to the typical female polymorphism of workers and queens. Based on individual-level gene expression data from 28 early third instar larvae, we test whether the same evolutionary dynamics that pertain to plastically expressed genes in adults also pertain to genes with plastic expression during development. In order to quantify plasticity of gene expression over multiple contrasts, we develop a novel geometric measure. For genes expressed during development, we show that plasticity of expression is positively correlated with evolutionary rates. We furthermore find a strong correlation between expression plasticity and expression variation within morphs, suggesting a close link between active and passive plasticity of gene expression. Our results support the notion of relaxed selection and neutral processes as important drivers in the evolution of adaptive plasticity. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Dynamic Expression of the Translational Machinery during Bacillus subtilis Life Cycle at a Single Cell Level

PubMed Central

Rosenberg, Alex; Sinai, Lior; Smith, Yoav; Ben-Yehuda, Sigal

2012-01-01

The ability of bacteria to responsively regulate the expression of translation components is crucial for rapid adaptation to fluctuating environments. Utilizing Bacillus subtilis (B. subtilis) as a model organism, we followed the dynamics of the translational machinery at a single cell resolution during growth and differentiation. By comprehensive monitoring the activity of the major rrn promoters and ribosomal protein production, we revealed diverse dynamics between cells grown in rich and poor medium, with the most prominent dissimilarities exhibited during deep stationary phase. Further, the variability pattern of translational activity varied among the cells, being affected by nutrient availability. We have monitored for the first time translational dynamics during the developmental process of sporulation within the two distinct cellular compartments of forespore and mother-cell. Our study uncovers a transient forespore specific increase in expression of translational components. Finally, the contribution of each rrn promoter throughout the bacterium life cycle was found to be relatively constant, implying that differential expression is not the main purpose for the existence of multiple rrn genes. Instead, we propose that coordination of the rrn operons serves as a strategy to rapidly fine tune translational activities in a synchronized fashion to achieve an optimal translation level for a given condition. PMID:22848659

Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

PubMed

Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

PubMed Central

Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

Transcriptional atlas of cardiogenesis maps congenital heart disease interactome.

PubMed

Li, Xing; Martinez-Fernandez, Almudena; Hartjes, Katherine A; Kocher, Jean-Pierre A; Olson, Timothy M; Terzic, Andre; Nelson, Timothy J

2014-07-01

Mammalian heart development is built on highly conserved molecular mechanisms with polygenetic perturbations resulting in a spectrum of congenital heart diseases (CHD). However, knowledge of cardiogenic ontogeny that regulates proper cardiogenesis remains largely based on candidate-gene approaches. Mapping the dynamic transcriptional landscape of cardiogenesis from a genomic perspective is essential to integrate the knowledge of heart development into translational applications that accelerate disease discovery efforts toward mechanistic-based treatment strategies. Herein, we designed a time-course transcriptome analysis to investigate the genome-wide dynamic expression landscape of innate murine cardiogenesis ranging from embryonic stem cells to adult cardiac structures. This comprehensive analysis generated temporal and spatial expression profiles, revealed stage-specific gene functions, and mapped the dynamic transcriptome of cardiogenesis to curated pathways. Reconciling known genetic underpinnings of CHD, we deconstructed a disease-centric dynamic interactome encoded within this cardiogenic atlas to identify stage-specific developmental disturbances clustered on regulation of epithelial-to-mesenchymal transition (EMT), BMP signaling, NF-AT signaling, TGFb-dependent EMT, and Notch signaling. Collectively, this cardiogenic transcriptional landscape defines the time-dependent expression of cardiac ontogeny and prioritizes regulatory networks at the interface between health and disease. Copyright © 2014 the American Physiological Society.

Information Propagation in Developmental Enhancers

NASA Astrophysics Data System (ADS)

Jena, Siddhartha; Levine, Michael

Rather than encoding information about protein sequence, certain lengths of noncoding DNA, called enhancers, interact with protein machinery such as transcription factors to precisely regulate gene expression. Enhancers have been studied extensively in the fruit fly Drosophila melanogaster, where they regulate the expression of developmental genes that establish the blueprint of the adult fly. It has been suggested that enhancer sequences possess a specific but unknown syntax with regards to the placement and strength of transcription factor binding sites. Moreover, studies in divergent fly species have shown that compensatory evolution allows for maintenance of enhancer functionality despite considerable variation in primary DNA sequence. Here, the possible role of enhancers as signal processing modules is studied as a way of explaining these two findings. We first demonstrate how this framework can be used to explain the fine-tuned spatiotemporal dynamics of gene expression. We then explore the evolutionary pressure on enhancer sequences and the resulting emergence of enhancers that are linked by compensatory mutations. This study provides a possible mechanism for the function of multiple enhancers linked to a single gene.

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Dynamic Assessment for 3- and 4-Year-Old Children Who Use Augmentative and Alternative Communication: Evaluating Expressive Syntax.

PubMed

Binger, Cathy; Kent-Walsh, Jennifer; King, Marika

2017-07-12

The developmental readiness to produce early sentences with an iPad communication application was assessed with ten 3- and 4-year-old children with severe speech disorders using graduated prompting dynamic assessment (DA) techniques. The participants' changes in performance within the DA sessions were evaluated, and DA performance was compared with performance during a subsequent intervention. Descriptive statistics were used to examine patterns of performance at various cueing levels and mean levels of cueing support. The Wilcoxon signed-ranks test was used to measure changes within the DA sessions. Correlational data were calculated to determine how well performance in DA predicted performance during a subsequent intervention. Participants produced targets successfully in DA at various cueing levels, with some targets requiring less cueing than others. Performance improved significantly within the DA sessions-that is, the level of cueing required for accurate productions of the targets decreased during DA sessions. Last, moderate correlations existed between DA scores and performance during the intervention for 3 out of 4 targets, with statistically significant findings for 2 of 4 targets. DA offers promise for examining the developmental readiness of young children who use augmentative and alternative communication to produce early expressive language structures.

Dynamic Assessment for 3- and 4-Year-Old Children Who Use Augmentative and Alternative Communication: Evaluating Expressive Syntax

PubMed Central

Kent-Walsh, Jennifer; King, Marika

2017-01-01

Purpose The developmental readiness to produce early sentences with an iPad communication application was assessed with ten 3- and 4-year-old children with severe speech disorders using graduated prompting dynamic assessment (DA) techniques. The participants' changes in performance within the DA sessions were evaluated, and DA performance was compared with performance during a subsequent intervention. Method Descriptive statistics were used to examine patterns of performance at various cueing levels and mean levels of cueing support. The Wilcoxon signed-ranks test was used to measure changes within the DA sessions. Correlational data were calculated to determine how well performance in DA predicted performance during a subsequent intervention. Results Participants produced targets successfully in DA at various cueing levels, with some targets requiring less cueing than others. Performance improved significantly within the DA sessions—that is, the level of cueing required for accurate productions of the targets decreased during DA sessions. Last, moderate correlations existed between DA scores and performance during the intervention for 3 out of 4 targets, with statistically significant findings for 2 of 4 targets. Conclusion DA offers promise for examining the developmental readiness of young children who use augmentative and alternative communication to produce early expressive language structures. PMID:28614580

RNA-sequencing of the sturgeon Acipenser baeri provides insights into expression dynamics of morphogenic differentiation and developmental regulatory genes in early versus late developmental stages.

PubMed

Song, Wei; Jiang, Keji; Zhang, Fengying; Lin, Yu; Ma, Lingbo

2016-08-08

Acipenser baeri, one of the critically endangered animals on the verge of extinction, is a key species for evolutionary, developmental, physiology and conservation studies and a standout amongst the most important food products worldwide. Though the transcriptome of the early development of A. baeri has been published recently, the transcriptome changes occurring in the transition from embryonic to late stages are still unknown. The aim of this work was to analyze the transcriptomes of embryonic and post-embryonic stages of A. baeri and identify differentially expressed genes (DEGs) and their expression patterns using mRNA collected from specimens at big yolk plug, wide neural plate and 64 day old sturgeon developmental stages for RNA-Seq. The paired-end sequencing of the transcriptome of samples of A. baeri collected at two early (big yolk plug (T1, 32 h after fertilization) and wide neural plate formation (T2, 45 h after fertilization)) and one late (T22, 64 day old sturgeon) developmental stages using Illumina Hiseq2000 platform generated 64039846, 64635214 and 75293762 clean paired-end reads for T1, T2 and T22, respectively. After quality control, the sequencing reads were de novo assembled to generate a set of 149,265 unigenes with N50 value of 1277 bp. Functional annotation indicated that a substantial number of these unigenes had significant similarity with proteins in public databases. Differential expression profiling allowed the identification of 2789, 12,819 and 10,824 DEGs from the respective T1 vs. T2, T1 vs. T22 and T2 vs. T22 comparisons. High correlation of DEGs' features was recorded among early stages while significant divergences were observed when comparing the late stage with early stages. GO and KEGG enrichment analyses revealed the biological processes, cellular component, molecular functions and metabolic pathways associated with identified DEGs. The qRT-PCR performed for candidate genes in specimens confirmed the validity of the RNA-seq data. This study presents, for the first time, an extensive overview of RNA-Seq based characterization of the early and post-embryonic developmental transcriptomes of A. baeri and provided 149,265 gene sequences that will be potentially valuable for future molecular and genetic studies in A. baeri.

Developmental temperature affects the expression of ejaculatory traits and the outcome of sperm competition in Callosobruchus maculatus.

PubMed

Vasudeva, R; Deeming, D C; Eady, P E

2014-09-01

The outcome of post-copulatory sexual selection is determined by a complex set of interactions between the primary reproductive traits of two or more males and their interactions with the reproductive traits of the female. Recently, a number of studies have shown the primary reproductive traits of both males and females express phenotypic plasticity in response to the thermal environment experienced during ontogeny. However, how plasticity in these traits affects the dynamics of sperm competition remains largely unknown. Here, we demonstrate plasticity in testes size, sperm size and sperm number in response to developmental temperature in the bruchid beetle Callosobruchus maculatus. Males reared at the highest temperature eclosed at the smallest body size and had the smallest absolute and relative testes size. Males reared at both the high- and low-temperature extremes produced both fewer and smaller sperm than males reared at intermediate temperatures. In the absence of sperm competition, developmental temperature had no effect on male fertility. However, under conditions of sperm competition, males reared at either temperature extreme were less competitive in terms of sperm offence (P(2)), whereas those reared at the lowest temperature were less competitive in terms of sperm defence (P(1)). This suggests the developmental pathways that regulate the phenotypic expression of these ejaculatory traits are subject to both natural and sexual selection: natural selection in the pre-ejaculatory environment and sexual selection in the post-ejaculatory environment. In nature, thermal heterogeneity during development is commonplace. Therefore, we suggest the interplay between ecology and development represents an important, yet hitherto underestimated component of male fitness via post-copulatory sexual selection. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

Systematically labeling developmental stage-specific genes for the study of pancreatic β-cell differentiation from human embryonic stem cells.

PubMed

Liu, Haisong; Yang, Huan; Zhu, Dicong; Sui, Xin; Li, Juan; Liang, Zhen; Xu, Lei; Chen, Zeyu; Yao, Anzhi; Zhang, Long; Zhang, Xi; Yi, Xing; Liu, Meng; Xu, Shiqing; Zhang, Wenjian; Lin, Hua; Xie, Lan; Lou, Jinning; Zhang, Yong; Xi, Jianzhong; Deng, Hongkui

2014-10-01

The applications of human pluripotent stem cell (hPSC)-derived cells in regenerative medicine has encountered a long-standing challenge: how can we efficiently obtain mature cell types from hPSCs? Attempts to address this problem are hindered by the complexity of controlling cell fate commitment and the lack of sufficient developmental knowledge for guiding hPSC differentiation. Here, we developed a systematic strategy to study hPSC differentiation by labeling sequential developmental genes to encompass the major developmental stages, using the directed differentiation of pancreatic β cells from hPSCs as a model. We therefore generated a large panel of pancreas-specific mono- and dual-reporter cell lines. With this unique platform, we visualized the kinetics of the entire differentiation process in real time for the first time by monitoring the expression dynamics of the reporter genes, identified desired cell populations at each differentiation stage and demonstrated the ability to isolate these cell populations for further characterization. We further revealed the expression profiles of isolated NGN3-eGFP(+) cells by RNA sequencing and identified sushi domain-containing 2 (SUSD2) as a novel surface protein that enriches for pancreatic endocrine progenitors and early endocrine cells both in human embryonic stem cells (hESC)-derived pancreatic cells and in the developing human pancreas. Moreover, we captured a series of cell fate transition events in real time, identified multiple cell subpopulations and unveiled their distinct gene expression profiles, among heterogeneous progenitors for the first time using our dual reporter hESC lines. The exploration of this platform and our new findings will pave the way to obtain mature β cells in vitro.

Transcriptome changes during fruit development and ripening of sweet orange (Citrus sinensis).

PubMed

Yu, Keqin; Xu, Qiang; Da, Xinlei; Guo, Fei; Ding, Yuduan; Deng, Xiuxin

2012-01-10

The transcriptome of the fruit pulp of the sweet orange variety Anliu (WT) and that of its red fleshed mutant Hong Anliu (MT) were compared to understand the dynamics and differential expression of genes expressed during fruit development and ripening. The transcriptomes of WT and MT were sampled at four developmental stages using an Illumina sequencing platform. A total of 19,440 and 18,829 genes were detected in MT and WT, respectively. Hierarchical clustering analysis revealed 24 expression patterns for the set of all genes detected, of which 20 were in common between MT and WT. Over 89% of the genes showed differential expression during fruit development and ripening in the WT. Functional categorization of the differentially expressed genes revealed that cell wall biosynthesis, carbohydrate and citric acid metabolism, carotenoid metabolism, and the response to stress were the most differentially regulated processes occurring during fruit development and ripening. A description of the transcriptomic changes occurring during fruit development and ripening was obtained in sweet orange, along with a dynamic view of the gene expression differences between the wild type and a red fleshed mutant. © 2012 Yu et al; licensee BioMed Central Ltd.

Developmental expression of Drosophila Wiskott-Aldrich Syndrome family proteins

PubMed Central

Rodriguez-Mesa, Evelyn; Abreu-Blanco, Maria Teresa; Rosales-Nieves, Alicia E.; Parkhurst, Susan M.

2012-01-01

Background Wiskott-Aldrich Syndrome (WASP) family proteins participate in many cellular processes involving rearrangements of the actin cytoskeleton. To the date, four WASP subfamily members have been described in Drosophila: Wash, WASp, SCAR, and Whamy. Wash, WASp, and SCAR are essential during early Drosophila development where they function in orchestrating cytoplasmic events including membrane-cytoskeleton interactions. A mutant for Whamy has not yet been reported. Results We generated monoclonal antibodies that are specific to Drosophila Wash, WASp, SCAR, and Whamy, and use these to describe their spatial and temporal localization patterns. Consistent with the importance of WASP family proteins in flies, we find that Wash, WASp, SCAR, and Whamy are dynamically expressed throughout oogenesis and embryogenesis. For example, we find that Wash accumulates at the oocyte cortex. WASp is highly expressed in the PNS, while SCAR is the most abundantly expressed in the CNS. Whamy exhibits an asymmetric subcellular localization that overlaps with mitochondria and is highly expressed in muscle. Conclusion All four WASP family members show specific expression patterns, some of which reflect their previously known roles and others revealing new potential functions. The monoclonal antibodies developed offer valuable new tools to investigate how WASP family proteins regulate actin cytoskeleton dynamics. PMID:22275148

Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

PubMed Central

Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

2010-01-01

Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

Bud detachment in hydra requires activation of fibroblast growth factor receptor and a Rho-ROCK-myosin II signaling pathway to ensure formation of a basal constriction.

PubMed

Holz, Oliver; Apel, David; Steinmetz, Patrick; Lange, Ellen; Hopfenmüller, Simon; Ohler, Kerstin; Sudhop, Stefanie; Hassel, Monika

2017-07-01

Hydra propagates asexually by exporting tissue into a bud, which detaches 4 days later as a fully differentiated young polyp. Prerequisite for detachment is activation of fibroblast growth factor receptor (FGFR) signaling. The mechanism which enables constriction and tissue separation within the monolayered ecto- and endodermal epithelia is unknown. Histological sections and staining of F-actin by phalloidin revealed conspicuous cell shape changes at the bud detachment site indicating a localized generation of mechanical forces and the potential enhancement of secretory functions in ectodermal cells. By gene expression analysis and pharmacological inhibition, we identified a candidate signaling pathway through Rho, ROCK, and myosin II, which controls bud base constriction and rearrangement of the actin cytoskeleton. Specific regional myosin phosphorylation suggests a crucial role of ectodermal cells at the detachment site. Inhibition of FGFR, Rho, ROCK, or myosin II kinase activity is permissive for budding, but represses myosin phosphorylation, rearrangement of F-actin and constriction. The young polyp remains permanently connected to the parent by a broad tissue bridge. Our data suggest an essential role of FGFR and a Rho-ROCK-myosin II pathway in the control of cell shape changes required for bud detachment. Developmental Dynamics 246:502-516, 2017. © 2017 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists. © 2017 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

Transcriptional dynamics of the developing sweet cherry (Prunus avium L.) fruit: sequencing, annotation and expression profiling of exocarp-associated genes

PubMed Central

Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz

2014-01-01

The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533

Mapping the mouse Allelome reveals tissue-specific regulation of allelic expression

PubMed Central

Andergassen, Daniel; Dotter, Christoph P; Wenzel, Daniel; Sigl, Verena; Bammer, Philipp C; Muckenhuber, Markus; Mayer, Daniela; Kulinski, Tomasz M; Theussl, Hans-Christian; Penninger, Josef M; Bock, Christoph; Barlow, Denise P; Pauler, Florian M; Hudson, Quanah J

2017-01-01

To determine the dynamics of allelic-specific expression during mouse development, we analyzed RNA-seq data from 23 F1 tissues from different developmental stages, including 19 female tissues allowing X chromosome inactivation (XCI) escapers to also be detected. We demonstrate that allelic expression arising from genetic or epigenetic differences is highly tissue-specific. We find that tissue-specific strain-biased gene expression may be regulated by tissue-specific enhancers or by post-transcriptional differences in stability between the alleles. We also find that escape from X-inactivation is tissue-specific, with leg muscle showing an unexpectedly high rate of XCI escapers. By surveying a range of tissues during development, and performing extensive validation, we are able to provide a high confidence list of mouse imprinted genes including 18 novel genes. This shows that cluster size varies dynamically during development and can be substantially larger than previously thought, with the Igf2r cluster extending over 10 Mb in placenta. DOI: http://dx.doi.org/10.7554/eLife.25125.001 PMID:28806168

Capturing in vivo RNA transcriptional dynamics from the malaria parasite Plasmodium falciparum

PubMed Central

Painter, Heather J.; Carrasquilla, Manuela; Llinás, Manuel

2017-01-01

To capture the transcriptional dynamics within proliferating cells, methods to differentiate nascent transcription from preexisting mRNAs are desired. One approach is to label newly synthesized mRNA transcripts in vivo through the incorporation of modified pyrimidines. However, the human malaria parasite, Plasmodium falciparum, is incapable of pyrimidine salvage for mRNA biogenesis. To capture cellular mRNA dynamics during Plasmodium development, we engineered parasites that can salvage pyrimidines through the expression of a single bifunctional yeast fusion gene, cytosine deaminase/uracil phosphoribosyltransferase (FCU). We show that expression of FCU allows for the direct incorporation of thiol-modified pyrimidines into nascent mRNAs. Using developmental stage-specific promoters to express FCU-GFP enables the biosynthetic capture and in-depth analysis of mRNA dynamics from subpopulations of cells undergoing differentiation. We demonstrate the utility of this method by examining the transcriptional dynamics of the sexual gametocyte stage transition, a process that is essential to malaria transmission between hosts. Using the pfs16 gametocyte-specific promoter to express FCU-GFP in 3D7 parasites, we found that sexual stage commitment is governed by transcriptional reprogramming and stabilization of a subset of essential gametocyte transcripts. We also measured mRNA dynamics in F12 gametocyte-deficient parasites and demonstrate that the transcriptional program required for sexual commitment and maturation is initiated but likely aborted due to the absence of the PfAP2-G transcriptional regulator and a lack of gametocyte-specific mRNA stabilization. Biosynthetic labeling of Plasmodium mRNAs is incredibly versatile, can be used to measure transcriptional dynamics at any stage of parasite development, and will allow for future applications to comprehensively measure RNA-protein interactions in the malaria parasite. PMID:28416533

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

PubMed Central

2007-01-01

Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

Impaired recognition of facial emotions from low-spatial frequencies in Asperger syndrome.

PubMed

Kätsyri, Jari; Saalasti, Satu; Tiippana, Kaisa; von Wendt, Lennart; Sams, Mikko

2008-01-01

The theory of 'weak central coherence' [Happe, F., & Frith, U. (2006). The weak coherence account: Detail-focused cognitive style in autism spectrum disorders. Journal of Autism and Developmental Disorders, 36(1), 5-25] implies that persons with autism spectrum disorders (ASDs) have a perceptual bias for local but not for global stimulus features. The recognition of emotional facial expressions representing various different levels of detail has not been studied previously in ASDs. We analyzed the recognition of four basic emotional facial expressions (anger, disgust, fear and happiness) from low-spatial frequencies (overall global shapes without local features) in adults with an ASD. A group of 20 participants with Asperger syndrome (AS) was compared to a group of non-autistic age- and sex-matched controls. Emotion recognition was tested from static and dynamic facial expressions whose spatial frequency contents had been manipulated by low-pass filtering at two levels. The two groups recognized emotions similarly from non-filtered faces and from dynamic vs. static facial expressions. In contrast, the participants with AS were less accurate than controls in recognizing facial emotions from very low-spatial frequencies. The results suggest intact recognition of basic facial emotions and dynamic facial information, but impaired visual processing of global features in ASDs.

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE PAGES

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

2017-06-21

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers

PubMed Central

Naxerova, Kamila; Bult, Carol J; Peaston, Anne; Fancher, Karen; Knowles, Barbara B; Kasif, Simon; Kohane, Isaac S

2008-01-01

Background In recent years, the molecular underpinnings of the long-observed resemblance between neoplastic and immature tissue have begun to emerge. Genome-wide transcriptional profiling has revealed similar gene expression signatures in several tumor types and early developmental stages of their tissue of origin. However, it remains unclear whether such a relationship is a universal feature of malignancy, whether heterogeneities exist in the developmental component of different tumor types and to which degree the resemblance between cancer and development is a tissue-specific phenomenon. Results We defined a developmental landscape by summarizing the main features of ten developmental time courses and projected gene expression from a variety of human tumor types onto this landscape. This comparison demonstrates a clear imprint of developmental gene expression in a wide range of tumors and with respect to different, even non-cognate developmental backgrounds. Our analysis reveals three classes of cancers with developmentally distinct transcriptional patterns. We characterize the biological processes dominating these classes and validate the class distinction with respect to a new time series of murine embryonic lung development. Finally, we identify a set of genes that are upregulated in most cancers and we show that this signature is active in early development. Conclusion This systematic and quantitative overview of the relationship between the neoplastic and developmental transcriptome spanning dozens of tissues provides a reliable outline of global trends in cancer gene expression, reveals potentially clinically relevant differences in the gene expression of different cancer types and represents a reference framework for interpretation of smaller-scale functional studies. PMID:18611264

Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

PubMed

Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

2016-07-07

During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. Copyright © 2016 Song et al.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

The Role of BDNF in the Development of Fear Learning.

PubMed

Dincheva, Iva; Lynch, Niccola B; Lee, Francis S

2016-10-01

Brain-derived neurotrophic factor (BDNF) is a growth factor that is dynamically expressed in the brain across postnatal development, regulating neuronal differentiation and synaptic plasticity. The neurotrophic hypothesis of psychiatric mood disorders postulates that in the adult brain, decreased BDNF levels leads to altered neural plasticity, contributing to disease. Although BDNF has been established as a key factor regulating the critical period plasticity in the developing visual system, it has recently been shown to also play a role in fear circuitry maturation, which has implications for the emergence of fear-related mood disorders. This review provides a detailed overview of developmental changes in expression of BDNF isoforms, as well as their receptors across postnatal life. In addition, recent developmental studies utilizing a genetic BDNF single nucleotide polymorphism (Val66Met) knock-in mouse highlight the impact of BDNF on fear learning during a sensitive period spanning the transition into adolescent time frame. We hypothesize that BDNF in the developing brain regulates fear circuit plasticity during a sensitive period in early adolescence, and alterations in BDNF expression (genetic or environmental) have a persistent impact on fear behavior and fear-related disorders. © 2016 Wiley Periodicals, Inc.

Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans.

PubMed

Sinha, Amit; Sommer, Ralf J; Dieterich, Christoph

2012-06-19

An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution.

Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans

PubMed Central

2012-01-01

Background An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. Results We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Conclusion Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution. PMID:22712530

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development1[OPEN

PubMed Central

2017-01-01

Rice (Oryza sativa) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1, a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. PMID:28500269

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development.

PubMed

Zhou, Li-Juan; Xiao, Lang-Tao; Xue, Hong-Wei

2017-07-01

Rice ( Oryza sativa ) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1 , a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. © 2017 American Society of Plant Biologists. All Rights Reserved.

Identification and Expression Analysis of microRNAs at the Grain Filling Stage in Rice(Oryza sativa L.)via Deep Sequencing

PubMed Central

Yi, Rong; Zhu, Zhixuan; Hu, Jihong; Qian, Qian; Dai, Jincheng; Ding, Yi

2013-01-01

MicroRNAs (miRNAs) have been shown to play crucial roles in the regulation of plant development. In this study, high-throughput RNA-sequencing technology was used to identify novel miRNAs, and to reveal miRNAs expression patterns at different developmental stages during rice (Oryza sativa L.) grain filling. A total of 434 known miRNAs (380, 402, 390 and 392 at 5, 7, 12 and 17 days after fertilization, respectively.) were obtained from rice grain. The expression profiles of these identified miRNAs were analyzed and the results showed that 161 known miRNAs were differentially expressed during grain development, a high proportion of which were up-regulated from 5 to 7 days after fertilization. In addition, sixty novel miRNAs were identified, and five of these were further validated experimentally. Additional analysis showed that the predicted targets of the differentially expressed miRNAs may participate in signal transduction, carbohydrate and nitrogen metabolism, the response to stimuli and epigenetic regulation. In this study, differences were revealed in the composition and expression profiles of miRNAs among individual developmental stages during the rice grain filling process, and miRNA editing events were also observed, analyzed and validated during this process. The results provide novel insight into the dynamic profiles of miRNAs in developing rice grain and contribute to the understanding of the regulatory roles of miRNAs in grain filling. PMID:23469249

Non-rigid, but not rigid, motion interferes with the processing of structural face information in developmental prosopagnosia.

PubMed

Maguinness, Corrina; Newell, Fiona N

2015-04-01

There is growing evidence to suggest that facial motion is an important cue for face recognition. However, it is poorly understood whether motion is integrated with facial form information or whether it provides an independent cue to identity. To provide further insight into this issue, we compared the effect of motion on face perception in two developmental prosopagnosics and age-matched controls. Participants first learned faces presented dynamically (video), or in a sequence of static images, in which rigid (viewpoint) or non-rigid (expression) changes occurred. Immediately following learning, participants were required to match a static face image to the learned face. Test face images varied by viewpoint (Experiment 1) or expression (Experiment 2) and were learned or novel face images. We found similar performance across prosopagnosics and controls in matching facial identity across changes in viewpoint when the learned face was shown moving in a rigid manner. However, non-rigid motion interfered with face matching across changes in expression in both individuals with prosopagnosia compared to the performance of control participants. In contrast, non-rigid motion did not differentially affect the matching of facial expressions across changes in identity for either prosopagnosics (Experiment 3). Our results suggest that whilst the processing of rigid motion information of a face may be preserved in developmental prosopagnosia, non-rigid motion can specifically interfere with the representation of structural face information. Taken together, these results suggest that both form and motion cues are important in face perception and that these cues are likely integrated in the representation of facial identity. Copyright © 2015 Elsevier Ltd. All rights reserved.

MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

PubMed Central

Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

2010-01-01

Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

An incoherent regulatory network architecture that orchestrates B cell diversification in response to antigen signaling

PubMed Central

Sciammas, Roger; Li, Ying; Warmflash, Aryeh; Song, Yiqiang; Dinner, Aaron R; Singh, Harinder

2011-01-01

The B-lymphocyte lineage is a leading system for analyzing gene regulatory networks (GRNs) that orchestrate distinct cell fate transitions. Upon antigen recognition, B cells can diversify their immunoglobulin (Ig) repertoire via somatic hypermutation (SHM) and/or class switch DNA recombination (CSR) before differentiating into antibody-secreting plasma cells. We construct a mathematical model for a GRN underlying this developmental dynamic. The intensity of signaling through the Ig receptor is shown to control the bimodal expression of a pivotal transcription factor, IRF-4, which dictates B cell fate outcomes. Computational modeling coupled with experimental analysis supports a model of ‘kinetic control', in which B cell developmental trajectories pass through an obligate transient state of variable duration that promotes diversification of the antibody repertoire by SHM/CSR in direct response to antigens. More generally, this network motif could be used to translate a morphogen gradient into developmental inductive events of varying time, thereby enabling the specification of distinct cell fates. PMID:21613984

Caste- and development-associated gene expression in a lower termite

PubMed Central

Scharf, Michael E; Wu-Scharf, Dancia; Pittendrigh, Barry R; Bennett, Gary W

2003-01-01

Background Social insects such as termites express dramatic polyphenism (the occurrence of multiple forms in a species on the basis of differential gene expression) both in association with caste differentiation and between castes after differentiation. We have used cDNA macroarrays to compare gene expression between polyphenic castes and intermediary developmental stages of the termite Reticulitermes flavipes. Results We identified differentially expressed genes from nine ontogenic categories. Quantitative PCR was used to quantify precise differences in gene expression between castes and between intermediary developmental stages. We found worker and nymph-biased expression of transcripts encoding termite and endosymbiont cellulases; presoldier-biased expression of transcripts encoding the storage/hormone-binding protein vitellogenin; and soldier-biased expression of gene transcripts encoding two transcription/translation factors, two signal transduction factors and four cytoskeletal/muscle proteins. The two transcription/translation factors showed significant homology to the bicaudal and bric-a-brac developmental genes of Drosophila. Conclusions Our results show differential expression of regulatory, structural and enzyme-coding genes in association with termite castes and their developmental precursor stages. They also provide the first glimpse into how insect endosymbiont cellulase gene expression can vary in association with the caste of a host. These findings shed light on molecular processes associated with termite biology, polyphenism, caste differentiation and development and highlight potentially interesting variations in developmental themes between termites, other insects, and higher animals. PMID:14519197

Dynamical Analyses for Developmental Science: A Primer for Intrigued Scientists

ERIC Educational Resources Information Center

DiDonato, M. D.; England, D.; Martin, C. L.; Amazeen, P. G.

2013-01-01

Dynamical systems theory is becoming more popular in social and developmental science. However, unfamiliarity with dynamical analysis techniques remains an obstacle for developmentalists who would like to quantitatively apply dynamics in their own research. The goal of this article is to address this issue by clearly and simply presenting several…

Dynamics of Wolbachia pipientis Gene Expression Across the Drosophila melanogaster Life Cycle

PubMed Central

Gutzwiller, Florence; Carmo, Catarina R.; Miller, Danny E.; Rice, Danny W.; Newton, Irene L. G.; Hawley, R. Scott; Teixeira, Luis; Bergman, Casey M.

2015-01-01

Symbiotic interactions between microbes and their multicellular hosts have manifold biological consequences. To better understand how bacteria maintain symbiotic associations with animal hosts, we analyzed genome-wide gene expression for the endosymbiotic α-proteobacteria Wolbachia pipientis across the entire life cycle of Drosophila melanogaster. We found that the majority of Wolbachia genes are expressed stably across the D. melanogaster life cycle, but that 7.8% of Wolbachia genes exhibit robust stage- or sex-specific expression differences when studied in the whole-organism context. Differentially-expressed Wolbachia genes are typically up-regulated after Drosophila embryogenesis and include many bacterial membrane, secretion system, and ankyrin repeat-containing proteins. Sex-biased genes are often organized as small operons of uncharacterized genes and are mainly up-regulated in adult Drosophila males in an age-dependent manner. We also systematically investigated expression levels of previously-reported candidate genes thought to be involved in host-microbe interaction, including those in the WO-A and WO-B prophages and in the Octomom region, which has been implicated in regulating bacterial titer and pathogenicity. Our work provides comprehensive insight into the developmental dynamics of gene expression for a widespread endosymbiont in its natural host context, and shows that public gene expression data harbor rich resources to probe the functional basis of the Wolbachia-Drosophila symbiosis and annotate the transcriptional outputs of the Wolbachia genome. PMID:26497146

Baicalin increases developmental competence of mouse embryos in vitro by inhibiting cellular apoptosis and modulating HSP70 and DNMT expression

PubMed Central

QI, Xiaonan; LI, Huatao; CONG, Xia; WANG, Xin; JIANG, Zhongling; CAO, Rongfeng; TIAN, Wenru

2016-01-01

Scutellaria baicalensis has been effectively used in Chinese traditional medicine to prevent miscarriages. However, little information is available on its mechanism of action. This study is designed specifically to reveal how baicalin, the main effective ingredient of S. baicalensis, improves developmental competence of embryos in vitro, using the mouse as a model. Mouse pronuclear embryos were cultured in KSOM medium supplemented with (0, 2, 4 and 8 μg/ml) baicalin. The results demonstrated that in vitro culture conditions significantly decreased the blastocyst developmental rate and blastocyst quality, possibly due to increased cellular stress and apoptosis. Baicalin (4 µg/ml) significantly increased 2- and 4-cell cleavage rates, morula developmental rate, and blastocyst developmental rate and cell number of in vitro-cultured mouse embryos. Moreover, baicalin increased the expression of Gja1, Cdh1, Bcl-2, and Dnmt3a genes, decreased the expression of Dnmt1 gene, and decreased cellular stress and apoptosis as it decreased the expression of HSP70, CASP3, and BAX and increased BCL-2 expression in blastocysts cultured in vitro. In conclusion, baicalin improves developmental competence of in vitro-cultured mouse embryos through inhibition of cellular apoptosis and HSP70 expression, and improvement of DNA methylation. PMID:27478062

Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus.

PubMed

Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

2016-10-01

This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .

Quantitative system drift compensates for altered maternal inputs to the gap gene network of the scuttle fly Megaselia abdita

PubMed Central

Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Janssens, Hilde; Alcaine-Colet, Anna; Lemke, Steffen; Schmidt-Ott, Urs; Jaeger, Johannes

2015-01-01

The segmentation gene network in insects can produce equivalent phenotypic outputs despite differences in upstream regulatory inputs between species. We investigate the mechanistic basis of this phenomenon through a systems-level analysis of the gap gene network in the scuttle fly Megaselia abdita (Phoridae). It combines quantification of gene expression at high spatio-temporal resolution with systematic knock-downs by RNA interference (RNAi). Initiation and dynamics of gap gene expression differ markedly between M. abdita and Drosophila melanogaster, while the output of the system converges to equivalent patterns at the end of the blastoderm stage. Although the qualitative structure of the gap gene network is conserved, there are differences in the strength of regulatory interactions between species. We term such network rewiring ‘quantitative system drift’. It provides a mechanistic explanation for the developmental hourglass model in the dipteran lineage. Quantitative system drift is likely to be a widespread mechanism for developmental evolution. DOI: http://dx.doi.org/10.7554/eLife.04785.001 PMID:25560971

Visualization of protein interactions in living Drosophila embryos by the bimolecular fluorescence complementation assay.

PubMed

Hudry, Bruno; Viala, Séverine; Graba, Yacine; Merabet, Samir

2011-01-28

Protein interactions control the regulatory networks underlying developmental processes. The understanding of developmental complexity will, therefore, require the characterization of protein interactions within their proper environment. The bimolecular fluorescence complementation (BiFC) technology offers this possibility as it enables the direct visualization of protein interactions in living cells. However, its potential has rarely been applied in embryos of animal model organisms and was only performed under transient protein expression levels. Using a Hox protein partnership as a test case, we investigated the suitability of BiFC for the study of protein interactions in the living Drosophila embryo. Importantly, all BiFC parameters were established with constructs that were stably expressed under the control of endogenous promoters. Under these physiological conditions, we showed that BiFC is specific and sensitive enough to analyse dynamic protein interactions. We next used BiFC in a candidate interaction screen, which led to the identification of several Hox protein partners. Our results establish the general suitability of BiFC for revealing and studying protein interactions in their physiological context during the rapid course of Drosophila embryonic development.

Survey of O-GlcNAc level variations in Xenopus laevis from oogenesis to early development.

PubMed

Dehennaut, Vanessa; Lefebvre, Tony; Leroy, Yves; Vilain, Jean-Pierre; Michalski, Jean-Claude; Bodart, Jean-François

2009-04-01

Little is known about the impact of O-linked-N-acetylglucosaminylation (O-GlcNAc) in gametes production and developmental processes. Here we investigated changes in O-GlcNAc, UDP-GlcNAc and O-GlcNAc transferase (OGT) levels in Xenopus laevis from oogenesis to embryo hatching. We showed that in comparison to stage VI, stages I-V oocytes expressed higher levels of O-GlcNAc correlating changes in OGT expression, but not in UDP-GlcNAc pools. Upon progesterone stimulation, an O-GlcNAc level burst occurred during meiotic resumption long before MPF and Mos-Erk2 pathways activations. Finally, we observed high levels of O-GlcNAc, UDP-GlcNAc and OGT during segmentation that decreased concomitantly at the onset of gastrulation. Nevertheless, no correlation between the glycosylation, the nucleotide-sugar and the glycosyltransferase was observed after neurulation. Our results show that O-GlcNAc is regulated throughout oogenesis and development within a complex pattern and suggest that dysfunctions in the dynamics of this glycosylation could lead to developmental abnormalities.

Epigenetic Influences on Brain Development and Plasticity

PubMed Central

Fagiolini, Michela; Jensen, Catherine L.; Champagne, Frances A.

2009-01-01

A fine interplay exists between sensory experience and innate genetic programs leading to the sculpting of neuronal circuits during early brain development. Recent evidence suggests that the dynamic regulation of gene expression through epigenetic mechanisms is at the interface between environmental stimuli and long-lasting molecular, cellular and complex behavioral phenotypes acquired during periods of developmental plasticity. Understanding these mechanisms may give insight into the formation of critical periods and provide new strategies for increasing plasticity and adaptive change in adulthood. PMID:19545993

Robust and irreversible development in cell society as a general consequence of intra-inter dynamics

NASA Astrophysics Data System (ADS)

Kaneko, Kunihiko; Furusawa, Chikara

2000-05-01

A dynamical systems scenario for developmental cell biology is proposed, based on numerical studies of a system with interacting units with internal dynamics and reproduction. Diversification, formation of discrete and recursive types, and rules for differentiation are found as a natural consequence of such a system. “Stem cells” that either proliferate or differentiate to different types stochastically are found to appear when intra-cellular dynamics are chaotic. Robustness of the developmental process against microscopic and macroscopic perturbations is shown to be a natural consequence of such intra-inter dynamics, while irreversibility in developmental process is discussed in terms of the gain of stability, loss of diversity and chaotic instability.

Characterization of the cork oak transcriptome dynamics during acorn development.

PubMed

Miguel, Andreia; de Vega-Bartol, José; Marum, Liliana; Chaves, Inês; Santo, Tatiana; Leitão, José; Varela, Maria Carolina; Miguel, Célia M

2015-06-25

Cork oak (Quercus suber L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water. A total of 80,357 expressed sequence tags (ESTs) were de novo assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in Q. suber transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability. To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.

Neuroimmune mechanisms of stress: sex differences, developmental plasticity, and implications for pharmacotherapy of stress-related disease

PubMed Central

Deak, Terrence; Quinn, Matt; Cidlowski, John A.; Victoria, Nicole C.; Murphy, Anne Z.; Sheridan, John F.

2016-01-01

The last decade has witnessed profound growth in studies examining the role of fundamental neuroimmune processes as key mechanisms that might form a natural bridge between normal physiology and pathological outcomes. Rooted in core concepts from psychoneuroimmunology, this review utilizes a succinct, exemplar-driven approach of several model systems that contribute significantly to our knowledge of the mechanisms by which neuroimmune processes interact with stress physiology. Specifically, we review recent evidence showing that (i) stress challenges produce time-dependent and stressor-specific patterns of cytokine/chemokine expression in the CNS; (ii) inflammation-related genes exhibit unique expression profiles in males and females depending upon individual, cooperative, or antagonistic interactions between steroid hormone receptors (Estrogen and Glucocorticoid receptors); (iii) adverse social experiences incurred through repeated social defeat engage a dynamic process of immune cell migration from the bone marrow to brain and prime neuroimmune function; and (iv) early developmental exposure to an inflammatory stimulus (carageenin injection into the hindpaw) has a lasting influence on stress reactivity across the lifespan. As such, the present review provides a theoretical framework for understanding the role that neuroimmune mechanisms might play in stress plasticity and pathological outcomes, while at the same time pointing toward features of the individual (sex, developmental experience, stress history) that might ultimately be used for the development of personalized strategies for therapeutic intervention in stress-related pathologies. PMID:26176590

Decline in the Quality of Family Relationships Predicts Escalation in Children’s Internalizing Symptoms from Middle to Late Childhood

PubMed Central

Kochanska, Grazyna

2015-01-01

An integration of family systems perspectives with developmental psychopathology provides a framework for examining the complex interplay between family processes and developmental trajectories of child psychopathology over time. In a community sample of 98 families, we investigated the evolution of family relationships, across multiple subsystems of the family (i.e., interparental, mother-child, father-child), and the impact of these changing family dynamics on developmental trajectories of child internalizing symptoms over 6 years, from preschool age to pre-adolescence. Parent–child relationship quality was observed during lengthy sessions, consisting of multiple naturalistic, carefully scripted contexts. Each parent completed reports about interparental relationship satisfaction and child internalizing symptoms. To the extent that mothers experienced a steeper decline in interparental relationship satisfaction over time, children developed internalizing symptoms at a faster rate. Further, symptoms escalated at a faster rate to the extent that negative mother-child relationship quality increased (more negative affect expressed by both mother and child, greater maternal power assertion) and positive mother-child relationship quality decreased (less positive affect expressed by both mother and child, less warmth and positive reciprocity). Time-lagged growth curve analyses established temporal precedence such that decline in family relationships preceded escalation in child internalizing symptoms. Results suggest that family dysfunction, across multiple subsystems, represents a driving force in the progression of child internalizing symptoms. PMID:25790794

Decline in the Quality of Family Relationships Predicts Escalation in Children's Internalizing Symptoms from Middle to Late Childhood.

PubMed

Brock, Rebecca L; Kochanska, Grazyna

2015-10-01

An integration of family systems perspectives with developmental psychopathology provides a framework for examining the complex interplay between family processes and developmental trajectories of child psychopathology over time. In a community sample of 98 families, we investigated the evolution of family relationships, across multiple subsystems of the family (i.e., interparental, mother-child, father-child), and the impact of these changing family dynamics on developmental trajectories of child internalizing symptoms over 6 years, from preschool age to pre-adolescence. Parent-child relationship quality was observed during lengthy sessions, consisting of multiple naturalistic, carefully scripted contexts. Each parent completed reports about interparental relationship satisfaction and child internalizing symptoms. To the extent that mothers experienced a steeper decline in interparental relationship satisfaction over time, children developed internalizing symptoms at a faster rate. Further, symptoms escalated at a faster rate to the extent that negative mother-child relationship quality increased (more negative affect expressed by both mother and child, greater maternal power assertion) and positive mother-child relationship quality decreased (less positive affect expressed by both mother and child, less warmth and positive reciprocity). Time-lagged growth curve analyses established temporal precedence such that decline in family relationships preceded escalation in child internalizing symptoms. Results suggest that family dysfunction, across multiple subsystems, represents a driving force in the progression of child internalizing symptoms.

Impaired imprinted X chromosome inactivation is responsible for the skewed sex ratio following in vitro fertilization

PubMed Central

Tan, Kun; An, Lei; Miao, Kai; Ren, Likun; Hou, Zhuocheng; Tao, Li; Zhang, Zhenni; Wang, Xiaodong; Xia, Wei; Liu, Jinghao; Wang, Zhuqing; Xi, Guangyin; Gao, Shuai; Sui, Linlin; Zhu, De-Sheng; Wang, Shumin; Wu, Zhonghong; Bach, Ingolf; Chen, Dong-bao; Tian, Jianhui

2016-01-01

Dynamic epigenetic reprogramming occurs during normal embryonic development at the preimplantation stage. Erroneous epigenetic modifications due to environmental perturbations such as manipulation and culture of embryos during in vitro fertilization (IVF) are linked to various short- or long-term consequences. Among these, the skewed sex ratio, an indicator of reproductive hazards, was reported in bovine and porcine embryos and even human IVF newborns. However, since the first case of sex skewing reported in 1991, the underlying mechanisms remain unclear. We reported herein that sex ratio is skewed in mouse IVF offspring, and this was a result of female-biased peri-implantation developmental defects that were originated from impaired imprinted X chromosome inactivation (iXCI) through reduced ring finger protein 12 (Rnf12)/X-inactive specific transcript (Xist) expression. Compensation of impaired iXCI by overexpression of Rnf12 to up-regulate Xist significantly rescued female-biased developmental defects and corrected sex ratio in IVF offspring. Moreover, supplementation of an epigenetic modulator retinoic acid in embryo culture medium up-regulated Rnf12/Xist expression, improved iXCI, and successfully redeemed the skewed sex ratio to nearly 50% in mouse IVF offspring. Thus, our data show that iXCI is one of the major epigenetic barriers for the developmental competence of female embryos during preimplantation stage, and targeting erroneous epigenetic modifications may provide a potential approach for preventing IVF-associated complications. PMID:26951653

Neuroimmune mechanisms of stress: sex differences, developmental plasticity, and implications for pharmacotherapy of stress-related disease.

PubMed

Deak, Terrence; Quinn, Matt; Cidlowski, John A; Victoria, Nicole C; Murphy, Anne Z; Sheridan, John F

2015-01-01

The last decade has witnessed profound growth in studies examining the role of fundamental neuroimmune processes as key mechanisms that might form a natural bridge between normal physiology and pathological outcomes. Rooted in core concepts from psychoneuroimmunology, this review utilizes a succinct, exemplar-driven approach of several model systems that contribute significantly to our knowledge of the mechanisms by which neuroimmune processes interact with stress physiology. Specifically, we review recent evidence showing that (i) stress challenges produce time-dependent and stressor-specific patterns of cytokine/chemokine expression in the CNS; (ii) inflammation-related genes exhibit unique expression profiles in males and females depending upon individual, cooperative or antagonistic interactions between steroid hormone receptors (estrogen and glucocorticoid receptors); (iii) adverse social experiences incurred through repeated social defeat engage a dynamic process of immune cell migration from the bone marrow to brain and prime neuroimmune function and (iv) early developmental exposure to an inflammatory stimulus (carageenin injection into the hindpaw) has a lasting influence on stress reactivity across the lifespan. As such, the present review provides a theoretical framework for understanding the role that neuroimmune mechanisms might play in stress plasticity and pathological outcomes, while at the same time pointing toward features of the individual (sex, developmental experience, stress history) that might ultimately be used for the development of personalized strategies for therapeutic intervention in stress-related pathologies.

Individual differences in frontolimbic circuitry and anxiety emerge with adolescent changes in endocannabinoid signaling across species.

PubMed

Gee, Dylan G; Fetcho, Robert N; Jing, Deqiang; Li, Anfei; Glatt, Charles E; Drysdale, Andrew T; Cohen, Alexandra O; Dellarco, Danielle V; Yang, Rui R; Dale, Anders M; Jernigan, Terry L; Lee, Francis S; Casey, B J

2016-04-19

Anxiety disorders peak in incidence during adolescence, a developmental window that is marked by dynamic changes in gene expression, endocannabinoid signaling, and frontolimbic circuitry. We tested whether genetic alterations in endocannabinoid signaling related to a common polymorphism in fatty acid amide hydrolase (FAAH), which alters endocannabinoid anandamide (AEA) levels, would impact the development of frontolimbic circuitry implicated in anxiety disorders. In a pediatric imaging sample of over 1,000 3- to 21-y-olds, we show effects of the FAAH genotype specific to frontolimbic connectivity that emerge by ∼12 y of age and are paralleled by changes in anxiety-related behavior. Using a knock-in mouse model of the FAAH polymorphism that controls for genetic and environmental backgrounds, we confirm phenotypic differences in frontoamygdala circuitry and anxiety-related behavior by postnatal day 45 (P45), when AEA levels begin to decrease, and also, at P75 but not before. These results, which converge across species and level of analysis, highlight the importance of underlying developmental neurobiology in the emergence of genetic effects on brain circuitry and function. Moreover, the results have important implications for the identification of risk for disease and precise targeting of treatments to the biological state of the developing brain as a function of developmental changes in gene expression and neural circuit maturation.

The Co-Development of Looking Dynamics and Discrimination Performance

ERIC Educational Resources Information Center

Perone, Sammy; Spencer, John P.

2014-01-01

The study of looking dynamics and discrimination form the backbone of developmental science and are central processes in theories of infant cognition. Looking dynamics and discrimination change dramatically across the 1st year of life. Surprisingly, developmental changes in looking and discrimination have not been studied together. Recent…

Tools for assessing mitochondrial dynamics in mouse tissues and neurodegenerative models

NASA Astrophysics Data System (ADS)

Pham, Anh H.

Mitochondria are dynamic organelles that undergo membrane fusion and fission and transport. The dynamic properties of mitochondria are important for regulating mitochondrial function. Defects in mitochondrial dynamics are linked neurodegenerative diseases and affect the development of many tissues. To investigate the role of mitochondrial dynamics in diseases, versatile tools are needed to explore the physiology of these dynamic organelles in multiple tissues. Current tools for monitoring mitochondrial dynamics have been limited to studies in cell culture, which may be inadequate model systems for exploring the network of tissues. Here, we have generated mouse models for monitoring mitochondrial dynamics in a broad spectrum of tissues and cell types. The Photo-Activatable Mitochondrial (PhAM floxed) line enables Cre-inducible expression of a mitochondrial targeted photoconvertible protein, Dendra2 (mito-Dendra2). In the PhAMexcised line, mito-Dendra2 is ubiquitously expressed to facilitate broad analysis of mitochondria at various developmental processes. We have utilized these models to study mitochondrial dynamics in the nigrostriatal circuit of Parkinson's disease (PD) and in the development of skeletal muscles. Increasing evidences implicate aberrant regulation of mitochondrial fusion and fission in models of PD. To assess the function of mitochondrial dynamics in the nigrostriatal circuit, we utilized transgenic techniques to abrogate mitochondrial fusion. We show that deletion of the Mfn2 leads to the degeneration of dopaminergic neurons and Parkinson's-like features in mice. To elucidate the dynamic properties of mitochondria during muscle development, we established a platform for examining mitochondrial compartmentalization in skeletal muscles. This model system may yield clues to the role of mitochondrial dynamics in mitochondrial myopathies.

Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.

2008-09-01

The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND)more » 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression ({>=} 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans.« less

Short-term withdrawal from developmental exposure to cocaine activates the glucocorticoid receptor and alters spine dynamics.

PubMed

Caffino, Lucia; Giannotti, Giuseppe; Malpighi, Chiara; Racagni, Giorgio; Fumagalli, Fabio

2015-10-01

Although glucocorticoid receptors (GRs) contribute to the action of cocaine, their role following developmental exposure to the psychostimulant is still unknown. To address this issue, we exposed adolescent male rats to cocaine (20mg/kg/day) from post-natal day (PND) 28 to PND 42 and sacrificed them at PND 45 or 90. We studied the medial prefrontal cortex (mPFC), a brain region that is still developing during adolescence. In PND 45 rats we found enhanced GR transcription and translation as well as increased trafficking toward the nucleus of the receptor, with no alteration in plasma corticosterone levels. We also showed reduced expression of the GR co-chaperone FKBP51, that normally keeps the receptor in the cytoplasm, and increased expression of Src1, which cooperates in the activation of GR transcriptional activity, revealing that short withdrawal alters the finely tuned mechanisms regulating GR action. Since activation of GRs regulate dendritic spine morphology, we next investigated spine dynamics in cocaine-withdrawn rats. We found that PSD95, cofilin and F-actin, molecules regulating spine actin network, are reduced in the mPFC of PND 45 rats suggesting reduced spine density, confirmed by confocal imaging. Further, formation of filopodia, i.e. the inactive spines, is enhanced suggesting the formation of non-functional spines. Of note, no changes were found in molecules related to GR machinery or spine dynamics following long-term abstinence, i.e. in adult rats (PND 90). These findings demonstrate that short withdrawal promotes plastic changes in the developing brain via the dysregulation of the GR system and alterations in the spine network. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

An Examination of Dynamic Gene Expression Changes in the Mouse Brain During Pregnancy and the Postpartum Period.

PubMed

Ray, Surjyendu; Tzeng, Ruei-Ying; DiCarlo, Lisa M; Bundy, Joseph L; Vied, Cynthia; Tyson, Gary; Nowakowski, Richard; Arbeitman, Michelle N

2015-11-23

The developmental transition to motherhood requires gene expression changes that alter the brain to drive the female to perform maternal behaviors. We broadly examined the global transcriptional response in the mouse maternal brain, by examining four brain regions: hypothalamus, hippocampus, neocortex, and cerebellum, in virgin females, two pregnancy time points, and three postpartum time points. We find that overall there are hundreds of differentially expressed genes, but each brain region and time point shows a unique molecular signature, with only 49 genes differentially expressed in all four regions. Interestingly, a set of "early-response genes" is repressed in all brain regions during pregnancy and postpartum stages. Several genes previously implicated in underlying postpartum depression change expression. This study serves as an atlas of gene expression changes in the maternal brain, with the results demonstrating that pregnancy, parturition, and postpartum maternal experience substantially impact diverse brain regions. Copyright © 2016 Ray et al.

Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.

PubMed

Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B

2014-03-01

Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.

The ANISEED database: digital representation, formalization, and elucidation of a chordate developmental program.

PubMed

Tassy, Olivier; Dauga, Delphine; Daian, Fabrice; Sobral, Daniel; Robin, François; Khoueiry, Pierre; Salgado, David; Fox, Vanessa; Caillol, Danièle; Schiappa, Renaud; Laporte, Baptiste; Rios, Anne; Luxardi, Guillaume; Kusakabe, Takehiro; Joly, Jean-Stéphane; Darras, Sébastien; Christiaen, Lionel; Contensin, Magali; Auger, Hélène; Lamy, Clément; Hudson, Clare; Rothbächer, Ute; Gilchrist, Michael J; Makabe, Kazuhiro W; Hotta, Kohji; Fujiwara, Shigeki; Satoh, Nori; Satou, Yutaka; Lemaire, Patrick

2010-10-01

Developmental biology aims to understand how the dynamics of embryonic shapes and organ functions are encoded in linear DNA molecules. Thanks to recent progress in genomics and imaging technologies, systemic approaches are now used in parallel with small-scale studies to establish links between genomic information and phenotypes, often described at the subcellular level. Current model organism databases, however, do not integrate heterogeneous data sets at different scales into a global view of the developmental program. Here, we present a novel, generic digital system, NISEED, and its implementation, ANISEED, to ascidians, which are invertebrate chordates suitable for developmental systems biology approaches. ANISEED hosts an unprecedented combination of anatomical and molecular data on ascidian development. This includes the first detailed anatomical ontologies for these embryos, and quantitative geometrical descriptions of developing cells obtained from reconstructed three-dimensional (3D) embryos up to the gastrula stages. Fully annotated gene model sets are linked to 30,000 high-resolution spatial gene expression patterns in wild-type and experimentally manipulated conditions and to 528 experimentally validated cis-regulatory regions imported from specialized databases or extracted from 160 literature articles. This highly structured data set can be explored via a Developmental Browser, a Genome Browser, and a 3D Virtual Embryo module. We show how integration of heterogeneous data in ANISEED can provide a system-level understanding of the developmental program through the automatic inference of gene regulatory interactions, the identification of inducing signals, and the discovery and explanation of novel asymmetric divisions.

The ANISEED database: Digital representation, formalization, and elucidation of a chordate developmental program

PubMed Central

Tassy, Olivier; Dauga, Delphine; Daian, Fabrice; Sobral, Daniel; Robin, François; Khoueiry, Pierre; Salgado, David; Fox, Vanessa; Caillol, Danièle; Schiappa, Renaud; Laporte, Baptiste; Rios, Anne; Luxardi, Guillaume; Kusakabe, Takehiro; Joly, Jean-Stéphane; Darras, Sébastien; Christiaen, Lionel; Contensin, Magali; Auger, Hélène; Lamy, Clément; Hudson, Clare; Rothbächer, Ute; Gilchrist, Michael J.; Makabe, Kazuhiro W.; Hotta, Kohji; Fujiwara, Shigeki; Satoh, Nori; Satou, Yutaka; Lemaire, Patrick

2010-01-01

Developmental biology aims to understand how the dynamics of embryonic shapes and organ functions are encoded in linear DNA molecules. Thanks to recent progress in genomics and imaging technologies, systemic approaches are now used in parallel with small-scale studies to establish links between genomic information and phenotypes, often described at the subcellular level. Current model organism databases, however, do not integrate heterogeneous data sets at different scales into a global view of the developmental program. Here, we present a novel, generic digital system, NISEED, and its implementation, ANISEED, to ascidians, which are invertebrate chordates suitable for developmental systems biology approaches. ANISEED hosts an unprecedented combination of anatomical and molecular data on ascidian development. This includes the first detailed anatomical ontologies for these embryos, and quantitative geometrical descriptions of developing cells obtained from reconstructed three-dimensional (3D) embryos up to the gastrula stages. Fully annotated gene model sets are linked to 30,000 high-resolution spatial gene expression patterns in wild-type and experimentally manipulated conditions and to 528 experimentally validated cis-regulatory regions imported from specialized databases or extracted from 160 literature articles. This highly structured data set can be explored via a Developmental Browser, a Genome Browser, and a 3D Virtual Embryo module. We show how integration of heterogeneous data in ANISEED can provide a system-level understanding of the developmental program through the automatic inference of gene regulatory interactions, the identification of inducing signals, and the discovery and explanation of novel asymmetric divisions. PMID:20647237

Angelman syndrome: current understanding and research prospects.

PubMed

Dan, Bernard

2009-11-01

Angelman syndrome is a neurogenetic disorder characterized by developmental delay, severe intellectual disability, absent speech, exuberant behavior with happy demeanor, motor impairment, and epilepsy, due to deficient UBE3A gene expression that may be caused by various abnormalities of chromosome 15. Recent findings in animal models demonstrated altered dendritic spine formation as well as both synaptic [including gamma-aminobutyric acid (GABA)(A) and N-methyl-D-aspartate (NMDA) transmission] and nonsynaptic (including gap junction) influences in various brain regions, including hippocampus and cerebellar cortex. Reversal of selected abnormalities in rescue genetically engineered animal models is encouraging, although it should not be misinterpreted as promising "cure" for affected patients. Much research is still required to fully understand the functional links between lack of UBE3A expression and clinical manifestations of Angelman syndrome. Studies of regulation of UBE3A expression, including imprinting-related methylation, may point to possibilities of therapeutic upregulation. Understanding relevant roles of the gene product might lead to targeted intervention. Further documentation of brain network dynamics, with particular emphasis on hippocampus, thalamocortical, and cerebellar networks is needed, including in a developmental perspective. There is also a need for further clinical research for improving management of problems such as epilepsy, behavior, communication, learning, motor impairment, and sleep disturbances.

Notchless is required for axial skeleton formation in mice.

PubMed

Beck-Cormier, Sarah; Escande, Marie; Souilhol, Céline; Vandormael-Pournin, Sandrine; Sourice, Sophie; Pilet, Paul; Babinet, Charles; Cohen-Tannoudji, Michel

2014-01-01

Maintenance of cell survival is essential for proper embryonic development. In the mouse, Notchless homolog 1 (Drosophila) (Nle1) is instrumental for survival of cells of the inner cell mass upon implantation. Here, we analyze the function of Nle1 after implantation using the Meox2(tm1(cre)Sor) mouse that expresses the Cre recombinase specifically in the epiblast at E5.5. First, we find that NLE1 function is required in epiblast cells, as Nle1-deficient cells are rapidly eliminated. In this report, we also show that the Meox2(Cre) transgene is active in specific tissues during organogenesis. In particular, we detect high Cre expression in the vertebral column, ribs, limbs and tailbud. We took advantage of this dynamic expression profile to analyze the effects of inducing mosaic deletion of Nle1 in the embryo. We show that Nle1 deletion in this context, results in severe developmental anomalies leading to lethality at birth. Mutant embryos display multiple developmental defects in particular during axial skeletal formation. We also provide evidence that axial defects are due to an increase in apoptotic cell death in the somite at E9.5. These data demonstrate an essential role for Nle1 during organogenesis and in particular during axial development.

Notchless Is Required for Axial Skeleton Formation in Mice

PubMed Central

Beck-Cormier, Sarah; Escande, Marie; Souilhol, Céline; Vandormael-Pournin, Sandrine; Sourice, Sophie; Pilet, Paul; Cohen-Tannoudji, Michel

2014-01-01

Maintenance of cell survival is essential for proper embryonic development. In the mouse, Notchless homolog 1 (Drosophila) (Nle1) is instrumental for survival of cells of the inner cell mass upon implantation. Here, we analyze the function of Nle1 after implantation using the Meox2tm1(cre)Sor mouse that expresses the Cre recombinase specifically in the epiblast at E5.5. First, we find that NLE1 function is required in epiblast cells, as Nle1-deficient cells are rapidly eliminated. In this report, we also show that the Meox2Cre transgene is active in specific tissues during organogenesis. In particular, we detect high Cre expression in the vertebral column, ribs, limbs and tailbud. We took advantage of this dynamic expression profile to analyze the effects of inducing mosaic deletion of Nle1 in the embryo. We show that Nle1 deletion in this context, results in severe developmental anomalies leading to lethality at birth. Mutant embryos display multiple developmental defects in particular during axial skeletal formation. We also provide evidence that axial defects are due to an increase in apoptotic cell death in the somite at E9.5. These data demonstrate an essential role for Nle1 during organogenesis and in particular during axial development. PMID:24875805

Deconstructing transcriptional heterogeneity in pluripotent stem cells

PubMed Central

Shalek, Alex K.; Satija, Rahul; DaleyKeyser, AJay; Li, Hu; Zhang, Jin; Pardee, Keith; Gennert, David; Trombetta, John J.; Ferrante, Thomas C.; Regev, Aviv; Daley, George Q.; Collins, James J.

2014-01-01

SUMMARY Pluripotent stem cells (PSCs) are capable of dynamic interconversion between distinct substates, but the regulatory circuits specifying these states and enabling transitions between them are not well understood. We set out to characterize transcriptional heterogeneity in PSCs by single-cell expression profiling under different chemical and genetic perturbations. Signaling factors and developmental regulators show highly variable expression, with expression states for some variable genes heritable through multiple cell divisions. Expression variability and population heterogeneity can be influenced by perturbation of signaling pathways and chromatin regulators. Strikingly, either removal of mature miRNAs or pharmacologic blockage of signaling pathways drives PSCs into a low-noise ground state characterized by a reconfigured pluripotency network, enhanced self-renewal, and a distinct chromatin state, an effect mediated by opposing miRNA families acting on the c-myc / Lin28 / let-7 axis. These data illuminate the nature of transcriptional heterogeneity in PSCs. PMID:25471879

Functional analysis of lysosomes during mouse preimplantation embryo development.

PubMed

Tsukamoto, Satoshi; Hara, Taichi; Yamamoto, Atsushi; Ohta, Yuki; Wada, Ayako; Ishida, Yuka; Kito, Seiji; Nishikawa, Tetsu; Minami, Naojiro; Sato, Ken; Kokubo, Toshiaki

2013-01-01

Lysosomes are acidic and highly dynamic organelles that are essential for macromolecule degradation and many other cellular functions. However, little is known about lysosomal function during early embryogenesis. Here, we found that the number of lysosomes increased after fertilization. Lysosomes were abundant during mouse preimplantation development until the morula stage, but their numbers decreased slightly in blastocysts. Consistently, the protein expression level of mature cathepsins B and D was high from the one-cell to morula stages but low in the blastocyst stage. One-cell embryos injected with siRNAs targeted to both lysosome-associated membrane protein 1 and 2 (LAMP1 and LAMP2) were developmentally arrested at the two-cell stage. Pharmacological inhibition of lysosomes also caused developmental retardation, resulting in accumulation of lipofuscin. Our findings highlight the functional changes in lysosomes in mouse preimplantation embryos.

Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

PubMed

Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

2018-06-01

Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development.

PubMed

Deluc, Laurent G; Grimplet, Jérôme; Wheatley, Matthew D; Tillett, Richard L; Quilici, David R; Osborne, Craig; Schooley, David A; Schlauch, Karen A; Cushman, John C; Cramer, Grant R

2007-11-22

Grape berry development is a dynamic process that involves a complex series of molecular genetic and biochemical changes divided into three major phases. During initial berry growth (Phase I), berry size increases along a sigmoidal growth curve due to cell division and subsequent cell expansion, and organic acids (mainly malate and tartrate), tannins, and hydroxycinnamates accumulate to peak levels. The second major phase (Phase II) is defined as a lag phase in which cell expansion ceases and sugars begin to accumulate. Véraison (the onset of ripening) marks the beginning of the third major phase (Phase III) in which berries undergo a second period of sigmoidal growth due to additional mesocarp cell expansion, accumulation of anthocyanin pigments for berry color, accumulation of volatile compounds for aroma, softening, peak accumulation of sugars (mainly glucose and fructose), and a decline in organic acid accumulation. In order to understand the transcriptional network responsible for controlling berry development, mRNA expression profiling was conducted on berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip Vitis oligonucleotide microarray ver. 1.0 spanning seven stages of berry development from small pea size berries (E-L stages 31 to 33 as defined by the modified E-L system), through véraison (E-L stages 34 and 35), to mature berries (E-L stages 36 and 38). Selected metabolites were profiled in parallel with mRNA expression profiling to understand the effect of transcriptional regulatory processes on specific metabolite production that ultimately influence the organoleptic properties of wine. Over the course of berry development whole fruit tissues were found to express an average of 74.5% of probes represented on the Vitis microarray, which has 14,470 Unigenes. Approximately 60% of the expressed transcripts were differentially expressed between at least two out of the seven stages of berry development (28% of transcripts, 4,151 Unigenes, had pronounced (> or =2 fold) differences in mRNA expression) illustrating the dynamic nature of the developmental process. The subset of 4,151 Unigenes was split into twenty well-correlated expression profiles. Expression profile patterns included those with declining or increasing mRNA expression over the course of berry development as well as transient peak or trough patterns across various developmental stages as defined by the modified E-L system. These detailed surveys revealed the expression patterns for genes that play key functional roles in phytohormone biosynthesis and response, calcium sequestration, transport and signaling, cell wall metabolism mediating expansion, ripening, and softening, flavonoid metabolism and transport, organic and amino acid metabolism, hexose sugar and triose phosphate metabolism and transport, starch metabolism, photosynthesis, circadian cycles and pathogen resistance. In particular, mRNA expression patterns of transcription factors, abscisic acid (ABA) biosynthesis, and calcium signaling genes identified candidate factors likely to participate in the progression of key developmental events such as véraison and potential candidate genes associated with such processes as auxin partitioning within berry cells, aroma compound production, and pathway regulation and sequestration of flavonoid compounds. Finally, analysis of sugar metabolism gene expression patterns indicated the existence of an alternative pathway for glucose and triose phosphate production that is invoked from véraison to mature berries. These results reveal the first high-resolution picture of the transcriptome dynamics that occur during seven stages of grape berry development. This work also establishes an extensive catalog of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern berry development in a widely grown cultivar of wine grape. More importantly, this analysis identified a set of previously unknown genes potentially involved in critical steps associated with fruit development that can now be subjected to functional testing.

Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development

PubMed Central

Deluc, Laurent G; Grimplet, Jérôme; Wheatley, Matthew D; Tillett, Richard L; Quilici, David R; Osborne, Craig; Schooley, David A; Schlauch, Karen A; Cushman, John C; Cramer, Grant R

2007-01-01

Background Grape berry development is a dynamic process that involves a complex series of molecular genetic and biochemical changes divided into three major phases. During initial berry growth (Phase I), berry size increases along a sigmoidal growth curve due to cell division and subsequent cell expansion, and organic acids (mainly malate and tartrate), tannins, and hydroxycinnamates accumulate to peak levels. The second major phase (Phase II) is defined as a lag phase in which cell expansion ceases and sugars begin to accumulate. Véraison (the onset of ripening) marks the beginning of the third major phase (Phase III) in which berries undergo a second period of sigmoidal growth due to additional mesocarp cell expansion, accumulation of anthocyanin pigments for berry color, accumulation of volatile compounds for aroma, softening, peak accumulation of sugars (mainly glucose and fructose), and a decline in organic acid accumulation. In order to understand the transcriptional network responsible for controlling berry development, mRNA expression profiling was conducted on berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0 spanning seven stages of berry development from small pea size berries (E-L stages 31 to 33 as defined by the modified E-L system), through véraison (E-L stages 34 and 35), to mature berries (E-L stages 36 and 38). Selected metabolites were profiled in parallel with mRNA expression profiling to understand the effect of transcriptional regulatory processes on specific metabolite production that ultimately influence the organoleptic properties of wine. Results Over the course of berry development whole fruit tissues were found to express an average of 74.5% of probes represented on the Vitis microarray, which has 14,470 Unigenes. Approximately 60% of the expressed transcripts were differentially expressed between at least two out of the seven stages of berry development (28% of transcripts, 4,151 Unigenes, had pronounced (≥2 fold) differences in mRNA expression) illustrating the dynamic nature of the developmental process. The subset of 4,151 Unigenes was split into twenty well-correlated expression profiles. Expression profile patterns included those with declining or increasing mRNA expression over the course of berry development as well as transient peak or trough patterns across various developmental stages as defined by the modified E-L system. These detailed surveys revealed the expression patterns for genes that play key functional roles in phytohormone biosynthesis and response, calcium sequestration, transport and signaling, cell wall metabolism mediating expansion, ripening, and softening, flavonoid metabolism and transport, organic and amino acid metabolism, hexose sugar and triose phosphate metabolism and transport, starch metabolism, photosynthesis, circadian cycles and pathogen resistance. In particular, mRNA expression patterns of transcription factors, abscisic acid (ABA) biosynthesis, and calcium signaling genes identified candidate factors likely to participate in the progression of key developmental events such as véraison and potential candidate genes associated with such processes as auxin partitioning within berry cells, aroma compound production, and pathway regulation and sequestration of flavonoid compounds. Finally, analysis of sugar metabolism gene expression patterns indicated the existence of an alternative pathway for glucose and triose phosphate production that is invoked from véraison to mature berries. Conclusion These results reveal the first high-resolution picture of the transcriptome dynamics that occur during seven stages of grape berry development. This work also establishes an extensive catalog of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern berry development in a widely grown cultivar of wine grape. More importantly, this analysis identified a set of previously unknown genes potentially involved in critical steps associated with fruit development that can now be subjected to functional testing. PMID:18034876

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Patterns of gender development.

PubMed

Martin, Carol Lynn; Ruble, Diane N

2010-01-01

A comprehensive theory of gender development must describe and explain long-term developmental patterning and changes and how gender is experienced in the short term. This review considers multiple views on gender patterning, illustrated with contemporary research. First, because developmental research involves understanding normative patterns of change with age, several theoretically important topics illustrate gender development: how children come to recognize gender distinctions and understand stereotypes, and the emergence of prejudice and sexism. Second, developmental researchers study the stability of individual differences over time, which elucidates developmental processes. We review stability in two domains-sex segregation and activities/interests. Finally, a new approach advances understanding of developmental patterns, based on dynamic systems theory. Dynamic systems theory is a metatheoretical framework for studying stability and change, which developed from the study of complex and nonlinear systems in physics and mathematics. Some major features and examples show how dynamic approaches have been and could be applied in studying gender development.

Patterns of Gender Development

PubMed Central

Martin, Carol Lynn; Ruble, Diane N.

2013-01-01

A comprehensive theory of gender development must describe and explain long-term developmental patterning and changes and how gender is experienced in the short term. This review considers multiple views on gender patterning, illustrated with contemporary research. First, because developmental research involves understanding normative patterns of change with age, several theoretically important topics illustrate gender development: how children come to recognize gender distinctions and understand stereotypes, and the emergence of prejudice and sexism. Second, developmental researchers study the stability of individual differences over time, which elucidates developmental processes. We review stability in two domains—sex segregation and activities/interests. Finally, a new approach advances understanding of developmental patterns, based on dynamic systems theory. Dynamic systems theory is a metatheoretical framework for studying stability and change, which developed from the study of complex and nonlinear systems in physics and mathematics. Some major features and examples show how dynamic approaches have been and could be applied in studying gender development. PMID:19575615

The wish for annihilation in 'love-death' as collapse of the need for recognition, in Wagner's Tristan und Isolde.

PubMed

Bergstein, Moshe

2013-08-01

Wagner's Tristan und Isolde holds a central position in Western music and culture. It is shown to demonstrate consequences of interruption of developmental processes involving the need for recognition of subjectivity, resulting in the collapse of this need into the wish for annihilation of self and other through 'love-death' [Liebestod]. A close reading of the musical language of the opera reveals how this interruption is demonstrated, and the consequent location of identity outside of language, particularly suitable for expression in music. Isolde's dynamics are presented as distinct from that of Tristan, and in contrast to other interpretations of Tristan and Isolde's love as an attack on the Oedipal order, or as a regressive wish for pre-Oedipal union. Isolde's Act I narrative locates the origin of her desire in the protagonists' mutual gaze at a traumatic moment. In this moment powerful and contrasting emotions converge, evoking thwarted developmental needs, and arousing the fantasy of redemption in love-death. By removing the magical elements, Wagner enables a deeper understanding of the characters' positions in relation to each other, each with his or her own needs for recognition and traumatic experiences. These positions invite mutual identifications resulting in rising tension between affirmation of identity and annihilation, with actual death as the only possible psychic solution. The dynamics described in the opera demonstrate the function of music and opera in conveying meaning which is not verbally expressible. Copyright © 2013 Institute of Psychoanalysis.

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

The co-development of looking dynamics and discrimination performance

PubMed Central

Perone, Sammy; Spencer, John P.

2015-01-01

The study of looking dynamics and discrimination form the backbone of developmental science and are central processes in theories of infant cognition. Looking dynamics and discrimination change dramatically across the first year of life. Surprisingly, developmental changes in looking and discrimination have not been studied together. Recent simulations of a dynamic neural field (DNF) model of infant looking and memory suggest that looking and discrimination do change together over development and arise from a single neurodevelopmental mechanism. We probe this claim by measuring looking dynamics and discrimination along continuous, metrically organized dimensions in 5-, 7, and 10-month-old infants (N = 119). The results showed that looking dynamics and discrimination changed together over development and are linked within individuals. Quantitative simulations of a DNF model provide insights into the processes that underlie developmental change in looking dynamics and discrimination. Simulation results support the view that these changes might arise from a single neurodevelopmental mechanism. PMID:23957821

Endothelial nitric oxide synthase is dynamically expressed during bone marrow stem cell differentiation into endothelial cells.

PubMed

Liu, Zhenguo; Jiang, Yuehua; Hao, Hong; Gupta, Kalpna; Xu, Jian; Chu, Ling; McFalls, Edward; Zweier, Jay; Verfaillie, Catherine; Bache, Robert J

2007-09-01

This study was designed to investigate the developmental expression of endothelial nitric oxide synthase (eNOS) during stem cell differentiation into endothelial cells and to examine the functional status of the newly differentiated endothelial cells. Mouse adult multipotent progenitor cells (MAPCs) were used as the source of stem cells and were induced to differentiate into endothelial cells with vascular endothelial growth factor (VEGF) in serum-free medium. Expression of eNOS in the cells during differentiation was evaluated with real-time PCR, nitric oxide synthase (NOS) activity, and Western blot analysis. It was found that eNOS, but no other NOS, was present in undifferentiated MAPCs. eNOS expression disappeared in the cells immediately after induction of differentiation. However, eNOS expression reoccurred at day 7 during differentiation. Increasing eNOS mRNA, protein content, and activity were observed in the cells at days 14 and 21 during differentiation. The differentiated endothelial cells formed dense capillary networks on growth factor-reduced Matrigel. VEGF-stimulated phosphorylation of extracellular signal-regulated kinase (ERK)-1 and ERK-2 occurred in these cells, which was inhibited by NOS inhibitor N(G)-nitro-L-arginine methyl ester. In conclusion, these data demonstrate that eNOS is present in MAPCs and is dynamically expressed during the differentiation of MAPCs into endothelial cells in vitro.

Annual research review: Rare genotypes and childhood psychopathology--uncovering diverse developmental mechanisms of ADHD risk.

PubMed

Scerif, Gaia; Baker, Kate

2015-03-01

Through the increased availability and sophistication of genetic testing, it is now possible to identify causal diagnoses in a growing proportion of children with neurodevelopmental disorders. In addition to developmental delay and intellectual disability, many genetic disorders are associated with high risks of psychopathology, which curtail the wellbeing of affected individuals and their families. Beyond the identification of significant clinical needs, understanding the diverse pathways from rare genetic mutations to cognitive dysfunction and emotional-behavioural disturbance has theoretical and practical utility. We overview (based on a strategic search of the literature) the state-of-the-art on causal mechanisms leading to one of the most common childhood behavioural diagnoses - attention deficit hyperactivity disorder (ADHD) - in the context of specific genetic disorders. We focus on new insights emerging from the mapping of causal pathways from identified genetic differences to neuronal biology, brain abnormalities, cognitive processing differences and ultimately behavioural symptoms of ADHD. First, ADHD research in the context of rare genotypes highlights the complexity of multilevel mechanisms contributing to psychopathology risk. Second, comparisons between genetic disorders associated with similar psychopathology risks can elucidate convergent or distinct mechanisms at each level of analysis, which may inform therapeutic interventions and prognosis. Third, genetic disorders provide an unparalleled opportunity to observe dynamic developmental interactions between neurocognitive risk and behavioural symptoms. Fourth, variation in expression of psychopathology risk within each genetic disorder points to putative moderating and protective factors within the genome and the environment. A common imperative emerging within psychopathology research is the need to investigate mechanistically how developmental trajectories converge or diverge between and within genotype-defined groups. Crucially, as genetic predispositions modify interaction dynamics from the outset, longitudinal research is required to understand the multi-level developmental processes that mediate symptom evolution. © 2014 Association for Child and Adolescent Mental Health.

A gene network model accounting for development and evolution of mammalian teeth

PubMed Central

Salazar-Ciudad, Isaac; Jernvall, Jukka

2002-01-01

Generation of morphological diversity remains a challenge for evolutionary biologists because it is unclear how an ultimately finite number of genes involved in initial pattern formation integrates with morphogenesis. Ideally, models used to search for the simplest developmental principles on how genes produce form should account for both developmental process and evolutionary change. Here we present a model reproducing the morphology of mammalian teeth by integrating experimental data on gene interactions and growth into a morphodynamic mechanism in which developing morphology has a causal role in patterning. The model predicts the course of tooth-shape development in different mammalian species and also reproduces key transitions in evolution. Furthermore, we reproduce the known expression patterns of several genes involved in tooth development and their dynamics over developmental time. Large morphological effects frequently can be achieved by small changes, according to this model, and similar morphologies can be produced by different changes. This finding may be consistent with why predicting the morphological outcomes of molecular experiments is challenging. Nevertheless, models incorporating morphology and gene activity show promise for linking genotypes to phenotypes. PMID:12048258

Developmental Changes in the Relationship Between the Infant's Attention and Emotion During Early Face-to-Face Communication: The 2-Month Transition

ERIC Educational Resources Information Center

Lavelli, Manuela; Fogel, Alan

2005-01-01

Weekly observations documented developmental changes in mother-infant face-to-face communication between birth and 3 months. Developmental trajectories for each dyad of the duration of infant facial expressions showed a change from the dominance of Simple Attention (without other emotion expressions) to active and emotionally positive forms of…

Developmental programming: Prenatal BPA treatment disrupts timing of LH surge and ovarian follicular wave dynamics in adult sheep

PubMed Central

Veiga-Lopez, A; Beckett, EM; Abi Salloum, B; Ye, W; Padmanabhan, V

2014-01-01

Developmental exposure to BPA adversely affects reproductive function. In sheep, prenatal BPA treatment induces reproductive neuroendocrine defects, manifested as LH excess and dampened LH surge and perturbs early ovarian gene expression. In this study we hypothesized that prenatal BPA treatment will also disrupt ovarian follicular dynamics. Pregnant sheep were treated from days 30 to 90 of gestation with 3 different BPA doses (0.05, 0.5, or 5 mg/kg BW/day). All female offspring were estrus synchronized and transrectal ultrasonography was performed daily for 22 days to monitor ovarian follicular and corpora lutea dynamics. Blood samples were collected to assess hormonal preovulatory changes and luteal progesterone dynamics. Statistical analysis revealed that the time interval between the estradiol rise and the preovulatory LH surge was shortened in the BPA-treated females. None of the three BPA doses had an effect on corpora lutea, progestogenic cycles, and mean or duration of ovulatory and non-ovulatory follicles. However, differences in follicular count trajectories were evident in all three follicular size classes (2–3 mm, 4–5 mm, and ≥ 6 mm) of prenatal BPA-treated animals compared to controls. Number of follicular waves tended also to be more variable in the prenatal BPA-treated groups ranging from 2 to 5 follicular waves per cycle, while this was restricted to 3 to 4 waves in control females. These changes in ovarian follicular dynamics coupled with defects in time interval between estradiol rise and preovulatory LH release are likely to lead to subfertility in prenatal BPA-treated females. PMID:24923655

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

The Developmental Dynamics of Task-Avoidant Behavior and Math Performance in Kindergarten and Elementary School

ERIC Educational Resources Information Center

Hirvonen, Riikka; Tolvanen, Asko; Aunola, Kaisa; Nurmi, Jari-Erik

2012-01-01

Besides cognitive factors, children's learning at school may be influenced by more dynamic phenomena, such as motivation and achievement-related task-avoidant behavior. The present study examined the developmental dynamics of task-avoidant behavior and math performance from kindergarten to Grade 4. A total of 225 children were tested for their…

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

Rewiring of the inferred protein interactome during blood development studied with the tool PPICompare.

PubMed

Will, Thorsten; Helms, Volkhard

2017-04-04

Differential analysis of cellular conditions is a key approach towards understanding the consequences and driving causes behind biological processes such as developmental transitions or diseases. The progress of whole-genome expression profiling enabled to conveniently capture the state of a cell's transcriptome and to detect the characteristic features that distinguish cells in specific conditions. In contrast, mapping the physical protein interactome for many samples is experimentally infeasible at the moment. For the understanding of the whole system, however, it is equally important how the interactions of proteins are rewired between cellular states. To overcome this deficiency, we recently showed how condition-specific protein interaction networks that even consider alternative splicing can be inferred from transcript expression data. Here, we present the differential network analysis tool PPICompare that was specifically designed for isoform-sensitive protein interaction networks. Besides detecting significant rewiring events between the interactomes of grouped samples, PPICompare infers which alterations to the transcriptome caused each rewiring event and what is the minimal set of alterations necessary to explain all between-group changes. When applied to the development of blood cells, we verified that a reasonable amount of rewiring events were reported by the tool and found that differential gene expression was the major determinant of cellular adjustments to the interactome. Alternative splicing events were consistently necessary in each developmental step to explain all significant alterations and were especially important for rewiring in the context of transcriptional control. Applying PPICompare enabled us to investigate the dynamics of the human protein interactome during developmental transitions. A platform-independent implementation of the tool PPICompare is available at https://sourceforge.net/projects/ppicompare/ .

Low-dose ionizing radiation limitations to seed germination: Results from a model linking physiological characteristics and developmental-dynamics simulation strategy.

PubMed

Liu, Hui; Hu, Dawei; Dong, Chen; Fu, Yuming; Liu, Guanghui; Qin, Youcai; Sun, Yi; Liu, Dianlei; Li, Lei; Liu, Hong

2017-08-01

There is much uncertainty about the risks of seed germination after repeated or protracted environmental low-dose ionizing radiation exposure. The purpose of this study is to explore the influence mechanism of low-dose ionizing radiation on wheat seed germination using a model linking physiological characteristics and developmental-dynamics simulation. A low-dose ionizing radiation environment simulator was built to investigate wheat (Triticum aestivum L.) seeds germination process and then a kinetic model expressing the relationship between wheat seed germination dynamics and low-dose ionizing radiation intensity variations was developed by experimental data, plant physiology, relevant hypotheses and system dynamics, and sufficiently validated and accredited by computer simulation. Germination percentages were showing no differences in response to different dose rates. However, root and shoot lengths were reduced significantly. Plasma governing equations were set up and the finite element analysis demonstrated H 2 O, CO 2 , O 2 as well as the seed physiological responses to the low-dose ionizing radiation. The kinetic model was highly valid, and simultaneously the related influence mechanism of low-dose ionizing radiation on wheat seed germination proposed in the modeling process was also adequately verified. Collectively these data demonstrate that low-dose ionizing radiation has an important effect on absorbing water, consuming O 2 and releasing CO 2 , which means the risk for embryo and endosperm development was higher. Copyright © 2017 Elsevier Ltd. All rights reserved.

Extensive alternative splicing transitions during postnatal skeletal muscle development are required for calcium handling functions

PubMed Central

Brinegar, Amy E; Xia, Zheng; Loehr, James Anthony; Li, Wei; Rodney, George Gerald

2017-01-01

Postnatal development of skeletal muscle is a highly dynamic period of tissue remodeling. Here, we used RNA-seq to identify transcriptome changes from late embryonic to adult mouse muscle and demonstrate that alternative splicing developmental transitions impact muscle physiology. The first 2 weeks after birth are particularly dynamic for differential gene expression and alternative splicing transitions, and calcium-handling functions are significantly enriched among genes that undergo alternative splicing. We focused on the postnatal splicing transitions of the three calcineurin A genes, calcium-dependent phosphatases that regulate multiple aspects of muscle biology. Redirected splicing of calcineurin A to the fetal isoforms in adult muscle and in differentiated C2C12 slows the timing of muscle relaxation, promotes nuclear localization of calcineurin target Nfatc3, and/or affects expression of Nfatc transcription targets. The results demonstrate a previously unknown specificity of calcineurin isoforms as well as the broader impact of alternative splicing during muscle postnatal development. PMID:28826478

Unique patterns of organization and migration of FGF-expressing cells during Drosophila morphogenesis.

PubMed

Du, Lijuan; Zhou, Amy; Patel, Akshay; Rao, Mishal; Anderson, Kelsey; Roy, Sougata

2017-07-01

Fibroblast growth factors (FGF) are essential signaling proteins that regulate diverse cellular functions in developmental and metabolic processes. In Drosophila, the FGF homolog, branchless (bnl) is expressed in a dynamic and spatiotemporally restricted pattern to induce branching morphogenesis of the trachea, which expresses the Bnl-receptor, breathless (btl). Here we have developed a new strategy to determine bnl- expressing cells and study their interactions with the btl-expressing cells in the range of tissue patterning during Drosophila development. To enable targeted gene expression specifically in the bnl expressing cells, a new LexA based bnl enhancer trap line was generated using CRISPR/Cas9 based genome editing. Analyses of the spatiotemporal expression of the reporter in various embryonic stages, larval or adult tissues and in metabolic hypoxia, confirmed its target specificity and versatility. With this tool, new bnl expressing cells, their unique organization and functional interactions with the btl-expressing cells were uncovered in a larval tracheoblast niche in the leg imaginal discs, in larval photoreceptors of the developing retina, and in the embryonic central nervous system. The targeted expression system also facilitated live imaging of simultaneously labeled Bnl sources and tracheal cells, which revealed a unique morphogenetic movement of the embryonic bnl- source. Migration of bnl- expressing cells may create a dynamic spatiotemporal pattern of the signal source necessary for the directional growth of the tracheal branch. The genetic tool and the comprehensive profile of expression, organization, and activity of various types of bnl-expressing cells described in this study provided us with an important foundation for future research investigating the mechanisms underlying Bnl signaling in tissue morphogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

The Zebrafish Models to Explore Genetic and Epigenetic Impacts on Evolutionary Developmental Origins of Aging

PubMed Central

Kishi, Shuji

2014-01-01

Can we reset, reprogram, rejuvenate or reverse the organismal aging process? Certain genetic manipulations could at least reset and reprogram epigenetic dynamics beyond phenotypic plasticity and elasticity in cells, which can be further manipulated into organisms. However, in a whole complex aging organism, how can we rejuvenate intrinsic resources and infrastructures in an intact/noninvasive manner? The incidence of diseases increases exponentially with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but essentially inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena to rejuvenate over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states based on diverse epigenotypes, in response to intrinsic or extrinsic environmental cues and genetic perturbations. We hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds and windows of plasticity and its robustness by molecular genetic and chemical epigenetic approaches, we have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during their embryonic and/or larval stages (“embryonic/larval senescence”). Subsequently, at least some of these mutant animals were found to show shortened lifespan, while some others would be expected to live longer in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and its regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes/genotypes and epigenotype that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. PMID:24239812

Sonic Hedgehog functions through dynamic changes in temporal competence in the developing ventral telencephalon

PubMed Central

Sousa, Vitor H.; Fishell, Gord

2010-01-01

Morphogens act during development to provide graded spatial information that controls patterning and cell lineage specification in the nervous system. The role of morphogen signaling in instructing the expression of downstream effector transcription factors has been well established. However, a key requirement for morphogen signaling is the existence of functional intracellular machinery able to mediate the appropriate response in target cells. Here we suggest that dynamic changes in the temporal responses to Shh in the developing ventral telencephalon occur through alterations in progenitor competence. We suggest these developmental changes in competence are mediated by a transcriptional mechanism that intrinsically integrates information from the distinct signaling pathways that act to pattern the telencephalic neuroepithelium. PMID:20466536

Developmental Differences in the Expression of Childhood Anxiety Symptoms and Fears.

ERIC Educational Resources Information Center

Weems, Carl F.; Costa, Natalie M.

2005-01-01

Objective: To examine age differences in the expression of childhood fears and anxiety symptoms. Method: A cross-sectional design was used to test recently formulated developmental hypotheses regarding the differential expression of childhood anxiety symptoms and fears in a community sample of youths (N = 145). Three groups of youths were…

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire.

PubMed

Gates, Michael A; Kannan, Ramakrishnan; Giniger, Edward

2011-11-30

The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis.

Impaired Integration of Emotional Faces and Affective Body Context in a Rare Case of Developmental Visual Agnosia

PubMed Central

Aviezer, Hillel; Hassin, Ran. R.; Bentin, Shlomo

2011-01-01

In the current study we examined the recognition of facial expressions embedded in emotionally expressive bodies in case LG, an individual with a rare form of developmental visual agnosia who suffers from severe prosopagnosia. Neuropsychological testing demonstrated that LG‘s agnosia is characterized by profoundly impaired visual integration. Unlike individuals with typical developmental prosopagnosia who display specific difficulties with face identity (but typically not expression) recognition, LG was also impaired at recognizing isolated facial expressions. By contrast, he successfully recognized the expressions portrayed by faceless emotional bodies handling affective paraphernalia. When presented with contextualized faces in emotional bodies his ability to detect the emotion expressed by a face did not improve even if it was embedded in an emotionally-congruent body context. Furthermore, in contrast to controls, LG displayed an abnormal pattern of contextual influence from emotionally-incongruent bodies. The results are interpreted in the context of a general integration deficit in developmental visual agnosia, suggesting that impaired integration may extend from the level of the face to the level of the full person. PMID:21482423

Imaging C. elegans embryos using an epifluorescent microscope and open source software.

PubMed

Verbrugghe, Koen J C; Chan, Raymond C

2011-03-24

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples(1,2). Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage(3), thus providing an ideal experiment model for studying questions in cell biology(4,5)and development(6-9). C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis(10,11)) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis(12-15)). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters(16,17). These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo(18-21). In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Mdivi-1, mitochondrial fission inhibitor, impairs developmental competence and mitochondrial function of embryos and cells in pigs

PubMed Central

YEON, Ji-Yeong; MIN, Sung-Hun; PARK, Hyo-Jin; KIM, Jin-Woo; LEE, Yong-Hee; PARK, Soo-Yong; JEONG, Pil-Soo; PARK, Humdai; LEE, Dong-Seok; KIM, Sun-Uk; CHANG, Kyu-Tae; KOO, Deog-Bon

2014-01-01

Mitochondria are highly dynamic organelles that undergo constant fusion/fission as well as activities orchestrated by large dynamin-related GTPases. These dynamic mitochondrial processes influence mitochondrial morphology, size and function. Therefore, this study was conducted to evaluate the effects of mitochondrial fission inhibitor, mdivi-1, on developmental competence and mitochondrial function of porcine embryos and primary cells. Presumptive porcine embryos were cultured in PZM-3 medium supplemented with mdivi-1 (0, 10 and 50 μM) for 6 days. Porcine fibroblast cells were cultured in growth medium with mdivi-1 (0 and 50 μM) for 2 days. Our results showed that the rate of blastocyst production and cell growth in the mdivi-1 (50 μM) treated group was lower than that of the control group (P < 0.05). Moreover, loss of mitochondrial membrane potential in the mdivi-1 (50 μM) treated group was increased relative to the control group (P < 0.05). Subsequent evaluation revealed that the intracellular levels of reactive oxygen species (ROS) and the apoptotic index were increased by mdivi-1 (50 μM) treatment (P < 0.05). Finally, the expression of mitochondrial fission-related protein (Drp 1) was lower in the embryos and cells in the mdivi-1-treated group than the control group. Taken together, these results indicate that mdivi-1 treatment may inhibit developmental competence and mitochondrial function in porcine embryos and primary cells. PMID:25501014

Poly(A) tail length regulates PABPC1 expression to tune translation in the heart.

PubMed

Chorghade, Sandip; Seimetz, Joseph; Emmons, Russell; Yang, Jing; Bresson, Stefan M; Lisio, Michael De; Parise, Gianni; Conrad, Nicholas K; Kalsotra, Auinash

2017-06-27

The rate of protein synthesis in the adult heart is one of the lowest in mammalian tissues, but it increases substantially in response to stress and hypertrophic stimuli through largely obscure mechanisms. Here, we demonstrate that regulated expression of cytosolic poly(A)-binding protein 1 (PABPC1) modulates protein synthetic capacity of the mammalian heart. We uncover a poly(A) tail-based regulatory mechanism that dynamically controls PABPC1 protein synthesis in cardiomyocytes and thereby titrates cellular translation in response to developmental and hypertrophic cues. Our findings identify PABPC1 as a direct regulator of cardiac hypertrophy and define a new paradigm of gene regulation in the heart, where controlled changes in poly(A) tail length influence mRNA translation.

Characterization of big bang, a novel gene encoding for PDZ domain-containing proteins that are dynamically expressed throughout Drosophila development.

PubMed

Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L

2006-06-01

PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.

Quantitative analysis of random ameboid motion

NASA Astrophysics Data System (ADS)

Bödeker, H. U.; Beta, C.; Frank, T. D.; Bodenschatz, E.

2010-04-01

We quantify random migration of the social ameba Dictyostelium discoideum. We demonstrate that the statistics of cell motion can be described by an underlying Langevin-type stochastic differential equation. An analytic expression for the velocity distribution function is derived. The separation into deterministic and stochastic parts of the movement shows that the cells undergo a damped motion with multiplicative noise. Both contributions to the dynamics display a distinct response to external physiological stimuli. The deterministic component depends on the developmental state and ambient levels of signaling substances, while the stochastic part does not.

Imaging Subcellular Structures in the Living Zebrafish Embryo.

PubMed

Engerer, Peter; Plucinska, Gabriela; Thong, Rachel; Trovò, Laura; Paquet, Dominik; Godinho, Leanne

2016-04-02

In vivo imaging provides unprecedented access to the dynamic behavior of cellular and subcellular structures in their natural context. Performing such imaging experiments in higher vertebrates such as mammals generally requires surgical access to the system under study. The optical accessibility of embryonic and larval zebrafish allows such invasive procedures to be circumvented and permits imaging in the intact organism. Indeed the zebrafish is now a well-established model to visualize dynamic cellular behaviors using in vivo microscopy in a wide range of developmental contexts from proliferation to migration and differentiation. A more recent development is the increasing use of zebrafish to study subcellular events including mitochondrial trafficking and centrosome dynamics. The relative ease with which these subcellular structures can be genetically labeled by fluorescent proteins and the use of light microscopy techniques to image them is transforming the zebrafish into an in vivo model of cell biology. Here we describe methods to generate genetic constructs that fluorescently label organelles, highlighting mitochondria and centrosomes as specific examples. We use the bipartite Gal4-UAS system in multiple configurations to restrict expression to specific cell-types and provide protocols to generate transiently expressing and stable transgenic fish. Finally, we provide guidelines for choosing light microscopy methods that are most suitable for imaging subcellular dynamics.

Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

PubMed

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

Functional Requirements for Heparan Sulfate Biosynthesis in Morphogenesis and Nervous System Development in C. elegans.

PubMed

Blanchette, Cassandra R; Thackeray, Andrea; Perrat, Paola N; Hekimi, Siegfried; Bénard, Claire Y

2017-01-01

The regulation of cell migration is essential to animal development and physiology. Heparan sulfate proteoglycans shape the interactions of morphogens and guidance cues with their respective receptors to elicit appropriate cellular responses. Heparan sulfate proteoglycans consist of a protein core with attached heparan sulfate glycosaminoglycan chains, which are synthesized by glycosyltransferases of the exostosin (EXT) family. Abnormal HS chain synthesis results in pleiotropic consequences, including abnormal development and tumor formation. In humans, mutations in either of the exostosin genes EXT1 and EXT2 lead to osteosarcomas or multiple exostoses. Complete loss of any of the exostosin glycosyltransferases in mouse, fish, flies and worms leads to drastic morphogenetic defects and embryonic lethality. Here we identify and study previously unavailable viable hypomorphic mutations in the two C. elegans exostosin glycosyltransferases genes, rib-1 and rib-2. These partial loss-of-function mutations lead to a severe reduction of HS levels and result in profound but specific developmental defects, including abnormal cell and axonal migrations. We find that the expression pattern of the HS copolymerase is dynamic during embryonic and larval morphogenesis, and is sustained throughout life in specific cell types, consistent with HSPGs playing both developmental and post-developmental roles. Cell-type specific expression of the HS copolymerase shows that HS elongation is required in both the migrating neuron and neighboring cells to coordinate migration guidance. Our findings provide insights into general principles underlying HSPG function in development.

Multi-functionality and plasticity characterize epithelial cells in Hydra

PubMed Central

Buzgariu, W; Al Haddad, S; Tomczyk, S; Wenger, Y; Galliot, B

2015-01-01

Epithelial sheets, a synapomorphy of all metazoans but porifers, are present as 2 layers in cnidarians, ectoderm and endoderm, joined at their basal side by an extra-cellular matrix named mesoglea. In the Hydra polyp, epithelial cells of the body column are unipotent stem cells that continuously self-renew and concomitantly express their epitheliomuscular features. These multifunctional contractile cells maintain homeostasis by providing a protective physical barrier, by digesting nutrients, by selecting a stable microbiota, and by rapidly closing wounds. In addition, epithelial cells are highly plastic, supporting the adaptation of Hydra to physiological and environmental changes, such as long starvation periods where survival relies on a highly dynamic autophagy flux. Epithelial cells also play key roles in developmental processes as evidenced by the organizer activity they develop to promote budding and regeneration. We propose here an integrative view of the homeostatic and developmental aspects of epithelial plasticity in Hydra. PMID:26716072

Insights into the dynamics of hind leg development in honey bee (Apis mellifera L.) queen and worker larvae - A morphology/differential gene expression analysis

PubMed Central

Santos, Carolina Gonçalves; Hartfelder, Klaus

2015-01-01

Phenotypic plasticity is a hallmark of the caste systems of social insects, expressed in their life history and morphological traits. These are best studied in bees. In their co-evolution with angiosperm plants, the females of corbiculate bees have acquired a specialized structure on their hind legs for collecting pollen. In the highly eusocial bees (Apini and Meliponini), this structure is however only present in workers and absent in queens. By means of histological sections and cell proliferation analysis we followed the developmental dynamics of the hind legs of queens and workers in the fourth and fifth larval instars. In parallel, we generated subtractive cDNA libraries for hind leg discs of queen and worker larvae by means of a Representational Difference Analysis (RDA). From the total of 135 unique sequences we selected 19 for RT-qPCR analysis, where six of these were confirmed as differing significantly in their expression between the two castes in the larval spinning stage. The development of complex structures such as the bees’ hind legs, requires diverse patterning mechanisms and signaling modules, as indicated by the set of differentially expressed genes related with cell adhesion and signaling pathways. PMID:26500430

[Effect of human oviductal embryotrophic factors on gene expression of mouse preimplantation embryos].

PubMed

Yao, Yuan-Qing; Lee, Kai-Fai; Xu, Jia-Seng; Ho, Pak-Chung; Yeung, Shu-Biu

2007-09-01

To investigate the effect of embryotrophic factors (ETF) from human oviductal cells on gene expression of mouse early developmental embryos and discuss the role of fallopian tube in early development of embryos. ETF was isolated from conditioned medium of human oviductal cell line by sequential liquid chromatographic systems. Mouse embryos were treated by ETF in vitro. Using differential display RT-PCR, the gene expression of embryos treated by ETF was compared with embryos without ETF treatment. The differentially expressed genes were separated, re-amplified, cloned and sequenced. Gene expression profiles of embryos with ETF treatment was different from embryos without this treatment. Eight differentially expressed genes were cloned and sequenced. These genes functioned in RNA degradation, synthesis, splicing, protein trafficking, cellular differentiation and embryo development. Embryotrophic factors from human oviductal cells affect gene expression of early developmental embryos. The human oviductal cells play wide roles in early developmental stages of embryos.

H2A.Z Acidic Patch Couples Chromatin Dynamics to Regulation of Gene Expression Programs during ESC Differentiation

PubMed Central

Subramanian, Vidya; Mazumder, Aprotim; Surface, Lauren E.; Butty, Vincent L.; Fields, Paul A.; Alwan, Allison; Torrey, Lillian; Thai, Kevin K.; Levine, Stuart S.; Bathe, Mark; Boyer, Laurie A.

2013-01-01

The histone H2A variant H2A.Z is essential for embryonic development and for proper control of developmental gene expression programs in embryonic stem cells (ESCs). Divergent regions of amino acid sequence of H2A.Z likely determine its functional specialization compared to core histone H2A. For example, H2A.Z contains three divergent residues in the essential C-terminal acidic patch that reside on the surface of the histone octamer as an uninterrupted acidic patch domain; however, we know little about how these residues contribute to chromatin structure and function. Here, we show that the divergent amino acids Gly92, Asp97, and Ser98 in the H2A.Z C-terminal acidic patch (H2A.ZAP3) are critical for lineage commitment during ESC differentiation. H2A.Z is enriched at most H3K4me3 promoters in ESCs including poised, bivalent promoters that harbor both activating and repressive marks, H3K4me3 and H3K27me3 respectively. We found that while H2A.ZAP3 interacted with its deposition complex and displayed a highly similar distribution pattern compared to wild-type H2A.Z, its enrichment levels were reduced at target promoters. Further analysis revealed that H2A.ZAP3 was less tightly associated with chromatin, suggesting that the mutant is more dynamic. Notably, bivalent genes in H2A.ZAP3 ESCs displayed significant changes in expression compared to active genes. Moreover, bivalent genes in H2A.ZAP3 ESCs gained H3.3, a variant associated with higher nucleosome turnover, compared to wild-type H2A.Z. We next performed single cell imaging to measure H2A.Z dynamics. We found that H2A.ZAP3 displayed higher mobility in chromatin compared to wild-type H2A.Z by fluorescent recovery after photobleaching (FRAP). Moreover, ESCs treated with the transcriptional inhibitor flavopiridol resulted in a decrease in the H2A.ZAP3 mobile fraction and an increase in its occupancy at target genes indicating that the mutant can be properly incorporated into chromatin. Collectively, our work suggests that the divergent residues in the H2A.Z acidic patch comprise a unique domain that couples control of chromatin dynamics to the regulation of developmental gene expression patterns during lineage commitment. PMID:23990805

Cellular and Molecular Dynamics of Th17 Differentiation and its Developmental Plasticity in the Intestinal Immune Response

PubMed Central

Bhaumik, Suniti; Basu, Rajatava

2017-01-01

After emerging from the thymus, naive CD4 T cells circulate through secondary lymphoid tissues, including gut-associated lymphoid tissue of the intestine. The activation of naïve CD4 T cells by antigen-presenting cells offering cognate antigen initiate differentiation programs that lead to the development of highly specialized T helper (Th) cell lineages. Although initially believed that developmental programing of effector T cells such as T helper 1 (Th1) or T helper 2 (Th2) resulted in irreversible commitment to a fixed fate, subsequent studies have demonstrated greater flexibility, or plasticity, in effector T cell stability than originally conceived. This is particularly so for the Th17 subset, differentiation of which is a highly dynamic process with overlapping developmental axes with inducible regulatory T (iTreg), T helper 22 (Th22), and Th1 cells. Accordingly, intermediary stages of Th17 cells are found in various tissues, which co-express lineage-specific transcription factor(s) or cytokine(s) of developmentally related CD4 T cell subsets. A highly specialized tissue like that of the intestine, which harbors the largest immune compartment of the body, adds several layers of complexity to the intricate process of Th differentiation. Due to constant exposure to millions of commensal microbes and periodic exposure to pathogens, the intestinal mucosa maintains a delicate balance between regulatory and effector T cells. It is becoming increasingly clear that equilibrium between tolerogenic and inflammatory axes is maintained in the intestine by shuttling the flexible genetic programming of a developing CD4 T cell along the developmental axis of iTreg, Th17, Th22, and Th1 subsets. Currently, Th17 plasticity remains an unresolved concern in the field of clinical research as targeting Th17 cells to cure immune-mediated disease might also target its related subsets. In this review, we discuss the expanding sphere of Th17 plasticity through its shared developmental axes with related cellular subsets such as Th22, Th1, and iTreg in the context of intestinal inflammation and also examine the molecular and epigenetic features of Th17 cells that mediate these overlapping developmental programs. PMID:28408906

Visualization of protein interactions in living Drosophila embryos by the bimolecular fluorescence complementation assay

PubMed Central

2011-01-01

Background Protein interactions control the regulatory networks underlying developmental processes. The understanding of developmental complexity will, therefore, require the characterization of protein interactions within their proper environment. The bimolecular fluorescence complementation (BiFC) technology offers this possibility as it enables the direct visualization of protein interactions in living cells. However, its potential has rarely been applied in embryos of animal model organisms and was only performed under transient protein expression levels. Results Using a Hox protein partnership as a test case, we investigated the suitability of BiFC for the study of protein interactions in the living Drosophila embryo. Importantly, all BiFC parameters were established with constructs that were stably expressed under the control of endogenous promoters. Under these physiological conditions, we showed that BiFC is specific and sensitive enough to analyse dynamic protein interactions. We next used BiFC in a candidate interaction screen, which led to the identification of several Hox protein partners. Conclusion Our results establish the general suitability of BiFC for revealing and studying protein interactions in their physiological context during the rapid course of Drosophila embryonic development. PMID:21276241

The sensitivity of Turing self-organization to biological feedback delays: 2D models of fish pigmentation.

PubMed

Gaffney, E A; Lee, S Seirin

2015-03-01

Turing morphogen models have been extensively explored in the context of large-scale self-organization in multicellular biological systems. However, reconciling the detailed biology of morphogen dynamics, while accounting for time delays associated with gene expression, reveals aberrant behaviours that are not consistent with early developmental self-organization, especially the requirement for exquisite temporal control. Attempts to reconcile the interpretation of Turing's ideas with an increasing understanding of the mechanisms driving zebrafish pigmentation suggests that one should reconsider Turing's model in terms of pigment cells rather than morphogens (Nakamasu et al., 2009, PNAS, 106: , 8429-8434; Yamaguchi et al., 2007, PNAS, 104: , 4790-4793). Here the dynamics of pigment cells is subject to response delays implicit in the cell cycle and apoptosis. Hence we explore simulations of fish skin patterning, focussing on the dynamical influence of gene expression delays in morphogen-based Turing models and response delays for cell-based Turing models. We find that reconciling the mechanisms driving the behaviour of Turing systems with observations of fish skin patterning remains a fundamental challenge. © The Authors 2013. Published by Oxford University Press on behalf of the Institute of Mathematics and its Applications. All rights reserved.

Sterols in spermatogenesis and sperm maturation

PubMed Central

Keber, Rok; Rozman, Damjana; Horvat, Simon

2013-01-01

Mammalian spermatogenesis is a complex developmental program in which a diploid progenitor germ cell transforms into highly specialized spermatozoa. One intriguing aspect of sperm production is the dynamic change in membrane lipid composition that occurs throughout spermatogenesis. Cholesterol content, as well as its intermediates, differs vastly between the male reproductive system and nongonadal tissues. Accumulation of cholesterol precursors such as testis meiosis-activating sterol and desmosterol is observed in testes and spermatozoa from several mammalian species. Moreover, cholesterogenic genes, especially meiosis-activating sterol-producing enzyme cytochrome P450 lanosterol 14α-demethylase, display stage-specific expression patterns during spermatogenesis. Discrepancies in gene expression patterns suggest a complex temporal and cell-type specific regulation of sterol compounds during spermatogenesis, which also involves dynamic interactions between germ and Sertoli cells. The functional importance of sterol compounds in sperm production is further supported by the modulation of sterol composition in spermatozoal membranes during epididymal transit and in the female reproductive tract, which is a prerequisite for successful fertilization. However, the exact role of sterols in male reproduction is unknown. This review discusses sterol dynamics in sperm maturation and describes recent methodological advances that will help to illuminate the complexity of sperm formation and function. PMID:23093550

The quest for four-dimensional imaging in plant cell biology: it's just a matter of time

PubMed Central

Domozych, David S.

2012-01-01

Background Analysis of plant cell dynamics over time, or four-dimensional imaging (4-DI), represents a major goal of plant science. The ability to resolve structures in the third dimension within the cell or tissue during developmental events or in response to environmental or experimental stresses (i.e. 4-DI) is critical to our understanding of gene expression, post-expression modulations of macromolecules and sub-cellular system interactions. Scope Microscopy-based technologies have been profoundly integral to this type of investigation, and new and refined microscopy technologies now allow for the visualization of cell dynamics with unprecedented resolution, contrast and experimental versatility. However, certain realities of light and electron microscopy, choice of specimen and specimen preparation techniques limit the scope of readily attaining 4-DI. Today, the plant microscopist must use a combinatorial strategy whereby multiple microscopy-based investigations are used. Modern fluorescence, confocal laser scanning, transmission electron and scanning electron microscopy provide effective conduits for synthesizing data detailing live cell dynamics and highly resolved snapshots of specific cell structures that will ultimately lead to 4-DI. This review provides a synopsis of such technologies available. PMID:22628381

Automatic facial mimicry in response to dynamic emotional stimuli in five-month-old infants.

PubMed

Isomura, Tomoko; Nakano, Tamami

2016-12-14

Human adults automatically mimic others' emotional expressions, which is believed to contribute to sharing emotions with others. Although this behaviour appears fundamental to social reciprocity, little is known about its developmental process. Therefore, we examined whether infants show automatic facial mimicry in response to others' emotional expressions. Facial electromyographic activity over the corrugator supercilii (brow) and zygomaticus major (cheek) of four- to five-month-old infants was measured while they viewed dynamic clips presenting audiovisual, visual and auditory emotions. The audiovisual bimodal emotion stimuli were a display of a laughing/crying facial expression with an emotionally congruent vocalization, whereas the visual/auditory unimodal emotion stimuli displayed those emotional faces/vocalizations paired with a neutral vocalization/face, respectively. Increased activation of the corrugator supercilii muscle in response to audiovisual cries and the zygomaticus major in response to audiovisual laughter were observed between 500 and 1000 ms after stimulus onset, which clearly suggests rapid facial mimicry. By contrast, both visual and auditory unimodal emotion stimuli did not activate the infants' corresponding muscles. These results revealed that automatic facial mimicry is present as early as five months of age, when multimodal emotional information is present. © 2016 The Author(s).

Dynamic genome wide expression profiling of Drosophila head development reveals a novel role of Hunchback in retinal glia cell development and blood-brain barrier integrity

PubMed Central

Torres-Oliva, Montserrat; Schneider, Julia; Wiegleb, Gordon

2018-01-01

Drosophila melanogaster head development represents a valuable process to study the developmental control of various organs, such as the antennae, the dorsal ocelli and the compound eyes from a common precursor, the eye-antennal imaginal disc. While the gene regulatory network underlying compound eye development has been extensively studied, the key transcription factors regulating the formation of other head structures from the same imaginal disc are largely unknown. We obtained the developmental transcriptome of the eye-antennal discs covering late patterning processes at the late 2nd larval instar stage to the onset and progression of differentiation at the end of larval development. We revealed the expression profiles of all genes expressed during eye-antennal disc development and we determined temporally co-expressed genes by hierarchical clustering. Since co-expressed genes may be regulated by common transcriptional regulators, we combined our transcriptome dataset with publicly available ChIP-seq data to identify central transcription factors that co-regulate genes during head development. Besides the identification of already known and well-described transcription factors, we show that the transcription factor Hunchback (Hb) regulates a significant number of genes that are expressed during late differentiation stages. We confirm that hb is expressed in two polyploid subperineurial glia cells (carpet cells) and a thorough functional analysis shows that loss of Hb function results in a loss of carpet cells in the eye-antennal disc. Additionally, we provide for the first time functional data indicating that carpet cells are an integral part of the blood-brain barrier. Eventually, we combined our expression data with a de novo Hb motif search to reveal stage specific putative target genes of which we find a significant number indeed expressed in carpet cells. PMID:29360820

Deficits in motor abilities and developmental fractionation of imitation performance in high-functioning autism spectrum disorders.

PubMed

Biscaldi, Monica; Rauh, Reinhold; Irion, Lisa; Jung, Nikolai H; Mall, Volker; Fleischhaker, Christian; Klein, Christoph

2014-07-01

The co-occurrence of motor and imitation disabilities often characterises the spectrum of deficits seen in patients with autism spectrum disorders (ASD). Whether these seemingly separate deficits are inter-related and whether, in particular, motor deficits contribute to the expression of imitation deficits is the topic of the present study and was investigated by comparing these deficits' cross-sectional developmental trajectories. To that end, different components of motor performance assessed in the Zurich Neuromotor Assessment and imitation abilities for facial movements and non-meaningful gestures were tested in 70 subjects (aged 6-29 years), including 36 patients with high-functioning ASD and 34 age-matched typically developed (TD) participants. The results show robust deficits in probands with ASD in timed motor performance and in the quality of movement, which are all independent of age, with one exception. Only diadochokinesis improves moderately with increasing age in ASD probands. Imitation of facial movements and of non-meaningful hand, finger, hand finger gestures not related to social context or tool use is also impaired in ASD subjects, but in contrast to motor performance this deficit overall improves with age. A general imitation factor, extracted from the highly inter-correlated imitation tests, is differentially correlated with components of neuromotor performance in ASD and TD participants. By developmentally fractionating developmentally stable motor deficits from developmentally dynamic imitation deficits, we infer that imitation deficits are primarily cognitive in nature.

Building quantitative, three-dimensional atlases of gene expression and morphology at cellular resolution.

PubMed

Knowles, David W; Biggin, Mark D

2013-01-01

Animals comprise dynamic three-dimensional arrays of cells that express gene products in intricate spatial and temporal patterns that determine cellular differentiation and morphogenesis. A rigorous understanding of these developmental processes requires automated methods that quantitatively record and analyze complex morphologies and their associated patterns of gene expression at cellular resolution. Here we summarize light microscopy-based approaches to establish permanent, quantitative datasets-atlases-that record this information. We focus on experiments that capture data for whole embryos or large areas of tissue in three dimensions, often at multiple time points. We compare and contrast the advantages and limitations of different methods and highlight some of the discoveries made. We emphasize the need for interdisciplinary collaborations and integrated experimental pipelines that link sample preparation, image acquisition, image analysis, database design, visualization, and quantitative analysis. Copyright © 2013 Wiley Periodicals, Inc.

Comparative analysis of Six 3 and Six 6 distribution in the developing and adult mouse brain.

PubMed

Conte, Ivan; Morcillo, Julian; Bovolenta, Paola

2005-11-01

Six 3 and Six 6 genes are two closely related members of the Six/sine oculis family of homeobox containing transcription factors. Their expression and function at early stages of embryonic development has been widely addressed in a variety of species. However, their mRNA distribution during late embryonic, postnatal, and adult brain barely has been analyzed. Here, we show that despite their initial overlap in the anterior neural plate, the expression of Six 3 and Six 6 progressively segregates to different regions during mammalian brain development, maintaining only few areas of partial overlap in the thalamic and hypothalamic regions. Six 3, but not Six 6, is additionally expressed in the olfactory bulb, cerebral cortex, hippocampus, midbrain, and cerebellum. These distinct patterns support the idea that Six 3 and Six 6 are differentially required during forebrain development. Developmental Dynamics 234:718-725, 2005. (c) 2005 Wiley-Liss, Inc.

Identification of embryonic pancreatic genes using Xenopus DNA microarrays.

PubMed

Hayata, Tadayoshi; Blitz, Ira L; Iwata, Nahoko; Cho, Ken W Y

2009-06-01

The pancreas is both an exocrine and endocrine endodermal organ involved in digestion and glucose homeostasis. During embryogenesis, the anlagen of the pancreas arise from dorsal and ventral evaginations of the foregut that later fuse to form a single organ. To better understand the molecular genetics of early pancreas development, we sought to isolate markers that are uniquely expressed in this tissue. Microarray analysis was performed comparing dissected pancreatic buds, liver buds, and the stomach region of tadpole stage Xenopus embryos. A total of 912 genes were found to be differentially expressed between these organs during early stages of organogenesis. K-means clustering analysis predicted 120 of these genes to be specifically enriched in the pancreas. Of these, we report on the novel expression patterns of 24 genes. Our analyses implicate the involvement of previously unsuspected signaling pathways during early pancreas development. Developmental Dynamics 238:1455-1466, 2009. (c) 2009 Wiley-Liss, Inc.

Identifying candidate genes affecting developmental time in Drosophila melanogaster: pervasive pleiotropy and gene-by-environment interaction

PubMed Central

Mensch, Julián; Lavagnino, Nicolás; Carreira, Valeria Paula; Massaldi, Ana; Hasson, Esteban; Fanara, Juan José

2008-01-01

Background Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait. Results We analyzed 179 co-isogenic single P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25°C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17°C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes. Conclusion We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during development. Taken together, our results stress the need to take into account the effect of environmental variation and the dynamics of gene interactions on the genetic architecture of this complex life-history trait. PMID:18687152

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

PubMed Central

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

Effect of timing of development on total cell number and expression profile of HSP-70.1 and GLUT-1 in buffalo (Bubalus bubalis) oocytes and preimplantation embryos produced in vitro.

PubMed

Rajhans, Rajib; Kumar, G Sai; Dubey, Pawan K; Sharma, G Taru

2010-03-29

The present study was designed to compare the expression profile of two developmentally important genes (HSP-70.1 and GLUT-1) and TCN (total cell number) count in fast (group A) and slow (group B) cleaved buffalo embryos to access their in vitro developmental competence. Buffalo COCs (cumulus oocyte complexes) were collected from local abattoir ovaries and subjected to in vitro maturation in: TCM-199 supplemented with 10% FBS (fetal bovine serum), BSA (3 mg/ml), sodium pyruvate (0.25 mM) and 20 ng/ml EGF (epidermal growth factor) at 38.5 degrees C under 5% CO2. In vitro derived embryos were collected at 4-8, 8-16 cell, morula and blastocyst stages at specific time points for gene expression analysis and total cell count. A semiquantitative RT-PCR (reverse transcriptase-PCR) assay was used to determine the HSP-70.1 and GLUT-1 transcripts. Results showed that developmental competence and TCN count in fast (group A)-cleaving embryos was significantly (P<0.05) higher than in the slow group (group B). The gene transcript of HSP-70.1 and GLUT-1 was expressed in oocytes (immature and mature) and throughout the embryonic developmental stages in the fast group (group A), while in the slow (group B) cleaving embryos, the expression of HSP-70.1 was absent in all the embryonic developmental stages, and expression of GLUT-1 was absent after 8-16 cell stage. In conclusion, TCN count and expression profile of HSP-70.1 and GLUT-1 genes in buffalo embryos are different taking into account the cleavage rate. Quality of such embryos for research purposes, TCN and expression profiling of developmentally important genes should be employed to optimize the in vitro culture system to produce superior quality of embryos.

Exploring Regularities and Dynamic Systems in L2 Development

ERIC Educational Resources Information Center

Lenzing, Anke

2015-01-01

This article focuses on a theoretical and empirical exploration of developmental trajectories and individual learner variation in second language (L2) acquisition. Taking a processability perspective, I view learner language as a dynamic system that includes predictable universal developmental trajectories as well as individual learner variation,…

Bridging Developmental Systems Theory and Evolutionary Psychology Using Dynamic Optimization

ERIC Educational Resources Information Center

Frankenhuis, Willem E.; Panchanathan, Karthik; Clark Barrett, H.

2013-01-01

Interactions between evolutionary psychologists and developmental systems theorists have been largely antagonistic. This is unfortunate because potential synergies between the two approaches remain unexplored. This article presents a method that may help to bridge the divide, and that has proven fruitful in biology: dynamic optimization. Dynamic…

A versatile genetic tool for post-translational control of gene expression in Drosophila melanogaster

PubMed Central

Sethi, Sachin

2017-01-01

Several techniques have been developed to manipulate gene expression temporally in intact neural circuits. However, the applicability of current tools developed for in vivo studies in Drosophila is limited by their incompatibility with existing GAL4 lines and side effects on physiology and behavior. To circumvent these limitations, we adopted a strategy to reversibly regulate protein degradation with a small molecule by using a destabilizing domain (DD). We show that this system is effective across different tissues and developmental stages. We further show that this system can be used to control in vivo gene expression levels with low background, large dynamic range, and in a reversible manner without detectable side effects on the lifespan or behavior of the animal. Additionally, we engineered tools for chemically controlling gene expression (GAL80-DD) and recombination (FLP-DD). We demonstrate the applicability of this technology in manipulating neuronal activity and for high-efficiency sparse labeling of neuronal populations. PMID:29140243

Micro-RNAs in cognition and cognitive disorders: Potential for novel biomarkers and therapeutics.

PubMed

Woldemichael, Bisrat T; Mansuy, Isabelle M

2016-03-15

Micro-RNAs (miRNAs) are small regulatory non-coding RNAs involved in the regulation of many biological functions. In the brain, they have distinct expression patterns depending on region, cell-type and developmental stage. Their expression profile is altered by neuronal activation in response to behavioral training or chemical/electrical stimulation. The dynamic changes in miRNA level regulate the expression of genes required for cognitive processes such as learning and memory. In addition, in cognitive dysfunctions such as dementias, expression levels of many miRNAs are perturbed, not only in brain areas affected by the pathology, but also in peripheral body fluids such as serum and cerebrospinal fluid. This presents an opportunity to utilize miRNAs as biomarkers for early detection and assessment of cognitive dysfunctions. Further, since miRNAs target many genes and pathways, they may represent key molecular signatures that can help understand the mechanisms of cognitive disorders and the development of potential therapeutic agents. Copyright © 2015 Elsevier Inc. All rights reserved.

Control of developmentally primed erythroid genes by combinatorial co-repressor actions

PubMed Central

Stadhouders, Ralph; Cico, Alba; Stephen, Tharshana; Thongjuea, Supat; Kolovos, Petros; Baymaz, H. Irem; Yu, Xiao; Demmers, Jeroen; Bezstarosti, Karel; Maas, Alex; Barroca, Vilma; Kockx, Christel; Ozgur, Zeliha; van Ijcken, Wilfred; Arcangeli, Marie-Laure; Andrieu-Soler, Charlotte; Lenhard, Boris; Grosveld, Frank; Soler, Eric

2015-01-01

How transcription factors (TFs) cooperate within large protein complexes to allow rapid modulation of gene expression during development is still largely unknown. Here we show that the key haematopoietic LIM-domain-binding protein-1 (LDB1) TF complex contains several activator and repressor components that together maintain an erythroid-specific gene expression programme primed for rapid activation until differentiation is induced. A combination of proteomics, functional genomics and in vivo studies presented here identifies known and novel co-repressors, most notably the ETO2 and IRF2BP2 proteins, involved in maintaining this primed state. The ETO2–IRF2BP2 axis, interacting with the NCOR1/SMRT co-repressor complex, suppresses the expression of the vast majority of archetypical erythroid genes and pathways until its decommissioning at the onset of terminal erythroid differentiation. Our experiments demonstrate that multimeric regulatory complexes feature a dynamic interplay between activating and repressing components that determines lineage-specific gene expression and cellular differentiation. PMID:26593974

Inferring dynamic gene regulatory networks in cardiac differentiation through the integration of multi-dimensional data.

PubMed

Gong, Wuming; Koyano-Nakagawa, Naoko; Li, Tongbin; Garry, Daniel J

2015-03-07

Decoding the temporal control of gene expression patterns is key to the understanding of the complex mechanisms that govern developmental decisions during heart development. High-throughput methods have been employed to systematically study the dynamic and coordinated nature of cardiac differentiation at the global level with multiple dimensions. Therefore, there is a pressing need to develop a systems approach to integrate these data from individual studies and infer the dynamic regulatory networks in an unbiased fashion. We developed a two-step strategy to integrate data from (1) temporal RNA-seq, (2) temporal histone modification ChIP-seq, (3) transcription factor (TF) ChIP-seq and (4) gene perturbation experiments to reconstruct the dynamic network during heart development. First, we trained a logistic regression model to predict the probability (LR score) of any base being bound by 543 TFs with known positional weight matrices. Second, four dimensions of data were combined using a time-varying dynamic Bayesian network model to infer the dynamic networks at four developmental stages in the mouse [mouse embryonic stem cells (ESCs), mesoderm (MES), cardiac progenitors (CP) and cardiomyocytes (CM)]. Our method not only infers the time-varying networks between different stages of heart development, but it also identifies the TF binding sites associated with promoter or enhancers of downstream genes. The LR scores of experimentally verified ESCs and heart enhancers were significantly higher than random regions (p <10(-100)), suggesting that a high LR score is a reliable indicator for functional TF binding sites. Our network inference model identified a region with an elevated LR score approximately -9400 bp upstream of the transcriptional start site of Nkx2-5, which overlapped with a previously reported enhancer region (-9435 to -8922 bp). TFs such as Tead1, Gata4, Msx2, and Tgif1 were predicted to bind to this region and participate in the regulation of Nkx2-5 gene expression. Our model also predicted the key regulatory networks for the ESC-MES, MES-CP and CP-CM transitions. We report a novel method to systematically integrate multi-dimensional -omics data and reconstruct the gene regulatory networks. This method will allow one to rapidly determine the cis-modules that regulate key genes during cardiac differentiation.

Differential expression pattern of UBX family genes in Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru

2007-06-29

UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics inmore » their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated.« less

Biomarkers of adult and developmental neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slikker, William; Bowyer, John F.

2005-08-07

Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessarymore » for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations.« less

EphrinA5 protein distribution in the developing mouse brain

PubMed Central

2010-01-01

Background EphrinA5 is one of the best-studied members of the Eph-ephrin family of guidance molecules, known to be involved in brain developmental processes. Using in situ hybridization, ephrinA5 mRNA expression has been detected in the retinotectal, the thalamocortical, and the olfactory systems; however, no study focused on the distribution of the protein. Considering that this membrane-anchored molecule may act far from the neuron soma expressing the transcript, it is of a crucial interest to localize ephrinA5 protein to better understand its function. Results Using immunohistochemistry, we found that ephrinA5 protein is highly expressed in the developing mouse brain from E12.5 to E16.5. The olfactory bulb, the cortex, the striatum, the thalamus, and the colliculi showed high intensity of labelling, suggesting its implication in topographic mapping of olfactory, retinocollicular, thalamocortical, corticothalamic and mesostriatal systems. In the olfactory nerve, we found an early ephrinA5 protein expression at E12.5 suggesting its implication in the guidance of primary olfactory neurons into the olfactory bulb. In the thalamus, we detected a dynamic graduated protein expression, suggesting its role in the corticothalamic patterning, whereas ephrinA5 protein expression in the target region of mesencephalic dopaminergic neurones indicated its involvement in the mesostriatal topographic mapping. Following E16.5, the signal faded gradually and was barely detectable at P0, suggesting a main role for ephrinA5 in primary molecular events in topographic map formation. Conclusion Our work shows that ephrinA5 protein is expressed in restrictive regions of the developing mouse brain. This expression pattern points out the potential sites of action of this molecule in the olfactory, retinotectal, thalamocortical, corticothalamic and mesostriatal systems, during development. This study is essential to better understand the role of ephrinA5 during developmental topographic mapping of connections and to further characterise the mechanisms involved in pathway restoration following cell transplantation in the damaged brain. PMID:20738842

Simultaneous imaging of blood flow dynamics and vascular remodelling during development.

PubMed

Ghaffari, Siavash; Leask, Richard L; Jones, Elizabeth A V

2015-12-01

Normal vascular development requires blood flow. Time-lapse imaging techniques have revolutionised our understanding of developmental biology, but measuring changes in blood flow dynamics has met with limited success. Ultrasound biomicroscopy and optical coherence tomography can concurrently image vascular structure and blood flow velocity, but these techniques lack the resolution to accurately calculate fluid forces such as shear stress. This is important because hemodynamic forces are biologically active and induce changes in the expression of genes important for vascular development. Regional variations in shear stress, rather than the overall level, control processes such as vessel enlargement and regression during vascular remodelling. We present a technique to concurrently visualise vascular remodelling and blood flow dynamics. We use an avian embryonic model and inject an endothelial-specific dye and fluorescent microspheres. The motion of the microspheres is captured with a high-speed camera and the velocity of the blood flow in and out of the region of interest is quantified by micro-particle image velocitymetry (µPIV). The vessel geometry and flow are used to numerically solve the flow physics with computational fluid dynamics (CFD). Using this technique, we can analyse changes in shear stress, pressure drops and blood flow velocities over a period of 10 to 16 h. We apply this to study the relationship between shear stress and chronic changes in vessel diameter during embryonic development, both in normal development and after TGFβ stimulation. This technique allows us to study the interaction of biomolecular and biomechanical signals during vascular remodelling using an in vivo developmental model. © 2015. Published by The Company of Biologists Ltd.

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

PubMed Central

Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

2011-01-01

Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

PubMed

Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

2005-02-01

cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

MicroRNA networks in mouse lung organogenesis.

PubMed

Dong, Jie; Jiang, Guoqian; Asmann, Yan W; Tomaszek, Sandra; Jen, Jin; Kislinger, Thomas; Wigle, Dennis A

2010-05-26

MicroRNAs (miRNAs) are known to be important regulators of both organ development and tumorigenesis. MiRNA networks and their regulation of messenger RNA (mRNA) translation and protein expression in specific biological processes are poorly understood. We explored the dynamic regulation of miRNAs in mouse lung organogenesis. Comprehensive miRNA and mRNA profiling was performed encompassing all recognized stages of lung development beginning at embryonic day 12 and continuing to adulthood. We analyzed the expression patterns of dynamically regulated miRNAs and mRNAs using a number of statistical and computational approaches, and in an integrated manner with protein levels from an existing mass-spectrometry derived protein database for lung development. In total, 117 statistically significant miRNAs were dynamically regulated during mouse lung organogenesis and clustered into distinct temporal expression patterns. 11,220 mRNA probes were also shown to be dynamically regulated and clustered into distinct temporal expression patterns, with 3 major patterns accounting for 75% of all probes. 3,067 direct miRNA-mRNA correlation pairs were identified involving 37 miRNAs. Two defined correlation patterns were observed upon integration with protein data: 1) increased levels of specific miRNAs directly correlating with downregulation of predicted mRNA targets; and 2) increased levels of specific miRNAs directly correlating with downregulation of translated target proteins without detectable changes in mRNA levels. Of 1345 proteins analyzed, 55% appeared to be regulated in this manner with a direct correlation between miRNA and protein level, but without detectable change in mRNA levels. Systematic analysis of microRNA, mRNA, and protein levels over the time course of lung organogenesis demonstrates dynamic regulation and reveals 2 distinct patterns of miRNA-mRNA interaction. The translation of target proteins affected by miRNAs independent of changes in mRNA level appears to be a prominent mechanism of developmental regulation in lung organogenesis.

Global survey of mRNA levels and decay rates of Chlamydia trachomatis trachoma and lymphogranuloma venereum biovars.

PubMed

Ferreira, Rita; Borges, Vítor; Borrego, Maria José; Gomes, João Paulo

2017-07-01

Interpreting the intricate bacterial transcriptomics implies understanding the dynamic relationship established between de novo transcription and the degradation of transcripts. Here, we performed a comparative overview of gene expression levels and mRNA decay rates for different-biovar (trachoma and lymphogranuloma venereum) strains of the obligate intracellular bacterium Chlamydia trachomatis . By using RNA-sequencing to measure gene expression levels at mid developmental stage and mRNA decay rates upon rifampicin-based transcription blockage, we observed that: i ) 60-70% of the top-50 expressed genes encode proteins with unknown function and proteins involved in "Translation, ribosomal structure and biogenesis" for all strains; ii ) the expression ranking by genes' functional categories was in general concordant among different-biovar strains; iii ) the median of the half-life time (t 1/2 ) values of transcripts were 15-17 min, indicating that the degree of transcripts' stability seems to correlate with the bacterial intracellular life-style, as these values are considerably higher than the ones observed in other studies for facultative intracellular and free-living bacteria; iv ) transcript decay rates were highly heterogeneous within each C. trachomatis strain and did not correlate with steady-state expression levels; v ) only at very few instances (essentially at gene functional category level) was possible to unveil dissimilarities potentially underlying phenotypic differences between biovars. In summary, the unveiled transcriptomic scenario, marked by a general lack of correlation between transcript production and degradation and a huge inter-transcript heterogeneity in decay rates, likely reflects the challenges underlying the unique biphasic developmental cycle of C. trachomatis and its intricate interactions with the human host, which probably exacerbate the complexity of the bacterial transcription regulation.

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire

PubMed Central

2011-01-01

Background The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. Results We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. Conclusions These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis. PMID:22129300

Transcriptome profiling of the dynamic life cycle of the scypohozoan jellyfish Aurelia aurita.

PubMed

Brekhman, Vera; Malik, Assaf; Haas, Brian; Sher, Noa; Lotan, Tamar

2015-02-14

The moon jellyfish Aurelia aurita is a widespread scyphozoan species that forms large seasonal blooms. Here we provide the first comprehensive view of the entire complex life of the Aurelia Red Sea strain by employing transcriptomic profiling of each stage from planula to mature medusa. A de novo transcriptome was assembled from Illumina RNA-Seq data generated from six stages throughout the Aurelia life cycle. Transcript expression profiling yielded clusters of annotated transcripts with functions related to each specific life-cycle stage. Free-swimming planulae were found highly enriched for functions related to cilia and microtubules, and the drastic morphogenetic process undergone by the planula while establishing the future body of the polyp may be mediated by specifically expressed Wnt ligands. Specific transcripts related to sensory functions were found in the strobila and the ephyra, whereas extracellular matrix functions were enriched in the medusa due to high expression of transcripts such as collagen, fibrillin and laminin, presumably involved in mesoglea development. The CL390-like gene, suggested to act as a strobilation hormone, was also highly expressed in the advanced strobila of the Red Sea species, and in the medusa stage we identified betaine-homocysteine methyltransferase, an enzyme that may play an important part in maintaining equilibrium of the medusa's bell. Finally, we identified the transcription factors participating in the Aurelia life-cycle and found that 70% of these 487 identified transcription factors were expressed in a developmental-stage-specific manner. This study provides the first scyphozoan transcriptome covering the entire developmental trajectory of the life cycle of Aurelia. It highlights the importance of numerous stage-specific transcription factors in driving morphological and functional changes throughout this complex metamorphosis, and is expected to be a valuable resource to the community.

Mechanisms of gap gene expression canalization in the Drosophila blastoderm.

PubMed

Gursky, Vitaly V; Panok, Lena; Myasnikova, Ekaterina M; Manu; Samsonova, Maria G; Reinitz, John; Samsonov, Alexander M

2011-01-01

Extensive variation in early gap gene expression in the Drosophila blastoderm is reduced over time because of gap gene cross regulation. This phenomenon is a manifestation of canalization, the ability of an organism to produce a consistent phenotype despite variations in genotype or environment. The canalization of gap gene expression can be understood as arising from the actions of attractors in the gap gene dynamical system. In order to better understand the processes of developmental robustness and canalization in the early Drosophila embryo, we investigated the dynamical effects of varying spatial profiles of Bicoid protein concentration on the formation of the expression border of the gap gene hunchback. At several positions on the anterior-posterior axis of the embryo, we analyzed attractors and their basins of attraction in a dynamical model describing expression of four gap genes with the Bicoid concentration profile accounted as a given input in the model equations. This model was tested against a family of Bicoid gradients obtained from individual embryos. These gradients were normalized by two independent methods, which are based on distinct biological hypotheses and provide different magnitudes for Bicoid spatial variability. We showed how the border formation is dictated by the biological initial conditions (the concentration gradient of maternal Hunchback protein) being attracted to specific attracting sets in a local vicinity of the border. Different types of these attracting sets (point attractors or one dimensional attracting manifolds) define several possible mechanisms of border formation. The hunchback border formation is associated with intersection of the spatial gradient of the maternal Hunchback protein and a boundary between the attraction basins of two different point attractors. We demonstrated how the positional variability for hunchback is related to the corresponding variability of the basin boundaries. The observed reduction in variability of the hunchback gene expression can be accounted for by specific geometrical properties of the basin boundaries. We clarified the mechanisms of gap gene expression canalization in early Drosophila embryos. These mechanisms were specified in the case of hunchback in well defined terms of the dynamical system theory.

Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish

PubMed Central

Sasaki, Tomoyuki; Kishi, Shuji

2013-01-01

The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. PMID:23660559

Examining the Developmental Dynamics between Achievement Strategies and Different Literacy Skills

ERIC Educational Resources Information Center

Georgiou, George K.; Manolitsis, George; Zhang, Xiao; Parrila, Rauno; Nurmi, Jari-Erik

2013-01-01

We examined the developmental dynamics between task-avoidant behavior and different literacy outcomes, and possible precursors of task-avoidant behavior. Seventy Greek children were followed from Grade 4 until Grade 6 and were assessed every year on reading fluency, spelling, and reading comprehension. The teachers assessed the children's…

Genotype × environment interaction is weaker in genitalia than in mating signals and body traits in Enchenopa treehoppers (Hemiptera: Membracidae).

PubMed

Rodríguez, Rafael L; Al-Wathiqui, Nooria

2011-07-01

Theory predicts that selection acting across environments should erode genetic variation in reaction norms; i.e., selection should weaken genotype × environment interaction (G × E). In spite of this expectation, G × E is often detected in fitness-related traits. It thus appears that G × E is at least sometimes sustained under selection, a possibility that highlights the need for theory that can account for variation in the presence and strength of G × E. We tested the hypothesis that trait differences in developmental architecture contribute to variation in the expression of G × E. Specifically, we assessed the influence of canalization (robustness to genetic or environmental perturbations) and condition-dependence (association between trait expression and prior resource acquisition or vital cellular processes). We compared G × E across three trait types expected to differ in canalization and condition-dependence: mating signals, body size-related traits, and genitalia. Because genitalia are expected to show the least condition-dependence and the most canalization, they should express weaker G × E than the other trait types. Our study species was a member of the Enchenopa binotata species complex of treehoppers. We found significant G × E in most traits; G × E was strongest in signals and body traits, and weakest in genitalia. These results support the hypothesis that trait differences in developmental architecture (canalization and condition-dependence) contribute to variation in the expression of G × E. We discuss implications for the dynamics of sexual selection on different trait types.

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

NASA Astrophysics Data System (ADS)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Sexually Dimorphic Expression of Secreted Frizzled-Related (SFRP) Genes in the Developing Mouse Müllerian Duct

PubMed Central

COX, SAM; SMITH, LEE; BOGANI, DEBORA; CHEESEMAN, MICHAEL; SIGGERS, PAM; GREENFIELD, ANDY

2007-01-01

In developing male embryos, the female reproductive tract primordia (Müllerian ducts) regress due to the production of testicular anti-Müllerian hormone (AMH). Because of the association between secreted frizzled-related proteins (SFRPs) and apoptosis, their reported developmental expression patterns and the role of WNT signaling in female reproductive tract development, we examined expression of Sfrp2 and Sfrp5 during development of the Müllerian duct in male (XY) and female (XX) mouse embryos. We show that expression of both Sfrp2 and Sfrp5 is dynamic and sexually dimorphic. In addition, the male-specific expression observed for both genes prior to the onset of regression is absent in mutant male embryos that fail to undergo Müllerian duct regression. We identified ENU-induced point mutations in Sfrp5 and Sfrp2 that are predicted to severely disrupt the function of these genes. Male embryos and adults homozygous for these mutations, both individually and in combination, are viable and apparently fertile with no overt abnormalities of reproductive tract development. PMID:16700072

A Developmental Systems Perspective on Epistasis: Computational Exploration of Mutational Interactions in Model Developmental Regulatory Networks

PubMed Central

Gutiérrez, Jayson

2009-01-01

The way in which the information contained in genotypes is translated into complex phenotypic traits (i.e. embryonic expression patterns) depends on its decoding by a multilayered hierarchy of biomolecular systems (regulatory networks). Each layer of this hierarchy displays its own regulatory schemes (i.e. operational rules such as +/− feedback) and associated control parameters, resulting in characteristic variational constraints. This process can be conceptualized as a mapping issue, and in the context of highly-dimensional genotype-phenotype mappings (GPMs) epistatic events have been shown to be ubiquitous, manifested in non-linear correspondences between changes in the genotype and their phenotypic effects. In this study I concentrate on epistatic phenomena pervading levels of biological organization above the genetic material, more specifically the realm of molecular networks. At this level, systems approaches to studying GPMs are specially suitable to shed light on the mechanistic basis of epistatic phenomena. To this aim, I constructed and analyzed ensembles of highly-modular (fully interconnected) networks with distinctive topologies, each displaying dynamic behaviors that were categorized as either arbitrary or functional according to early patterning processes in the Drosophila embryo. Spatio-temporal expression trajectories in virtual syncytial embryos were simulated via reaction-diffusion models. My in silico mutational experiments show that: 1) the average fitness decay tendency to successively accumulated mutations in ensembles of functional networks indicates the prevalence of positive epistasis, whereas in ensembles of arbitrary networks negative epistasis is the dominant tendency; and 2) the evaluation of epistatic coefficients of diverse interaction orders indicates that, both positive and negative epistasis are more prevalent in functional networks than in arbitrary ones. Overall, I conclude that the phenotypic and fitness effects of multiple perturbations are strongly conditioned by both the regulatory architecture (i.e. pattern of coupled feedback structures) and the dynamic nature of the spatio-temporal expression trajectories displayed by the simulated networks. PMID:19738908

Developmental onset of reproductive barriers and associated proteome changes in stigma/styles of Solanum pennellii

PubMed Central

Chalivendra, Subbaiah C.; Lopez-Casado, Gloria; Bedinger, Patricia A.

2013-01-01

Although self-incompatibility (SI) in plants has been studied extensively, far less is known about interspecific reproductive barriers. One interspecific barrier, known as unilateral incongruity or incompatibility (UI), occurs when species display unidirectional compatibility in interspecific crosses. In the wild tomato species Solanum pennellii, both SI and self-compatible (SC) populations express UI when crossed with domesticated tomato, offering a useful model system to dissect the molecular mechanisms involved in reproductive barriers. In this study, the timing of reproductive barrier establishment during pistil development was determined in SI and SC accessions of S. pennellii using a semi-in vivo system to track pollen-tube growth in developing styles. Both SI and UI barriers were absent in styles 5 days prior to flower opening, but were established by 2 days before flower opening, with partial barriers detected during a transition period 3–4 days before flower opening. The developmental expression dynamics of known SI factors, S-RNases and HT proteins, was also examined. The accumulation of HT-A protein coincided temporally and spatially with UI barriers in developing pistils. Proteomic analysis of stigma/styles from key developmental stages showed a switch in protein profiles from cell-division-associated proteins in immature stigma/styles to a set of proteins in mature stigma/styles that included S-RNases, HT-A protein and proteins associated with cell-wall loosening and defense responses, which could be involved in pollen–pistil interactions. Other prominent proteins in mature stigma/styles were those involved in lipid metabolism, consistent with the accumulation of lipid-rich material during pistil maturation. PMID:23166371

Developmental theory of aging revisited: focus on causal and mechanistic links between development and senescence.

PubMed

Walker, Richard F

2011-08-01

Senescence violates the most basic tenet of natural selection by causing death rather than individual survival. Thus, current theories favor the concept of antagonistic pleiotropy (AP) to explain how aging emerged in metazoans. Presumably, pleiotropic genes reduce vigor and limit longevity in adults. However, they also promote fitness and reproduction in juveniles, causing them to be selected and retained in the gene pool. The general hypothesis presented herein is a special case of AP that identifies the common cause and mechanism of aging in iteroparous (i.e., capable of reproducing multiple times) animals. It ascribes senescence to unremitting, nonprogrammed change or remodeling forced upon the adult soma by postmaturation expression of developmental gene(s) affecting dynamic transformation of the single-celled conceptus into a complex, multicellular organism. Whereas persistent somatic change is necessary for development to proceed normally, it also has the potential to erode homeostasis in adults after maturation is complete. Thus, developmental inertia is the primary cause of senescence, whereas decay of internal order and integrated function among interdependent systems of the body is the general mechanism by which aging progresses over time. Accordingly, this global pathogenic process creates an environment in which the many recognized, age-associated physiologic and metabolic sequelae can arise as consequences of senescence rather than causes of it. Paradoxically, the genes that promote somatic remodeling essential for development and survival also guarantee aging and death by the same action whose outcomes differ only by the time it is expressed relevant to maturation.

A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

DOE PAGES

Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; ...

2015-11-03

Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less

A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.

Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less

Primer and interviews: Molecular mechanisms of morphological evolution

PubMed Central

Kiefer, Julie C

2010-01-01

The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

Development of emotional facial recognition in late childhood and adolescence.

PubMed

Thomas, Laura A; De Bellis, Michael D; Graham, Reiko; LaBar, Kevin S

2007-09-01

The ability to interpret emotions in facial expressions is crucial for social functioning across the lifespan. Facial expression recognition develops rapidly during infancy and improves with age during the preschool years. However, the developmental trajectory from late childhood to adulthood is less clear. We tested older children, adolescents and adults on a two-alternative forced-choice discrimination task using morphed faces that varied in emotional content. Actors appeared to pose expressions that changed incrementally along three progressions: neutral-to-fear, neutral-to-anger, and fear-to-anger. Across all three morph types, adults displayed more sensitivity to subtle changes in emotional expression than children and adolescents. Fear morphs and fear-to-anger blends showed a linear developmental trajectory, whereas anger morphs showed a quadratic trend, increasing sharply from adolescents to adults. The results provide evidence for late developmental changes in emotional expression recognition with some specificity in the time course for distinct emotions.

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

PubMed Central

Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

2016-01-01

Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

Gap Gene Regulatory Dynamics Evolve along a Genotype Network

PubMed Central

Crombach, Anton; Wotton, Karl R.; Jiménez-Guri, Eva; Jaeger, Johannes

2016-01-01

Developmental gene networks implement the dynamic regulatory mechanisms that pattern and shape the organism. Over evolutionary time, the wiring of these networks changes, yet the patterning outcome is often preserved, a phenomenon known as “system drift.” System drift is illustrated by the gap gene network—involved in segmental patterning—in dipteran insects. In the classic model organism Drosophila melanogaster and the nonmodel scuttle fly Megaselia abdita, early activation and placement of gap gene expression domains show significant quantitative differences, yet the final patterning output of the system is essentially identical in both species. In this detailed modeling analysis of system drift, we use gene circuits which are fit to quantitative gap gene expression data in M. abdita and compare them with an equivalent set of models from D. melanogaster. The results of this comparative analysis show precisely how compensatory regulatory mechanisms achieve equivalent final patterns in both species. We discuss the larger implications of the work in terms of “genotype networks” and the ways in which the structure of regulatory networks can influence patterns of evolutionary change (evolvability). PMID:26796549

Differentially-dimensioned furrow formation by zygotic gene expression and the MBT

PubMed Central

Xie, Yi

2018-01-01

Despite extensive work on the mechanisms that generate plasma membrane furrows, understanding how cells are able to dynamically regulate furrow dimensions is an unresolved question. Here, we present an in-depth characterization of furrow behaviors and their regulation in vivo during early Drosophila morphogenesis. We show that the deepening in furrow dimensions with successive nuclear cycles is largely due to the introduction of a new, rapid ingression phase (Ingression II). Blocking the midblastula transition (MBT) by suppressing zygotic transcription through pharmacological or genetic means causes the absence of Ingression II, and consequently reduces furrow dimensions. The analysis of compound chromosomes that produce chromosomal aneuploidies suggests that multiple loci on the X, II, and III chromosomes contribute to the production of differentially-dimensioned furrows, and we track the X-chromosomal contribution to furrow lengthening to the nullo gene product. We further show that checkpoint proteins are required for furrow lengthening; however, mitotic phases of the cell cycle are not strictly deterministic for furrow dimensions, as a decoupling of mitotic phases with periods of active ingression occurs as syncytial furrow cycles progress. Finally, we examined the turnover of maternal gene products and find that this is a minor contributor to the developmental regulation of furrow morphologies. Our results suggest that cellularization dynamics during cycle 14 are a continuation of dynamics established during the syncytial cycles and provide a more nuanced view of developmental- and MBT-driven morphogenesis. PMID:29337989

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks

PubMed Central

Gerstein, Mark

2016-01-01

Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem’s gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally–e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the “state” and “control” in the model refer to its own (internal) and another subsystem’s (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model’s parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with evolutionarily ancient functions (e.g. the ribosomal proteins), in contrast to those with more recently evolved functions (e.g., cell-cell communication). This suggests that despite striking morphological differences, some fundamental embryonic-developmental processes are still controlled by ancient regulatory systems. PMID:27760135

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks.

PubMed

Wang, Daifeng; He, Fei; Maslov, Sergei; Gerstein, Mark

2016-10-01

Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem's gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally-e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the "state" and "control" in the model refer to its own (internal) and another subsystem's (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model's parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with evolutionarily ancient functions (e.g. the ribosomal proteins), in contrast to those with more recently evolved functions (e.g., cell-cell communication). This suggests that despite striking morphological differences, some fundamental embryonic-developmental processes are still controlled by ancient regulatory systems.

A developmental-psychobiological approach to developmental neuropsychology.

PubMed

Michel, G F

2001-01-01

Although both developmental psychobiology and developmental neuropsychology examine the interface between biological and psychological processes, they differ in conceptual framework. This article argues for the incorporation into developmental neuropsychology of certain aspects of the conceptual framework of developmental psychobiology. Three principles of dynamic psychobiological interaction are described and applied to four issues in neuropsychology (handedness, sex differences in behavior, critical periods, and modularity of structure-function relations). Then, it is proposed that developmental psychobiology can make four direct contributions to developmental neuropsychology. Finally, it is argued that the value of the conceptual framework provided by developmental psychobiology depends, in part, on how well it translates into procedures that can be applied in the clinical settings of the developmental neuropsychologist.

Postnatal Vitamin D Intake Modulates Hippocampal Learning and Memory in Adult Mice

PubMed Central

Liang, Qiujuan; Cai, Chunhui; Duan, Dongxia; Hu, Xinyu; Hua, Wanhao; Jiang, Peicheng; Zhang, Liu; Xu, Jun; Gao, Zhengliang

2018-01-01

Vitamin D (VD) is a neuroactive steroid crucial for brain development, function and homeostasis. Its deficiency is associated with numerous brain conditions. As such, VD and its variants are routinely taken by a broad of groups with/without known VD deficiency. In contrast, the harmful effects of VD overdose have been poorly studied. Similarly, the developmental stage-specific VD deficiency and overdose have been rarely explored. In the present work, we showed that postnatal VD supplementation enhanced the motor function transiently in the young adult, but not in the older one. Postnatal VD intake abnormality did not impact the anxiety and depressive behavior but was detrimental to spatial learning and hippocampus-dependent memory. At the molecular level we failed to observe an obvious and constant change with the neural development and activity-related genes examined. However, disrupted developmental expression dynamics were observed for most of the genes, suggesting that the altered neural development dynamics and therefore aberrant adult plasticity might underlie the functional deficits. Our work highlights the essence of VD homeostasis in neural development and adult brain function. Further studies are needed to determine the short- and long-term effects VD intake status may have on brain development, homeostasis, and diseases. PMID:29666565

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

Adolescent mouse takes on an active transcriptomic expression during postnatal cerebral development.

PubMed

Xu, Wei; Xin, Chengqi; Lin, Qiang; Ding, Feng; Gong, Wei; Zhou, Yuanyuan; Yu, Jun; Cui, Peng; Hu, Songnian

2014-06-01

Postnatal cerebral development is a complicated biological process precisely controlled by multiple genes. To understand the molecular mechanism of cerebral development, we compared dynamics of mouse cerebrum transcriptome through three developmental stages using high-throughput RNA-seq technique. Three libraries were generated from the mouse cerebrum at infancy, adolescence and adulthood, respectively. Consequently, 44,557,729 (infancy), 59,257,530 (adolescence) and 72,729,636 (adulthood) reads were produced, which were assembled into 15,344, 16,048 and 15,775 genes, respectively. We found that the overall gene expression level increased from infancy to adolescence and decreased later on upon reaching adulthood. The adolescence cerebrum has the most active gene expression, with expression of a large number of regulatory genes up-regulated and some crucial pathways activated. Transcription factor (TF) analysis suggested the similar dynamics as expression profiling, especially those TFs functioning in neurogenesis differentiation, oligodendrocyte lineage determination and circadian rhythm regulation. Moreover, our data revealed a drastic increase in myelin basic protein (MBP)-coding gene expression in adolescence and adulthood, suggesting that the brain myelin may be generated since mouse adolescence. In addition, differential gene expression analysis indicated the activation of rhythmic pathway, suggesting the function of rhythmic movement since adolescence; Furthermore, during infancy and adolescence periods, gene expression related to axonrepulsion and attraction showed the opposite trends, indicating that axon repulsion was activated after birth, while axon attraction might be activated at the embryonic stage and declined during the postnatal development. Our results from the present study may shed light on the molecular mechanism underlying the postnatal development of the mammalian cerebrum. Copyright © 2014. Production and hosting by Elsevier Ltd.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

l-Ergothioneine improves the developmental potential of in vitro sheep embryos without influencing OCTN1-mediated cross-membrane transcript expression.

PubMed

Mishra, A; Reddy, I J; Dhali, A; Javvaji, P K

2018-04-02

SummaryThe objective of the study was to investigate the effect of l-ergothioneine (l-erg) (5 mM or 10 mM) supplementation in maturation medium on the developmental potential and OCTN1-dependant l-erg-mediated (10 mM) change in mRNA abundance of apoptotic (Bcl2, Bax, Casp3 and PCNA) and antioxidant (GPx, SOD1, SOD2 and CAT) genes in sheep oocytes and developmental stages of embryos produced in vitro. Oocytes matured with l-erg (10 mM) reduced their embryo toxicity by decreasing intracellular ROS and increasing intracellular GSH in matured oocytes that in turn improved developmental potential, resulting in significantly (P < 0.05) higher percentages of cleavage (53.72% vs 38.86, 46.56%), morulae (34.36% vs 20.62, 25.84%) and blastocysts (14.83% vs 6.98, 9.26%) compared with other lower concentrations (0 mM and 5 mM) of l-erg without change in maturation rate. l-Erg (10 mM) treatment did not influence the mRNA abundance of the majority of apoptotic and antioxidant genes studied in the matured oocytes and developmental stages of embryo. A gene expression study found that the SLC22A4 gene that encodes OCTN1, an integral membrane protein and specific transporter of l-erg was not expressed in oocytes and developmental stages of embryos. Therefore it was concluded from the study that although there was improvement in the developmental potential of sheep embryos by l-erg supplementation in maturation medium, there was no change in the expression of the majority of the genes studied due to the absence of the SLC22A4 gene in oocytes and embryos that encode OCTN1, which is responsible for transportation of l-erg across the membrane to alter gene expression.

Identifying gene coexpression networks underlying the dynamic regulation of wood-forming tissues in Populus under diverse environmental conditions.

PubMed

Zinkgraf, Matthew; Liu, Lijun; Groover, Andrew; Filkov, Vladimir

2017-06-01

Trees modify wood formation through integration of environmental and developmental signals in complex but poorly defined transcriptional networks, allowing trees to produce woody tissues appropriate to diverse environmental conditions. In order to identify relationships among genes expressed during wood formation, we integrated data from new and publically available datasets in Populus. These datasets were generated from woody tissue and include transcriptome profiling, transcription factor binding, DNA accessibility and genome-wide association mapping experiments. Coexpression modules were calculated, each of which contains genes showing similar expression patterns across experimental conditions, genotypes and treatments. Conserved gene coexpression modules (four modules totaling 8398 genes) were identified that were highly preserved across diverse environmental conditions and genetic backgrounds. Functional annotations as well as correlations with specific experimental treatments associated individual conserved modules with distinct biological processes underlying wood formation, such as cell-wall biosynthesis, meristem development and epigenetic pathways. Module genes were also enriched for DNase I hypersensitivity footprints and binding from four transcription factors associated with wood formation. The conserved modules are excellent candidates for modeling core developmental pathways common to wood formation in diverse environments and genotypes, and serve as testbeds for hypothesis generation and testing for future studies. No claim to original US government works. New Phytologist © 2017 New Phytologist Trust.

iTRAQ-Based Proteomics Analysis and Network Integration for Kernel Tissue Development in Maize

PubMed Central

Dong, Yongbin; Wang, Qilei; Du, Chunguang; Xiong, Wenwei; Li, Xinyu; Zhu, Sailan; Li, Yuling

2017-01-01

Grain weight is one of the most important yield components and a developmentally complex structure comprised of two major compartments (endosperm and pericarp) in maize (Zea mays L.), however, very little is known concerning the coordinated accumulation of the numerous proteins involved. Herein, we used isobaric tags for relative and absolute quantitation (iTRAQ)-based comparative proteomic method to analyze the characteristics of dynamic proteomics for endosperm and pericarp during grain development. Totally, 9539 proteins were identified for both components at four development stages, among which 1401 proteins were non-redundant, 232 proteins were specific in pericarp and 153 proteins were specific in endosperm. A functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the tissue development. Three and 76 proteins involved in 49 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were integrated for the specific endosperm and pericarp proteins, respectively, reflecting their complex metabolic interactions. In addition, four proteins with important functions and different expression levels were chosen for gene cloning and expression analysis. Different concordance between mRNA level and the protein abundance was observed across different proteins, stages, and tissues as in previous research. These results could provide useful message for understanding the developmental mechanisms in grain development in maize. PMID:28837076

Focusing the lens: The infant's point of view. Discussion of "Brief interventions with parents, infants, and young children: A Framework for thinking".

PubMed

Jordan, Brigid

2011-11-01

This is a discussion of the article "Brief Interventions With Parents, Infants, and Young Children: A Framework for Thinking by Louise Emmanuel." Questions of symptom formation, the difference between a defense and developmental phenomena, and different therapeutic techniques are explored from the perspective of The Baby as Subject (an infant-parent psychotherapy approach developed at the Royal Children's Hospital in Melbourne, Australia). The relationship between feeding difficulties and the dynamics of the infant-parent attachment relationship are discussed with reference to whether the infant's apparent self-sufficiency is interpersonally generated and whether bids for autonomy are a sign of healthy, age-appropriate developmental drives at play. The use of representational toys in infant-parent psychotherapy to enable infants and toddlers to represent their experience or for the therapist to visually express what he or she understands the infant's experience to be and thus to work directly with the infant's representations is outlined. In addition to the linguistic content of verbal interpretations, the infant is receptive to the experience of another thinking mind and the emotional language, facial expressions, and gestures that also convey to the baby the experience of being understood or misunderstood. Copyright © 2011 Michigan Association for Infant Mental Health.

DNA replication-timing analysis of human chromosome 22 at high resolution and different developmental states.

PubMed

White, Eric J; Emanuelsson, Olof; Scalzo, David; Royce, Thomas; Kosak, Steven; Oakeley, Edward J; Weissman, Sherman; Gerstein, Mark; Groudine, Mark; Snyder, Michael; Schübeler, Dirk

2004-12-21

Duplication of the genome during the S phase of the cell cycle does not occur simultaneously; rather, different sequences are replicated at different times. The replication timing of specific sequences can change during development; however, the determinants of this dynamic process are poorly understood. To gain insights into the contribution of developmental state, genomic sequence, and transcriptional activity to replication timing, we investigated the timing of DNA replication at high resolution along an entire human chromosome (chromosome 22) in two different cell types. The pattern of replication timing was correlated with respect to annotated genes, gene expression, novel transcribed regions of unknown function, sequence composition, and cytological features. We observed that chromosome 22 contains regions of early- and late-replicating domains of 100 kb to 2 Mb, many (but not all) of which are associated with previously described chromosomal bands. In both cell types, expressed sequences are replicated earlier than nontranscribed regions. However, several highly transcribed regions replicate late. Overall, the DNA replication-timing profiles of the two different cell types are remarkably similar, with only nine regions of difference observed. In one case, this difference reflects the differential expression of an annotated gene that resides in this region. Novel transcribed regions with low coding potential exhibit a strong propensity for early DNA replication. Although the cellular function of such transcripts is poorly understood, our results suggest that their activity is linked to the replication-timing program.

Role of the Small Intestine in Developmental Programming: Impact of Maternal Nutrition on the Dam and Offspring123

PubMed Central

Meyer, Allison M; Caton, Joel S

2016-01-01

Small-intestinal growth and function are critical for optimal animal growth and health and play a major role in nutrient digestion and absorption, energy and nutrient expenditure, and immunological competence. During fetal and perinatal development, the small intestine is affected by the maternal environment and nutrient intake. In ruminants, altered small-intestinal mass, villi morphology, hypertrophy, hyperplasia, vascularity, and gene expression have been observed as a result of poor gestational nutrition or intrauterine growth restriction. Although many of these data come from fetal stages, data have also demonstrated that nutrition during mid- and late gestation affects lamb small-intestinal growth, vascularity, digestive enzyme activity, and gene expression at 20 and 180 d of age as well. The small intestine is known to be a highly plastic tissue, changing with nutrient intake and physiological state even in adulthood, and the maternal small intestine adapts to pregnancy and advancing gestation. In ruminants, the growth, vascularity, and gene expression of the maternal small intestine also adapt to the nutritional plane and specific nutrient intake such as high selenium during pregnancy. These changes likely alter both pre- and postnatal nutrient delivery to offspring. More research is necessary to better understand the role of the offspring and maternal small intestines in whole-animal responses to developmental programming, but programming of this plastic tissue seems to play a dynamic role in gestational nutrition impacts on the whole animal. PMID:27180380

Regulatory heterochronies and loose temporal scaling between sea star and sea urchin regulatory circuits.

PubMed

Gildor, Tsvia; Hinman, Veronica; Ben-Tabou-De-Leon, Smadar

2017-01-01

It has long been argued that heterochrony, a change in relative timing of a developmental process, is a major source of evolutionary innovation. Heterochronic changes of regulatory gene activation could be the underlying molecular mechanism driving heterochronic changes through evolution. Here, we compare the temporal expression profiles of key regulatory circuits between sea urchin and sea star, representative of two classes of Echinoderms that shared a common ancestor about 500 million years ago. The morphologies of the sea urchin and sea star embryos are largely comparable, yet, differences in certain mesodermal cell types and ectodermal patterning result in distinct larval body plans. We generated high resolution temporal profiles of 17 mesodermally-, endodermally- and ectodermally-expressed regulatory genes in the sea star, Patiria miniata, and compared these to their orthologs in the Mediterranean sea urchin, Paracentrotus lividus. We found that the maternal to zygotic transition is delayed in the sea star compared to the sea urchin, in agreement with the longer cleavage stage in the sea star. Interestingly, the order of gene activation shows the highest variation in the relatively diverged mesodermal circuit, while the correlations of expression dynamics are the highest in the strongly conserved endodermal circuit. We detected loose scaling of the developmental rates of these species and observed interspecies heterochronies within all studied regulatory circuits. Thus, after 500 million years of parallel evolution, mild heterochronies between the species are frequently observed and the tight temporal scaling observed for closely related species no longer holds.

Sensory Processing Dysfunctions as Expressed among Children with Different Severities of Intellectual Developmental Disabilities

ERIC Educational Resources Information Center

Engel-Yeger, Batya; Hardal-Nasser, Reem; Gal, Eynat

2011-01-01

High frequency of sensory processing dysfunctions (SPD) is prevalent among children with intellectual developmental disabilities and contributes to their maladaptive behaviors. However, the knowledge about the expressions of SPD in different levels of IDD severity is limited. As SPD may reduce adaptive responses and limit participation, this…

Mimicking emotions: how 3-12-month-old infants use the facial expressions and eyes of a model.

PubMed

Soussignan, Robert; Dollion, Nicolas; Schaal, Benoist; Durand, Karine; Reissland, Nadja; Baudouin, Jean-Yves

2018-06-01

While there is an extensive literature on the tendency to mimic emotional expressions in adults, it is unclear how this skill emerges and develops over time. Specifically, it is unclear whether infants mimic discrete emotion-related facial actions, whether their facial displays are moderated by contextual cues and whether infants' emotional mimicry is constrained by developmental changes in the ability to discriminate emotions. We therefore investigate these questions using Baby-FACS to code infants' facial displays and eye-movement tracking to examine infants' looking times at facial expressions. Three-, 7-, and 12-month-old participants were exposed to dynamic facial expressions (joy, anger, fear, disgust, sadness) of a virtual model which either looked at the infant or had an averted gaze. Infants did not match emotion-specific facial actions shown by the model, but they produced valence-congruent facial responses to the distinct expressions. Furthermore, only the 7- and 12-month-olds displayed negative responses to the model's negative expressions and they looked more at areas of the face recruiting facial actions involved in specific expressions. Our results suggest that valence-congruent expressions emerge in infancy during a period where the decoding of facial expressions becomes increasingly sensitive to the social signal value of emotions.

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

FGF-2 deficiency does not influence FGF ligand and receptor expression during development of the nigrostriatal system.

PubMed

Ratzka, Andreas; Baron, Olga; Grothe, Claudia

2011-01-01

Secreted proteins of the fibroblast growth factor (FGF) family play important roles during development of various organ systems. A detailed knowledge of their temporal and spatial expression profiles, especially of closely related FGF family members, are essential to further identification of specific functions in distinct tissues. In the central nervous system dopaminergic neurons of the substantia nigra and their axonal projections into the striatum progressively degenerate in Parkinson's disease. In contrast, FGF-2 deficient mice display increased numbers of dopaminergic neurons. In this study, we determined the expression profiles of all 22 FGF-ligands and 10 FGF-receptor isoforms, in order to clarify, if FGF-2 deficiency leads to compensatory up-regulation of other FGFs in the nigrostriatal system. Three tissues, ventral mesencephalon (VM), striatum (STR) and as reference tissue spinal cord (SC) of wild-type and FGF-2 deficient mice at four developmental stages E14.5, P0, P28, and adult were comparatively analyzed by quantitative RT-PCR. As no differences between the genotypes were observed, a compensatory up-regulation can be excluded. Moreover, this analysis revealed that the majority of FGF-ligands (18/22) and FGF-receptors (9/10) are expressed during normal development of the nigrostriatal system and identified dynamic changes for some family members. By comparing relative expression level changes to SC reference tissue, general alterations in all 3 tissues, such as increased expression of FGF-1, -2, -22, FgfR-2c, -3c and decreased expression of FGF-13 during postnatal development were identified. Further, specific changes affecting only one tissue, such as increased FGF-16 (STR) or decreased FGF-17 (VM) expression, or two tissues, such as decreased expression of FGF-8 (VM, STR) and FGF-15 (SC, VM) were found. Moreover, 3 developmentally down-regulated FGFs (FGF-8b, FGF-15, FGF-17a) were functionally characterized by plasmid-based over-expression in dissociated E11.5 VM cell cultures, however, such a continuous exposure had no influence on the yield of dopaminergic neurons in vitro.

Statistical inference for time course RNA-Seq data using a negative binomial mixed-effect model.

PubMed

Sun, Xiaoxiao; Dalpiaz, David; Wu, Di; S Liu, Jun; Zhong, Wenxuan; Ma, Ping

2016-08-26

Accurate identification of differentially expressed (DE) genes in time course RNA-Seq data is crucial for understanding the dynamics of transcriptional regulatory network. However, most of the available methods treat gene expressions at different time points as replicates and test the significance of the mean expression difference between treatments or conditions irrespective of time. They thus fail to identify many DE genes with different profiles across time. In this article, we propose a negative binomial mixed-effect model (NBMM) to identify DE genes in time course RNA-Seq data. In the NBMM, mean gene expression is characterized by a fixed effect, and time dependency is described by random effects. The NBMM is very flexible and can be fitted to both unreplicated and replicated time course RNA-Seq data via a penalized likelihood method. By comparing gene expression profiles over time, we further classify the DE genes into two subtypes to enhance the understanding of expression dynamics. A significance test for detecting DE genes is derived using a Kullback-Leibler distance ratio. Additionally, a significance test for gene sets is developed using a gene set score. Simulation analysis shows that the NBMM outperforms currently available methods for detecting DE genes and gene sets. Moreover, our real data analysis of fruit fly developmental time course RNA-Seq data demonstrates the NBMM identifies biologically relevant genes which are well justified by gene ontology analysis. The proposed method is powerful and efficient to detect biologically relevant DE genes and gene sets in time course RNA-Seq data.

Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

PubMed

Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

2014-11-27

Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Citrus Chlorophyllase Dynamics at Ethylene-Induced Fruit Color-Break: A Study of Chlorophyllase Expression, Posttranslational Processing Kinetics, and in Situ Intracellular Localization1[OA

PubMed Central

Azoulay Shemer, Tamar; Harpaz-Saad, Smadar; Belausov, Eduard; Lovat, Nicole; Krokhin, Oleg; Spicer, Victor; Standing, Kenneth G.; Goldschmidt, Eliezer E.; Eyal, Yoram

2008-01-01

Fruit color-break is the visual manifestation of the developmentally regulated transition of chloroplasts to chromoplasts during fruit ripening and often involves biosynthesis of copious amounts of carotenoids concomitant with massive breakdown of chlorophyll. Regulation of chlorophyll breakdown at different physiological and developmental stages of the plant life cycle, particularly at fruit color-break, is still not well understood. Here, we present the dynamics of native chlorophyllase (Chlase) and chlorophyll breakdown in lemon (Citrus limon) fruit during ethylene-induced color-break. We show, using in situ immunofluorescence on ethylene-treated fruit peel (flavedo) tissue, that citrus Chlase is located in the plastid, in contrast to recent reports suggesting cytoplasmic localization of Arabidopsis (Arabidopsis thaliana) Chlases. At the intra-organellar level, Chlase signal was found to overlap mostly with chlorophyll fluorescence, suggesting association of most of the Chlase protein with the photosynthetic membranes. Confocal microscopy analysis showed that the kinetics of chlorophyll breakdown was not uniform in the flavedo cells. Chlorophyll quantity at the cellular level was negatively correlated with plastid Chlase accumulation; plastids with reduced chlorophyll content were found by in situ immunofluorescence to contain significant levels of Chlase, while plastids containing still-intact chlorophyll lacked any Chlase signal. Immunoblot and protein-mass spectrometry analyses were used to demonstrate that citrus Chlase initially accumulates as an approximately 35-kD precursor, which is subsequently N-terminally processed to approximately 33-kD mature forms by cleavage at either of three consecutive amino acid positions. Chlase plastid localization, expression kinetics, and the negative correlation with chlorophyll levels support the central role of the enzyme in chlorophyll breakdown during citrus fruit color-break. PMID:18633118

Etiology of distinct membrane excitability in pre- and posthearing auditory neurons relies on activity of Cl− channel TMEM16A

PubMed Central

Zhang, Xiao-Dong; Lee, Jeong-Han; Lv, Ping; Chen, Wei Chun; Kim, Hyo Jeong; Wei, Dongguang; Wang, Wenying; Sihn, Choong-Ryoul; Doyle, Karen Jo; Rock, Jason R.; Chiamvimonvat, Nipavan; Yamoah, Ebenezer N.

2015-01-01

The developmental rehearsal for the debut of hearing is marked by massive changes in the membrane properties of hair cells (HCs) and spiral ganglion neurons (SGNs). Whereas the underlying mechanisms for the developing HC transition to mature stage are understood in detail, the maturation of SGNs from hyperexcitable prehearing to quiescent posthearing neurons with broad dynamic range is unknown. Here, we demonstrated using pharmacological approaches, caged-Ca2+ photolysis, and gramicidin patch recordings that the prehearing SGN uses Ca2+-activated Cl− conductance to depolarize the resting membrane potential and to prime the neurons in a hyperexcitable state. Immunostaining of the cochlea preparation revealed the identity and expression of the Ca2+-activated Cl− channel transmembrane member 16A (TMEM16A) in SGNs. Moreover, null deletion of TMEM16A reduced the Ca2+-activated Cl− currents and action potential firing in SGNs. To determine whether Cl− ions and TMEM16A are involved in the transition between pre- and posthearing features of SGNs we measured the intracellular Cl− concentration [Cl−]i in SGNs. Surprisingly, [Cl−]i in SGNs from prehearing mice was ∼90 mM, which was significantly higher than posthearing neurons, ∼20 mM, demonstrating discernible altered roles of Cl− channels in the developing neuron. The switch in [Cl−]i stems from delayed expression of the development of intracellular Cl− regulating mechanisms. Because the Cl− channel is the only active ion-selective conductance with a reversal potential that lies within the dynamic range of SGN action potentials, developmental alteration of [Cl−]i, and hence the equilibrium potential for Cl− (ECl), transforms pre- to posthearing phenotype. PMID:25675481

Temporal cohesion of the structural, functional and molecular characteristics of the developing zebrafish heart.

PubMed

Matrone, Gianfranco; Wilson, Kathryn S; Mullins, John J; Tucker, Carl S; Denvir, Martin A

2015-06-01

Heart formation is a complex, dynamic and highly coordinated process of molecular, morphogenetic and functional factors with each interacting and contributing to formation of the mature organ. Cardiac abnormalities in early life can be lethal in mammals but not in the zebrafish embryo which has been widely used to study the developing heart. While early cardiac development in the zebrafish has been well characterized, functional changes during development and how these relate to architectural, cellular and molecular aspects of development have not been well described previously. To address this we have carefully characterised cardiac structure, function, cardiomyocyte proliferation and cardiac-specific gene expression between 48 and 120 hpf in the zebrafish. We show that the zebrafish heart increases in volume and changes shape significantly between 48 and 72 hpf accompanied by a 40% increase in cardiomyocyte number. Between 96 and 120 hpf, while external heart expansion slows, there is rapid formation of a mature and extensive trabecular network within the ventricle chamber. While ejection fraction does not change during the course of development other determinants of contractile function increase significantly particularly between 72 and 96 hpf leading to an increase in cardinal vein blood flow. This study has revealed a number of novel aspects of cardiac developmental dynamics with striking temporal orchestration of structure and function within the first few days of development. These changes are associated with changes in expression of developmental and maturational genes. This study provides important insights into the complex temporal relationship between structure and function of the developing zebrafish heart. Copyright © 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina.

PubMed

Gunter, Helen M; Degnan, Bernard M

2007-08-01

Heat shock proteins (Hsps) have dual functions, participating in both the stress response and a broad range of developmental processes. At physiological temperatures, it has been demonstrated in deuterostomes (vertebrates) and ecdysozoans (insects) that Hsps are expressed in tissues that are undergoing differentiation and morphogenesis. Here we investigate the developmental expression of Hsp70, Hsp90 and their regulatory transcription factor heat shock transcription factor (HSF) in the marine gastropod Haliotis asinina, a representative of the 3rd major lineage of bilaterian animals, the Lophotrochozoa. HasHsp70, HasHsp90 and HasHSF are maternally expressed in H. asinina and are progressively restricted to the micromere lineage during cleavage. During larval morphogenesis, they are expressed in unique and overlapping patterns in the prototroch, foot, and mantle. Hsp expression peaked in these tissues during periods of cell differentiation and morphogenesis, returning to lower levels after morphogenesis was complete. These patterns of Hsp and HSF expression in H. asinina are akin to those observed in ecdysozoans and deuterostomes, with Hsps being activated in cells and tissues undergoing morphogenesis.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental programming: Prenatal BPA treatment disrupts timing of LH surge and ovarian follicular wave dynamics in adult sheep

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veiga-Lopez, A.; Beckett, E.M.; Abi Salloum, B.

Developmental exposure to BPA adversely affects reproductive function. In sheep, prenatal BPA treatment induces reproductive neuroendocrine defects, manifested as LH excess and dampened LH surge and perturbs early ovarian gene expression. In this study we hypothesized that prenatal BPA treatment will also disrupt ovarian follicular dynamics. Pregnant sheep were treated from days 30 to 90 of gestation with 3 different BPA doses (0.05, 0.5, or 5 mg/kg BW/day). All female offspring were estrus synchronized and transrectal ultrasonography was performed daily for 22 days to monitor ovarian follicular and corpora lutea dynamics. Blood samples were collected to assess preovulatory hormonal changesmore » and luteal progesterone dynamics. Statistical analysis revealed that the time interval between the estradiol rise and the preovulatory LH surge was shortened in the BPA-treated females. None of the three BPA doses had an effect on corpora lutea, progestogenic cycles, and mean number or duration of ovulatory and non-ovulatory follicles. However, differences in follicular count trajectories were evident in all three follicular size classes (2–3 mm, 4–5 mm, and ≥ 6 mm) of prenatal BPA-treated animals compared to controls. Number of follicular waves tended also to be more variable in the prenatal BPA-treated groups ranging from 2 to 5 follicular waves per cycle, while this was restricted to 3 to 4 waves in control females. These changes in ovarian follicular dynamics coupled with defects in time interval between estradiol rise and preovulatory LH release are likely to lead to subfertility in prenatal BPA-treated females. - Highlights: • Prenatal BPA shortens interval between estradiol rise and preovulatory LH surge. • Prenatal BPA affects follicular count trajectory and follicular wave occurrence. • Prenatal BPA does not affect ovulatory rate and progesterone dynamics.« less

Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

2013-10-01

The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

Biased gene expression in early honeybee larval development

PubMed Central

2013-01-01

Background Female larvae of the honeybee (Apis mellifera) develop into either queens or workers depending on nutrition. This nutritional stimulus triggers different developmental trajectories, resulting in adults that differ from each other in physiology, behaviour and life span. Results To understand how these trajectories are established we have generated a comprehensive atlas of gene expression throughout larval development. We found substantial differences in gene expression between worker and queen-destined larvae at 6 hours after hatching. Some of these early changes in gene expression are maintained throughout larval development, indicating that caste-specific developmental trajectories are established much earlier than previously thought. Within our gene expression data we identified processes that potentially underlie caste differentiation. Queen-destined larvae have higher expression of genes involved in transcription, translation and protein folding early in development with a later switch to genes involved in energy generation. Using RNA interference, we were able to demonstrate that one of these genes, hexamerin 70b, has a role in caste differentiation. Both queen and worker developmental trajectories are associated with the expression of genes that have alternative splice variants, although only a single variant of a gene tends to be differentially expressed in a given caste. Conclusions Our data, based on the biases in gene expression early in development together with published data, supports the idea that caste development in the honeybee consists of two phases; an initial biased phase of development, where larvae can still switch to the other caste by differential feeding, followed by commitment to a particular developmental trajectory. PMID:24350621

Achondroplasia: Development, pathogenesis, and therapy.

PubMed

Ornitz, David M; Legeai-Mallet, Laurence

2017-04-01

Autosomal dominant mutations in fibroblast growth factor receptor 3 (FGFR3) cause achondroplasia (Ach), the most common form of dwarfism in humans, and related chondrodysplasia syndromes that include hypochondroplasia (Hch), severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), and thanatophoric dysplasia (TD). FGFR3 is expressed in chondrocytes and mature osteoblasts where it functions to regulate bone growth. Analysis of the mutations in FGFR3 revealed increased signaling through a combination of mechanisms that include stabilization of the receptor, enhanced dimerization, and enhanced tyrosine kinase activity. Paradoxically, increased FGFR3 signaling profoundly suppresses proliferation and maturation of growth plate chondrocytes resulting in decreased growth plate size, reduced trabecular bone volume, and resulting decreased bone elongation. In this review, we discuss the molecular mechanisms that regulate growth plate chondrocytes, the pathogenesis of Ach, and therapeutic approaches that are being evaluated to improve endochondral bone growth in people with Ach and related conditions. Developmental Dynamics 246:291-309, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Proteome labelling and protein identification in specific tissues and at specific developmental stages in an animal

PubMed Central

Elliott, Thomas S.; Townsley, Fiona M.; Bianco, Ambra; Ernst, Russell J.; Sachdeva, Amit; Elsässer, Simon J.; Davis, Lloyd; Lang, Kathrin; Pisa, Rudolf; Greiss, Sebastian.; Lilley, Kathryn S.; Chin, Jason W.

2014-01-01

Identifying the proteins synthesized in defined cells at specific times in an animal will facilitate the study of cellular functions and dynamic processes. Here we introduce stochastic orthogonal recoding of translation with chemoselective modification (SORT-M) to address this challenge. SORT-M involves modifying cells to express an orthogonal aminoacyl-tRNA synthetase/tRNA pair to enable the incorporation of chemically modifiable analogs of amino acids at diverse sense codons in cells in rich media. We apply SORT-M to Drosophila melanogaster fed standard food to label and image proteins in specific tissues at precise developmental stages with diverse chemistries, including cyclopropene-tetrazine inverse electron demand Diels-Alder cycloaddition reactions. We also use SORT-M to identify proteins synthesized in germ cells of the fly ovary without dissection. SORT-M will facilitate the definition of proteins synthesized in specific sets of cells to study development, and learning and memory in flies, and may be extended to other animals. PMID:24727715

Attention trajectories, mechanisms and outcomes: at the interface between developing cognition and environment.

PubMed

Scerif, Gaia

2010-11-01

Attentional processes play a crucial role in prioritizing information for further processing and they therefore sit at the interface between internal goals and the challenges presented by the environment. How does attentional control interact with the changing constraints imposed by the developing cognitive system? Emerging work in this area has employed a range of complementary techniques, from increasingly refined neurocognitive measures in typically developing individuals, to the investigation of risk or protective factors influencing attention trajectories in developmental disorders. A growing corpus of data suggests that, while attentional biases for specific input characteristics (e.g. suddenly appearing stimuli, emotional expressions) are in place from infancy, it is the interplay between these predispositions, genetic and environmental factors that drives attention development over time. With the advent of multidisciplinary approaches to the developmental cognitive neuroscience of attention, unravelling these complex dynamics from infancy and their outcome on learning is increasingly within reach. © 2010 Blackwell Publishing Ltd.

Change in Gene Expression in Zebrafish as an Endpoint for Developmental Neurotoxicity Screening

EPA Science Inventory

Chemicals that adversely affect the developing nervous system may have long-term consequences on human health. Little information exists on a large number of environmental chemicals to guide the risk assessments for developmental neurotoxicity (DNT). As traditional developmental ...

Adolescent Maturation of Dopamine D1 and D2 Receptor Function and Interactions in Rodents

PubMed Central

Dwyer, Jennifer B.; Leslie, Frances M.

2016-01-01

Adolescence is a developmental period characterized by heightened vulnerability to illicit drug use and the onset of neuropsychiatric disorders. These clinical phenomena likely share common neurobiological substrates, as mesocorticolimbic dopamine systems actively mature during this period. Whereas prior studies have examined age-dependent changes in dopamine receptor binding, there have been fewer functional analyses. The aim of the present study was therefore to determine whether the functional consequences of D1 and D2-like activation are age-dependent. Adolescent and adult rats were given direct D1 and D2 agonists, alone and in combination. Locomotor and stereotypic behaviors were measured, and brains were collected for analysis of mRNA expression for the immediate early genes (IEGs), cfos and arc. Adolescents showed enhanced D2-like receptor control of locomotor and repetitive behaviors, which transitioned to dominant D1-like mechanisms in adulthood. When low doses of agonists were co-administered, adults showed supra-additive behavioral responses to D1/D2 combinations, whereas adolescents did not, which may suggest age differences in D1/D2 synergy. D1/D2-stimulated IEG expression was particularly prominent in the bed nucleus of the stria terminalis (BNST). Given the BNST’s function as an integrator of corticostriatal, hippocampal, and stress-related circuitry, and the importance of neural network dynamics in producing behavior, an exploratory functional network analysis of regional IEG expression was performed. This data-driven analysis demonstrated similar developmental trajectories as those described in humans and suggested that dopaminergic drugs alter forebrain coordinated gene expression age dependently. D1/D2 recruitment of stress nuclei into functional networks was associated with low behavioral output in adolescents. Network analysis presents a novel tool to assess pharmacological action, and highlights critical developmental changes in functional neural circuitry. Immature D1/D2 interactions in adolescents may underlie their unique responses to drugs of abuse and vulnerability to psychopathology. These data highlight the need for age-specific pharmacotherapy design and clinical application in adolescence. PMID:26784516

Attention Orienting by Gaze and Facial Expressions Across Development

PubMed Central

Neath, Karly; Nilsen, Elizabeth S.; Gittsovich, Katarzyna; Itier, Roxane J.

2014-01-01

Processing of facial expressions has been shown to potentiate orienting of attention toward the direction signaled by gaze in adults, an important social–cognitive function. However, little is known about how this social attention skill develops. This study is the first to examine the developmental trajectory of the gaze orienting effect (GOE), its modulations by facial expressions, and its links with theory of mind (ToM) abilities. Dynamic emotional stimuli were presented to 222 participants (7–25 years old) with normal trait anxiety using a gaze-cuing paradigm. The GOE was found as early as 7 years of age and decreased linearly until 12–13 years, at which point adult levels were reached. Both fearful and surprised expressions enhanced the GOE compared with neutral expressions. The GOE for fearful faces was also larger than for joyful and angry expressions. These effects did not interact with age and were not driven by intertrial variance. Importantly, the GOE did not correlate with ToM abilities as assessed by the “Reading the Mind in the Eyes” test. The implication of these findings for clinical and typically developing populations is discussed. PMID:23356559

Interdyad Differences in Early Mother-Infant Face-to-Face Communication: Real-Time Dynamics and Developmental Pathways

ERIC Educational Resources Information Center

Lavelli, Manuela; Fogel, Alan

2013-01-01

A microgenetic research design with a multiple case study method and a combination of quantitative and qualitative analyses was used to investigate interdyad differences in real-time dynamics and developmental change processes in mother-infant face-to-face communication over the first 3 months of life. Weekly observations of 24 mother-infant dyads…

Environmental-stress-induced Chromatin Regulation and its Heritability

PubMed Central

Fang, Lei; Wuptra, Kenly; Chen, Danqi; Li, Hongjie; Huang, Shau-Ku; Jin, Chunyuan; Yokoyama, Kazunari K

2014-01-01

Chromatin is subject to proofreading and repair mechanisms during the process of DNA replication, as well as repair to maintain genetic and epigenetic information and genome stability. The dynamic structure of chromatin modulates various nuclear processes, including transcription and replication, by altering the accessibility of the DNA to regulatory factors. Structural changes in chromatin are affected by the chemical modification of histone proteins and DNA, remodeling of nucleosomes, incorporation of variant histones, noncoding RNAs, and nonhistone DNA-binding proteins. Phenotypic diversity and fidelity can be balanced by controlling stochastic switching of chromatin structure and dynamics in response to the environmental disruptors and endogenous stresses. The dynamic chromatin remodeling can, therefore, serve as a sensor, through which environmental and/or metabolic agents can alter gene expression, leading to global cellular changes involving multiple interactive networks. Furthermore its recent evidence also suggests that the epigenetic changes are heritable during the development. This review will discuss the environmental sensing system for chromatin regulation and genetic and epigenetic controls from developmental perspectives. PMID:25045581

The violent adolescent: the urge to destroy versus the urge to feel alive.

PubMed

Snyder, Jane; Rogers, Kenneth

2002-09-01

The dynamics of adolescent violence are explored from theoretical and developmental perspectives applied to the review of psychoanalytic studies of violence and three cases: the case of Willie Bosket, presented in Fox Butterfield's All God's Children, an adolescent treated by one of the authors, and observation of staff dynamics in a juvenile detention facility. Studies indicate that violence is used to preserve a sense of existence and psychic equilibrium as well as to express rage and destroy unwanted projected parts of the self and dangerous intrusions into a fragile self-coherence. In the case studies, violent activity serves a number of psychic functions: it leads to high arousal states and the feeling of being alive thereby disavowing underlying feelings of deadness and depression, it serves to contain and discharge overwhelming chaotic and rageful feelings, and it enacts object ties and the unconscious fantasies of the parent. Staff dynamics in a treatment setting for juvenile offenders reflect the intrapsychic dynamics of the juvenile offender prone to acting out, projection, hypervigilance to signs of disrespect, and disavowal of unwanted affects including helplessness and vulnerability.

Gene expression profiling of the hippocampal dentate gyrus in an adult toxicity study captures a variety of neurodevelopmental dysfunctions in rat models of hypothyroidism.

PubMed

Shiraki, Ayako; Saito, Fumiyo; Akane, Hirotoshi; Akahori, Yumi; Imatanaka, Nobuya; Itahashi, Megu; Yoshida, Toshinori; Shibutani, Makoto

2016-01-01

We previously found that developmental hypothyroidism changed the expression of genes in the rat hippocampal dentate gyrus, a brain region where adult neurogenesis is known to occur. In the present study, we performed brain region-specific global gene expression profiling in an adult rat hypothyroidism model to see if it reflected the developmental neurotoxicity we saw in the developmental hypothyroidism model. Starting when male rats were 5 weeks old, we administered 6-propyl-2-thiouracil at a doses of 0, 0.1 and 10 mg kg(-1) body weight by gavage for 28 days. We selected four brain regions to represent both cerebral and cerebellar tissues: hippocampal dentate gyrus, cerebral cortex, corpus callosum and cerebellar vermis. We observed significant alterations in the expression of genes related to neural development (Eph family genes and Robo3) in the cerebral cortex and hippocampal dentate gyrus and in the expression of genes related to myelination (Plp1 and Mbp) in the hippocampal dentate gyrus. We observed only minor changes in the expression of these genes in the corpus callosum and cerebellar vermis. We used real-time reverse-transcription polymerase chain reaction to confirm Chrdl1, Hes5, Mbp, Plp1, Slit1, Robo3 and the Eph family transcript expression changes. The most significant changes in gene expression were found in the dentate gyrus. Considering that the gene expression profile of the adult dentate gyrus closely related to neurogenesis, 28-day toxicity studies looking at gene expression changes in adult hippocampal dentate gyrus may also detect possible developmental neurotoxic effects. Copyright © 2015 John Wiley & Sons, Ltd.

Expression profiles of the Gα subunits during Xenopus tropicalis embryonic development.

PubMed

Fuentealba, Jaime; Toro-Tapia, Gabriela; Rodriguez, Marion; Arriagada, Cecilia; Maureira, Alejandro; Beyer, Andrea; Villaseca, Soraya; Leal, Juan I; Hinrichs, Maria V; Olate, Juan; Caprile, Teresa; Torrejón, Marcela

2016-09-01

Heterotrimeric G protein signaling plays major roles during different cellular events. However, there is a limited understanding of the molecular mechanisms underlying G protein control during embryogenesis. G proteins are highly conserved and can be grouped into four subfamilies according to sequence homology and function. To further studies on G protein function during embryogenesis, the present analysis identified four Gα subunits representative of the different subfamilies and determined their spatiotemporal expression patterns during Xenopus tropicalis embryogenesis. Each of the Gα subunit transcripts was maternally and zygotically expressed, and, as development progressed, dynamic expression patterns were observed. In the early developmental stages, the Gα subunits were expressed in the animal hemisphere and dorsal marginal zone. While expression was observed at the somite boundaries, in vascular structures, in the eye, and in the otic vesicle during the later stages, expression was mainly found in neural tissues, such as the neural tube and, especially, in the cephalic vesicles, neural crest region, and neural crest-derived structures. Together, these results support the pleiotropism and complexity of G protein subfamily functions in different cellular events. The present study constitutes the most comprehensive description to date of the spatiotemporal expression patterns of Gα subunits during vertebrate development. Copyright © 2016 Elsevier B.V. All rights reserved.

High-Throughput Sequencing of Small RNA Transcriptomes in Maize Kernel Identifies miRNAs Involved in Embryo and Endosperm Development.

PubMed

Xing, Lijuan; Zhu, Ming; Zhang, Min; Li, Wenzong; Jiang, Haiyang; Zou, Junjie; Wang, Lei; Xu, Miaoyun

2017-12-14

Maize kernel development is a complex biological process that involves the temporal and spatial expression of many genes and fine gene regulation at a transcriptional and post-transcriptional level, and microRNAs (miRNAs) play vital roles during this process. To gain insight into miRNA-mediated regulation of maize kernel development, a deep-sequencing technique was used to investigate the dynamic expression of miRNAs in the embryo and endosperm at three developmental stages in B73. By miRNA transcriptomic analysis, we characterized 132 known miRNAs and six novel miRNAs in developing maize kernel, among which, 15 and 14 miRNAs were commonly differentially expressed between the embryo and endosperm at 9 days after pollination (DAP), 15 DAP and 20 DAP respectively. Conserved miRNA families such as miR159, miR160, miR166, miR390, miR319, miR528 and miR529 were highly expressed in developing embryos; miR164, miR171, miR393 and miR2118 were highly expressed in developing endosperm. Genes targeted by those highly expressed miRNAs were found to be largely related to a regulation category, including the transcription, macromolecule biosynthetic and metabolic process in the embryo as well as the vitamin biosynthetic and metabolic process in the endosperm. Quantitative reverse transcription-PCR (qRT-PCR) analysis showed that these miRNAs displayed a negative correlation with the levels of their corresponding target genes. Importantly, our findings revealed that members of the miR169 family were highly and dynamically expressed in the developing kernel, which will help to exploit new players functioning in maize kernel development.

Schizophrenia Risk Variation in the NRG1 gene Exerts Effects on NRG1-IV Splicing During Fetal and Early Postnatal Human Neocortical Development

PubMed Central

Paterson, Clare; Wang, Yanhong; Kleinman, Joel E.; Law, Amanda J.

2015-01-01

OBJECTIVE Neuregulin 1 (NRG1) is a multifunctional neurotrophin and a critical mediator of neurodevelopment and risk for schizophrenia. NRG1 undergoes extensive alternative splicing, and association of brain NRG1-IV isoform expression with the schizophrenia-risk polymorphism, rs6994992, is a potential molecular mechanism of risk. Novel splice variants of NRG1-IV (NRG1-IVNV), with predicted unique signaling capabilities, have been cloned in fetal brain. Because the developmental expression and genetic regulation of NRG1-IVNV in human brain and relationship to schizophrenia is unknown, the authors investigated the temporal dynamics of NRG1-IVNV transcription, compared to the major NRG1 isoforms (types I-IV), across human prenatal and postnatal prefrontal cortical development and examined the association of rs6994992 with NRG1-IVNV expression. METHOD NRG1, types I-IV and NRG1-IVNV isoform expression was evaluated using quantitative real-time PCR in prefrontal cortex during human fetal brain development (14-39 weeks gestation: N=41) and postnatally through aging (age range 0-83 years: N=195). The association of rs6994992 genotype with NRG1-IVNV expression was determined. In-vitro assays were performed to determine the subcellular distribution and proteolytic processing of NRG1-IVNV isoforms. RESULTS Expression of NRG1, types I, II, III was temporally regulated during human prenatal and postnatal neocortical development and the trajectory of NRG1-IVNV was unique, being expressed from 16 weeks gestation until 3 years of age, after which it was undetectable. NRG1-IVNVs expression was associated with rs6994992 genotype, whereby homozygosity for the schizophrenia-risk allele (T) conferred lower cortical NRG1-IVNV levels. Finally, in-vitro cellular assays demonstrate that NRG1-IVNV is a novel nuclear enriched, truncated NRG1 protein that is resistant to proteolytic processing. CONCLUSION This study provides the first quantitative map of NRG1 isoform expression during human neocortical development and aging and identifies a potential mechanism of early developmental risk for schizophrenia at the NRG1 locus, involving a novel class of NRG1 proteins. PMID:24935406

Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

PubMed Central

2010-01-01

Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

PubMed

Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

2016-02-29

Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

PubMed

Baskar, Venkidasamy; Park, Se Won

2015-07-01

Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

Temporal and Spatial Expression of CCN Genes in Zebrafish

PubMed Central

Fernando, Carol A; Conrad, Patricia A; Bartels, Cynthia F; Marques, Tomas; To, Michael; Balow, Stephanie A; Nakamura, Yukio; Warman, Matthew L

2010-01-01

The six mammalian CCN genes (Cyr61, CTGF, Nov, WISP1, WISP2, WISP3) encode a family of secreted, cysteine-rich, multimodular proteins having roles in cell proliferation, adhesion, migration, and differentiation during embryogenesis, wound healing, and angiogenesis. We used bioinformatics to identify 9 CCN genes in zebrafish (zCCNs), 6 of which have not been previously described. When compared with mammalian CCN family members, 3 were paralogs of Cyr61, 2 of CTGF, 2 of WISP1, 1 of WISP2, and 1 of WISP3. No paralog of Nov was found. In situ hybridization was performed to characterize the sites of expression of the zCCNs during early zebrafish development. zCCNs demonstrated both unique and overlapping patterns of expression, suggesting potential division of labor between orthologous genes and providing an alternate approach to gene function studies that will complement studies in mammalian models. Developmental Dynamics 239:1755–1767, 2010. © 2010 Wiley-Liss, Inc. PMID:20503371

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

PubMed

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

PINK1 is required for timely cell-type specific mitochondrial clearance during Drosophila midgut metamorphosis.

PubMed

Liu, Yan; Lin, Jingjing; Zhang, Minjie; Chen, Kai; Yang, Shengxi; Wang, Qun; Yang, Hongqin; Xie, Shusen; Zhou, Yongjian; Zhang, Xi; Chen, Fei; Yang, Yufeng

2016-11-15

Mitophagy is the selective degradation of mitochondria by autophagy, which is an important mitochondrial quality and quantity control process. During Drosophila metamorphosis, the degradation of midgut involves a large change in length and organization, which is mediated by autophagy. Here we noticed a cell-type specific mitochondrial clearance process that occurs in enterocytes (ECs), while most mitochondria remain in intestinal stem cells (ISCs) during metamorphosis. Although PINK1/PARKIN represent the canonical pathway for the elimination of impaired mitochondria in varied pathological conditions, their roles in developmental processes or normal physiological conditions have been less studied. To examine the potential contribution of PINK1 in developmental processes, we monitored the dynamic expression pattern of PINK1 in the midgut development by taking advantage of a newly CRISPR/Cas9 generated knock-in fly strain expressing PINK1-mCherry fusion protein that presumably recapitulates the endogenous expression pattern of PINK1. We disclosed a spatiotemporal correlation between the expression pattern of PINK1 and the mitochondrial clearance or persistence in ECs or ISCs respectively. By mosaic genetic analysis, we then demonstrated that PINK1 and PARKIN function epistatically to mediate the specific timely removal of mitochondria, and are involved in global autophagy in ECs during Drosophila midgut metamorphosis, with kinase-dead PINK1 exerting dominant negative effects. Taken together, our studies concluded that the PINK1/PARKIN is crucial for timely cell-type specific mitophagy under physiological conditions and demonstrated again that Drosophila midgut metamorphosis might serve as an elegant in vivo model to study autophagy. Copyright © 2016 Elsevier Inc. All rights reserved.

Transcriptomic Analysis Reveals Mechanisms of Sterile and Fertile Flower Differentiation and Development in Viburnum macrocephalum f. keteleeri

PubMed Central

Lu, Zhaogeng; Xu, Jing; Li, Weixing; Zhang, Li; Cui, Jiawen; He, Qingsong; Wang, Li; Jin, Biao

2017-01-01

Sterile and fertile flowers are an important evolutionary developmental (evo-devo) phenotype in angiosperm flowers, playing important roles in pollinator attraction and sexual reproductive success. However, the gene regulatory mechanisms underlying fertile and sterile flower differentiation and development remain largely unknown. Viburnum macrocephalum f. keteleeri, which possesses fertile and sterile flowers in a single inflorescence, is a useful candidate species for investigating the regulatory networks in differentiation and development. We developed a de novo-assembled flower reference transcriptome. Using RNA sequencing (RNA-seq), we compared the expression patterns of fertile and sterile flowers isolated from the same inflorescence over its rapid developmental stages. The flower reference transcriptome consisted of 105,683 non-redundant transcripts, of which 5,675 transcripts showed significant differential expression between fertile and sterile flowers. Combined with morphological and cytological changes between fertile and sterile flowers, we identified expression changes of many genes potentially involved in reproductive processes, phytohormone signaling, and cell proliferation and expansion using RNA-seq and qRT-PCR. In particular, many transcription factors (TFs), including MADS-box family members and ABCDE-class genes, were identified, and expression changes in TFs involved in multiple functions were analyzed and highlighted to determine their roles in regulating fertile and sterile flower differentiation and development. Our large-scale transcriptional analysis of fertile and sterile flowers revealed the dynamics of transcriptional networks and potentially key components in regulating differentiation and development of fertile and sterile flowers in Viburnum macrocephalum f. keteleeri. Our data provide a useful resource for Viburnum transcriptional research and offer insights into gene regulation of differentiation of diverse evo-devo processes in flowers. PMID:28298915

Mutations in the Katnb1 gene cause left-right asymmetry and heart defects.

PubMed

Furtado, Milena B; Merriner, D Jo; Berger, Silke; Rhodes, Danielle; Jamsai, Duangporn; O'Bryan, Moira K

2017-12-01

The microtubule-severing protein complex katanin is composed two subunits, the ATPase subunit, KATNA1, and the noncatalytic regulatory subunit, KATNB1. Recently, the Katnb1 gene has been linked to infertility, regulation of centriole and cilia formation in fish and mammals, as well as neocortical brain development. KATNB1 protein is expressed in germ cells in humans and mouse, mitotic/meiotic spindles and cilia, although the full expression pattern of the Katnb1 gene has not been described. Using a knockin-knockout mouse model of Katnb1 dysfunction we demonstrate that Katnb1 is ubiquitously expressed during embryonic development, although a stronger expression is seen in the crown cells of the gastrulation organizer, the murine node. Furthermore, null and hypomorphic Katnb1 gene mutations show a novel correlation between Katnb1 dysregulation and the development of impaired left-right signaling, including cardiac malformations. Katanin function is a critical regulator of heart development in mice. These findings are potentially relevant to human cardiac development. Developmental Dynamics 246:1027-1035, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Retinal Determination genes function along with cell-cell signals to regulate Drosophila eye development: examples of multi-layered regulation by Master Regulators

PubMed Central

Baker, Nicholas E.; Firth, Lucy C.

2015-01-01

It is thought that Retinal Determination gene products define the response made to cell-cell signals within the eye developmental field by binding to enhancers of genes that are also regulated by cell-cell signaling pathways. In Drosophila, Retinal Determination genes including Eyeless, teashirt, eyes absent, dachsous and sine oculis, are required for normal eye development and can induce ectopic eyes when mis-expressed. Characterization of the enhancers responsible for eye expression of the hedgehog, shaven, and atonal genes, as well as the dynamics of Retinal Determination gene expression themselves, now suggest a multilayered network whereby transcriptional regulation by either Retinal Determination genes or cell-cell signaling pathways can sometimes be indirect and mediated by other transcription factor intermediates. In this updated view of the interaction between extracellular information and cell intrinsic programs during development, regulation of individual genes might sometimes be several steps removed from either the Retinal Determination genes or cell-cell signaling pathways that nevertheless govern their expression. PMID:21607995

DNA methylation at differentially methylated regions of imprinted genes is resistant to developmental programming by maternal nutrition

PubMed Central

Ivanova, Elena; Chen, Jian-Hua; Segonds-Pichon, Anne; Ozanne, Susan E.; Kelsey, Gavin

2012-01-01

The nutritional environment in which the mammalian fetus or infant develop is recognized as influencing the risk of chronic diseases, such as type 2 diabetes and hypertension, in a phenomenon that has become known as developmental programming. The late onset of such diseases in response to earlier transient experiences has led to the suggestion that developmental programming may have an epigenetic component, because epigenetic marks such as DNA methylation or histone tail modifications could provide a persistent memory of earlier nutritional states. One class of genes that has been considered a potential target or mediator of programming events is imprinted genes, because these genes critically depend upon epigenetic modifications for correct expression and because many imprinted genes have roles in controlling fetal growth as well as neonatal and adult metabolism. In this study, we have used an established model of developmental programming—isocaloric protein restriction to female mice during gestation or lactation—to examine whether there are effects on expression and DNA methylation of imprinted genes in the offspring. We find that although expression of some imprinted genes in liver of offspring is robustly and sustainably changed, methylation of the differentially methylated regions (DMRs) that control their monoallelic expression remains largely unaltered. We conclude that deregulation of imprinting through a general effect on DMR methylation is unlikely to be a common factor in developmental programming. PMID:22968513

Nuclear Lamins

PubMed Central

Dechat, Thomas; Adam, Stephen A.; Taimen, Pekka; Shimi, Takeshi; Goldman, Robert D.

2010-01-01

The nuclear lamins are type V intermediate filament proteins that are critically important for the structural properties of the nucleus. In addition, they are involved in the regulation of numerous nuclear processes, including DNA replication, transcription and chromatin organization. The developmentally regulated expression of lamins suggests that they are involved in cellular differentiation. Their assembly dynamic properties throughout the cell cycle, particularly in mitosis, are influenced by posttranslational modifications. Lamins may regulate nuclear functions by direct interactions with chromatin and determining the spatial organization of chromosomes within the nuclear space. They may also regulate chromatin functions by interacting with factors that epigenetically modify the chromatin or directly regulate replication or transcription. PMID:20826548

Zygotic Genome Activation in Vertebrates.

PubMed

Jukam, David; Shariati, S Ali M; Skotheim, Jan M

2017-08-21

The first major developmental transition in vertebrate embryos is the maternal-to-zygotic transition (MZT) when maternal mRNAs are degraded and zygotic transcription begins. During the MZT, the embryo takes charge of gene expression to control cell differentiation and further development. This spectacular organismal transition requires nuclear reprogramming and the initiation of RNAPII at thousands of promoters. Zygotic genome activation (ZGA) is mechanistically coordinated with other embryonic events, including changes in the cell cycle, chromatin state, and nuclear-to-cytoplasmic component ratios. Here, we review progress in understanding vertebrate ZGA dynamics in frogs, fish, mice, and humans to explore differences and emphasize common features. Copyright © 2017 Elsevier Inc. All rights reserved.

Computational Modeling and Simulation of Developmental ...

EPA Pesticide Factsheets

Developmental and Reproductive Toxicity (DART) testing is important for assessing the potential consequences of drug and chemical exposure on human health and well-being. Complexity of pregnancy and the reproductive cycle makes DART testing challenging and costly for traditional (animal-based) methods. A compendium of in vitro data from ToxCast/Tox21 high-throughput screening (HTS) programs is available for predictive toxicology. ‘Predictive DART’ will require an integrative strategy that mobilizes HTS data into in silico models that capture the relevant embryology. This lecture addresses progress on EPA's 'virtual embryo'. The question of how tissues and organs are shaped during development is crucial for understanding (and predicting) human birth defects. While ToxCast HTS data may predict developmental toxicity with reasonable accuracy, mechanistic models are still necessary to capture the relevant biology. Subtle microscopic changes induced chemically may amplify to an adverse outcome but coarse changes may override lesion propagation in any complex adaptive system. Modeling system dynamics in a developing tissue is a multiscale problem that challenges our ability to predict toxicity from in vitro profiling data (ToxCast/Tox21). (DISCLAIMER: The views expressed in this presentation are those of the presenter and do not necessarily reflect the views or policies of the US EPA). This was an invited seminar presentation to the National Institute for Public H

The Developmental Course of Supportive Dyadic Coping in Couples

ERIC Educational Resources Information Center

Johnson, Matthew D.; Horne, Rebecca M.; Galovan, Adam M.

2016-01-01

Drawing from a relational developmental systems (RDS) perspective (Lerner, Agans, DeSouza, & Gasca, 2013) and data from 1,427 continuously partnered young adult and midlife mixed-sex couples over the first 5 years of the German Panel Analysis of Intimate Relationships and Family Dynamics (pairfam), this study examined the developmental course…

DNA methylation restricts lineage-specific functions of transcription factor Gata4 during embryonic stem cell differentiation.

PubMed

Oda, Masaaki; Kumaki, Yuichi; Shigeta, Masaki; Jakt, Lars Martin; Matsuoka, Chisa; Yamagiwa, Akiko; Niwa, Hitoshi; Okano, Masaki

2013-06-01

DNA methylation changes dynamically during development and is essential for embryogenesis in mammals. However, how DNA methylation affects developmental gene expression and cell differentiation remains elusive. During embryogenesis, many key transcription factors are used repeatedly, triggering different outcomes depending on the cell type and developmental stage. Here, we report that DNA methylation modulates transcription-factor output in the context of cell differentiation. Using a drug-inducible Gata4 system and a mouse embryonic stem (ES) cell model of mesoderm differentiation, we examined the cellular response to Gata4 in ES and mesoderm cells. The activation of Gata4 in ES cells is known to drive their differentiation to endoderm. We show that the differentiation of wild-type ES cells into mesoderm blocks their Gata4-induced endoderm differentiation, while mesoderm cells derived from ES cells that are deficient in the DNA methyltransferases Dnmt3a and Dnmt3b can retain their response to Gata4, allowing lineage conversion from mesoderm cells to endoderm. Transcriptome analysis of the cells' response to Gata4 over time revealed groups of endoderm and mesoderm developmental genes whose expression was induced by Gata4 only when DNA methylation was lost, suggesting that DNA methylation restricts the ability of these genes to respond to Gata4, rather than controlling their transcription per se. Gata4-binding-site profiles and DNA methylation analyses suggested that DNA methylation modulates the Gata4 response through diverse mechanisms. Our data indicate that epigenetic regulation by DNA methylation functions as a heritable safeguard to prevent transcription factors from activating inappropriate downstream genes, thereby contributing to the restriction of the differentiation potential of somatic cells.

The architecture and dynamics of developing mind: experiential structuralism as a frame for unifying cognitive developmental theories.

PubMed

Demetriou, A; Efklides, A; Platsidou, M

1993-01-01

This Monograph presents a theory of cognitive development. The theory argues that the mind develops across three fronts. The first refers to a general processing system that defines the general potentials of mind to develop cognitive strategies and skills. The second refers to a hypercognitive system that governs self-understanding and self-regulation. The third involves a set of specialized structural systems (SSSs) that are responsible for the representation and processing of different reality domains. There are specific forces that are responsible for this organization of mind. These are expressed in the Monograph in terms of a set of five organizational principles. The developmental course of the major systems is outlined. Developmental change is ascribed by the theory to the interaction between the various systems. Different types of development require different change mechanisms. Five studies are presented that provide empirical support for these postulates. Study 1 demonstrated the organizational power of principles and SSSs. Study 2 showed that the SSSs constrain the effect of learning. Study 3 established that the hypercognitive system does function as the interface between tasks and SSS-specific processes or between SSSs and general cognitive functions such as attention and memory. Study 4 investigated the relations between one of the components of the processing system, storage, and two different SSSs expressed via two different symbolic systems, namely, the numeric and the imaginal. Finally, Study 5 examined the interaction between the components of the processing system and the relations between each of these components and one SSS, namely, the quantitative-relational SSS. The theoretical implications of these studies with regard to general issues, such as the nature of representation, the causation of cognitive change, and individual differences in cognitive development, are discussed in the concluding chapter.

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

PubMed

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The developmental dynamics of behavioral growth processes in rodent egocentric and allocentric space.

PubMed

Golani, Ilan

2012-06-01

In this review I focus on how three methodological principles advocated by Philip Teitelbaum influenced my work to this day: that similar principles of organization should be looked for in ontogeny and recovery of function; that the order of emergence of behavioral components provides a view on the organization of that behavior; and that the components of behavior should be exhibited by the animal itself in relatively pure form. I start by showing how these principles influenced our common work on the developmental dynamics of rodent egocentric space, and then proceed to describe how these principles affected my work with Yoav Benjamini and others on the developmental dynamics of rodent allocentric space. We analyze issues traditionally addressed by physiological psychologists with methods borrowed from ethology, EW (Eshkol-Wachman) movement notation, dynamical systems and exploratory data analysis. Then we show how the natural origins of axes embodied by the behavior of the organism itself, are used by us as the origins of axes for the measurement of the developmental moment-by-moment dynamics of behavior. Using this methodology we expose similar principles of organization across situations, species and preparations, provide a developmental view on the organization of behavior, expose the natural components of behavior in relatively pure form, and reveal how low level primitives generate higher level constructs. Advances in tracking technology should allow us to study how movements in egocentric and allocentric spaces interlace. Tracking of multi-limb coordination, progress in online recording of neural activity in freely moving animals, and the unprecedented accumulation of genetically engineered mouse preparations makes the behavioral ground plan exposed in this review essential for a systematic study of the brain/behavior interface. Copyright © 2012 Elsevier B.V. All rights reserved.

Testing all six person-oriented principles in dynamic factor analysis.

PubMed

Molenaar, Peter C M

2010-05-01

All six person-oriented principles identified by Sterba and Bauer's Keynote Article can be tested by means of dynamic factor analysis in its current form. In particular, it is shown how complex interactions and interindividual differences/intraindividual change can be tested in this way. In addition, the necessity to use single-subject methods in the analysis of developmental processes is emphasized, and attention is drawn to the possibility to optimally treat developmental psychopathology by means of new computational techniques that can be integrated with dynamic factor analysis.

Developmental Thyroid Hormone Insufficiency Reduces Expression of Brain-Derived Neurotrophic Factor (BDNF) in Adults But Not in Neonates

EPA Science Inventory

Brain-derived neurotrophic factor (BDNF) is a neurotrophin critical for many developmental and physiological aspects of CNS function. Severe hypothyroidism in the early neonatal period results in developmental and cognitive impairments and reductions in mRNA and protein expressio...

Sexuality and Developmental Disability: Obstacles to Healthy Sexuality throughout the Lifespan

ERIC Educational Resources Information Center

Richards, Deborah; Miodrag, Nancy; Watson, Shelley L.

2006-01-01

This paper presents a lifespan perspective of sexuality issues for individuals with developmental disabilities. Individuals with developmental disabilities are human beings who have historically been denied the right to express their sexuality or engage in sexual relationships due to misconceptions or negative attitudes. Using a hypothetical case…

A Theoretical Approach to Understanding Population Dynamics with Seasonal Developmental Durations

NASA Astrophysics Data System (ADS)

Lou, Yijun; Zhao, Xiao-Qiang

2017-04-01

There is a growing body of biological investigations to understand impacts of seasonally changing environmental conditions on population dynamics in various research fields such as single population growth and disease transmission. On the other side, understanding the population dynamics subject to seasonally changing weather conditions plays a fundamental role in predicting the trends of population patterns and disease transmission risks under the scenarios of climate change. With the host-macroparasite interaction as a motivating example, we propose a synthesized approach for investigating the population dynamics subject to seasonal environmental variations from theoretical point of view, where the model development, basic reproduction ratio formulation and computation, and rigorous mathematical analysis are involved. The resultant model with periodic delay presents a novel term related to the rate of change of the developmental duration, bringing new challenges to dynamics analysis. By investigating a periodic semiflow on a suitably chosen phase space, the global dynamics of a threshold type is established: all solutions either go to zero when basic reproduction ratio is less than one, or stabilize at a positive periodic state when the reproduction ratio is greater than one. The synthesized approach developed here is applicable to broader contexts of investigating biological systems with seasonal developmental durations.

DNA-Binding Kinetics Determines the Mechanism of Noise-Induced Switching in Gene Networks

PubMed Central

Tse, Margaret J.; Chu, Brian K.; Roy, Mahua; Read, Elizabeth L.

2015-01-01

Gene regulatory networks are multistable dynamical systems in which attractor states represent cell phenotypes. Spontaneous, noise-induced transitions between these states are thought to underlie critical cellular processes, including cell developmental fate decisions, phenotypic plasticity in fluctuating environments, and carcinogenesis. As such, there is increasing interest in the development of theoretical and computational approaches that can shed light on the dynamics of these stochastic state transitions in multistable gene networks. We applied a numerical rare-event sampling algorithm to study transition paths of spontaneous noise-induced switching for a ubiquitous gene regulatory network motif, the bistable toggle switch, in which two mutually repressive genes compete for dominant expression. We find that the method can efficiently uncover detailed switching mechanisms that involve fluctuations both in occupancies of DNA regulatory sites and copy numbers of protein products. In addition, we show that the rate parameters governing binding and unbinding of regulatory proteins to DNA strongly influence the switching mechanism. In a regime of slow DNA-binding/unbinding kinetics, spontaneous switching occurs relatively frequently and is driven primarily by fluctuations in DNA-site occupancies. In contrast, in a regime of fast DNA-binding/unbinding kinetics, switching occurs rarely and is driven by fluctuations in levels of expressed protein. Our results demonstrate how spontaneous cell phenotype transitions involve collective behavior of both regulatory proteins and DNA. Computational approaches capable of simulating dynamics over many system variables are thus well suited to exploring dynamic mechanisms in gene networks. PMID:26488666

Using the preschool language scale, fourth edition to characterize language in preschoolers with autism spectrum disorders.

PubMed

Volden, Joanne; Smith, Isabel M; Szatmari, Peter; Bryson, Susan; Fombonne, Eric; Mirenda, Pat; Roberts, Wendy; Vaillancourt, Tracy; Waddell, Charlotte; Zwaigenbaum, Lonnie; Georgiades, Stelios; Duku, Eric; Thompson, Ann

2011-08-01

The Preschool Language Scale, Fourth Edition (PLS-4; Zimmerman, Steiner, & Pond, 2002) was used to examine syntactic and semantic language skills in preschool children with autism spectrum disorders (ASD) to determine its suitability for use with this population. We expected that PLS-4 performance would be better in more intellectually able children and that receptive skills would be relatively more impaired than expressive abilities, consistent with previous findings in the area of vocabulary. Our sample consisted of 294 newly diagnosed preschool children with ASD. Children were assessed via a battery of developmental measures, including the PLS-4. As expected, PLS-4 scores were higher in more intellectually able children with ASD, and overall, expressive communication was higher than auditory comprehension. However, this overall advantage was not stable across nonverbal developmental levels. Expressive skills were significantly better than receptive skills at the youngest developmental levels, whereas the converse applied in children with more advanced development. The PLS-4 can be used to obtain a general index of early syntax and semantic skill in young children with ASD. Longitudinal data will be necessary to determine how the developmental relationship between receptive and expressive language skills unfolds in children with ASD.

Conserved and divergent expression patterns of markers of axial development in the laboratory opossum, Monodelphis domestica.

PubMed

Yoshida, Michio; Kajikawa, Eriko; Yamamoto, Daisuke; Kurokawa, Daisuke; Yonemura, Shigenobu; Kobayashi, Kensaku; Kiyonari, Hiroshi; Aizawa, Shinichi

2016-12-01

Previous comparative studies suggest that the requirement for Nodal in epiblast and hypoblast development is unique to mammalians. Expression of anterior visceral endoderm (AVE) genes in the visceral endoderm and of their orthologs in the hypoblast may be unique to mammalians and avians, and is absent in the reptilian hypoblast. Axis formation in reptiles is signaled by the formation of the posterior marginal epiblast (PME), which expresses a series of primitive streak genes. To assess the phylogenetic origin of Nodal and AVE gene expression and axis formation in amniotes, we examined marker gene expression in gray short-tailed opossum, a metatherian. Nodal was expressed in neither epiblast nor hypoblast of opossum embryos. No AVE genes were expressed in the opossum hypoblast. Attainment of polarity in the embryonic disk was signaled by Nodal, Wnt3a, Fgf8, and Bra expression in the PME at 8.5 days post-coitus. Nodal expression in epiblast or hypoblast may be unique to eutherians. AVE gene expression in visceral endoderm and hypoblast may have been independently acquired in eutherian and avian lineages. PME formation appears to be the event that signals axis formation in reptilian and metatherian embryos, and thus may be an ancestral characteristic of basal amniotes. Developmental Dynamics 245:1176-1188, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain.

PubMed

Ye, Xin; Smallwood, Philip; Nathans, Jeremy

2011-01-01

The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here, we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (Ndp(AP)). In the CNS, Ndp(AP) expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of Ndp(AP) expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, Ndp(AP) expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. Copyright © 2010 Elsevier B.V. All rights reserved.

Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain

PubMed Central

Ye, Xin; Smallwood, Philip; Nathans, Jeremy

2011-01-01

The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (NdpAP). In the CNS, NdpAP expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of NdpAP expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, NdpAP expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. PMID:21055480

Commonly dysregulated genes in murine APL cells

PubMed Central

Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

2007-01-01

To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Developmental regulation of MURF ubiquitin ligases and autophagy proteins nbr1, p62/SQSTM1 and LC3 during cardiac myofibril assembly and turnover.

PubMed

Perera, Sue; Holt, Mark R; Mankoo, Baljinder S; Gautel, Mathias

2011-03-01

The striated muscle-specific tripartite motif (TRIM) proteins TRIM63/MURF1, TRIM55/MURF2 and TRIM54/MURF3 can function as ubiquitin E3 ligases in ubiquitin-mediated muscle protein turnover. Despite their well-characterised roles in muscle atrophy, the dynamics of MURF expression in the development and early postnatal adaptation of striated muscle is largely unknown. Here, we show that MURF2 is expressed at the very onset of mouse cardiac differentiation at embryonic day 8.5, and represents a sensitive marker for differentiating myocardium. During cardiac development, expression shifts from the 50 kDa to the 60 kDa A-isoform, which dominates postnatally. In contrast, MURF1 shows strong postnatal upregulation and MURF3 is not significantly expressed before birth. MURF2 expression parallels that of the autophagy-associated proteins LC3, p62/SQSTM1 and nbr1. SiRNA knockdown of MURF2 in neonatal rat cardiomyocytes disrupts posttranslational microtubule modification and myofibril assembly, and is only partly compensated by upregulation of MURF3 but not MURF1. Knockdown of both MURF2 and MURF3 severely disrupts the formation of ordered Z- and M-bands, likely by perturbed tubulin dynamics. These results suggest that ubiquitin-mediated protein turnover and MURF2 in particular play an unrecognised role in the earliest steps of heart muscle differentiation, and that partial complementation of MURF2 deficiency is afforded by MURF3. Copyright © 2010 Elsevier Inc. All rights reserved.

Impaired perception of facial emotion in developmental prosopagnosia.

PubMed

Biotti, Federica; Cook, Richard

2016-08-01

Developmental prosopagnosia (DP) is a neurodevelopmental condition characterised by difficulties recognising faces. Despite severe difficulties recognising facial identity, expression recognition is typically thought to be intact in DP; case studies have described individuals who are able to correctly label photographic displays of facial emotion, and no group differences have been reported. This pattern of deficits suggests a locus of impairment relatively late in the face processing stream, after the divergence of expression and identity analysis pathways. To date, however, there has been little attempt to investigate emotion recognition systematically in a large sample of developmental prosopagnosics using sensitive tests. In the present study, we describe three complementary experiments that examine emotion recognition in a sample of 17 developmental prosopagnosics. In Experiment 1, we investigated observers' ability to make binary classifications of whole-face expression stimuli drawn from morph continua. In Experiment 2, observers judged facial emotion using only the eye-region (the rest of the face was occluded). Analyses of both experiments revealed diminished ability to classify facial expressions in our sample of developmental prosopagnosics, relative to typical observers. Imprecise expression categorisation was particularly evident in those individuals exhibiting apperceptive profiles, associated with problems encoding facial shape accurately. Having split the sample of prosopagnosics into apperceptive and non-apperceptive subgroups, only the apperceptive prosopagnosics were impaired relative to typical observers. In our third experiment, we examined the ability of observers' to classify the emotion present within segments of vocal affect. Despite difficulties judging facial emotion, the prosopagnosics exhibited excellent recognition of vocal affect. Contrary to the prevailing view, our results suggest that many prosopagnosics do experience difficulties classifying expressions, particularly those with apperceptive profiles. These individuals may have difficulties forming view-invariant structural descriptions at an early stage in the face processing stream, before identity and expression pathways diverge. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effects of 2G on Gene Expression of Stress-Related Hormones in Rat Placenta

NASA Technical Reports Server (NTRS)

Benson, S.; Talyansky, Y.; Moyer, E. L.; Lowe, M.; Baer, L. A.; Ronca, A. E.

2017-01-01

Understanding the effects of spaceflight on mammalian reproductive and developmental physiology is important to future human space exploration and permanent settlement beyond Earth orbit. Fetal developmental programming, including modulation of the HPA axis, is thought to originate at the placental-uterine interface, where both transfer of maternal hormones to the fetus and synthesis of endogenous hormones occurs. In healthy rats, fetal corticosterone levels are kept significantly lower by 11BetaHSD-2, which inactivates corticosterone by conversion into cortisone. Placental tissues express endogenous HPA axis-associated hormones including corticotropin-releasing hormone (CRH), pre-opiomelanocortin (POMC), and vasopressin, which may contribute to fetal programming alongside maternal hormones. DNA methylase 3A, 11BetaHSD-2, and 11BetaHSD-1, which are involved in the regulation of maternal cortisol transfer and modulation of the HPA axis, are also expressed in placental tissues along with glucocorticoid receptor and may be affected by differential gravity exposure during pregnancy. Fetuses may respond differently to maternal glucocorticoid exposure during gestation through sexually dimorphic expression of corticosterone-modulating hormones. To elucidate effects of altered gravity on placental gene expression, here we present a ground-based analogue study involving continuous centrifugation to produce 2g hypergravity. We hypothesized that exposure to 2g would induce a decrease in 11BetaHSD-2 expression through the downregulation of DNA methylase 3a and GC receptor, along with concurrent upregulation in endogenous CRH, POMC, and vasopressin expression. Timed pregnant female rats were exposed to 2G from Gestational day 6 to Gestational day 20, and comparisons made with Stationary Control (SC) and Vivarium Control (VC) dams at 1G. Dams were euthanized and placentas harvested on G20. We homogenized placental tissues, extracted and purified RNA, synthesized cDNA, and quantified the expression levels of the genes of interest relative to the GAPDH housekeeping gene, using RT-qPCR and gene-specific cDNA probes. Elucidation of glucocorticoid transfer and synthesis in the placenta can provide new insights into the unique dynamics of mammalian development in microgravity and guide future multi-generational studies in space.

A biogenesis step upstream of Microprocessor controls miR-17~92 expression

PubMed Central

Du, Peng; Wang, Longfei; Sliz, Piotr; Gregory, Richard I.

2015-01-01

SUMMARY The precise control of miR-17~92 microRNA (miRNA) is essential for normal development and overexpression of certain miRNAs from this cluster is oncogenic. Here we find the relative expression of the six miRNAs processed from the primary (pri-miR-17~92) transcript is dynamically regulated during embryonic stem cell (ESC) differentiation. Pri-miR-17~92 is processed to a biogenesis intermediate, termed ‘progenitor-miRNA’ (pro-miRNA). Pro-miRNA is an efficient substrate for Microprocessor and is required to selectively license production of pre-miR-17, -18a, -19a, 20a, and -19b from this cluster. Two complementary cis-regulatory repression domains within pri-miR-17~92 are required for the blockade of miRNA processing through the formation of an autoinhibitory RNA conformation. The endonuclease CPSF3 (CPSF73), and the Spliceosome-associated ISY1 are responsible for pro-miRNA biogenesis and expression of all miRNAs within the cluster except miR-92. Thus, developmentally regulated pro-miRNA processing is key step controlling miRNA expression and explains the posttranscriptional control of miR-17~92 expression in development. PMID:26255770

Observing the cell in its native state: Imaging subcellular dynamics in multicellular organisms.

PubMed

Liu, Tsung-Li; Upadhyayula, Srigokul; Milkie, Daniel E; Singh, Ved; Wang, Kai; Swinburne, Ian A; Mosaliganti, Kishore R; Collins, Zach M; Hiscock, Tom W; Shea, Jamien; Kohrman, Abraham Q; Medwig, Taylor N; Dambournet, Daphne; Forster, Ryan; Cunniff, Brian; Ruan, Yuan; Yashiro, Hanako; Scholpp, Steffen; Meyerowitz, Elliot M; Hockemeyer, Dirk; Drubin, David G; Martin, Benjamin L; Matus, David Q; Koyama, Minoru; Megason, Sean G; Kirchhausen, Tom; Betzig, Eric

2018-04-20

True physiological imaging of subcellular dynamics requires studying cells within their parent organisms, where all the environmental cues that drive gene expression, and hence the phenotypes that we actually observe, are present. A complete understanding also requires volumetric imaging of the cell and its surroundings at high spatiotemporal resolution, without inducing undue stress on either. We combined lattice light-sheet microscopy with adaptive optics to achieve, across large multicellular volumes, noninvasive aberration-free imaging of subcellular processes, including endocytosis, organelle remodeling during mitosis, and the migration of axons, immune cells, and metastatic cancer cells in vivo. The technology reveals the phenotypic diversity within cells across different organisms and developmental stages and may offer insights into how cells harness their intrinsic variability to adapt to different physiological environments. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Sequential pattern formation governed by signaling gradients

NASA Astrophysics Data System (ADS)

Jörg, David J.; Oates, Andrew C.; Jülicher, Frank

2016-10-01

Rhythmic and sequential segmentation of the embryonic body plan is a vital developmental patterning process in all vertebrate species. However, a theoretical framework capturing the emergence of dynamic patterns of gene expression from the interplay of cell oscillations with tissue elongation and shortening and with signaling gradients, is still missing. Here we show that a set of coupled genetic oscillators in an elongating tissue that is regulated by diffusing and advected signaling molecules can account for segmentation as a self-organized patterning process. This system can form a finite number of segments and the dynamics of segmentation and the total number of segments formed depend strongly on kinetic parameters describing tissue elongation and signaling molecules. The model accounts for existing experimental perturbations to signaling gradients, and makes testable predictions about novel perturbations. The variety of different patterns formed in our model can account for the variability of segmentation between different animal species.

An introduction to using children's drawings as an assessment tool.

PubMed

Wilson, D; Ratekin, C

1990-03-01

This article is intended to familiarize the ambulatory care provider with possible uses of children's drawings as assessment tools. Drawings can be a useful adjunct in detecting perceptual-motor difficulties and developmental delay, and can provide clues to self-image and family dynamics. Piaget's theory of cognitive development provides a framework to evaluate the child's intellectual development as reflected in drawings. The developmental scales of Koppitz are presented as a practical screening tool. The Koppitz scales include both developmental norms and items that might indicate emotional problems. Observing the child's drawing of the family provides clues to family dynamics. Becoming highly skilled in the evaluation of children's drawings requires a familiarity with neurophysiology, education, psychology, and psychoanalytic and developmental theory, along with intuition and practice. This article presents an introduction to evaluating children's drawings.

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

Enhancer modularity and the evolution of new traits.

PubMed

Koshikawa, Shigeyuki

2015-01-01

Animals have modular cis-regulatory regions in their genomes, and expression of a single gene is often regulated by multiple enhancers residing in such a region. In the laboratory, and also in natural populations, loss of an enhancer can result in a loss of gene expression. Although only a few examples have been well characterized to date, some studies have suggested that an evolutionary gain of a new enhancer function can establish a new gene expression domain. Our recent study showed that Drosophila guttifera has more enhancers and additional expression domains of the wingless gene during the pupal stage, compared to D. melanogaster, and that these new features appear to have evolved in the ancestral lineage leading to D. guttifera. (1) Gain of a new expression domain of a developmental regulatory gene (toolkit gene), such as wingless, can cause co-option of the expression of its downstream genes to the new domain, resulting in duplication of a preexisting structure at this new body position. Recently, with the advancement of evo-devo studies, we have learned that the developmental regulatory systems are strikingly similar across various animal taxa, in spite of the great diversity of the animals' morphology. Even behind "new" traits, co-options of essential developmental genes from known systems are very common. We previously provided concrete evidence of gains of enhancer activities of a developmental regulatory gene underlying gains of new traits. (1) Broad occurrence of this scenario is testable and should be validated in the future.

Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

PubMed

Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

2009-04-01

Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.

PubMed

Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina

2015-10-01

The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.

Decoding the Long Noncoding RNA During Cardiac Maturation: A Roadmap for Functional Discovery.

PubMed

Touma, Marlin; Kang, Xuedong; Zhao, Yan; Cass, Ashley A; Gao, Fuying; Biniwale, Reshma; Coppola, Giovanni; Xiao, Xinshu; Reemtsen, Brian; Wang, Yibin

2016-10-01

Cardiac maturation during perinatal transition of heart is critical for functional adaptation to hemodynamic load and nutrient environment. Perturbation in this process has major implications in congenital heart defects. Transcriptome programming during perinatal stages is an important information but incomplete in current literature, particularly, the expression profiles of the long noncoding RNAs (lncRNAs) are not fully elucidated. From comprehensive analysis of transcriptomes derived from neonatal mouse heart left and right ventricles, a total of 45 167 unique transcripts were identified, including 21 916 known and 2033 novel lncRNAs. Among these lncRNAs, 196 exhibited significant dynamic regulation along maturation process. By implementing parallel weighted gene co-expression network analysis of mRNA and lncRNA data sets, several lncRNA modules coordinately expressed in a developmental manner similar to protein coding genes, while few lncRNAs revealed chamber-specific patterns. Out of 2262 lncRNAs located within 50 kb of protein coding genes, 5% significantly correlate with the expression of their neighboring genes. The impact of Ppp1r1b-lncRNA on the corresponding partner gene Tcap was validated in cultured myoblasts. This concordant regulation was also conserved in human infantile hearts. Furthermore, the Ppp1r1b-lncRNA/Tcap expression ratio was identified as a molecular signature that differentiated congenital heart defect phenotypes. The study provides the first high-resolution landscape on neonatal cardiac lncRNAs and reveals their potential interaction with mRNA transcriptome during cardiac maturation. Ppp1r1b-lncRNA was identified as a regulator of Tcap expression, with dynamic interaction in postnatal cardiac development and congenital heart defects. © 2016 American Heart Association, Inc.

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

Functional characterization of three MicroRNAs of the Asian Tiger Mosquito, Aedes albopictus

PubMed Central

2013-01-01

Background Temporal and stage specific expression of microRNAs (miRNAs) in embryos, larvae, pupae and adults of Aedes albopictus showed differential expression levels across the four developmental stages, indicating their potential regulatory roles in mosquito development. The functional characterization of these miRNAs was not known. Accordingly our study evaluated the functional characterization of three miRNAs, which are temporally up-regulated in the various developmental stages of Ae. albopictus mosquitoes. Methods miRNA mimics, inhibitors and negative controls were designed and their knock-in and knock-down efficiency were analyzed by qRT-PCR after transfecting the mosquito cell lines C6/36, and also by injecting in their specific developmental stages. The functional role of each individual miRNA was analyzed with various parameters of development such as, hatching rate and hatching time in embryos, eclosion rate in larvae, longevity and fecundity in the adult mosquitoes. Results The knock-in with the specifically designed miRNA mimics showed increased levels of expression of miRNA compared with their normal controls. We confirmed these findings using qRT-PCR, both by in vitro expression in C6/36 mosquito cell lines after transfection as well as in in vivo expression in developmental stages of mosquitoes by microinjection. The knock-down of expression with the corresponding inhibitors showed a considerable decrease in the expression levels of these miRNAs and obvious functional effects in Ae. albopictus development, detected by a decrease in the hatching rate of embryos and eclosion rate in larvae and a marked reduction in longevity and fecundity in adults. Conclusion This study carried out by knock-in and knock-down of specifically and temporally expressed miRNAs in Ae. albopictus by microinjection is a novel study to delineate the importance of the miRNA expression in regulating mosquito development. The knock-down and loss of function of endogenously expressed miRNAs by the miRNA inhibitors in specific developmental stages had considerable effects on development, but enhancement of their gain of function was not observed on knock-in of these specific miRNAs. Hence, our study indicates that an optimal level of endogenous expression of miRNA is indispensable for the normal development and maintenance of the vectorial population density and pathogen transmissibility of this mosquito vector. PMID:23924583

Cell Migration Analysis: A Low-Cost Laboratory Experiment for Cell and Developmental Biology Courses Using Keratocytes from Fish Scales

ERIC Educational Resources Information Center

Prieto, Daniel; Aparicio, Gonzalo; Sotelo-Silveira, Jose R.

2017-01-01

Cell and developmental processes are complex, and profoundly dependent on spatial relationships that change over time. Innovative educational or teaching strategies are always needed to foster deep comprehension of these processes and their dynamic features. However, laboratory exercises in cell and developmental biology at the undergraduate level…

Correlation of LNCR rasiRNAs Expression with Heterochromatin Formation during Development of the Holocentric Insect Spodoptera frugiperda

PubMed Central

Stanojcic, Slavica; Gimenez, Sylvie; Permal, Emmanuelle; Cousserans, François; Quesneville, Hadi; Fournier, Philippe; d'Alençon, Emmanuelle

2011-01-01

Repeat-associated small interfering RNAs (rasiRNAs) are derived from various genomic repetitive elements and ensure genomic stability by silencing endogenous transposable elements. Here we describe a novel subset of 46 rasiRNAs named LNCR rasiRNAs due to their homology with one long non-coding RNA (LNCR) of Spodoptera frugiperda. LNCR operates as the intermediate of an unclassified transposable element (TE-LNCR). TE-LNCR is a very invasive transposable element, present in high copy numbers in the S. frugiperda genome. LNCR rasiRNAs are single-stranded RNAs without a prominent nucleotide motif, which are organized in two distinct, strand-specific clusters. The expression of LNCR and LNCR rasiRNAs is developmentally regulated. Formation of heterochromatin in the genomic region where three copies of the TE-LNCR are embedded was followed by chromatin immunoprecipitation (ChIP) and we observed this chromatin undergo dynamic changes during development. In summary, increased LNCR expression in certain developmental stages is followed by the appearance of a variety of LNCR rasiRNAs which appears to correlate with subsequent accumulation of a heterochromatic histone mark and silencing of the genomic region with TE-LNCR. These results support the notion that a repeat-associated small interfering RNA pathway is linked to heterochromatin formation and/or maintenance during development to establish repression of the TE-LNCR transposable element. This study provides insights into the rasiRNA silencing pathway and its role in the formation of fluctuating heterochromatin during the development of one holocentric organism. PMID:21980354

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics.

PubMed

Sun, Kaiwen; Zheng, Yuyu; Zhu, Ziqiang

2017-11-20

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel protein-protein interaction pairs and monitoring protein interaction dynamics are of particular interest for revealing how plants respond to environmental factors and/or developmental signals. A plethora of approaches have been developed to examine protein-protein interactions, either in vitro or in vivo. Among them, the recently established luciferase complementation imaging (LCI) assay is the simplest and fastest method for demonstrating in vivo protein-protein interactions. In this assay, protein A or protein B is fused with the amino-terminal or carboxyl-terminal half of luciferase, respectively. When protein A interacts with protein B, the two halves of luciferase will be reconstituted to form a functional and active luciferase enzyme. Luciferase activity can be recorded with a luminometer or CCD-camera. Compared with other approaches, the LCI assay shows protein-protein interactions both qualitatively and quantitatively. Agrobacterium infiltration in Nicotiana benthamiana leaves is a widely used system for transient protein expression. With the combination of LCI and transient expression, these approaches show that the physical interaction between COP1 and SPA1 was gradually reduced after jasmonate treatment.

Children's Expression and Control of Emotion-Related Behavior: Developmental and Gender Influences on Children's and Parents' Perceptions.

ERIC Educational Resources Information Center

Dorr, Aimee; And Others

This study examined the developmental and gender influences on children's normative emotional expression and control. The study surveyed 307 pairs of middle-class European-American children who were 7, 11, and 15 years old, and one parent of each child. The results of the survey showed that children were closer to the norm in their expressive…

From the Infant's Smile to Mastery of Anxiety: The Developmental Role of Humor.

ERIC Educational Resources Information Center

Levine, Jacob

The smiles and laughter of an infant form the beginning of the developmental process of interpersonal interaction and socialization. The earliest smiles are automatic expressions of internal states, but soon infants' smiles are communications of pleasure. The developmental changes in smiling and laughing in early infancy reflect the rapidity with…

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

A 3-dimensional human embryonic stem cell (hESC)-derived model to detect developmental neurotoxicity of nanoparticles.

PubMed

Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne

2013-04-01

Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.

MOLECULAR AND MORPHOLOGICAL CHANGES IN ZEBRAFISH FOLLOWING TRANSIENT ETHANOL EXPOSURE DURING DEFINED DEVELOPMENTAL STAGES

PubMed Central

Zhang, Chengjin; Frazier, Jared M.; Chen, Hao; Liu, Yao; Lee, Ju-Ahng; Cole, Gregory J.

2014-01-01

Alcohol is a teratogen that has diverse effects on brain and craniofacial development, leading to a constellation of developmental disorders referred to as fetal alcohol spectrum disorder (FASD). The molecular basis of ethanol insult remains poorly understood, as does the relationship between molecular and behavioral changes as a consequence of prenatal ethanol exposure. Zebrafish embryos were exposed to a range of ethanol concentrations (0.5–5.0%) during defined developmental stages, and examined for morphological phenotypes characteristic of FASD. Embryos were also analyzed by in situ hybridization for changes in expression of defined cell markers for neural cell types that are sonic hedgehog-dependent. We show that transient binge-like ethanol exposures during defined developmental stages, such as early gastrulation and early neurulation, result in a range of phenotypes and changes in expression of Shh-dependent genes. The severity of fetal alcohol syndrome (FAS) morphological phenotypes, such as microphthalmia, depends on the embryonic stage and concentration of alcohol exposure, as does diminution of retinal Pax6a or forebrain and hindbrain GAD1 gene expression. We also show that changes in eye and brain morphology correlate with changes in Pax6a and GAD1 gene expression. Our results therefore show that transient binge-like ethanol exposures in zebrafish embryos produce the stereotypical morphological phenotypes of FAS, with the severity of phenotypes depending on the developmental stage and alcohol concentration of exposure. PMID:24929233

Developmental constraints shape the evolution of the nematode mid-developmental transition.

PubMed

Zalts, Harel; Yanai, Itai

2017-03-27

Evolutionary theory assumes that genetic variation is uniform and gradual in nature, yet morphological and gene expression studies have revealed that different life-stages exhibit distinct levels of cross-species conservation. In particular, a stage in mid-embryogenesis is highly conserved across species of the same phylum, suggesting that this stage is subject to developmental constraints, either by increased purifying selection or by a strong mutational bias. An alternative explanation, however, holds that the same 'hourglass' pattern of variation may result from increased positive selection at the earlier and later stages of development. To distinguish between these scenarios, we examined gene expression variation in a population of the nematode Caenorhabditis elegans using an experimental design that eliminated the influence of positive selection. By measuring gene expression for all genes throughout development in 20 strains, we found that variations were highly uneven throughout development, with a significant depletion during mid-embryogenesis. In particular, the family of homeodomain transcription factors, whose expression generally coincides with mid-embryogenesis, evolved under high constraint. Our data further show that genes responsible for the integration of germ layers during morphogenesis are the most constrained class of genes. Together, these results provide strong evidence for developmental constraints as the mechanism underlying the hourglass model of animal evolution. Understanding the pattern and mechanism of developmental constraints provides a framework to understand how evolutionary processes have interacted with embryogenesis and led to the diversity of animal life on Earth.

Pluripotency gene network dynamics: System views from parametric analysis.

PubMed

Akberdin, Ilya R; Omelyanchuk, Nadezda A; Fadeev, Stanislav I; Leskova, Natalya E; Oschepkova, Evgeniya A; Kazantsev, Fedor V; Matushkin, Yury G; Afonnikov, Dmitry A; Kolchanov, Nikolay A

2018-01-01

Multiple experimental data demonstrated that the core gene network orchestrating self-renewal and differentiation of mouse embryonic stem cells involves activity of Oct4, Sox2 and Nanog genes by means of a number of positive feedback loops among them. However, recent studies indicated that the architecture of the core gene network should also incorporate negative Nanog autoregulation and might not include positive feedbacks from Nanog to Oct4 and Sox2. Thorough parametric analysis of the mathematical model based on this revisited core regulatory circuit identified that there are substantial changes in model dynamics occurred depending on the strength of Oct4 and Sox2 activation and molecular complexity of Nanog autorepression. The analysis showed the existence of four dynamical domains with different numbers of stable and unstable steady states. We hypothesize that these domains can constitute the checkpoints in a developmental progression from naïve to primed pluripotency and vice versa. During this transition, parametric conditions exist, which generate an oscillatory behavior of the system explaining heterogeneity in expression of pluripotent and differentiation factors in serum ESC cultures. Eventually, simulations showed that addition of positive feedbacks from Nanog to Oct4 and Sox2 leads mainly to increase of the parametric space for the naïve ESC state, in which pluripotency factors are strongly expressed while differentiation ones are repressed.

Cell type-specific translational repression of Cyclin B during meiosis in males.

PubMed

Baker, Catherine Craig; Gim, Byung Soo; Fuller, Margaret T

2015-10-01

The unique cell cycle dynamics of meiosis are controlled by layers of regulation imposed on core mitotic cell cycle machinery components by the program of germ cell development. Although the mechanisms that regulate Cdk1/Cyclin B activity in meiosis in oocytes have been well studied, little is known about the trans-acting factors responsible for developmental control of these factors in male gametogenesis. During meiotic prophase in Drosophila males, transcript for the core cell cycle protein Cyclin B1 (CycB) is expressed in spermatocytes, but the protein does not accumulate in spermatocytes until just before the meiotic divisions. Here, we show that two interacting proteins, Rbp4 and Fest, expressed at the onset of spermatocyte differentiation under control of the developmental program of male gametogenesis, function to direct cell type- and stage-specific repression of translation of the core G2/M cell cycle component cycB during the specialized cell cycle of male meiosis. Binding of Fest to Rbp4 requires a 31-amino acid region within Rbp4. Rbp4 and Fest are required for translational repression of cycB in immature spermatocytes, with Rbp4 binding sequences in a cell type-specific shortened form of the cycB 3' UTR. Finally, we show that Fest is required for proper execution of meiosis I. © 2015. Published by The Company of Biologists Ltd.

Dynamics in the tomato root transcriptome on infection with the potato cyst nematode Globodera rostochiensis.

PubMed

Swiecicka, Magdalena; Filipecki, Marcin; Lont, Dieuwertje; Van Vliet, Joke; Qin, Ling; Goverse, Aska; Bakker, Jaap; Helder, Johannes

2009-07-01

Plant parasitic nematodes infect roots and trigger the formation of specialized feeding sites by substantial reprogramming of the developmental process of root cells. In this article, we describe the dynamic changes in the tomato root transcriptome during early interactions with the potato cyst nematode Globodera rostochiensis. Using amplified fragment length polymorphism-based mRNA fingerprinting (cDNA-AFLP), we monitored 17 600 transcript-derived fragments (TDFs) in infected and uninfected tomato roots, 1-14 days after inoculation with nematode larvae. Six hundred and twenty-four TDFs (3.5%) showed significant differential expression on nematode infection. We employed GenEST, a computer program which links gene expression profiles generated by cDNA-AFLP and databases of cDNA sequences, to identify 135 tomato sequences. These sequences were grouped into eight functional categories based on the presence of genes involved in hormone regulation, plant pathogen defence response, cell cycle and cytoskeleton regulation, cell wall modification, cellular signalling, transcriptional regulation, primary metabolism and allocation. The presence of unclassified genes was also taken into consideration. This article describes the responsiveness of numerous tomato genes hitherto uncharacterized during infection with endoparasitic cyst nematodes. The analysis of transcriptome profiles allowed the sequential order of expression to be dissected for many groups of genes and the genes to be connected with the biological processes involved in compatible interactions between the plant and nematode.

Sarcomeric Myosin Expression in the Tongue Body of Humans, Macaques and Rats

PubMed Central

Rahnert, Jill A.; Sokoloff, Alan J.; Burkholder, Thomas J.

2010-01-01

Expression of developmental and unconventional myosin heavy chain (MHC) isoforms in some adult head and neck muscles is thought to reflect specific contractile demands of muscle fibers active during kinematically complex movements. Mammalian tongue muscles are active during oromotor behaviors that encompass a wide range of tongue movement speeds and tongue shape changes (e.g. respiration, oral transport, swallowing, rejection), but the extent to which tongue muscles express developmental and unconventional MHC is not known. Quantitative PCR was used to determine the mRNA content of conventional MHC-beta, MHC-2a, MHC-2b and MHC-2x, the developmental isoforms embryonic MHC and neonatal MHC and the unconventional isoforms atrial/cardiac-α MHC (MHC-alpha), extraocular MHC, masseter MHC and slow tonic MHC in tongue body muscles of the rat, macaque and human. In all species, conventional MHC isoforms predominate. MHC-2b and MHC-2x account for 98% of total MHC mRNA in the rat. MHC-2a, MHC-2x and MHC-beta account for 94% of total MHC mRNA in humans and 96% of total MHC mRNA in macaque. With the exception of MHC-alpha in humans (5%), developmental and unconventional MHC mRNA represents less than 0.3% of total MHC mRNA. We conclude that in these species, there is limited expression of developmental and unconventional MHC and that diversity of tongue body muscle fiber contractile properties is achieved primarily by MHC-beta, MHC-2a, MHC-2x and MHC-2b. Whether expression of MHC-alpha mRNA in tongue is unique to humans or present in other hominoids awaits further investigation. PMID:19907142

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

PubMed

Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

2017-07-30

The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

PubMed

Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

2016-11-01

Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Analysis of preplate splitting and early cortical development illuminates the biology of neurological disease.

PubMed

Olson, Eric C

2014-01-01

The development of the layered cerebral cortex starts with a process called preplate splitting. Preplate splitting involves the establishment of prospective cortical layer 6 (L6) neurons within a plexus of pioneer neurons called the preplate. The forming layer 6 splits the preplate into a superficial layer of pioneer neurons called the marginal zone and a deeper layer of pioneer neurons called the subplate. Disruptions of this early developmental event by toxin exposure or mutation are associated with neurological disease including severe intellectual disability. This review explores recent findings that reveal the dynamism of gene expression and morphological differentiation during this early developmental period. Over 1000 genes show expression increases of ≥2-fold during this period in differentiating mouse L6 neurons. Surprisingly, 88% of previously identified non-syndromic intellectual-disability (NS-ID) genes are expressed at this time and show an average expression increase of 1.6-fold in these differentiating L6 neurons. This changing genetic program must, in part, support the dramatic cellular reorganizations that occur during preplate splitting. While different models have been proposed for the formation of a layer of L6 cortical neurons within the preplate, original histological studies and more recent work exploiting transgenic mice suggest that the process is largely driven by the coordinated polarization and coalescence of L6 neurons rather than by cellular translocation or migration. The observation that genes associated with forms of NS-ID are expressed during very early cortical development raises the possibility of studying the relevant biological events at a time point when the cortex is small, contains relatively few cell types, and few functional circuits. This review then outlines how explant models may prove particularly useful in studying the consequence of toxin and mutation on the etiology of some forms of NS-ID.

Remodeling a tissue: subtraction adds insight.

PubMed

Axelrod, Jeffrey D

2012-11-27

Sculpting a body plan requires both patterning of gene expression and translating that pattern into morphogenesis. Developmental biologists have made remarkable strides in understanding gene expression patterning, but despite a long history of fascination with the mechanics of morphogenesis, knowledge of how patterned gene expression drives the emergence of even simple shapes and forms has grown at a slower pace. The successful merging of approaches from cell biology, developmental biology, imaging, engineering, and mathematical and computational sciences is now accelerating progress toward a fuller and better integrated understanding of the forces shaping morphogenesis.

Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids.

PubMed

Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

2015-08-13

Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.

Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization[OPEN

PubMed Central

Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Peng, Huiru; Sun, Qixin; Ni, Zhongfu

2018-01-01

Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid (Aegilops spp), tetraploid, and hexaploid wheat (Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. PMID:29298834

Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens

PubMed Central

Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

2016-01-01

The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism. PMID:27721443

Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens.

PubMed

Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

2016-10-10

The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism.

Daytime soybean transcriptome fluctuations during water deficit stress.

PubMed

Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Marcolino-Gomes, Juliana; Nakayama, Thiago Jonas; Molinari, Hugo Bruno Correa; Lobo, Francisco Pereira; Harmon, Frank G; Nepomuceno, Alexandre Lima

2015-07-07

Since drought can seriously affect plant growth and development and little is known about how the oscillations of gene expression during the drought stress-acclimation response in soybean is affected, we applied Illumina technology to sequence 36 cDNA libraries synthesized from control and drought-stressed soybean plants to verify the dynamic changes in gene expression during a 24-h time course. Cycling variables were measured from the expression data to determine the putative circadian rhythm regulation of gene expression. We identified 4866 genes differentially expressed in soybean plants in response to water deficit. Of these genes, 3715 were differentially expressed during the light period, from which approximately 9.55% were observed in both light and darkness. We found 887 genes that were either up- or down-regulated in different periods of the day. Of 54,175 predicted soybean genes, 35.52% exhibited expression oscillations in a 24 h period. This number increased to 39.23% when plants were submitted to water deficit. Major differences in gene expression were observed in the control plants from late day (ZT16) until predawn (ZT20) periods, indicating that gene expression oscillates during the course of 24 h in normal development. Under water deficit, dissimilarity increased in all time-periods, indicating that the applied stress influenced gene expression. Such differences in plants under stress were primarily observed in ZT0 (early morning) to ZT8 (late day) and also from ZT4 to ZT12. Stress-related pathways were triggered in response to water deficit primarily during midday, when more genes were up-regulated compared to early morning. Additionally, genes known to be involved in secondary metabolism and hormone signaling were also expressed in the dark period. Gene expression networks can be dynamically shaped to acclimate plant metabolism under environmental stressful conditions. We have identified putative cycling genes that are expressed in soybean leaves under normal developmental conditions and genes whose expression oscillates under conditions of water deficit. These results suggest that time of day, as well as light and temperature oscillations that occur considerably affect the regulation of water deficit stress response in soybean plants.

Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

PubMed

Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

2012-02-01

MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

Decoding the Regulatory Network for Blood Development from Single-Cell Gene Expression Measurements

PubMed Central

Haghverdi, Laleh; Lilly, Andrew J.; Tanaka, Yosuke; Wilkinson, Adam C.; Buettner, Florian; Macaulay, Iain C.; Jawaid, Wajid; Diamanti, Evangelia; Nishikawa, Shin-Ichi; Piterman, Nir; Kouskoff, Valerie; Theis, Fabian J.; Fisher, Jasmin; Göttgens, Berthold

2015-01-01

Here we report the use of diffusion maps and network synthesis from state transition graphs to better understand developmental pathways from single cell gene expression profiling. We map the progression of mesoderm towards blood in the mouse by single-cell expression analysis of 3,934 cells, capturing cells with blood-forming potential at four sequential developmental stages. By adapting the diffusion plot methodology for dimensionality reduction to single-cell data, we reconstruct the developmental journey to blood at single-cell resolution. Using transitions between individual cellular states as input, we develop a single-cell network synthesis toolkit to generate a computationally executable transcriptional regulatory network model that recapitulates blood development. Model predictions were validated by showing that Sox7 inhibits primitive erythropoiesis, and that Sox and Hox factors control early expression of Erg. We therefore demonstrate that single-cell analysis of a developing organ coupled with computational approaches can reveal the transcriptional programs that control organogenesis. PMID:25664528

The moderating effects of intellectual development on core symptoms of autism and PDD-NOS in toddlers and infants.

PubMed

Matson, Johnny L; Dempsey, Timothy; LoVullo, Santino V; Fodstad, Jill C; Knight, Cheryl; Sevin, Jay A; Sharp, Brenda

2013-01-01

Little research has been conducted on whether deficits in developmental functioning affect the range of core symptoms for autism spectrum disorders (ASD). This study represents a first attempt to determine whether developmental level has an effect on the expression of ASD symptoms in infants and toddlers. Eight hundred and fifty-three infants were evaluated with respect to the nature and extent of their ASD symptoms and developmental functioning. Young children with autism displayed a higher number of symptoms than those with PDD-NOS on all three domains of impairment (social, communication, repetitive behaviors). As expected, children without an ASD evinced far fewer symptoms than both these groups. Developmental level was not found to be a moderator for expression of ASD symptoms for the entire sample, or individual diagnostic groups. Higher developmental level was associated with lower severity of evinced ASD symptoms in the sample. Copyright © 2012 Elsevier Ltd. All rights reserved.

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

PubMed Central

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research

PubMed Central

Kockel, Lutz; Huq, Lutfi M.; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E. S.; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M.; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E.; Chisholm, Townley W.; Kim, Seung K.

2016-01-01

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. PMID:27527793

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research.

PubMed

Kockel, Lutz; Huq, Lutfi M; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E S; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E; Chisholm, Townley W; Kim, Seung K

2016-10-13

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. Copyright © 2016 Kockel et al.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

Effects of developmental variability on the dynamics and self-organization of cell populations

NASA Astrophysics Data System (ADS)

Prabhakara, Kaumudi H.; Gholami, Azam; Zykov, Vladimir S.; Bodenschatz, Eberhard

2017-11-01

We report experimental and theoretical results for spatiotemporal pattern formation in cell populations, where the parameters vary in space and time due to mechanisms intrinsic to the system, namely Dictyostelium discoideum (D.d.) in the starvation phase. We find that different patterns are formed when the populations are initialized at different developmental stages, or when populations at different initial developmental stages are mixed. The experimentally observed patterns can be understood with a modified Kessler-Levine model that takes into account the initial spatial heterogeneity of the cell populations and a developmental path introduced by us, i.e. the time dependence of the various biochemical parameters. The dynamics of the parameters agree with known biochemical studies. Most importantly, the modified model reproduces not only our results, but also the observations of an independent experiment published earlier. This shows that pattern formation can be used to understand and quantify the temporal evolution of the system parameters.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

PubMed

Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

2010-10-01

To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

Developmental toxicity in flounder embryos exposed to crude oils derived from different geographical regions.

PubMed

Jung, Jee-Hyun; Lee, Eun-Hee; Choi, Kwang-Min; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

2017-06-01

Crude oils from distinct geographical regions have distinct chemical compositions, and, as a result, their toxicity may be different. However, developmental toxicity of crude oils derived from different geographical regions has not been extensively characterized. In this study, flounder embryos were separately exposed to effluents contaminated by three crude oils including: Basrah Light (BLO), Pyrenees (PCO), and Sakhalin Vityaz (SVO), in addition to a processed fuel oil (MFO-380), to measure developmental toxicity and for gene expressions. Each oil possessed a distinct chemical composition. Edema defect was highest in embryos exposed to PCO and MFO-380 that both have a greater fraction of three-ring PAHs (33% and 22%, respectively) compared to BLO and SVO. Observed caudal fin defects were higher in embryos exposed to SVO and MFO-380, which are both dominated by naphthalenes (81% and 52%, respectively). CYP1A gene expressions were also highest in embryos exposed to SVO and MFO-380. Higher incidence of cardiotoxicity and lower nkx 2.5 expression were detected in embryos exposed to PCO. Unique gene expression profiles were observed in embryos exposed to crude oils with distinct compositions. This study demonstrates that crude oils of different geographical origins with different compositional characteristics induce developmental toxicity to different degrees. Copyright © 2017 Elsevier Inc. All rights reserved.

Regulation of Expressive Behavior as Reflecting Affect Socialization.

ERIC Educational Resources Information Center

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Phenoloxidase activity among developmental stages and pupal cell types of the ground beetle Carabus (Chaetocarabus) lefebvrei (Coleoptera, Carabidae).

PubMed

Giglio, Anita; Giulianini, Piero Giulio

2013-04-01

In ecological immunology is of great importance the study of the immune defense plasticity as response to a variable environment. In holometabolous insects the fitness of each developmental stage depends on the capacity to mount a response (i.e. physiological, behavioral) under environmental pressure. The immune response is a highly dynamic trait closely related to the ecology of organism and the variation in the expression of an immune system component may affect another fitness relevant trait of organism (i.e. growth, reproduction). The present research quantified immune function (total and differential number of hemocytes, phagocytosis in vivo and activity of phenoloxidase) in the pupal stage of Carabus (Chaetocarabus) lefebvrei. Moreover, the cellular and humoral immune function was compared across the larval, pupal and adult stages to evaluate the changes in immunocompetence across the developmental stages. Four types of circulating hemocytes were characterized via transmission electron microscopy in the pupal stage: prohemocytes, plasmatocytes, granulocytes and oenocytoids. The artificial non-self-challenge treatments performed in vivo have shown that plasmatocytes and granulocytes are responsible for phagocytosis. The level of active phenoloxidase increases with the degree of pigmentation of the cuticle in each stage. In C. lefebvrei, there are different strategies in term of immune response to enhance the fitness of each life stage. The results have shown that the variation in speed and specificity of immune function across the developmental stages is correlated with differences in infection risk, life expectancy and biological function of the life cycle. Copyright © 2013 Elsevier Ltd. All rights reserved.

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

PubMed Central

Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

2015-01-01

While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

Developmental profiles and mentality in preschool children with Prader-Willi syndrome: a preliminary study.

PubMed

Chen, Chien-Min; Chen, Chia-Ling; Hou, Jia-Woei; Hsu, Hung-Chih; Chung, Chia-Ying; Chou, Shih-Wei; Lin, Chu-Hsu; Chen, Kai-Hua

2010-01-01

A majority of the children with Prader-Willi syndrome (PWS) have global developmental delay and mental delay. The aim of this study was to investigate the developmental profiles and mental assessments among preschool children with PWS. Ten children with PWS between the ages of 15 months to 6 years, and 11 children with typical development were enrolled. Developmental profiles in terms of their developmental quotient (DQ) for the eight domains of the Chinese Children Developmental Inventory (CCDI) and mental assessments in terms of intelligence quotient (IQ) and developmental index (DI) were carried out for all children. The DQs of all eight domains, including gross motor, fine motor, expressive language, concept comprehension, situation comprehension, self help, personal- social and general development, in the PWS group were lower than the DQs of the children from the typical development group (p < 0.01). Children with PWS had better DQs in the fine motor domain than in the gross motor domain and in the receptive language domain than in the expressive language domain. Furthermore, their verbal IQ were better than their performance IQ and their mental DI was better than their psychomotor DI. These findings suggest that the children with PWS show an uneven global developmental delay together with an uneven mental delay. The results of this study should allow clinicians to better understand the developmental functioning of children with PWS and this will help with the planning of treatment strategies.

Children's Representations of Facial Expression and Identity: Identity-Contingent Expression Aftereffects

ERIC Educational Resources Information Center

Vida, Mark D.; Mondloch, Catherine J.

2009-01-01

This investigation used adaptation aftereffects to examine developmental changes in the perception of facial expressions. Previous studies have shown that adults' perceptions of ambiguous facial expressions are biased following adaptation to intense expressions. These expression aftereffects are strong when the adapting and probe expressions share…

Plant chromatin warms up in Madrid

PubMed Central

Jarillo, José A; Gaudin, Valerie; Hennig, Lars; Köhler, Claudia; Piñeiro, Manuel

2014-01-01

The 3rd European Workshop on Plant Chromatin (EWPC) was held on August 2013 in Madrid, Spain. A number of different topics on plant chromatin were presented during the meeting, including new factors mediating Polycomb Group protein function in plants, chromatin-mediated reprogramming in plant developmental transitions, the role of histone variants, and newly identified chromatin remodeling factors. The function of interactions between chromatin and transcription factors in the modulation of gene expression, the role of chromatin dynamics in the control of nuclear processes and the influence of environmental factors on chromatin organization were also reported. In this report, we highlight some of the new insights emerging in this growing area of research, presented at the 3rd EWPC. PMID:24504145

Microscopic Optical Projection Tomography In Vivo

PubMed Central

Meyer, Heiko; Ripoll, Jorge; Tavernarakis, Nektarios

2011-01-01

We describe a versatile optical projection tomography system for rapid three-dimensional imaging of microscopic specimens in vivo. Our tomographic setup eliminates the in xy and z strongly asymmetric resolution, resulting from optical sectioning in conventional confocal microscopy. It allows for robust, high resolution fluorescence as well as absorption imaging of live transparent invertebrate animals such as C. elegans. This system offers considerable advantages over currently available methods when imaging dynamic developmental processes and animal ageing; it permits monitoring of spatio-temporal gene expression and anatomical alterations with single-cell resolution, it utilizes both fluorescence and absorption as a source of contrast, and is easily adaptable for a range of small model organisms. PMID:21559481

Reframing Balint: thoughts on family medicine departmental Balint groups.

PubMed

Stein, Howard F

2003-04-01

This paper explores recurrent processes and themes in the 1,300 family medicine faculty, resident, intern, and community Balint groups the author has facilitated/led. The frequent group "deviation" from the central Balint task of understanding difficult physician-patient relationships is reframed as less "resistance" or "obstacle" to work, as it is an expression of unmet developmental needs and organizational realities. When group members are carefully attended to (by facilitator and one another), the group often becomes emotionally capable of addressing a "case " in the conventional Balint understanding of the work the group has assembled to do. The group dynamics of such "hybrid" Balint groups thus become comprehensible as other than error.

Genetic and Cellular Mechanisms Regulating Anterior Foregut and Esophageal Development

PubMed Central

Jacobs, Ian J.; Ku, Wei-Yao; Que, Jianwen

2012-01-01

Separation of the single anterior foregut tube into the esophagus and trachea involves cell proliferation and differentiation, as well as dynamic changes in cell-cell adhesion and migration. These biological processes are regulated and coordinated at multiple levels through the interplay of the epithelium and mesenchyme. Genetic studies and in vitro modeling have shed light on relevant regulatory networks that include a number of transcription factors and signaling pathways. These signaling molecules exhibit unique expression patterns and play specific functions in their respective territories before the separation process occurs. Disruption of regulatory networks inevitably leads to defective separation and malformation of the trachea and esophagus and results in the formation of a relatively common birth defect, esophageal atresia with or without tracheoesophageal fistula (EA/TEF). Significantly, some of the signaling pathways and transcription factors involved in anterior foregut separation continue to play important roles in the morphogenesis of the individual organs. In this review, we will focus on new findings related to these different developmental processes and discuss them in the context of developmental disorders (or birth defects) commonly seen in clinics. PMID:22750256

Role of PIN-mediated auxin efflux in apical hook development of Arabidopsis thaliana.

PubMed

Zádníková, Petra; Petrásek, Jan; Marhavy, Peter; Raz, Vered; Vandenbussche, Filip; Ding, Zhaojun; Schwarzerová, Katerina; Morita, Miyo T; Tasaka, Masao; Hejátko, Jan; Van Der Straeten, Dominique; Friml, Jirí; Benková, Eva

2010-02-01

The apical hook of dark-grown Arabidopsis seedlings is a simple structure that develops soon after germination to protect the meristem tissues during emergence through the soil and that opens upon exposure to light. Differential growth at the apical hook proceeds in three sequential steps that are regulated by multiple hormones, principally auxin and ethylene. We show that the progress of the apical hook through these developmental phases depends on the dynamic, asymmetric distribution of auxin, which is regulated by auxin efflux carriers of the PIN family. Several PIN proteins exhibited specific, partially overlapping spatial and temporal expression patterns, and their subcellular localization suggested auxin fluxes during hook development. Genetic manipulation of individual PIN activities interfered with different stages of hook development, implying that specific combinations of PIN genes are required for progress of the apical hook through the developmental phases. Furthermore, ethylene might modulate apical hook development by prolonging the formation phase and strongly suppressing the maintenance phase. This ethylene effect is in part mediated by regulation of PIN-dependent auxin efflux and auxin signaling.

A role for peroxisome proliferator-activated receptor γ coactivator-1 in the control of mitochondrial dynamics during postnatal cardiac growth.

PubMed

Martin, Ola J; Lai, Ling; Soundarapandian, Mangala M; Leone, Teresa C; Zorzano, Antonio; Keller, Mark P; Attie, Alan D; Muoio, Deborah M; Kelly, Daniel P

2014-02-14

Increasing evidence has shown that proper control of mitochondrial dynamics (fusion and fission) is required for high-capacity ATP production in the heart. Transcriptional coactivators, peroxisome proliferator-activated receptor γ coactivator-1 (PGC-1) α and PGC-1β, have been shown to regulate mitochondrial biogenesis in the heart at the time of birth. The function of PGC-1 coactivators in the heart after birth has been incompletely understood. Our aim was to assess the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts in mice. Conditional gene targeting was used in mice to explore the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts. Marked mitochondrial structural derangements were observed in hearts of PGC-1α/β-deficient mice during postnatal growth, including fragmentation and elongation, associated with the development of a lethal cardiomyopathy. The expression of genes involved in mitochondrial fusion (Mfn1, Opa1) and fission (Drp1, Fis1) was altered in the hearts of PGC-1α/β-deficient mice. PGC-lα was shown to directly regulate Mfn1 gene transcription by coactivating the estrogen-related receptor α on a conserved DNA element. Surprisingly, PGC-1α/β deficiency in the adult heart did not result in evidence of abnormal mitochondrial dynamics or heart failure. However, transcriptional profiling demonstrated that PGC-1 coactivators are required for high-level expression of nuclear- and mitochondrial-encoded genes involved in mitochondrial dynamics and energy transduction in the adult heart. These results reveal distinct developmental stage-specific programs involved in cardiac mitochondrial dynamics.

Gene expression as a sensitive endpoint to evaluate cell differentiation and maturation of the developing central nervous system in primary cultures of rat cerebellar granule cells (CGCs) exposed to pesticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogberg, Helena T.; Department of Physiology, Wenner-Gren Institute, Stockholm University; Kinsner-Ovaskainen, Agnieszka

The major advantage of primary neuronal cultures for developmental neurotoxicity (DNT) testing is their ability to replicate the crucial stages of neurodevelopment. In our studies using primary culture of cerebellar granule cells (CGCs) we have evaluated whether the gene expression relevant to the most critical developmental processes such as neuronal differentiation (NF-68 and NF-200) and functional maturation (NMDA and GABA{sub A} receptors), proliferation and differentiation of astrocytes (GFAP and S100{beta}) as well as the presence of neural precursor cells (nestin and Sox10) could be used as an endpoint for in vitro DNT. The expression of these genes was assessed aftermore » exposure to various pesticides (paraquat parathion, dichlorvos, pentachlorophenol and cycloheximide) that could induce developmental neurotoxicity through different mechanisms. All studied pesticides significantly modified the expression of selected genes, related to the different stages of neuronal and/or glial cell development and maturation. The most significant changes were observed after exposure to paraquat and parathion (i.e. down-regulation of mRNA expression of NF-68 and NF-200, NMDA and GABA{sub A} receptors). Similarly, dichlorvos affected mainly neurons (decreased mRNA expression of NF-68 and GABA{sub A} receptors) whereas cycloheximide had an effect on neurons and astrocytes, as significant decreases in the mRNA expression of both neurofilaments (NF-68 and NF-200) and the astrocyte marker (S100{beta}) were observed. Our results suggest that toxicity induced by pesticides that target multiple pathways of neurodevelopment can be identified by studying expression of genes that are involved in different stages of cell development and maturation, and that gene expression could be used as a sensitive endpoint for initial screening to identify the compounds with the potential to cause developmental neurotoxicity.« less

Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming

PubMed Central

Bromer, Jason G.; Wu, Jie; Zhou, Yuping; Taylor, Hugh S.

2009-01-01

Diethylstilbestrol (DES) is a nonsteroidal estrogen that induces developmental anomalies of the female reproductive tract. The homeobox gene HOXA10 controls uterine organogenesis, and its expression is altered after in utero DES exposure. We hypothesized that an epigenetic mechanism underlies DES-mediated alterations in HOXA10 expression. We analyzed the expression pattern and methylation profile of HOXA10 after DES exposure. Expression of HOXA10 is increased in human endometrial cells after DES exposure, whereas Hoxa10 expression is repressed and shifted caudally from its normal location in mice exposed in utero. Cytosine guanine dinucleotide methylation frequency in the Hoxa10 intron was higher in DES-exposed offspring compared with controls (P = 0.017). The methylation level of Hoxa10 was also higher in the caudal portion of the uterus after DES exposure at the promoter and intron (P < 0.01). These changes were accompanied by increased expression of DNA methyltransferases 1 and 3b. No changes in methylation were observed after in vitro or adult DES exposure. DES has a dual mechanism of action as an endocrine disruptor; DES functions as a classical estrogen and directly stimulates HOXA10 expression with short-term exposure, however, in utero exposure results in hypermethylation of the HOXA10 gene and long-term altered HOXA10 expression. We identify hypermethylation as a novel mechanism of DES-induced altered developmental programming. PMID:19299448

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Patterns of expression of position-dependent integrated transgenes in mouse embryo.

PubMed Central

Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

1990-01-01

The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

Developmentally sensitive markers of personality functioning in adolescents: Age-specific and age-neutral expressions.

PubMed

Debast, Inge; Rossi, Gina; Feenstra, Dineke; Hutsebaut, Joost

2017-04-01

Criterion D of the Diagnostic and Statistical Manual of Mental Disorders (5th ed.; DSM-5 ; American Psychiatric Association [APA], 2013) refers to a possible onset of personality disorders (PDs) in adolescence and in Section II the development/course in adolescence is described by some typical characteristics for several PDs. Yet, age-specific expressions of PDs are lacking in Section III. We urgently need a developmentally sensitive assessment instrument that differentiates developmental and contextual changes on the one hand from expressions of personality pathology on the other hand. Therefore we investigated which items of the Severity Indices for Personality Problems-118 (SIPP-118) were developmentally sensitive throughout adolescence and adulthood and which could be considered more age-specific markers requiring other content or thresholds over age groups. Applying item response theory (IRT) we detected differential item functioning (DIF) in 36% of the items in matched samples of 639 adolescents versus 639 adults. The DIF across age groups mainly reflected a different degree of symptom expressions for the same underlying level of functioning. The threshold for exhibiting symptoms given a certain degree of personality dysfunction was lower in adolescence for areas of personality functioning related to the Self and Interpersonal domains. Some items also measured a latent construct of personality functioning differently across adolescents and adults. This suggests that several facets of the SIPP-118 do not solely measure aspects of personality pathology in adolescents, but likely include more developmental issues. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

NASA Technical Reports Server (NTRS)

Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

2000-01-01

beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

Early Adversity and Developmental Outcomes: Interaction Between Genetics, Epigenetics, and Social Experiences Across the Life Span.

PubMed

Champagne, Frances A

2010-09-01

Longitudinal studies in humans demonstrate the association between prenatal and postnatal experiences of adversity and long-term changes in neurodevelopment. These studies raise the question of how experiences become incorporated at a biological level to induce persistent changes in functioning. Laboratory studies using animal models and recent analyses in human cohorts implicate epigenetic mechanisms as a possible route through which these environmental effects are achieved. In particular, there is evidence that changes in DNA methylation are associated with early life experiences with consequences for gene expression and behavior. Despite the potential stability of DNA methylation, it is apparent that this epigenetic mark can be dynamically modified through pharmacological targeting and behavioral experiences. Developmental plasticity may also be achieved through modification of the juvenile environment. Although these juvenile experiences may lead to common endpoints, there is evidence suggesting that the effects of early and later life experiences may be achieved by different molecular pathways. This review discusses evidence for the role of epigenetic mechanisms in shaping developmental trajectories in response to early life experience as well as the potential plasticity that can occur beyond the perinatal period. These studies have implications for approaches to intervention and suggest the importance of considering individual differences in genetic and epigenetic vulnerability in developing treatment strategies. © The Author(s) 2010.

The fetal programming of telomere biology hypothesis: an update.

PubMed

Entringer, Sonja; de Punder, Karin; Buss, Claudia; Wadhwa, Pathik D

2018-03-05

Research on mechanisms underlying fetal programming of health and disease risk has focused primarily on processes that are specific to cell types, organs or phenotypes of interest. However, the observation that developmental conditions concomitantly influence a diverse set of phenotypes, the majority of which are implicated in age-related disorders, raises the possibility that such developmental conditions may additionally exert effects via a common underlying mechanism that involves cellular/molecular ageing-related processes. In this context, we submit that telomere biology represents a process of particular interest in humans because, firstly, this system represents among the most salient antecedent cellular phenotypes for common age-related disorders; secondly, its initial (newborn) setting appears to be particularly important for its long-term effects; and thirdly, its initial setting appears to be plastic and under developmental regulation. We propose that the effects of suboptimal intrauterine conditions on the initial setting of telomere length and telomerase expression/activity capacity may be mediated by the programming actions of stress-related maternal-placental-fetal oxidative, immune, endocrine and metabolic pathways in a manner that may ultimately accelerate cellular dysfunction, ageing and disease susceptibility over the lifespan. This perspectives paper provides an overview of each of the elements underlying this hypothesis, with an emphasis on recent developments, findings and future directions.This article is part of the theme issue 'Understanding diversity in telomere dynamics'. © 2018 The Author(s).

Do convergent developmental mechanisms underlie convergent phenotypes?

NASA Technical Reports Server (NTRS)

Wray, Gregory A.

2002-01-01

Convergence is a pervasive evolutionary process, affecting many aspects of phenotype and even genotype. Relatively little is known about convergence in developmental processes, however, nor about the degree to which convergence in development underlies convergence in anatomy. A switch in the ecology of sea urchins from feeding to nonfeeding larvae illustrates how convergence in development can be associated with convergence in anatomy. Comparisons to more distantly related taxa, however, suggest that this association may be limited to relatively close phylogenetic comparisons. Similarities in gene expression during development provide another window into the association between convergence in developmental processes and convergence in anatomy. Several well-studied transcription factors exhibit likely cases of convergent gene expression in distantly related animal phyla. Convergence in regulatory gene expression domains is probably more common than generally acknowledged, and can arise for several different reasons. Copyright 2002 S. Karger AG, Basel.

Gene Circuit Analysis of the Terminal Gap Gene huckebein

PubMed Central

Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

2009-01-01

The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

Gene circuit analysis of the terminal gap gene huckebein.

PubMed

Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

2009-10-01

The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network.

Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann–Mangold organizer

PubMed Central

Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

2012-01-01

How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann–Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer. PMID:22492356

Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann-Mangold organizer.

PubMed

Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

2012-05-01

How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann-Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer.

Molecular cloning, developmental expression, and cellular localization of the 70-kDa RPA-1 subunit of Drosophila melanogaster.

PubMed

Perdigão, J; Logarinho, E; Avides, M C; Sunkel, C E

1999-12-01

Replication protein A (RPA) is a highly conserved multifunctional heterotrimeric complex, involved in DNA replication, repair, recombination, and possibly transcription. Here, we report the cloning of the gene that codes for the largest subunit of the Drosophila melanogaster RPA homolog, dmRPA70. In situ hybridization showed that dmRPA70 RNA is present in developing embryos during the first 16 cycles. After this point, dm-RPA70 expression is downregulated in cells that enter a G1 phase and exit the mitotic cycle, becoming restricted to brief bursts of accumulation from late G1 to S phase. This pattern of regulated expression is also observed in the developing eye imaginal disc. In addition, we have shown that the presence of cyclin E is necessary and sufficient to drive the expression of dmRPA70 in embryonic cells arrested in G1 but is not required in tissues undergoing endoreduplication. Immunolocalization showed that in early developing embryos, the dmRPA70 protein associates with chromatin from the end of mitosis until the beginning of the next prophase in a dynamic speckled pattern that is strongly suggestive of its association with replication foci.

Expression profiling of cassava storage roots reveals an active process of glycolysis/gluconeogenesis.

PubMed

Yang, Jun; An, Dong; Zhang, Peng

2011-03-01

Mechanisms related to the development of cassava storage roots and starch accumulation remain largely unknown. To evaluate genome-wide expression patterns during tuberization, a 60 mer oligonucleotide microarray representing 20 840 cassava genes was designed to identify differentially expressed transcripts in fibrous roots, developing storage roots and mature storage roots. Using a random variance model and the traditional twofold change method for statistical analysis, 912 and 3 386 upregulated and downregulated genes related to the three developmental phases were identified. Among 25 significantly changed pathways identified, glycolysis/gluconeogenesis was the most evident one. Rate-limiting enzymes were identified from each individual pathway, for example, enolase, L-lactate dehydrogenase and aldehyde dehydrogenase for glycolysis/gluconeogenesis, and ADP-glucose pyrophosphorylase, starch branching enzyme and glucan phosphorylase for sucrose and starch metabolism. This study revealed that dynamic changes in at least 16% of the total transcripts, including transcription factors, oxidoreductases/transferases/hydrolases, hormone-related genes, and effectors of homeostasis. The reliability of these differentially expressed genes was verified by quantitative real-time reverse transcription-polymerase chain reaction. These studies should facilitate our understanding of the storage root formation and cassava improvement. © 2011 Institute of Botany, Chinese Academy of Sciences.

The Spatial and Temporal Transcriptomic Landscapes of Ginseng, Panax ginseng C. A. Meyer.

PubMed

Wang, Kangyu; Jiang, Shicui; Sun, Chunyu; Lin, Yanping; Yin, Rui; Wang, Yi; Zhang, Meiping

2015-12-11

Ginseng, including Asian ginseng (Panax ginseng C. A. Meyer) and American ginseng (P. quinquefolius L.), is one of the most important medicinal herbs in Asia and North America, but significantly understudied. This study sequenced and characterized the transcriptomes and expression profiles of genes expressed in 14 tissues and four different aged roots of Asian ginseng. A total of 265.2 million 100-bp clean reads were generated using the high-throughput sequencing platform HiSeq 2000, representing >8.3x of the 3.2-Gb ginseng genome. From the sequences, 248,993 unigenes were assembled for whole plant, 61,912-113,456 unigenes for each tissue and 54,444-65,412 unigenes for different year-old roots. We comprehensively analyzed the unigene sets and gene expression profiles. We found that the number of genes allocated to each functional category is stable across tissues or developmental stages, while the expression profiles of different genes of a gene family or involved in ginsenoside biosynthesis dramatically diversified spatially and temporally. These results provide an overall insight into the spatial and temporal transcriptome dynamics and landscapes of Asian ginseng, and comprehensive resources for advanced research and breeding of ginseng and related species.

Tuning the chemosensory window

PubMed Central

Zhou, Shanshan; Mackay, Trudy FC

2010-01-01

Accurate perception of chemical signals from the environment is critical for the fitness of most animals. Drosophila melanogaster experiences its chemical environment through families of chemoreceptors that include olfactory receptors, gustatory receptors and odorant binding proteins. Its chemical environment, however, changes during its life cycle and the interpretation of chemical signals is dependent on dynamic social and physical surroundings. Phenotypic plasticity of gene expression of the chemoreceptor repertoire allows flies to adjust the chemosensory window through which they “view” their world and to modify the ensemble of expressed chemoreceptor proteins in line with their developmental and physiological state and according to their needs to locate food and oviposition sites under different social and physical environmental conditions. Furthermore, males and females differ in their expression profiles of chemoreceptor genes. Thus, each sex experiences its chemical environment via combinatorial activation of distinct chemoreceptor ensembles. The remarkable phenotypic plasticity of the chemoreceptor repertoire raises several fundamental questions. What are the mechanisms that translate environmental cues into regulation of chemoreceptor gene expression? How are gustatory and olfactory cues integrated perceptually? What is the relationship between ensembles of odorant binding proteins and odorant receptors? And, what is the significance of co-regulated chemoreceptor transcriptional networks? PMID:20305396

The Effects of a Developmental, Social-Pragmatic Language Intervention on Rate of Expressive Language Production in Young Children with Autistic Spectrum Disorders

ERIC Educational Resources Information Center

Ingersoll, Brooke; Dvortcsak, Anna; Whalen, Christina; Sikora, Darryn

2005-01-01

Developmental, social-pragmatic (DSP) interventions are based on the study of interactions between typically developing infants and their mothers. Despite the fact that DSP approaches are firmly grounded in developmental theory, there is limited research on the efficacy of these interventions for promoting social-communicative behavior in young…

Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport

PubMed Central

Sanders, Anna A. W. M.; Li, Chunmei; Kennedy, Julie; Cai, Jerry; Scheidel, Noemie; Kennedy, Breandán N.; Morin, Ryan D.; Leroux, Michel R.; Blacque, Oliver E.

2016-01-01

Primary cilia are specialised sensory and developmental signalling devices extending from the surface of most eukaryotic cells. Defects in these organelles cause inherited human disorders (ciliopathies) such as retinitis pigmentosa and Bardet-Biedl syndrome (BBS), frequently affecting many physiological and developmental processes across multiple organs. Cilium formation, maintenance and function depend on intracellular transport systems such as intraflagellar transport (IFT), which is driven by kinesin-2 and IFT-dynein motors and regulated by the Bardet-Biedl syndrome (BBS) cargo-adaptor protein complex, or BBSome. To identify new cilium-associated genes, we employed the nematode C. elegans, where ciliogenesis occurs within a short timespan during late embryogenesis when most sensory neurons differentiate. Using whole-organism RNA-Seq libraries, we discovered a signature expression profile highly enriched for transcripts of known ciliary proteins, including FAM-161 (FAM161A orthologue), CCDC-104 (CCDC104), and RPI-1 (RP1/RP1L1), which we confirm are cilium-localised in worms. From a list of 185 candidate ciliary genes, we uncover orthologues of human MAP9, YAP, CCDC149, and RAB28 as conserved cilium-associated components. Further analyses of C. elegans RAB-28, recently associated with autosomal-recessive cone-rod dystrophy, reveal that this small GTPase is exclusively expressed in ciliated neurons where it dynamically associates with IFT trains. Whereas inactive GDP-bound RAB-28 displays no IFT movement and diffuse localisation, GTP-bound (activated) RAB-28 concentrates at the periciliary membrane in a BBSome-dependent manner and undergoes bidirectional IFT. Functional analyses reveal that whilst cilium structure, sensory function and IFT are seemingly normal in a rab-28 null allele, overexpression of predicted GDP or GTP locked variants of RAB-28 perturbs cilium and sensory pore morphogenesis and function. Collectively, our findings present a new approach for identifying ciliary proteins, and unveil RAB28, a GTPase most closely related to the BBS protein RABL4/IFT27, as an IFT-associated cargo with BBSome-dependent cell autonomous and non-autonomous functions at the ciliary base. PMID:27930654

Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.

PubMed

Jensen, Victor L; Carter, Stephen; Sanders, Anna A W M; Li, Chunmei; Kennedy, Julie; Timbers, Tiffany A; Cai, Jerry; Scheidel, Noemie; Kennedy, Breandán N; Morin, Ryan D; Leroux, Michel R; Blacque, Oliver E

2016-12-01

Primary cilia are specialised sensory and developmental signalling devices extending from the surface of most eukaryotic cells. Defects in these organelles cause inherited human disorders (ciliopathies) such as retinitis pigmentosa and Bardet-Biedl syndrome (BBS), frequently affecting many physiological and developmental processes across multiple organs. Cilium formation, maintenance and function depend on intracellular transport systems such as intraflagellar transport (IFT), which is driven by kinesin-2 and IFT-dynein motors and regulated by the Bardet-Biedl syndrome (BBS) cargo-adaptor protein complex, or BBSome. To identify new cilium-associated genes, we employed the nematode C. elegans, where ciliogenesis occurs within a short timespan during late embryogenesis when most sensory neurons differentiate. Using whole-organism RNA-Seq libraries, we discovered a signature expression profile highly enriched for transcripts of known ciliary proteins, including FAM-161 (FAM161A orthologue), CCDC-104 (CCDC104), and RPI-1 (RP1/RP1L1), which we confirm are cilium-localised in worms. From a list of 185 candidate ciliary genes, we uncover orthologues of human MAP9, YAP, CCDC149, and RAB28 as conserved cilium-associated components. Further analyses of C. elegans RAB-28, recently associated with autosomal-recessive cone-rod dystrophy, reveal that this small GTPase is exclusively expressed in ciliated neurons where it dynamically associates with IFT trains. Whereas inactive GDP-bound RAB-28 displays no IFT movement and diffuse localisation, GTP-bound (activated) RAB-28 concentrates at the periciliary membrane in a BBSome-dependent manner and undergoes bidirectional IFT. Functional analyses reveal that whilst cilium structure, sensory function and IFT are seemingly normal in a rab-28 null allele, overexpression of predicted GDP or GTP locked variants of RAB-28 perturbs cilium and sensory pore morphogenesis and function. Collectively, our findings present a new approach for identifying ciliary proteins, and unveil RAB28, a GTPase most closely related to the BBS protein RABL4/IFT27, as an IFT-associated cargo with BBSome-dependent cell autonomous and non-autonomous functions at the ciliary base.

Developmental expression of human hemoglobins mediated by maturation of their subunit interfaces

PubMed Central

Manning, Lois R; Popowicz, Anthony M; Padovan, Julio; Chait, Brian T; Russell, J Eric; Manning, James M

2010-01-01

Different types of human hemoglobins (Hbs) consisting of various combinations of the embryonic, fetal, and adult Hb subunits are present at certain times during development representing a major paradigm of developmental biology that is still not understood and one which we address here. We show that the subunit interfaces of these Hbs have increasing bonding strengths as demonstrated by their distinct distribution of tetramers, dimers, and monomers during gel filtration at very low-Hb concentration. This maturation is mediated by competition between subunits for more favorable partners with stronger subunit interactions. Thus, the protein products of gene expression can themselves have a role in the developmental process due to their intrinsic properties. PMID:20572018

Differentially Expressed microRNAs and Target Genes Associated with Plastic Internode Elongation in Alternanthera philoxeroides in Contrasting Hydrological Habitats

PubMed Central

Li, Gengyun; Deng, Ying; Geng, Yupeng; Zhou, Chengchuan; Wang, Yuguo; Zhang, Wenju; Song, Zhiping; Gao, Lexuan; Yang, Ji

2017-01-01

Phenotypic plasticity is crucial for plants to survive in changing environments. Discovering microRNAs, identifying their targets and further inferring microRNA functions in mediating plastic developmental responses to environmental changes have been a critical strategy for understanding the underlying molecular mechanisms of phenotypic plasticity. In this study, the dynamic expression patterns of microRNAs under contrasting hydrological habitats in the amphibious species Alternanthera philoxeroides were identified by time course expression profiling using high-throughput sequencing technology. A total of 128 known and 18 novel microRNAs were found to be differentially expressed under contrasting hydrological habitats. The microRNA:mRNA pairs potentially associated with plastic internode elongation were identified by integrative analysis of microRNA and mRNA expression profiles, and were validated by qRT-PCR and 5′ RLM-RACE. The results showed that both the universal microRNAs conserved across different plants and the unique microRNAs novelly identified in A. philoxeroides were involved in the responses to varied water regimes. The results also showed that most of the differentially expressed microRNAs were transiently up-/down-regulated at certain time points during the treatments. The fine-scale temporal changes in microRNA expression highlighted the importance of time-series sampling in identifying stress-responsive microRNAs and analyzing their role in stress response/tolerance. PMID:29259617

Reaction-diffusion pattern in shoot apical meristem of plants.

PubMed

Fujita, Hironori; Toyokura, Koichi; Okada, Kiyotaka; Kawaguchi, Masayoshi

2011-03-29

A fundamental question in developmental biology is how spatial patterns are self-organized from homogeneous structures. In 1952, Turing proposed the reaction-diffusion model in order to explain this issue. Experimental evidence of reaction-diffusion patterns in living organisms was first provided by the pigmentation pattern on the skin of fishes in 1995. However, whether or not this mechanism plays an essential role in developmental events of living organisms remains elusive. Here we show that a reaction-diffusion model can successfully explain the shoot apical meristem (SAM) development of plants. SAM of plants resides in the top of each shoot and consists of a central zone (CZ) and a surrounding peripheral zone (PZ). SAM contains stem cells and continuously produces new organs throughout the lifespan. Molecular genetic studies using Arabidopsis thaliana revealed that the formation and maintenance of the SAM are essentially regulated by the feedback interaction between WUSHCEL (WUS) and CLAVATA (CLV). We developed a mathematical model of the SAM based on a reaction-diffusion dynamics of the WUS-CLV interaction, incorporating cell division and the spatial restriction of the dynamics. Our model explains the various SAM patterns observed in plants, for example, homeostatic control of SAM size in the wild type, enlarged or fasciated SAM in clv mutants, and initiation of ectopic secondary meristems from an initial flattened SAM in wus mutant. In addition, the model is supported by comparing its prediction with the expression pattern of WUS in the wus mutant. Furthermore, the model can account for many experimental results including reorganization processes caused by the CZ ablation and by incision through the meristem center. We thus conclude that the reaction-diffusion dynamics is probably indispensable for the SAM development of plants.

Reaction-Diffusion Pattern in Shoot Apical Meristem of Plants

PubMed Central

Fujita, Hironori; Toyokura, Koichi; Okada, Kiyotaka; Kawaguchi, Masayoshi

2011-01-01

A fundamental question in developmental biology is how spatial patterns are self-organized from homogeneous structures. In 1952, Turing proposed the reaction-diffusion model in order to explain this issue. Experimental evidence of reaction-diffusion patterns in living organisms was first provided by the pigmentation pattern on the skin of fishes in 1995. However, whether or not this mechanism plays an essential role in developmental events of living organisms remains elusive. Here we show that a reaction-diffusion model can successfully explain the shoot apical meristem (SAM) development of plants. SAM of plants resides in the top of each shoot and consists of a central zone (CZ) and a surrounding peripheral zone (PZ). SAM contains stem cells and continuously produces new organs throughout the lifespan. Molecular genetic studies using Arabidopsis thaliana revealed that the formation and maintenance of the SAM are essentially regulated by the feedback interaction between WUSHCEL (WUS) and CLAVATA (CLV). We developed a mathematical model of the SAM based on a reaction-diffusion dynamics of the WUS-CLV interaction, incorporating cell division and the spatial restriction of the dynamics. Our model explains the various SAM patterns observed in plants, for example, homeostatic control of SAM size in the wild type, enlarged or fasciated SAM in clv mutants, and initiation of ectopic secondary meristems from an initial flattened SAM in wus mutant. In addition, the model is supported by comparing its prediction with the expression pattern of WUS in the wus mutant. Furthermore, the model can account for many experimental results including reorganization processes caused by the CZ ablation and by incision through the meristem center. We thus conclude that the reaction-diffusion dynamics is probably indispensable for the SAM development of plants. PMID:21479227

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Analyses of Ca2+ dynamics using a ubiquitin-10 promoter-driven Yellow Cameleon 3.6 indicator reveal reliable transgene expression and differences in cytoplasmic Ca2+ responses in Arabidopsis and rice (Oryza sativa) roots.

PubMed

Behera, Smrutisanjita; Wang, Nili; Zhang, Chunxia; Schmitz-Thom, Ina; Strohkamp, Sarah; Schültke, Stefanie; Hashimoto, Kenji; Xiong, Lizhong; Kudla, Jörg

2015-04-01

Ca(2+) signatures are central to developmental processes and adaptive responses in plants. However, high-resolution studies of Ca(2+) dynamics using genetically encoded Ca(2+) indicators (GECIs) such as Yellow Cameleon (YC) proteins have so far not been conducted in important model crops such as rice (Oryza sativa). We conducted a comparative study of 35S and ubiquitin-10 (UBQ10) promoter functionality in Arabidopsis thaliana and O. sativa plants expressing the Ca(2+) indicator Yellow Cameleon 3.6 (YC3.6) under control of the UBQ10 or 35S promoter. Ca(2+) signatures in roots of both species were analyzed during exposure to hyperpolarization/depolarization cycles or in response to application of the amino acid glutamate. We found a superior performance of the UBQ10 promoter with regard to expression pattern, levels and expression stabilities in both species. We observed remarkable differences between the two species in the spatiotemporal parameters of the observed Ca(2+) signatures. Rice appeared in general to respond with a lower maximal signal amplitude but greatly increased signal duration when compared with Arabidopsis. Our results identify important advantages to using the UBQ10 promoter in Arabidopsis and rice and in T-DNA mutant backgrounds. Moreover, the observed differences in Ca(2+) signaling in the two species underscore the need for comparative studies to achieve a comprehensive understanding of Ca(2+) signaling in plants. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Loss of RNA expression and allele-specific expression associated with congenital heart disease

PubMed Central

McKean, David M.; Homsy, Jason; Wakimoto, Hiroko; Patel, Neil; Gorham, Joshua; DePalma, Steven R.; Ware, James S.; Zaidi, Samir; Ma, Wenji; Patel, Nihir; Lifton, Richard P.; Chung, Wendy K.; Kim, Richard; Shen, Yufeng; Brueckner, Martina; Goldmuntz, Elizabeth; Sharp, Andrew J.; Seidman, Christine E.; Gelb, Bruce D.; Seidman, J. G.

2016-01-01

Congenital heart disease (CHD), a prevalent birth defect occurring in 1% of newborns, likely results from aberrant expression of cardiac developmental genes. Mutations in a variety of cardiac transcription factors, developmental signalling molecules and molecules that modify chromatin cause at least 20% of disease, but most CHD remains unexplained. We employ RNAseq analyses to assess allele-specific expression (ASE) and biallelic loss-of-expression (LOE) in 172 tissue samples from 144 surgically repaired CHD subjects. Here we show that only 5% of known imprinted genes with paternal allele silencing are monoallelic versus 56% with paternal allele expression—this cardiac-specific phenomenon seems unrelated to CHD. Further, compared with control subjects, CHD subjects have a significant burden of both LOE genes and ASE events associated with altered gene expression. These studies identify FGFBP2, LBH, RBFOX2, SGSM1 and ZBTB16 as candidate CHD genes because of significantly altered transcriptional expression. PMID:27670201

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

PubMed

Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

2006-01-01

In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

NASA Astrophysics Data System (ADS)

Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

2015-06-01

Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs.

Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

PubMed Central

Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

2015-01-01

Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs. PMID:26047353

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Spatially Restricted and Developmentally Dynamic Expression of Engrailed Genes in Multiple Cerebellar Cell Types

PubMed Central

Wilson, Sandra L.; Kalinovsky, Anna; Orvis, Grant D.

2011-01-01

The cerebellum is a highly organized structure partitioned into lobules along the anterior–posterior (A-P) axis and into striped molecular domains along the medial–lateral (M-L) axis. The Engrailed (En) homeobox genes are required for patterning the morphological and molecular domains along both axes, as well as for the establishment of the normal afferent topography required to generate a fully functional cerebellum. As a means to understand how the En genes regulate multiple levels of cerebellum construction, we characterized En1 and En2 expression around birth and at postnatal day (P)21 during the period when the cerebellum undergoes a remarkable transformation from a smooth ovoid structure to a highly foliated structure. We show that both En1 and En2 are expressed in many neuronal cell types in the cerebellum, and expression persists until at least P21. En1 and En2 expression, however, undergoes profound changes in their cellular and spatial distributions between embryonic stages and P21, and their expression domains become largely distinct. Comparison of the distribution of En-expressing Purkinje cells relative to early- and late-onset Purkinje cell M-L stripe proteins revealed that although En1- and En2-expressing Purkinje cell domains do not strictly align with those of ZEBRINII at P21, a clear pattern exists that is most evident at E17.5 by an inverse correlation between the level of En2 expression and PLCβ4 and EPHA4. PMID:21431469

The protein expression landscape of mitosis and meiosis in diploid budding yeast.

PubMed

Becker, Emmanuelle; Com, Emmanuelle; Lavigne, Régis; Guilleux, Marie-Hélène; Evrard, Bertrand; Pineau, Charles; Primig, Michael

2017-03-06

Saccharomyces cerevisiae is an established model organism for the molecular analysis of fundamental biological processes. The genomes of numerous strains have been sequenced, and the transcriptome and proteome ofmajor phases during the haploid and diploid yeast life cycle have been determined. However, much less is known about dynamic changes of the proteome when cells switch from mitotic growth to meiotic development. We report a quantitative protein profiling analysis of yeast cell division and differentiation based on mass spectrometry. Information about protein levels was integrated with strand-specific tiling array expression data. We identified a total of 2366 proteins in at least one condition, including 175 proteins showing a statistically significant>5-fold change across the sample set, and 136 proteins detectable in sporulating but not respiring cells. We correlate protein expression patterns with biological processes and molecular function by Gene Ontology term enrichment, chemoprofiling, transcription interference and the formation of double stranded RNAs by overlapping sense/antisense transcripts. Our work provides initial quantitative insight into protein expression in diploid respiring and differentiating yeast cells. Critically, it associates developmentally regulated induction of antisense long noncoding RNAs and double stranded RNAs with fluctuating protein concentrations during growth and development. This integrated genomics analysis helps better understand how the transcriptome and the proteome correlate in diploid yeast cells undergoing mitotic growth in the presence of acetate (respiration) versus meiotic differentiation (Meiosis I and II). The study (i) provides quantitative expression data for 2366 proteins and their cognate mRNAs in at least one sample, (ii) shows strongly fluctuating protein levels during growth and differentiation for 175 cases, and (iii) identifies 136 proteins absent in mitotic but present in meiotic yeast cells. We have integrated protein profiling data using mass spectrometry with tiling array RNA profiling data and information on double-stranded RNAs (dsRNAs) by overlapping sense/antisense transcripts from an RNA-Sequencing experiment. This work therefore provides quantitative insight into protein expression during cell division and development and associates changing protein levels with developmental stage specific induction of antisense transcripts and the formation of dsRNAs. Copyright © 2017 Elsevier B.V. All rights reserved.

Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

PubMed

Izard, Carroll E; Abe, Jo Ann A

2004-09-01

Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

Suppression of the endoplasmic reticulum calcium pump during zebrafish gastrulation affects left-right asymmetry of the heart and brain.

PubMed

Kreiling, Jill A; Balantac, Zaneta L; Crawford, Andrew R; Ren, Yuexin; Toure, Jamal; Zchut, Sigalit; Kochilas, Lazaros; Creton, Robbert

2008-01-01

Vertebrate embryos generate striking Ca(2+) patterns, which are unique regulators of dynamic developmental events. In the present study, we used zebrafish embryos as a model system to examine the developmental roles of Ca(2+) during gastrulation. We found that gastrula stage embryos maintain a distinct pattern of cytosolic Ca(2+) along the dorsal-ventral axis, with higher Ca(2+) concentrations in the ventral margin and lower Ca(2+) concentrations in the dorsal margin and dorsal forerunner cells. Suppression of the endoplasmic reticulum Ca(2+) pump with 0.5 microM thapsigargin elevates cytosolic Ca(2+) in all embryonic regions and induces a randomization of laterality in the heart and brain. Affected hearts, visualized in living embryos by a subtractive imaging technique, displayed either a reversal or loss of left-right asymmetry. Brain defects include a left-right reversal of pitx2 expression in the dorsal diencephalon and a left-right reversal of the prominent habenular nucleus in the brain. Embryos are sensitive to inhibition of the endoplasmic reticulum Ca(2+) pump during early and mid gastrulation and lose their sensitivity during late gastrulation and early segmentation. Suppression of the endoplasmic reticulum Ca(2+) pump during gastrulation inhibits expression of no tail (ntl) and left-right dynein related (lrdr) in the dorsal forerunner cells and affects development of Kupffer's vesicle, a ciliated organ that generates a counter-clockwise flow of fluid. Previous studies have shown that Ca(2+) plays a role in Kupffer's vesicle function, influencing ciliary motility and translating the vesicle's counter-clockwise flow into asymmetric patterns of gene expression. The present results suggest that Ca(2+) plays an additional role in the formation of Kupffer's vesicle.

Transcriptional programming during cell wall maturation in the expanding Arabidopsis stem.

PubMed

Hall, Hardy; Ellis, Brian

2013-01-25

Plant cell walls are complex dynamic structures that play a vital role in coordinating the directional growth of plant tissues. The rapid elongation of the inflorescence stem in the model plant Arabidopsis thaliana is accompanied by radical changes in cell wall structure and chemistry, but analysis of the underlying mechanisms and identification of the genes that are involved has been hampered by difficulties in accurately sampling discrete developmental states along the developing stem. By creating stem growth kinematic profiles for individual expanding Arabidopsis stems we have been able to harvest and pool developmentally-matched tissue samples, and to use these for comparative analysis of global transcript profiles at four distinct phases of stem growth: the period of elongation rate increase, the point of maximum growth rate, the point of stem growth cessation and the fully matured stem. The resulting profiles identify numerous genes whose expression is affected as the stem tissues pass through these defined growth transitions, including both novel loci and genes identified in earlier studies. Of particular note is the preponderance of highly active genes associated with secondary cell wall deposition in the region of stem growth cessation, and of genes associated with defence and stress responses in the fully mature stem. The use of growth kinematic profiling to create tissue samples that are accurately positioned along the expansion growth continuum of Arabidopsis inflorescence stems establishes a new standard for transcript profiling analyses of such tissues. The resulting expression profiles identify a substantial number of genes whose expression is correlated for the first time with rapid cell wall extension and subsequent fortification, and thus provide an important new resource for plant biologists interested in gene discovery related to plant biomass accumulation.

Postnatal development of GABAergic interneurons in the neocortical subplate of mice.

PubMed

Qu, G-J; Ma, J; Yu, Y-C; Fu, Y

2016-05-13

The subplate (SP) plays important roles in developmental and functional events in the neocortex, such as thalamocortical and corticofugal projection, cortical oscillation generation and corticocortical connectivity. Although accumulated evidence indicates that SP interneurons are crucial for SP function, the molecular composition of SP interneurons as well as their developmental profile and distribution remain largely unclear. In this study, we systematically investigated dynamic development of SP thickness and chemical marker expression in SP interneurons in distinct cortical regions during the first postnatal month. We found that, although the relative area of the SP in the cerebral cortex significantly declined with postnatal development, the absolute thickness did not change markedly. We also found that somatostatin (SOM), the ionotropic serotonin receptor 3A (5HT3AR), and parvalbumin (PV) reliably identify three distinct non-overlapping subpopulations of SP interneurons. The SOM group, which represents ~30% of total SP interneurons, expresses neuronal nitric oxide synthase (nNOS) and calbindin (CB) and colocalizes entirely with neuropeptide Y (NPY). The 5HT3AR group, which accounts for ~60% of the total interneuronal population, expresses calretinin (CR) and GABA-A receptor subunit delta (GABAARδ). The PV group accounts for ~10% of total SP interneurons and coexpressed GABAARδ. Moreover, distinct interneuron subtypes show characteristic temporal and spatial distribution in the SP. nNOS(+) interneurons in the SP increase from the anterior motor cortex to posterior visual cortex, while CR(+) and CB(+) interneurons the opposite. Interestedly, the majority of GABAARδ(+) neurons in SP are non-GABAergic neurons in contrast to other cortical layers. These findings clarify and extend our understanding of SP interneurons in the developing cerebral cortex and will underpin further study of SP function. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

MicroRNA Profiling as Tool for In Vitro Developmental Neurotoxicity Testing: The Case of Sodium Valproate

PubMed Central

Smirnova, Lena; Block, Katharina; Sittka, Alexandra; Oelgeschläger, Michael; Seiler, Andrea E. M.; Luch, Andreas

2014-01-01

Studying chemical disturbances during neural differentiation of murine embryonic stem cells (mESCs) has been established as an alternative in vitro testing approach for the identification of developmental neurotoxicants. miRNAs represent a class of small non-coding RNA molecules involved in the regulation of neural development and ESC differentiation and specification. Thus, neural differentiation of mESCs in vitro allows investigating the role of miRNAs in chemical-mediated developmental toxicity. We analyzed changes in miRNome and transcriptome during neural differentiation of mESCs exposed to the developmental neurotoxicant sodium valproate (VPA). A total of 110 miRNAs and 377 mRNAs were identified differently expressed in neurally differentiating mESCs upon VPA treatment. Based on miRNA profiling we observed that VPA shifts the lineage specification from neural to myogenic differentiation (upregulation of muscle-abundant miRNAs, mir-206, mir-133a and mir-10a, and downregulation of neural-specific mir-124a, mir-128 and mir-137). These findings were confirmed on the mRNA level and via immunochemistry. Particularly, the expression of myogenic regulatory factors (MRFs) as well as muscle-specific genes (Actc1, calponin, myosin light chain, asporin, decorin) were found elevated, while genes involved in neurogenesis (e.g. Otx1, 2, and Zic3, 4, 5) were repressed. These results were specific for valproate treatment and―based on the following two observations―most likely due to the inhibition of histone deacetylase (HDAC) activity: (i) we did not observe any induction of muscle-specific miRNAs in neurally differentiating mESCs exposed to the unrelated developmental neurotoxicant sodium arsenite; and (ii) the expression of muscle-abundant mir-206 and mir-10a was similarly increased in cells exposed to the structurally different HDAC inhibitor trichostatin A (TSA). Based on our results we conclude that miRNA expression profiling is a suitable molecular endpoint for developmental neurotoxicity. The observed lineage shift into myogenesis, where miRNAs may play an important role, could be one of the developmental neurotoxic mechanisms of VPA. PMID:24896083

Dysgraphia

MedlinePlus

Written expression disorder; Specific learning disorder with impairment in written expression ... can have dysgraphia only or along with other learning disabilities, such as: Developmental coordination disorder (includes poor handwriting) ...

RNA-Seq Reveals Dynamic Changes of Gene Expression in Key Stages of Intestine Regeneration in the Sea Cucumber Apostichopus japonicas

PubMed Central

Sun, Lina; Yang, Hongsheng; Chen, Muyan; Ma, Deyou; Lin, Chenggang

2013-01-01

Background Sea cucumbers (Holothuroidea; Echinodermata) have the capacity to regenerate lost tissues and organs. Although the histological and cytological aspects of intestine regeneration have been extensively studied, little is known of the genetic mechanisms involved. There has, however, been a renewed effort to develop a database of Expressed Sequence Tags (ESTs) in Apostichopus japonicus, an economically-important species that occurs in China. This is important for studies on genetic breeding, molecular markers and special physiological phenomena. We have also constructed a library of ESTs obtained from the regenerative body wall and intestine of A. japonicus. The database has increased to ∼30000 ESTs. Results We used RNA-Seq to determine gene expression profiles associated with intestinal regeneration in A. japonicus at 3, 7, 14 and 21 days post evisceration (dpe). This was compared to profiles obtained from a normally-functioning intestine. Approximately 5 million (M) reads were sequenced in every library. Over 2400 up-regulated genes (>10%) and over 1000 down-regulated genes (∼5%) were observed at 3 and 7dpe (log2Ratio≥1, FDR≤0.001). Specific “Go terms” revealed that the DEGs (Differentially Expressed Genes) performed an important function at every regeneration stage. Besides some expected pathways (for example, Ribosome and Spliceosome pathway term), the “Notch signaling pathway,” the “ECM-receptor interaction” and the “Cytokine-cytokine receptor interaction” were significantly enriched. We also investigated the expression profiles of developmental genes, ECM-associated genes and Cytoskeletal genes. Twenty of the most important differentially expressed genes (DEGs) were verified by Real-time PCR, which resulted in a trend concordance of almost 100% between the two techniques. Conclusion Our studies demonstrated dynamic changes in global gene expression during intestine regeneration and presented a series of candidate genes and enriched pathways that contribute to intestine regeneration in sea cucumbers. This provides a foundation for future studies on the genetics/molecular mechanisms associated with intestine regeneration. PMID:23936330

A Conserved Developmental Patterning Network Produces Quantitatively Different Output in Multiple Species of Drosophila

PubMed Central

Meyer, Miriah; Wunderlich, Zeba; Simirenko, Lisa; Luengo Hendriks, Cris L.; Keränen, Soile V. E.; Henriquez, Clara; Knowles, David W.; Biggin, Mark D.; Eisen, Michael B.; DePace, Angela H.

2011-01-01

Differences in the level, timing, or location of gene expression can contribute to alternative phenotypes at the molecular and organismal level. Understanding the origins of expression differences is complicated by the fact that organismal morphology and gene regulatory networks could potentially vary even between closely related species. To assess the scope of such changes, we used high-resolution imaging methods to measure mRNA expression in blastoderm embryos of Drosophila yakuba and Drosophila pseudoobscura and assembled these data into cellular resolution atlases, where expression levels for 13 genes in the segmentation network are averaged into species-specific, cellular resolution morphological frameworks. We demonstrate that the blastoderm embryos of these species differ in their morphology in terms of size, shape, and number of nuclei. We present an approach to compare cellular gene expression patterns between species, while accounting for varying embryo morphology, and apply it to our data and an equivalent dataset for Drosophila melanogaster. Our analysis reveals that all individual genes differ quantitatively in their spatio-temporal expression patterns between these species, primarily in terms of their relative position and dynamics. Despite many small quantitative differences, cellular gene expression profiles for the whole set of genes examined are largely similar. This suggests that cell types at this stage of development are conserved, though they can differ in their relative position by up to 3–4 cell widths and in their relative proportion between species by as much as 5-fold. Quantitative differences in the dynamics and relative level of a subset of genes between corresponding cell types may reflect altered regulatory functions between species. Our results emphasize that transcriptional networks can diverge over short evolutionary timescales and that even small changes can lead to distinct output in terms of the placement and number of equivalent cells. PMID:22046143

A developmental psychopathology perspective on adolescence.

PubMed

Cicchetti, Dante; Rogosch, Fred A

2002-02-01

Developmental psychopathology offers an integrative framework for conceptualizing the course of development during adolescence, with particular relevance for understanding continuity and the emergence of psychopathology during this and subsequent developmental periods. In this article, the utility of a developmental psychopathology perspective for informing the design of research, prevention, and intervention is highlighted. Interdisciplinary, organizational models of development, emphasizing the dynamic relations between the developing individual and internal and external contexts, are discussed. Examination of boundaries between abnormal and normal development during adolescence offers important vantage points for articulating diversity in the developmental course during this period. Conceptualizing divergence and convergence in developmental pathways, continuity and discontinuity in development, and the transactions of risk and protective processes leading to maladaptation, psychopathology, and resilience are highlighted.

GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice.

PubMed

Lew, D; Brady, H; Klausing, K; Yaginuma, K; Theill, L E; Stauber, C; Karin, M; Mellon, P L

1993-04-01

During pituitary development, the homeo domain protein GHF-1 is required for generation of somatotropes and lactotropes and for growth hormone (GH) and prolactin (PRL) gene expression. GHF-1 mRNA is detectable several days before the emergence of GH- or PRL-expressing cells, suggesting the existence of a somatotropic progenitor cell in which GHF-1 transcription is first activated. We have immortalized this cell type by using the GHF-1 regulatory region to target SV40 T-antigen (Tag) tumorigenesis in transgenic mice. The GHF-Tag transgene caused developmental entrapment of somatotropic progenitor cells that express GHF-1 but not GH or PRL, resulting in dwarfism. Immortalized cell lines derived from a transgenic pituitary tumor maintain the characteristics of the somato/lactotropic progenitor in that they express GHF-1 mRNA and protein yet fail to activate GH or PRL transcription. Using these cells, we identified an enhancer that activates GHF-1 transcription at this early stage of development yet is inactive in cells representing later developmental stages of the somatotropic lineage or in other cell types. These experiments not only demonstrate the potential for immortalization of developmental progenitor cells using the regulatory regions from cell type-specific transcription factor genes but illustrate the power of such model systems in the study of developmental control.

[An investigation of the imitation skills in children with autism spectrum disorder and their association with receptive-expressive language development].

PubMed

Turan, Figen; Ökçün Akçamuş, Meral Çilem

2013-01-01

This study aimed to compare imitation skills in children with autism spectrum disorder, and age-matched typically developing children and children with developmental delay, as well as to examine the association between imitation skills, and receptive and expressive language development in children with autism spectrum disorder. Imitation skills in children with autism spectrum disorder (n=18), and age-matched children with developmental delay (n=15) and typically developing children (n= 16) were assessed using the Motor Imitation Scale and Imitation Battery, and the differences in mean imitation scores between the groups were examined. Receptive language and expressive language development in the children with autism spectrum disorder were assessed using the Turkish Communicative Development Inventory (TCDI), and their association with imitation scores was explored. The children with autism spectrum disorder had significantly lower imitation scores than the children with developmental delay and typically developing children; however, there wasn't a significant difference in imitation scores between the children with developmental delay and typically developing children. A significant association between imitation scores, and receptive and expressive language development was observed in the children with autism spectrum disorder. The present findings indicate that deficient imitation skills are a distinctive feature of children with autism spectrum disorder and that imitation skills play a crucial role in children's language development.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

NASA Astrophysics Data System (ADS)

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-01

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

PubMed

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-17

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation

PubMed Central

Pazhamala, Lekha T.; Purohit, Shilp; Saxena, Rachit K.; Garg, Vanika; Krishnamurthy, L.; Verdier, Jerome

2017-01-01

Abstract Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose–proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. PMID:28338822

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Large-scale gene expression profiling data for the model moss Physcomitrella patens aid understanding of developmental progression, culture and stress conditions.

PubMed

Hiss, Manuel; Laule, Oliver; Meskauskiene, Rasa M; Arif, Muhammad A; Decker, Eva L; Erxleben, Anika; Frank, Wolfgang; Hanke, Sebastian T; Lang, Daniel; Martin, Anja; Neu, Christina; Reski, Ralf; Richardt, Sandra; Schallenberg-Rüdinger, Mareike; Szövényi, Peter; Tiko, Theodhor; Wiedemann, Gertrud; Wolf, Luise; Zimmermann, Philip; Rensing, Stefan A

2014-08-01

The moss Physcomitrella patens is an important model organism for studying plant evolution, development, physiology and biotechnology. Here we have generated microarray gene expression data covering the principal developmental stages, culture forms and some environmental/stress conditions. Example analyses of developmental stages and growth conditions as well as abiotic stress treatments demonstrate that (i) growth stage is dominant over culture conditions, (ii) liquid culture is not stressful for the plant, (iii) low pH might aid protoplastation by reduced expression of cell wall structure genes, (iv) largely the same gene pool mediates response to dehydration and rehydration, and (v) AP2/EREBP transcription factors play important roles in stress response reactions. With regard to the AP2 gene family, phylogenetic analysis and comparison with Arabidopsis thaliana shows commonalities as well as uniquely expressed family members under drought, light perturbations and protoplastation. Gene expression profiles for P. patens are available for the scientific community via the easy-to-use tool at https://www.genevestigator.com. By providing large-scale expression profiles, the usability of this model organism is further enhanced, for example by enabling selection of control genes for quantitative real-time PCR. Now, gene expression levels across a broad range of conditions can be accessed online for P. patens. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Developmental defects in zebrafish for classification of EGF pathway inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pruvot, Benoist; Curé, Yoann; Djiotsa, Joachim

2014-01-15

One of the major challenges when testing drug candidates targeted at a specific pathway in whole animals is the discrimination between specific effects and unwanted, off-target effects. Here we used the zebrafish to define several developmental defects caused by impairment of Egf signaling, a major pathway of interest in tumor biology. We inactivated Egf signaling by genetically blocking Egf expression or using specific inhibitors of the Egf receptor function. We show that the combined occurrence of defects in cartilage formation, disturbance of blood flow in the trunk and a decrease of myelin basic protein expression represent good indicators for impairmentmore » of Egf signaling. Finally, we present a classification of known tyrosine kinase inhibitors according to their specificity for the Egf pathway. In conclusion, we show that developmental indicators can help to discriminate between specific effects on the target pathway from off-target effects in molecularly targeted drug screening experiments in whole animal systems. - Highlights: • We analyze the functions of Egf signaling on zebrafish development. • Genetic blocking of Egf expression causes cartilage, myelin and circulatory defects. • Chemical inhibition of Egf receptor function causes similar defects. • Developmental defects can reveal the specificity of Egf pathway inhibitors.« less

Developmental Exposure to Diethylstilbestrol Alters Uterine Gene Expression That May Be Associated With Uterine Neoplasia Later in Life

PubMed Central

Newbold, Retha R.; Jefferson, Wendy N.; Grissom, Sherry F.; Padilla-Banks, Elizabeth; Snyder, Ryan J.; Lobenhofer, Edward K.

2008-01-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 μg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 μg/kg/d) on days 1–5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose–responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17β estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. PMID:17394237

Developmental exposure to diethylstilbestrol alters uterine gene expression that may be associated with uterine neoplasia later in life.

PubMed

Newbold, Retha R; Jefferson, Wendy N; Grissom, Sherry F; Padilla-Banks, Elizabeth; Snyder, Ryan J; Lobenhofer, Edward K

2007-09-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 microg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 microg/kg/d) on days 1-5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose-responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17beta estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. (c) 2007 Wiley-Liss, Inc.

THE EVOLUTION OF CANALIZATION AND THE BREAKING OF VON BAER'S LAWS: MODELING THE EVOLUTION OF DEVELOPMENT WITH EPISTASIS.

PubMed

Rice, Sean H

1998-06-01

Evolution can change the developmental processes underlying a character without changing the average expression of the character itself. This sort of change must occur in both the evolution of canalization, in which a character becomes increasingly buffered against genetic or developmental variation, and in the phenomenon of closely related species that show similar adult phenotypes but different underlying developmental patterns. To study such phenomena, I develop a model that follows evolution on a surface representing adult phenotype as a function of underlying developmental characters. A contour on such a "phenotype landscape" is a set of states of developmental characters that produce the same adult phenotype. Epistasis induces curvature of this surface, and degree of canalization is represented by the slope along a contour. I first discuss the geometric properties of phenotype landscapes, relating epistasis to canalization. I then impose a fitness function on the phenotype and model evolution of developmental characters as a function of the fitness function and the local geometry of the surface. This model shows how canalization evolves as a population approaches an optimum phenotype. It further shows that under some circumstances, "decanalization" can occur, in which the expression of adult phenotype becomes increasingly sensitive to developmental variation. This process can cause very similar populations to diverge from one another developmentally even when their adult phenotypes experience identical selection regimes. © 1998 The Society for the Study of Evolution.

Bud detachment in hydra requires activation of fibroblast growth factor receptor and a Rho–ROCK–myosin II signaling pathway to ensure formation of a basal constriction

PubMed Central

Holz, Oliver; Apel, David; Steinmetz, Patrick; Lange, Ellen; Hopfenmüller, Simon; Ohler, Kerstin; Sudhop, Stefanie

2017-01-01

Background: Hydra propagates asexually by exporting tissue into a bud, which detaches 4 days later as a fully differentiated young polyp. Prerequisite for detachment is activation of fibroblast growth factor receptor (FGFR) signaling. The mechanism which enables constriction and tissue separation within the monolayered ecto‐ and endodermal epithelia is unknown. Results: Histological sections and staining of F‐actin by phalloidin revealed conspicuous cell shape changes at the bud detachment site indicating a localized generation of mechanical forces and the potential enhancement of secretory functions in ectodermal cells. By gene expression analysis and pharmacological inhibition, we identified a candidate signaling pathway through Rho, ROCK, and myosin II, which controls bud base constriction and rearrangement of the actin cytoskeleton. Specific regional myosin phosphorylation suggests a crucial role of ectodermal cells at the detachment site. Inhibition of FGFR, Rho, ROCK, or myosin II kinase activity is permissive for budding, but represses myosin phosphorylation, rearrangement of F‐actin and constriction. The young polyp remains permanently connected to the parent by a broad tissue bridge. Conclusions: Our data suggest an essential role of FGFR and a Rho‐ROCK‐myosin II pathway in the control of cell shape changes required for bud detachment. Developmental Dynamics 246:502–516, 2017. © 2017 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists PMID:28411398

Chronic Stress Modulates Regional Cerebral Glucose Transporter Expression in an Age-Specific and Sexually-Dimorphic Manner

PubMed Central

Kelly, Sean D.; Harrell, Constance S.; Neigh, Gretchen N.

2014-01-01

Facilitative glucose transporters (GLUT) mediate glucose uptake across the blood-brain-barrier into neurons and glia. Deficits in specific cerebral GLUT isoforms are linked to developmental and neurological dysfunction, but less is known about the range of variation in cerebral GLUT expression in normal conditions and the effects of environmental influences on cerebral GLUT expression. Knowing that puberty is a time of increased cerebral plasticity, metabolic demand, and shifts in hormonal balance for males and females, we first assessed gene expression of five GLUT subtypes in four brain regions in male and female adolescent and adult Wistar rats. The data indicated that sex differences in GLUT expression were most profound in the hypothalamus, and the transition from adolescence to adulthood had the most profound effect on GLUT expression in the hippocampus. Next, given the substantial energetic demands during adolescence and prior demonstrations of the adverse effects of adolescent stress, we determined the extent to which chronic stress altered GLUT expression in males and females in both adolescence and adulthood. Chronic stress significantly altered cerebral GLUT expression in males and females throughout both developmental stages but in a sexually dimorphic and brain region-specific manner. Collectively, our data demonstrate that cerebral GLUTs are expressed differentially based on brain region, sex, age, and stress exposure. These results suggest that developmental and environmental factors influence GLUT expression in multiple brain regions. Given the importance of appropriate metabolic balance within the brain, further assessment of the functional implications of life stage and environmentally-induced changes in GLUTs are warranted. PMID:24382486

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

In Vitro Experimental Model for the Long-Term Analysis of Cellular Dynamics During Bronchial Tree Development from Lung Epithelial Cells

PubMed Central

Maruta, Naomichi; Marumoto, Moegi

2017-01-01

Lung branching morphogenesis has been studied for decades, but the underlying developmental mechanisms are still not fully understood. Cellular movements dynamically change during the branching process, but it is difficult to observe long-term cellular dynamics by in vivo or tissue culture experiments. Therefore, developing an in vitro experimental model of bronchial tree would provide an essential tool for developmental biology, pathology, and systems biology. In this study, we succeeded in reconstructing a bronchial tree in vitro by using primary human bronchial epithelial cells. A high concentration gradient of bronchial epithelial cells was required for branching initiation, whereas homogeneously distributed endothelial cells induced the formation of successive branches. Subsequently, the branches grew in size to the order of millimeter. The developed model contains only two types of cells and it facilitates the analysis of lung branching morphogenesis. By taking advantage of our experimental model, we carried out long-term time-lapse observations, which revealed self-assembly, collective migration with leader cells, rotational motion, and spiral motion of epithelial cells in each developmental event. Mathematical simulation was also carried out to analyze the self-assembly process and it revealed simple rules that govern cellular dynamics. Our experimental model has provided many new insights into lung development and it has the potential to accelerate the study of developmental mechanisms, pattern formation, left–right asymmetry, and disease pathogenesis of the human lung. PMID:28471293

The Dynamic Lift of Developmental Process

ERIC Educational Resources Information Center

Smith, Linda B.; Breazeal, Cynthia

2007-01-01

What are the essential properties of human intelligence, currently unparalleled in its power relative to other biological forms and relative to artificial forms of intelligence? We suggest that answering this question depends critically on understanding developmental process. This paper considers three principles potentially essential to building…

Developmental Hypothyroidism Alters Brain-Derived Neurotrophic Factor (BDNF) Expression in Adulthood.

EPA Science Inventory

Severe developmental thyroid hormone (TH) insufficiency results in alterations in brain structure/function and lasting behavioral impairments. Environmental toxicants reduce circulating levels of TH, but the disruption is modest and the doseresponse relationships of TH and neuro...

CELLULAR, BIOCHEMICAL, AND MOLECULAR TECHNIQUES IN DEVELOPMENTAL TOXICOLOGY

EPA Science Inventory

Cellular, molecular and biochemical approaches vastly expand the possibilities for revealing the underlying mechanisms of developmental toxicity. The increasing interest in embryonic development as a model system for the study of gene expression has resulted in a cornucopia of i...

Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

PubMed

Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

2016-09-08

The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

[Recombinant expression of Schistosoma japonicum fructose-1, 6-bisphos- phate aldolase and its expression in different developmental stages of S. japonicum].

PubMed

Yan, Ke; Zhong, Zheng-rong; Xu, Yun-xia; Ding, Shu-qin; Hu, Jian-guo; Xu, Yuan-hong; Luo, Qing-lie; Shen, Ji-long

2015-06-01

To clone, express and purify Schistosoma japonicum fructose-1, 6-bisphosphate aldolase (SjFBPA) in E. coli and observe its expression in different developmental stages of S. japonicum. FBPA gene was amplified from S. japonicum adult worm cDNA by using PCR. The amplified product was recombined into pET28a plasmid, and inducibly expressed with IPTG in E. coli BL21. SDS-PAGE and Western blotting were employed to analyze and identify the recombinant protein SjFBPA (rSjFBPA). Then, rSjFBPA was purified by chromatographic purification and its purity was analyzed by SDS- PAGE. The protein concentration of rSjFBPA purified was measured by the BCA method. Furthermore, SjFBPA mRNA was ana- lyzed in different developmental stages of S. japonicum by RT-PCR. SjFBPA was successfully amplified by using PCR and identified by restriction enzyme digestion and sequencing. The Western blotting analysis confirmed that the recombinant pro- tein could specifically reactive to the anti-His-tag monoclonal antibody. The concentration of the purified recombinant protein was about 4 mg/ml. The result of RT-PCR showed that SjFBPA mRNA was expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum. SjFBPA is successfully recombined and expressed in a prokaryotic system, and SjFBPA mRNA is expressed in cercaria, schistosomulum, adult worm and egg of S. japonicum.

Specific subpopulations of hypothalamic leptin receptor-expressing neurons mediate the effects of early developmental leptin receptor deletion on energy balance.

PubMed

Rupp, Alan C; Allison, Margaret B; Jones, Justin C; Patterson, Christa M; Faber, Chelsea L; Bozadjieva, Nadejda; Heisler, Lora K; Seeley, Randy J; Olson, David P; Myers, Martin G

2018-06-06

To date, early developmental ablation of leptin receptor (LepRb) expression from circumscribed populations of hypothalamic neurons (e.g., arcuate nucleus (ARC) Pomc- or Agrp-expressing cells) has only minimally affected energy balance. In contrast, removal of LepRb from at least two large populations (expressing vGat or Nos1) spanning multiple hypothalamic regions produced profound obesity and metabolic dysfunction. Thus, we tested the notion that the total number of leptin-responsive hypothalamic neurons (rather than specific subsets of cells with a particular molecular or anatomical signature) subjected to early LepRb deletion might determine energy balance. We generated new mouse lines deleted for LepRb in ARC Ghrh Cre neurons or in Htr2c Cre neurons (representing roughly half of all hypothalamic LepRb neurons, distributed across many nuclei). We compared the phenotypes of these mice to previously-reported models lacking LepRb in Pomc, Agrp, vGat or Nos1 cells. The early developmental deletion of LepRb from vGat or Nos1 neurons produced dramatic obesity, but deletion of LepRb from Pomc, Agrp, Ghrh, or Htr2c neurons minimally altered energy balance. Although early developmental deletion of LepRb from known populations of ARC neurons fails to substantially alter body weight, the minimal phenotype of mice lacking LepRb in Htr2c cells suggests that the phenotype that results from early developmental LepRb deficiency depends not simply upon the total number of leptin-responsive hypothalamic LepRb cells. Rather, specific populations of LepRb neurons must play particularly important roles in body energy homeostasis; these as yet unidentified LepRb cells likely reside in the DMH. Copyright © 2018 The Authors. Published by Elsevier GmbH.. All rights reserved.

Australian black field crickets show changes in neural gene expression associated with socially-induced morphological, life-history, and behavioral plasticity.

PubMed

Kasumovic, Michael M; Chen, Zhiliang; Wilkins, Marc R

2016-10-24

Ecological and evolutionary model organisms have provided extensive insight into the ecological triggers, adaptive benefits, and evolution of life-history driven developmental plasticity. Despite this, we still have a poor understanding of the underlying genetic changes that occur during shifts towards different developmental trajectories. The goal of this study is to determine whether we can identify underlying gene expression patterns that can describe the different life-history trajectories individuals follow in response to social cues of competition. To do this, we use the Australian black field cricket (Teleogryllus commodus), a species with sex-specific developmental trajectories moderated by the density and quality of calls heard during immaturity. In this study, we manipulated the social information males and females could hear by rearing individuals in either calling or silent treatments. We next used RNA-Seq to develop a reference transcriptome to study changes in brain gene expression at two points prior to sexual maturation. We show accelerated development in both sexes when exposed to calling; changes were also seen in growth, lifespan, and reproductive effort. Functional relationships between genes and phenotypes were apparent from ontological enrichment analysis. We demonstrate that increased investment towards traits such as growth and reproductive effort were often associated with the expression of a greater number of genes with similar effect, thus providing a suite of candidate genes for future research in this and other invertebrate organisms. Our results provide interesting insight into the genomic underpinnings of developmental plasticity and highlight the potential of a genomic exploration of other evolutionary theories such as condition dependence and sex-specific developmental strategies.

Precision of Readout at the hunchback Gene: Analyzing Short Transcription Time Traces in Living Fly Embryos

PubMed Central

Tran, Huy; Ferraro, Teresa; Lucas, Tanguy; Guillou, Aurelien; Coppey, Mathieu; Dostatni, Nathalie

2016-01-01

The simultaneous expression of the hunchback gene in the numerous nuclei of the developing fly embryo gives us a unique opportunity to study how transcription is regulated in living organisms. A recently developed MS2-MCP technique for imaging nascent messenger RNA in living Drosophila embryos allows us to quantify the dynamics of the developmental transcription process. The initial measurement of the morphogens by the hunchback promoter takes place during very short cell cycles, not only giving each nucleus little time for a precise readout, but also resulting in short time traces of transcription. Additionally, the relationship between the measured signal and the promoter state depends on the molecular design of the reporting probe. We develop an analysis approach based on tailor made autocorrelation functions that overcomes the short trace problems and quantifies the dynamics of transcription initiation. Based on live imaging data, we identify signatures of bursty transcription initiation from the hunchback promoter. We show that the precision of the expression of the hunchback gene to measure its position along the anterior-posterior axis is low both at the boundary and in the anterior even at cycle 13, suggesting additional post-transcriptional averaging mechanisms to provide the precision observed in fixed embryos. PMID:27942043

Identification and Characterization of microRNAs during Maize Grain Filling

PubMed Central

Lv, Panqing; Peng, Qian; Ding, Dong; Li, Weihua; Tang, Jihua

2015-01-01

The grain filling rate is closely associated with final grain yield of maize during the period of maize grain filling. To identify the key microRNAs (miRNAs) and miRNA-dependent gene regulation networks of grain filling in maize, a deep-sequencing technique was used to research the dynamic expression patternsof miRNAs at four distinct developmental grain filling stages in Zhengdan 958, which is an elite hybrid and cultivated widely in China. The sequencing result showed that the expression amount of almost all miRNAs was changing with the development of the grain filling and formed in seven groups. After normalization, 77 conserved miRNAs and 74 novel miRNAs were co-detected in these four samples. Eighty-one out of 162 targets of the conserved miRNAs belonged to transcriptional regulation (81, 50%), followed by oxidoreductase activity (18, 11%), signal transduction (16, 10%) and development (15, 9%). The result showed that miRNA 156, 393, 396 and 397, with their respective targets, might play key roles in the grain filling rate by regulating maize growth, development and environment stress response. The result also offered novel insights into the dynamic change of miRNAs during the developing process of maize kernels and assistedin the understanding of how miRNAs are functioning about the grain filling rate. PMID:25951054

Identification and Characterization of microRNAs during Maize Grain Filling.

PubMed

Jin, Xining; Fu, Zhiyuan; Lv, Panqing; Peng, Qian; Ding, Dong; Li, Weihua; Tang, Jihua

2015-01-01

The grain filling rate is closely associated with final grain yield of maize during the period of maize grain filling. To identify the key microRNAs (miRNAs) and miRNA-dependent gene regulation networks of grain filling in maize, a deep-sequencing technique was used to research the dynamic expression patterns of miRNAs at four distinct developmental grain filling stages in Zhengdan 958, which is an elite hybrid and cultivated widely in China. The sequencing result showed that the expression amount of almost all miRNAs was changing with the development of the grain filling and formed in seven groups. After normalization, 77 conserved miRNAs and 74 novel miRNAs were co-detected in these four samples. Eighty-one out of 162 targets of the conserved miRNAs belonged to transcriptional regulation (81, 50%), followed by oxidoreductase activity (18, 11%), signal transduction (16, 10%) and development (15, 9%). The result showed that miRNA 156, 393, 396 and 397, with their respective targets, might play key roles in the grain filling rate by regulating maize growth, development and environment stress response. The result also offered novel insights into the dynamic change of miRNAs during the developing process of maize kernels and assisted in the understanding of how miRNAs are functioning about the grain filling rate.

RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex

PubMed Central

Clare, Alison J.; Wicky, Hollie E.; Empson, Ruth M.; Hughes, Stephanie M.

2017-01-01

Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their expression could contribute to the progression of disease phenotypes. PMID:28936162

MiR-495 and miR-218 regulate the expression of the Onecut transcription factors HNF-6 and OC-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simion, Alexandru; Laudadio, Ilaria; Prevot, Pierre-Paul

2010-01-01

MicroRNAs are small, non-coding RNAs that posttranscriptionally regulate gene expression mainly by binding to the 3'UTR of their target mRNAs. Recent data revealed that microRNAs have an important role in pancreas and liver development and physiology. Using cloning and microarray profiling approaches, we show that a unique repertoire of microRNAs is expressed at the onset of liver and pancreas organogenesis, and in pancreas and liver at key stages of cell fate determination. Among the microRNAs that are expressed at these stages, miR-495 and miR-218 were predicted to, respectively, target the Onecut (OC) transcription factors Hepatocyte Nuclear Factor-6 (HNF-6/OC-1) and OC-2,more » two important regulators of liver and pancreas development. MiR-495 and miR-218 are dynamically expressed in developing liver and pancreas, and by transient transfection, we show that they target HNF-6 and OC-2 3'UTRs. Moreover, when overexpressed in cultured cells, miR-495 and miR-218 decrease the endogenous levels of HNF-6 and OC-2 mRNA. These results indicate that the expression of regulators of liver and pancreas development is modulated by microRNAs. They also suggest a developmental role for miR-495 and miR-218.« less

Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization.

PubMed

Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu; Xin, Mingming

2018-01-01

Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid ( Aegilops spp), tetraploid, and hexaploid wheat ( Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. © 2018 American Society of Plant Biologists. All rights reserved.

Separable roles of UFO during floral development revealed by conditional restoration of gene function.

PubMed

Laufs, Patrick; Coen, Enrico; Kronenberger, Jocelyne; Traas, Jan; Doonan, John

2003-02-01

The UNUSUAL FLORAL ORGANS (UFO) gene is required for several aspects of floral development in Arabidopsis including specification of organ identity in the second and third whorls and the proper pattern of primordium initiation in the inner three whorls. UFO is expressed in a dynamic pattern during the early phases of flower development. Here we dissect the role of UFO by ubiquitously expressing it in ufo loss-of-function flowers at different developmental stages and for various durations using an ethanol-inducible expression system. The previously known functions of UFO could be separated and related to its expression at specific stages of development. We show that a 24- to 48-hour period of UFO expression from floral stage 2, before any floral organs are visible, is sufficient to restore normal petal and stamen development. The earliest requirement for UFO is during stage 2, when the endogenous UFO gene is transiently expressed in the centre of the wild-type flower and is required to specify the initiation patterns of petal, stamen and carpel primordia. Petal and stamen identity is determined during stages 2 or 3, when UFO is normally expressed in the presumptive second and third whorl. Although endogenous UFO expression is absent from the stamen whorl from stage 4 onwards, stamen identity can be restored by UFO activation up to stage 6. We also observed floral phenotypes not observed in loss-of-function or constitutive gain-of-function backgrounds, revealing additional roles of UFO in outgrowth of petal primordia.

Bioelectric memory: modeling resting potential bistability in amphibian embryos and mammalian cells.

PubMed

Law, Robert; Levin, Michael

2015-10-15

Bioelectric gradients among all cells, not just within excitable nerve and muscle, play instructive roles in developmental and regenerative pattern formation. Plasma membrane resting potential gradients regulate cell behaviors by regulating downstream transcriptional and epigenetic events. Unlike neurons, which fire rapidly and typically return to the same polarized state, developmental bioelectric signaling involves many cell types stably maintaining various levels of resting potential during morphogenetic events. It is important to begin to quantitatively model the stability of bioelectric states in cells, to understand computation and pattern maintenance during regeneration and remodeling. To facilitate the analysis of endogenous bioelectric signaling and the exploitation of voltage-based cellular controls in synthetic bioengineering applications, we sought to understand the conditions under which somatic cells can stably maintain distinct resting potential values (a type of state memory). Using the Channelpedia ion channel database, we generated an array of amphibian oocyte and mammalian membrane models for voltage evolution. These models were analyzed and searched, by simulation, for a simple dynamical property, multistability, which forms a type of voltage memory. We find that typical mammalian models and amphibian oocyte models exhibit bistability when expressing different ion channel subsets, with either persistent sodium or inward-rectifying potassium, respectively, playing a facilitative role in bistable memory formation. We illustrate this difference using fast sodium channel dynamics for which a comprehensive theory exists, where the same model exhibits bistability under mammalian conditions but not amphibian conditions. In amphibians, potassium channels from the Kv1.x and Kv2.x families tend to disrupt this bistable memory formation. We also identify some common principles under which physiological memory emerges, which suggest specific strategies for implementing memories in bioengineering contexts. Our results reveal conditions under which cells can stably maintain one of several resting voltage potential values. These models suggest testable predictions for experiments in developmental bioelectricity, and illustrate how cells can be used as versatile physiological memory elements in synthetic biology, and unconventional computation contexts.

Developmental Dynamics of Emotion and Cognition Processes in Preschoolers

PubMed Central

Blankson, A. Nayena; O’Brien, Marion; Leerkes, Esther M.; Marcovitch, Stuart; Calkins, Susan D.; Weaver, Jennifer Miner

2012-01-01

Dynamic relations during the preschool years across processes of control and understanding in the domains of emotion and cognition were examined. Participants were 263 children (42% non-white) and their mothers who were seen first when the children were 3 years old and again when they were 4. Results indicated dynamic dependence among the processes studied. Specifically, change in cognitive processes of control and understanding were dependent upon initial levels of the other processes. Changes in emotion control and understanding were not predicted by earlier performance in the other processes. Findings are discussed with regard to the constructs of control and understanding and the developmental interrelations among emotion and cognitive processes. PMID:22925076

Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

PubMed Central

Xiao, Han; Radovich, Cheryll; Welty, Nicholas; Hsu, Jason; Li, Dongmei; Meulia, Tea; van der Knaap, Esther

2009-01-01

Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7), anthesis-stage flowers (floral landmark 10 and fruit landmark 1), and 5 days post anthesis fruit (fruit landmark 3). To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in the NILs that differ at the sun locus, higher or lower transcript levels for many genes involved in phytohormone biosynthesis or signaling as well as organ identity and patterning of tomato fruit were found between developmental time points. PMID:19422692

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

Reversible RNA adenosine methylation in biological regulation

PubMed Central

Jia, Guifang; Fu, Ye; He, Chuan

2012-01-01

N6-methyladenosine (m6A) is a ubiquitous modification in messenger RNA (mRNA) and other RNAs across most eukaryotes. For many years, however, the exact functions of m6A were not clearly understood. The discovery that the fat mass and obesity associated protein (FTO) is an m6A demethylase indicates that this modification is reversible and dynamically regulated, suggesting it has regulatory roles. In addition, it has been shown that m6A affects cell fate decisions in yeast and plant development. Recent affinity-based m6A profiling in mouse and human cells further showed that this modification is a widespread mark in coding and non-coding RNA transcripts and is likely dynamically regulated throughout developmental processes. Therefore, reversible RNA methylation, analogous to reversible DNA and histone modifications, may affect gene expression and cell fate decisions by modulating multiple RNA-related cellular pathways, which potentially provides rapid responses to various cellular and environmental signals, including energy and nutrient availability in mammals. PMID:23218460

Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells

PubMed Central

Freire-Pritchett, Paula; Schoenfelder, Stefan; Várnai, Csilla; Wingett, Steven W; Cairns, Jonathan; Collier, Amanda J; García-Vílchez, Raquel; Furlan-Magaril, Mayra; Osborne, Cameron S; Fraser, Peter; Rugg-Gunn, Peter J; Spivakov, Mikhail

2017-01-01

Long-range cis-regulatory elements such as enhancers coordinate cell-specific transcriptional programmes by engaging in DNA looping interactions with target promoters. Deciphering the interplay between the promoter connectivity and activity of cis-regulatory elements during lineage commitment is crucial for understanding developmental transcriptional control. Here, we use Promoter Capture Hi-C to generate a high-resolution atlas of chromosomal interactions involving ~22,000 gene promoters in human pluripotent and lineage-committed cells, identifying putative target genes for known and predicted enhancer elements. We reveal extensive dynamics of cis-regulatory contacts upon lineage commitment, including the acquisition and loss of promoter interactions. This spatial rewiring occurs preferentially with predicted changes in the activity of cis-regulatory elements and is associated with changes in target gene expression. Our results provide a global and integrated view of promoter interactome dynamics during lineage commitment of human pluripotent cells. DOI: http://dx.doi.org/10.7554/eLife.21926.001 PMID:28332981

Tug of war: adding and removing histone lysine methylation in Arabidopsis.

PubMed

Xiao, Jun; Lee, Un-Sa; Wagner, Doris

2016-12-01

Histone lysine methylation plays a fundamental role in the epigenetic regulation of gene expression in multicellular eukaryotes, including plants. It shapes plant developmental and growth programs as well as responses to the environment. The methylation status of certain amino-acids, in particular of the histone 3 (H3) lysine tails, is dynamically controlled by opposite acting histone methyltransferase 'writers' and histone demethylase 'erasers'. The methylation status is interpreted by a third set of proteins, the histone modification 'readers', which specifically bind to a methylated amino-acid on the H3 tail. Histone methylation writers, readers, and erasers themselves are regulated by intrinsic or extrinsic stimuli; this forms a feedback loop that contributes to development and environmental adaptation in Arabidopsis and other plants. Recent studies have expanded our knowledge regarding the biological roles and dynamic regulation of histone methylation. In this review, we will discuss recent advances in understanding the regulation and roles of histone methylation in plants and animals. Copyright © 2016 Elsevier Ltd. All rights reserved.

A Drosophila model for fetal alcohol syndrome disorders: role for the insulin pathway

PubMed Central

McClure, Kimberly D.; French, Rachael L.; Heberlein, Ulrike

2011-01-01

SUMMARY Prenatal exposure to ethanol in humans results in a wide range of developmental abnormalities, including growth deficiency, developmental delay, reduced brain size, permanent neurobehavioral abnormalities and fetal death. Here we describe the use of Drosophila melanogaster as a model for exploring the effects of ethanol exposure on development and behavior. We show that developmental ethanol exposure causes reduced viability, developmental delay and reduced adult body size. We find that flies reared on ethanol-containing food have smaller brains and imaginal discs, which is due to reduced cell division rather than increased apoptosis. Additionally, we show that, as in mammals, flies reared on ethanol have altered responses to ethanol vapor exposure as adults, including increased locomotor activation, resistance to the sedating effects of the drug and reduced tolerance development upon repeated ethanol exposure. We have found that the developmental and behavioral defects are largely due to the effects of ethanol on insulin signaling; specifically, a reduction in Drosophila insulin-like peptide (Dilp) and insulin receptor expression. Transgenic expression of Dilp proteins in the larval brain suppressed both the developmental and behavioral abnormalities displayed by ethanol-reared adult flies. Our results thus establish Drosophila as a useful model system to uncover the complex etiology of fetal alcohol syndrome. PMID:21303840

Guided Autobiography's Developmental Exchange: What's in It for Me?

ERIC Educational Resources Information Center

Thornton, James E.; Collins, John B.; Birren, James E.; Svensson, Cheryl

2011-01-01

The developmental exchange is a central feature of social development, interpersonal dynamics, situated learning, and personal transformation. It is the enabling process in Guided Autobiography (GAB) settings that promotes the achievement of personal goals and group accomplishments. Nevertheless, these exchanges are embedded in the GAB structures…

Complex Dynamics in Academics' Developmental Processes in Teaching

ERIC Educational Resources Information Center

Trautwein, Caroline; Nückles, Matthias; Merkt, Marianne

2015-01-01

Improving teaching in higher education is a concern for universities worldwide. This study explored academics' developmental processes in teaching using episodic interviews and teaching portfolios. Eight academics in the context of teaching development reported changes in their teaching and change triggers. Thematic analyses revealed seven areas…

Play Therapy. ERIC Digest.

ERIC Educational Resources Information Center

Landreth, Garry; Bratton, Sue

Play therapy is based on developmental principles and, thus, provides, through play, developmentally appropriate means of expression and communication for children. Therefore, skill in using play therapy is an essential tool for mental health professionals who work with children. Therapeutic play allows children the opportunity to express…

Developmental transcriptional profiling reveals key insights into Triticeae reproductive development.

PubMed

Tran, Frances; Penniket, Carolyn; Patel, Rohan V; Provart, Nicholas J; Laroche, André; Rowland, Owen; Robert, Laurian S

2013-06-01

Despite their importance, there remains a paucity of large-scale gene expression-based studies of reproductive development in species belonging to the Triticeae. As a first step to address this deficiency, a gene expression atlas of triticale reproductive development was generated using the 55K Affymetrix GeneChip(®) wheat genome array. The global transcriptional profiles of the anther/pollen, ovary and stigma were analyzed at concurrent developmental stages, and co-expressed as well as preferentially expressed genes were identified. Data analysis revealed both novel and conserved regulatory factors underlying Triticeae floral development and function. This comprehensive resource rests upon detailed gene annotations, and the expression profiles are readily accessible via a web browser. © 2013 Her Majesty the Queen in Right of Canada as represented by the Minister of Agriculture and Agri-Food Canada.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Frodo proteins: modulators of Wnt signaling in vertebrate development.

PubMed

Brott, Barbara K; Sokol, Sergei Y

2005-09-01

The Frodo/dapper (Frd) proteins are recently discovered signaling adaptors, which functionally and physically interact with Wnt and Nodal signaling pathways during vertebrate development. The Frd1 and Frd2 genes are expressed in dynamic patterns in early embryos, frequently in cells undergoing epithelial-mesenchymal transition. The Frd proteins function in multiple developmental processes, including mesoderm and neural tissue specification, early morphogenetic cell movements, and organogenesis. Loss-of-function studies using morpholino antisense oligonucleotides demonstrate that the Frd proteins regulate Wnt signal transduction in a context-dependent manner and may be involved in Nodal signaling. The identification of Frd-associated factors and cellular targets of the Frd proteins should shed light on the molecular mechanisms underlying Frd functions in embryonic development and in cancer.

Developing an eBook-Integrated High-Fidelity Mobile App Prototype for Promoting Child Motor Skills and Taxonomically Assessing Children's Emotional Responses Using Face and Sound Topology.

PubMed

Brown, William; Liu, Connie; John, Rita Marie; Ford, Phoebe

2014-01-01

Developing gross and fine motor skills and expressing complex emotion is critical for child development. We introduce "StorySense", an eBook-integrated mobile app prototype that can sense face and sound topologies and identify movement and expression to promote children's motor skills and emotional developmental. Currently, most interactive eBooks on mobile devices only leverage "low-motor" interaction (i.e. tapping or swiping). Our app senses a greater breath of motion (e.g. clapping, snapping, and face tracking), and dynamically alters the storyline according to physical responses in ways that encourage the performance of predetermined motor skills ideal for a child's gross and fine motor development. In addition, our app can capture changes in facial topology, which can later be mapped using the Facial Action Coding System (FACS) for later interpretation of emotion. StorySense expands the human computer interaction vocabulary for mobile devices. Potential clinical applications include child development, physical therapy, and autism.

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

Glutathione S-transferase pi isoform (GSTP1) expression in murine retina increases with developmental maturity.

PubMed

Lee, Wen-Hsiang; Joshi, Pratibha; Wen, Rong

2014-01-01

Glutathione S-transferase pi isoform (GSTP1) is an intracellular detoxification enzyme that catalyzes reduction of chemically reactive electrophiles and is a zeaxanthin-binding protein in the human macula. We have previously demonstrated that GSTP1 levels are decreased in human age-related macular degeneration (AMD) retina compared to normal controls (Joshi et al., Invest Ophthalmol Vis Sci, e-abstract, 2009). We also showed that GSTP1 levels parallel survival of human retinal pigment epithelial (RPE) cells exposed to ultraviolet (UV) light, and GSTP1 over-expression protects them against UV light damage (Joshi et al., Invest Ophthalmol Vis Sci, e-abstract, 2010). In the present work, we determined the developmental time course of GSTP1 expression in murine retina and in response to light challenge. Eyes from BALB/c mice at postnatal day 20, 1 month, and 2 months of age were prepared for retinal protein extraction and cryo sectioning, and GSTP1 levels in the retina were analyzed by Western blot and immunohistochemistry (IHC). Another group of BALB/c mice with the same age ranges was exposed to 1000 lx of white fluorescent light for 24 h, and their retinas were analyzed for GSTP1 expression by Western blot and IHC in a similar manner. GSTP1 levels in the murine retina increased in ascending order from postnatal day 20, 1 month, and 2 months of age. Moreover, GSTP1 expression in murine retina at postnatal day 20, 1 month, and 2 months of age increased in response to brief light exposure compared to age-matched controls under normal condition. GSTP1 expression in retina increases with developmental age in mice and accompanies murine retinal maturation. Brief exposure to light induces GSTP1 expression in the murine retina across various developmental ages. GSTP1 induction may be a protective response to light-induced oxidative damage in the murine retina.

Glutathione S-Transferase Pi Isoform (GSTP1) Expression in Murine Retina Increases with Developmental Maturity

PubMed Central

Lee, Wen-Hsiang; Joshi, Pratibha; Wen, Rong

2014-01-01

Background and Aims Glutathione S-transferase pi isoform (GSTP1) is an intracellular detoxification enzyme that catalyzes reduction of chemically reactive electrophiles and is a zeaxanthin-binding protein in the human macula. We have previously demonstrated that GSTP1 levels are decreased in human age-related macular degeneration (AMD) retina compared to normal controls [1]. We also showed that GSTP1 levels parallel survival of human retinal pigment epithelial (RPE) cells exposed to UV light, and GSTP1 over-expression protects them against UV light damage [2]. In the present work, we determined the developmental time course of GSTP1 expression in murine retina and in response to light challenge. Methods Eyes from BALB/c mice at post-natal day 20, 1 month, and 2 months of age were prepared for retinal protein extraction and cryo sectioning, and GSTP1 levels in the retina were analyzed by Western blot and immunohistochemistry (IHC). Another group of BALB/c mice with the same age ranges was exposed to 1000 lux of white fluorescent light for 24 hours, and their retinas were analyzed for GSTP1 expression by Western blot and IHC in a similar manner. Results GSTP1 levels in the murine retina increased in ascending order from post-natal day 20, 1 month, and 2 months of age. Moreover, GSTP1 expression in murine retina at post-natal day 20, 1 month, and 2 months of age increased in response to brief light exposure compared to age-matched controls under normal condition. Conclusions GSTP1 expression in retina increases with developmental age in mice and accompanies murine retinal maturation. Brief exposure to light induces GSTP1 expression in the murine retina across various developmental ages. GSTP1 induction may be a protective response to light-induced oxidative damage in the murine retina. PMID:24664677

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

PubMed

Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

2015-09-04

A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our findings reveal dynamics of developmental gene network evolution in wild populations. This holds important implications: (1) for understanding how phenotypic novelty is generated in the wild; (2) for providing a possible bridge between micro- and macroevolution; and (3) for understanding how development mediates the response of organisms to past, and potentially, future climate change.

Discovering sparse transcription factor codes for cell states and state transitions during development

PubMed Central

Furchtgott, Leon A; Melton, Samuel; Menon, Vilas; Ramanathan, Sharad

2017-01-01

Computational analysis of gene expression to determine both the sequence of lineage choices made by multipotent cells and to identify the genes influencing these decisions is challenging. Here we discover a pattern in the expression levels of a sparse subset of genes among cell types in B- and T-cell developmental lineages that correlates with developmental topologies. We develop a statistical framework using this pattern to simultaneously infer lineage transitions and the genes that determine these relationships. We use this technique to reconstruct the early hematopoietic and intestinal developmental trees. We extend this framework to analyze single-cell RNA-seq data from early human cortical development, inferring a neocortical-hindbrain split in early progenitor cells and the key genes that could control this lineage decision. Our work allows us to simultaneously infer both the identity and lineage of cell types as well as a small set of key genes whose expression patterns reflect these relationships. DOI: http://dx.doi.org/10.7554/eLife.20488.001 PMID:28296636

Developmental origin of lung macrophage diversity

PubMed Central

Tan, Serena Y. S.; Krasnow, Mark A.

2016-01-01

Macrophages are specialized phagocytic cells, present in all tissues, which engulf and digest pathogens, infected and dying cells, and debris, and can recruit and regulate other immune cells and the inflammatory response and aid in tissue repair. Macrophage subpopulations play distinct roles in these processes and in disease, and are typically recognized by differences in marker expression, immune function, or tissue of residency. Although macrophage subpopulations in the brain have been found to have distinct developmental origins, the extent to which development contributes to macrophage diversity between tissues and within tissues is not well understood. Here, we investigate the development and maintenance of mouse lung macrophages by marker expression patterns, genetic lineage tracing and parabiosis. We show that macrophages populate the lung in three developmental waves, each giving rise to a distinct lineage. These lineages express different markers, reside in different locations, renew in different ways, and show little or no interconversion. Thus, development contributes significantly to lung macrophage diversity and targets each lineage to a different anatomical domain. PMID:26952982

Developmental Hypothyroidism Reduces the Expression of ...

EPA Pesticide Factsheets

Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Current Approaches to Intervention in Children with Developmental Coordination Disorder

ERIC Educational Resources Information Center

Sugden, David

2007-01-01

This review analyzes approaches to intervention in children with developmental coordination disorder within the framework of how children develop and learn motor skills, drawing upon maturational, cognitive, and dynamic systems models. The approaches to intervention are divided into two categories: (1) process or deficit-oriented approaches; and…

The Down Syndrome Behavioural Phenotype: Taking a Developmental Approach

ERIC Educational Resources Information Center

Fidler, Deborah; Most, David; Philofsky, Amy

2009-01-01

Individuals with Down syndrome are predisposed to show a specific behavioural phenotype, or a pattern of strengths and challenges in functioning across different domains of development. It is argued that a developmental approach to researching the Down syndrome behavioural phenotype, including an examination of the dynamic process of the unfolding…

Developmental Evaluation: Applying Complexity Concepts to Enhance Innovation and Use

ERIC Educational Resources Information Center

Patton, Michael Quinn

2010-01-01

Developmental evaluation (DE) offers a powerful approach to monitoring and supporting social innovations by working in partnership with program decision makers. In this book, eminent authority shows how to conduct evaluations within a DE framework. Patton draws on insights about complex dynamic systems, uncertainty, nonlinearity, and emergence. He…

Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor.

PubMed

Zhu, Jia-Ying; Ze, Sang-Zi; Stanley, David W; Yang, Bin

2014-09-01

Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor. The cDNAs for ecCuZnSOD, icCuZnSOD, and MnSOD, respectively, encode 24.55, 15.81, and 23.14 kDa polypeptides, which possess structural features typical of other insect SODs. They showed 20-94% identity to other known SOD sequences from Bombyx mori, Musca domestica, Nasonia vitripennis, Pediculus humanus corporis, and Tribolium castaneum. Expression of these genes was analyzed in selected tissues and developmental stages, and following exposure to Escherichia coli and parasitization by Scleroderma guani. We recorded expression of all three SODs in cuticle, fat body, and hemocytes and in the major developmental stages. Relatively higher expressions were detected in late-instar larvae and pupae, compared to other developmental stages. Transcriptional levels were upregulated following bacterial infection. Analysis of pupae parasitized by S. guani revealed that expression of T. molitor SOD genes was significantly induced following parasitization. We infer that these genes act in immune response and in host-parasitoid interactions. © 2014 Wiley Periodicals, Inc.

Developmental Effects of Acute, Chronic, and Withdrawal from Chronic Nicotine on Fear Conditioning

PubMed Central

Portugal, George S.; Wilkinson, Derek S.; Turner, Jill R.; Blendy, Julie A.; Gould, Thomas J.

2012-01-01

Pre-adolescence and adolescence are developmental periods associated with increased vulnerability for tobacco addiction, and exposure to tobacco during these periods may lead to long-lasting changes in behavioral and neuronal plasticity. The present study examined the short- and long-term effects of nicotine and nicotine withdrawal on fear conditioning in pre-adolescent, adolescent, and adult mice, and potential underlying substrates that may mediate the developmental effects of nicotine, such as changes in nicotinic acetylcholine receptor (nAChR) binding, CREB expression, and nicotine metabolism. Age-related differences existed in sensitivity to the effects of acute nicotine, chronic nicotine and nicotine withdrawal on contextual fear conditioning (no changes in cued fear conditioning were seen); younger mice were more sensitive to the acute effects and less sensitive to the effects of nicotine withdrawal 24 hours post treatment cessation. Developmental differences in nAChR binding were associated with the effects of nicotine withdrawal on contextual learning. Developmental differences in nicotine metabolism and CREB expression were also observed, but were not related to the effects of nicotine withdrawal on contextual learning 24 hours post treatment. Chronic nicotine exposure during pre-adolescence or adolescence, however, produced long-lasting impairments in contextual learning that were observed during adulthood, whereas adult chronic nicotine exposure did not. These developmental effects could be related to changes in CREB. Overall, there is a developmental shift in the effects of nicotine on hippocampus-dependent learning and developmental exposure to nicotine results in adult cognitive deficits; these changes in cognition may play an important role in the development and maintenance of nicotine addiction. PMID:22521799

An Out-of-Math Experience: Einstein, Relativity, and the Developmental Mathematics Student.

ERIC Educational Resources Information Center

Fiore, Greg

2000-01-01

Discusses Einstein's special relativity theory and some of the developmental mathematics involved. Presents motivational classroom materials used in discussing relative-motion problems, evaluating a radical expression, graphing with asymptotes, interpreting a graph, studying variation, and solving literal and radical equations. (KHR)

Gene Expression Changes in Developing Zebrafish as Potential Markers for Rapid Developmental Neurotoxicity Screening

EPA Science Inventory

Sparse information exists on many chemicals to guide developmental neurotoxicity (DNT) risk assessments. As DNT testing using rodents is laborious and expensive, alternative species such as zebrafish are being adapted for toxicity screening. Assessing the DNT potential of chem...

Community Inclusion for Children and Youth with Developmental Disabilities.

ERIC Educational Resources Information Center

Fennick, Ellen; Royle, James

2003-01-01

Activity coaches from university teacher education and health education programs were trained to use individualized accommodations to help six children (ages 6-13) with developmental disabilities participate in community recreation activities. Children participated in swim classes or gymnastics at individualized levels, expressed enjoyment, and…

Developmental cigarette smoke exposure II: Hepatic proteome profiles in 6 month old adult offspring.

PubMed

Neal, Rachel E; Chen, Jing; Webb, Cindy; Stocke, Kendall; Gambrell, Caitlin; Greene, Robert M; Pisano, M Michele

2016-10-01

Utilizing a mouse model of 'active' developmental cigarette smoke exposure (CSE) [gestational day (GD) 1 through postnatal day (PD) 21] characterized by offspring low birth weight, the impact of developmental CSE on liver proteome profiles of adult offspring at 6 months of age was determined. Liver tissue was collected from Sham- and CSE-offspring for 2D-SDS-PAGE based proteome analysis with Partial Least Squares-Discriminant Analysis (PLS-DA). A similar study conducted at the cessation of exposure to cigarette smoke documented decreased gluconeogenesis coupled to oxidative stress in weanling offspring. In the current study, exposure throughout development to cigarette smoke resulted in impaired hepatic carbohydrate metabolism, decreased serum glucose levels, and increased gluconeogenic regulatory enzyme abundances during the fed-state coupled to decreased expression of SIRT1 as well as increased PEPCK and PGC1α expression. Together these findings indicate inappropriately timed gluconeogenesis that may reflect impaired insulin signaling in mature offspring exposed to 'active' developmental CSE. Copyright © 2016 Elsevier Inc. All rights reserved.

Novel marker for the onset of frontotemporal dementia: early increase in activity-dependent neuroprotective protein (ADNP) in the face of Tau mutation.

PubMed

Schirer, Yulie; Malishkevich, Anna; Ophir, Yotam; Lewis, Jada; Giladi, Eliezer; Gozes, Illana

2014-01-01

Tauopathy, a major pathology in Alzheimer's disease, is also found in ~50% of frontotemporal dementias (FTDs). Tau transcript, a product of a single gene, undergoes alternative splicing to yield 6 protein species, each with either 3 or 4 microtubule binding repeat domains (tau 3R or 4R, associated with dynamic and stable microtubules, respectively). While the healthy human brain shows a 1/1 ratio of tau 3R/4R, this ratio may be dramatically changed in the FTD brain. We have previously discovered that activity-dependent neuroprotective protein (ADNP) is essential for brain formation in the mouse, with ADNP+/- mice exhibiting tauopathy, age-driven neurodegeneration and behavioral deficits. Here, in transgenic mice overexpressing a mutated tau 4R species, in the cerebral cortex but not in the cerebellum, we showed significantly increased ADNP expression (~3-fold transcripts) in the cerebral cortex of young transgenic mice (~disease onset), but not in the cerebellum, as compared to control littermates. The transgene-age-related increased ADNP expression paralleled augmented dynamic tau 3R transcript level compared to control littermates. Blocking mutated tau 4R transgene expression resulted in normalization of ADNP and tau 3R expression. ADNP was previously shown to be a member of the SWItch/Sucrose NonFermentable (SWI/SNF) chromatin remodeling complex. Here, Brahma (Brm), a component of the SWI/SNF complex regulating alternative splicing, showed a similar developmental expression pattern to ADNP. Immunoprecipitations further suggested Brm-ADNP interaction coupled to ADNP - polypyrimidine tract-binding protein (PTB)-associated splicing factor (PSF)-binding, with PSF being a direct regulator of tau transcript splicing. It should be noted that although we have shown a correlation between levels of ADNP and tau isoform expression three months of age, we are not presenting evidence of a direct link between the two. Future research into ADNP/tau relations is warranted.

Geometric Morphometrics on Gene Expression Patterns Within Phenotypes: A Case Example on Limb Development

PubMed Central

Martínez-Abadías, Neus; Mateu, Roger; Niksic, Martina; Russo, Lucia; Sharpe, James

2016-01-01

How the genotype translates into the phenotype through development is critical to fully understand the evolution of phenotypes. We propose a novel approach to directly assess how changes in gene expression patterns are associated with changes in morphology using the limb as a case example. Our method combines molecular biology techniques, such as whole-mount in situ hybridization, with image and shape analysis, extending the use of Geometric Morphometrics to the analysis of nonanatomical shapes, such as gene expression domains. Elliptical Fourier and Procrustes-based semilandmark analyses were used to analyze the variation and covariation patterns of the limb bud shape with the expression patterns of two relevant genes for limb morphogenesis, Hoxa11 and Hoxa13. We devised a multiple thresholding method to semiautomatically segment gene domains at several expression levels in large samples of limb buds from C57Bl6 mouse embryos between 10 and 12 postfertilization days. Besides providing an accurate phenotyping tool to quantify the spatiotemporal dynamics of gene expression patterns within developing structures, our morphometric analyses revealed high, non-random, and gene-specific variation undergoing canalization during limb development. Our results demonstrate that Hoxa11 and Hoxa13, despite being paralogs with analogous functions in limb patterning, show clearly distinct dynamic patterns, both in shape and size, and are associated differently with the limb bud shape. The correspondence between our results and already well-established molecular processes underlying limb development confirms that this morphometric approach is a powerful tool to extract features of development regulating morphogenesis. Such multilevel analyses are promising in systems where not so much molecular information is available and will advance our understanding of the genotype–phenotype map. In systematics, this knowledge will increase our ability to infer how evolution modified a common developmental pattern to generate a wide diversity of morphologies, as in the vertebrate limb. PMID:26377442

Does dynamic immobilization reduce chondrocyte apoptosis and disturbance to the femoral head perfusion?

PubMed Central

Li, Lian-Yong; Zhang, Li-Jun; Jia, Jing-Yu; Zhao, Qun; Wang, En-bo; Li, Qi-Wei

2013-01-01

The purpose of this study is to investigate whether the dynamic hip immobilization is more favourable for lessening ischemic injury to the immature femoral head than a static immobilization. 152 Japanese white rabbits were divided into four groups randomly, and the hips were immobilized into “human” position (group A), “frog leg” position (group B) and “dynamic frog leg” position (group C). Group D was used as control. Ten rabbits in each group were killed, and the hip specimens were harvested at 1, 2, and 3 weeks after immobilization. Bcl-2/Bax expression balance and chondrocytes apoptosis were analyzed. The remaining eight rabbits in each group were used to measure the blood supply of capital femoral epiphysis by selective vascular perfusion with Indian ink. The Bcl-2/Bax expression ratio in group C was significantly increased than that in group A and B (p<0.001), while that was not significantly different from control group (p=0.0592). At three weeks after immobilization, the average apoptotic ratio was 36.7%, 45.8%, and 26.7% in group A, B and C, respectively (p<0.01). There was no significant difference between group C and normal control (p=0.0597). The perfusion ratio was 0.03±0.03, 0.03±0.02, and 0.08±0.03 in group A, B and C respectively, and 0.12±0.04 in control group (p<0.05). Thus, the dynamic immobilization model exhibited a relatively less chondrocytes apoptosis and disturbance to the femoral head perfusion than other immobilizations in vivo, which therefore may be useful for reducing avascular necrosis following the treatment of developmental dysplasia of the hip. PMID:23330006

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation.

PubMed

Pazhamala, Lekha T; Purohit, Shilp; Saxena, Rachit K; Garg, Vanika; Krishnamurthy, L; Verdier, Jerome; Varshney, Rajeev K

2017-04-01

Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose-proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

PubMed

Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

2014-02-01

The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

Endo-β-mannanase and β-tubulin gene expression during the final phases of coffee seed maturation.

PubMed

Santos, F C; Clemente, A C S; Caixeta, F; Rosa, S D V F

2015-10-02

Coffee seeds begin to develop shortly after fertilization and can take 6 to 8 months to complete their formation, a period during which all the characteristics of the mature seed are determined, directly influencing physiological quality. However, little is known about the molecular mechanisms that act during coffee seed maturation. The objective of the current study was to analyze expression of the β-tubulin (TUB) and endo-β-mannanase (MAN) genes during different phases at the end of development and in different tissues of Coffea arabica seeds. The transcription levels of the TUB and MAN genes were quantified in a relative manner using qRT-PCR in whole seeds, and dissected into embryos and endosperms at different developmental stages. Greater expression of MAN was observed in whole seeds and in endosperms during the green stage, and in the embryo during the over-ripe stage. High TUB gene expression was observed in whole seeds during the green stage and, in the embryos, there were peaks in expression during the over-ripe stage. In endosperms, the peak of expression occurred in both the green stage and in the cherry stage. These results suggest participation of endo-β-mannanase during the initial seed developmental stages, and in the stages of physiological maturity in the embryo tissues. TUB gene expression varied depending on the developmental stage and section of seed analyzed, indicating the participation of β-tubulin during organogenesis and coffee seed maturation.

Laminar-specific and developmental expression of aquaporin-4 in the mouse hippocampus

PubMed Central

Hsu, Mike S.; Seldin, Marcus; Lee, Darrin J.; Seifert, Gerald; Steinhäuser, Christian; Binder, Devin K.

2011-01-01

Mice deficient in the water channel AQP4 demonstrate increased seizure duration in response to hippocampal stimulation as well as impaired extracellular K+ clearance. However, the expression of AQP4 in the hippocampus is not well described. In this study, we investigated i) the developmental, laminar and cell-type specificity of AQP4 expression in the hippocampus; ii) the effect of Kir4.1 deletion on AQP4 expression; and iii) performed Western blot and RT-PCR analyses. AQP4 immunohistochemistry on coronal sections from WT or Kir4.1-/- mice revealed a developmentally-regulated and laminar-specific pattern, with highest expression in the CA1 stratum lacunosummoleculare (SLM) and the molecular layer (ML) of the dentate gyrus (DG). AQP4 was colocalized with the glial markers GFAP and S100ß in the hippocampus, and was also ubiquitously expressed on astrocytic endfeet around blood vessels. No difference in AQP4 immunoreactivity was observed in Kir4.1-/- mice. Electrophysiological and postrecording RT-PCR analyses of individual cells revealed that AQP4 and Kir4.1 were co-expressed in nearly all CA1 astrocytes. In NG2 cells, AQP4 was also expressed at the transcript level. This study is the first to examine subregional AQP4 expression during development of the hippocampus. The strikingly high expression of AQP4 in the CA1 SLM and DG ML identifies these regions as potential sites of astrocytic K+ and H2O regulation. These results begin to delineate the functional capabilities of hippocampal subregions and cell types for K+ and H2O homeostasis, which is critical to excitability and serves as a potential target for modulation in diverse diseases. PMID:21256195

Applications and Challenges in Dynamic Assessment.

ERIC Educational Resources Information Center

Haywood, H. Carl; Tzuriel, David

2002-01-01

Reviews what is known about dynamic assessment, offering examples of its utility as a tool for research and clinical work in psychopathology, neuropsychology, education, the study of cultural differences, and developmental research. After discussing the use of dynamic assessment in assessing outcomes of cognitive education programs, the paper…

Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

PubMed Central

Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

2012-01-01

The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left-right patterning.

PubMed

McDowell, Gary; Rajadurai, Suvithan; Levin, Michael

2016-12-19

Consistent left-right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key 'determinant' genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left–right patterning

PubMed Central

Rajadurai, Suvithan

2016-01-01

Consistent left–right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs. Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key ‘determinant’ genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821521

The dynamics of DNA methylation and hydroxymethylation during amelogenesis.

PubMed

Yoshioka, Hirotaka; Minamizaki, Tomoko; Yoshiko, Yuji

2015-11-01

Amelogenesis is a multistep process that relies on specific temporal and spatial signaling networks between the dental epithelium and mesenchymal tissues. Epigenetic modifications of key developmental genes in this process may be closely linked to a network of molecular events. However, the role of epigenetic regulation in amelogenesis remains unclear. Here, we have uncovered the spatial distributions of 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) to determine epigenetic events in the mandibular incisors of mice. Immunohistochemistry and dot blotting showed that 5-hmC in ameloblasts increased from the secretory stage to the later maturation stage. We also demonstrated the distribution of 5-mC-positive ameloblasts with punctate nuclear labeling from sometime after the initiation of the secretory stage to the later maturation stage; however, dot blotting failed to detect this change. No obvious alteration of 5-mC/5-hmC staining in odontoblasts and dental pulp cells was observed. Concomitant with quantitative expression data, immunohistochemistry showed that maintenance DNA methyltransferase DNMT1 was highly expressed in immature dental epithelial cells and subsequently decreased at later stages of development. Meanwhile, de novo DNA methyltransferase Dnmt3a and Dnmt3b and DNA demethylase Tet family genes were universally expressed, except Tet1 that was highly expressed in immature dental epithelial cells. Thus, DNMT1 may sustain the undifferentiated status of dental epithelial cells through the maintenance of DNA methylation, while the hydroxylation of 5-mC may occur through the whole differentiation process by TET activity. Taken together, these data indicate that the dynamic changes of 5-mC and 5-hmC may be critical for the regulation of amelogenesis.

Evolutionary origin and functional divergence of totipotent cell homeobox genes in eutherian mammals.

PubMed

Maeso, Ignacio; Dunwell, Thomas L; Wyatt, Chris D R; Marlétaz, Ferdinand; Vető, Borbála; Bernal, Juan A; Quah, Shan; Irimia, Manuel; Holland, Peter W H

2016-06-13

A central goal of evolutionary biology is to link genomic change to phenotypic evolution. The origin of new transcription factors is a special case of genomic evolution since it brings opportunities for novel regulatory interactions and potentially the emergence of new biological properties. We demonstrate that a group of four homeobox gene families (Argfx, Leutx, Dprx, Tprx), plus a gene newly described here (Pargfx), arose by tandem gene duplication from the retinal-expressed Crx gene, followed by asymmetric sequence evolution. We show these genes arose as part of repeated gene gain and loss events on a dynamic chromosomal region in the stem lineage of placental mammals, on the forerunner of human chromosome 19. The human orthologues of these genes are expressed specifically in early embryo totipotent cells, peaking from 8-cell to morula, prior to cell fate restrictions; cow orthologues have similar expression. To examine biological roles, we used ectopic gene expression in cultured human cells followed by high-throughput RNA-seq and uncovered extensive transcriptional remodelling driven by three of the genes. Comparison to transcriptional profiles of early human embryos suggest roles in activating and repressing a set of developmentally-important genes that spike at 8-cell to morula, rather than a general role in genome activation. We conclude that a dynamic chromosome region spawned a set of evolutionarily new homeobox genes, the ETCHbox genes, specifically in eutherian mammals. After these genes diverged from the parental Crx gene, we argue they were recruited for roles in the preimplantation embryo including activation of genes at the 8-cell stage and repression after morula. We propose these new homeobox gene roles permitted fine-tuning of cell fate decisions necessary for specification and function of embryonic and extra-embryonic tissues utilised in mammalian development and pregnancy.

Vietnamese children and language-based processing tasks.

PubMed

Hwa-Froelich, Deborah A; Matsuo, Hisako

2005-07-01

Vietnamese children's performance on language-based processing tasks of fast-mapping (FM) word-learning and dynamic assessment (DA) word- and rule-learning tasks were investigated. Twenty-one first- and second-generation Vietnamese preschool children participated in this study. All children were enrolled in 2 Head Start programs in a large city in the Midwest. All children had passed a developmental assessment and routine speech, language, and hearing screenings. All participants were taught 4 invented monosyllabic words in an FM word task, an invented monosyllabic suffix rule (-po) meaning "a part of" in a DA rule task, and 4 invented bisyllabic words in a DA word task. Potential relationships among task performances were investigated. Receptive task performances, expressive task performances, and task totals were added to create receptive total, expressive total, and accumulated performance total (APT) scores. Relationships among receptive total, expressive total, and APT scores were also investigated. Significant correlations were found between FM word, DA rule, and the receptive total. The expressive total correlated with all task total scores, APT, age, and modifiability scores. Modifiability scores correlated with the two DA tasks, expressive total, and the APT. Findings indicate that FM word and the expressive total were positively correlated with most of the other tasks, composite totals, and age. Performance on language-based processing tasks may provide valuable information for separating typically developing Vietnamese preschool children from their peers with language disorders. Practitioners should consider linguistic characteristics of target stimuli. Comparisons should include task, receptive, expressive, and APT.

Candidate ionotropic taste receptors in the Drosophila larva.

PubMed

Stewart, Shannon; Koh, Tong-Wey; Ghosh, Arpan C; Carlson, John R

2015-04-07

We examine in Drosophila a group of ∼35 ionotropic receptors (IRs), the IR20a clade, about which remarkably little is known. Of 28 genes analyzed, GAL4 drivers representing 11 showed expression in the larva. Eight drivers labeled neurons of the pharynx, a taste organ, and three labeled neurons of the body wall that may be chemosensory. Expression was not observed in neurons of one taste organ, the terminal organ, although these neurons express many drivers of the Gr (Gustatory receptor) family. For most drivers of the IR20a clade, we observed expression in a single pair of cells in the animal, with limited coexpression, and only a fraction of pharyngeal neurons are labeled. The organization of IR20a clade expression thus appears different from the organization of the Gr family or the Odor receptor (Or) family in the larva. A remarkable feature of the larval pharynx is that some of its organs are incorporated into the adult pharynx, and several drivers of this clade are expressed in the pharynx of both larvae and adults. Different IR drivers show different developmental dynamics across the larval stages, either increasing or decreasing. Among neurons expressing drivers in the pharynx, two projection patterns can be distinguished in the CNS. Neurons exhibiting these two kinds of projection patterns may activate different circuits, possibly signaling the presence of cues with different valence. Taken together, the simplest interpretation of our results is that the IR20a clade encodes a class of larval taste receptors.

Autism Symptomatology in Boys with Fragile X Syndrome: A Cross Sectional Developmental Trajectories Comparison with Nonsyndromic Autism Spectrum Disorder

PubMed Central

Thurman, Angela John; McDuffie, Andrea; Kover, Sara T.; Hagerman, Randi J.; Abbeduto, Leonard

2015-01-01

Although males with fragile X syndrome (FXS) are frequently described as demonstrating autism symptomatology, there is much debate regarding whether the behavioral symptoms representing the core domains of autism are the result of the same or different underlying neurological/psychological mechanisms. The present study used a cross-sectional developmental trajectories approach to compare the profiles of autism symptomatology relative to chronological age (CA), nonverbal IQ, and expressive vocabulary ability between individuals with FXS and individuals with nonsyndromic ASD. Results suggest that the onset of autism symptoms and their developmental trajectories in males with FXS differ in important ways as a function of chronological age, nonverbal cognitive ability, and expressive vocabulary relative to males with nonsyndromic ASD. Theoretical and clinical implications are discussed. PMID:25904201

Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba.

PubMed

Lin, Liyuan; Han, Xiaojiao; Chen, Yicun; Wu, Qingke; Wang, Yangdong

2013-12-01

Quantitative real-time PCR has emerged as a highly sensitive and widely used method for detection of gene expression profiles, via which accurate detection depends on reliable normalization. Since no single control is appropriate for all experimental treatments, it is generally advocated to select suitable internal controls prior to use for normalization. This study reported the evaluation of the expression stability of twelve potential reference genes in different tissue/organs and six fruit developmental stages of Litsea cubeba in order to screen the superior internal reference genes for data normalization. Two softwares-geNorm, and NormFinder-were used to identify stability of these candidate genes. The cycle threshold difference and coefficient of variance were also calculated to evaluate the expression stability of candidate genes. F-BOX, EF1α, UBC, and TUA were selected as the most stable reference genes across 11 sample pools. F-BOX, EF1α, and EIF4α exhibited the highest expression stability in different tissue/organs and different fruit developmental stages. Besides, a combination of two stable reference genes would be sufficient for gene expression normalization in different fruit developmental stages. In addition, the relative expression profiles of DXS and DXR were evaluated by EF1α, UBC, and SAMDC. The results further validated the reliability of stable reference genes and also highlighted the importance of selecting suitable internal controls for L. cubeba. These reference genes will be of great importance for transcript normalization in future gene expression studies on L. cubeba.

Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

PubMed

Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

2014-11-01

Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

PubMed

Metzger, David C H; Schulte, Patricia M

2018-04-14

Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.