Sample records for developmental expression patterns

  1. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  2. Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

    PubMed

    Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

    2016-02-01

    Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Dynamic CRM occupancy reflects a temporal map of developmental progression.

    PubMed

    Wilczyński, Bartek; Furlong, Eileen E M

    2010-06-22

    Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

  4. Remodeling a tissue: subtraction adds insight.

    PubMed

    Axelrod, Jeffrey D

    2012-11-27

    Sculpting a body plan requires both patterning of gene expression and translating that pattern into morphogenesis. Developmental biologists have made remarkable strides in understanding gene expression patterning, but despite a long history of fascination with the mechanics of morphogenesis, knowledge of how patterned gene expression drives the emergence of even simple shapes and forms has grown at a slower pace. The successful merging of approaches from cell biology, developmental biology, imaging, engineering, and mathematical and computational sciences is now accelerating progress toward a fuller and better integrated understanding of the forces shaping morphogenesis.

  5. Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

    PubMed Central

    Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

    2016-01-01

    Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

  6. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    PubMed

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  7. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    PubMed Central

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

  8. Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

    PubMed Central

    Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

    2010-01-01

    Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

  9. Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

    PubMed

    Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

    2012-01-01

    Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

  10. On Expression Patterns and Developmental Origin of Human Brain Regions.

    PubMed

    Kirsch, Lior; Chechik, Gal

    2016-08-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

  11. On Expression Patterns and Developmental Origin of Human Brain Regions

    PubMed Central

    Kirsch, Lior; Chechik, Gal

    2016-01-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

  12. Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

    PubMed

    Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

    2014-11-27

    Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

  13. Predictive computation of genomic logic processing functions in embryonic development

    PubMed Central

    Peter, Isabelle S.; Faure, Emmanuel; Davidson, Eric H.

    2012-01-01

    Gene regulatory networks (GRNs) control the dynamic spatial patterns of regulatory gene expression in development. Thus, in principle, GRN models may provide system-level, causal explanations of developmental process. To test this assertion, we have transformed a relatively well-established GRN model into a predictive, dynamic Boolean computational model. This Boolean model computes spatial and temporal gene expression according to the regulatory logic and gene interactions specified in a GRN model for embryonic development in the sea urchin. Additional information input into the model included the progressive embryonic geometry and gene expression kinetics. The resulting model predicted gene expression patterns for a large number of individual regulatory genes each hour up to gastrulation (30 h) in four different spatial domains of the embryo. Direct comparison with experimental observations showed that the model predictively computed these patterns with remarkable spatial and temporal accuracy. In addition, we used this model to carry out in silico perturbations of regulatory functions and of embryonic spatial organization. The model computationally reproduced the altered developmental functions observed experimentally. Two major conclusions are that the starting GRN model contains sufficiently complete regulatory information to permit explanation of a complex developmental process of gene expression solely in terms of genomic regulatory code, and that the Boolean model provides a tool with which to test in silico regulatory circuitry and developmental perturbations. PMID:22927416

  14. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    PubMed Central

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  15. Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

    PubMed Central

    Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

    2004-01-01

    Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

  16. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

    PubMed Central

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

    2016-01-01

    Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

  17. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  18. Discovering sparse transcription factor codes for cell states and state transitions during development

    PubMed Central

    Furchtgott, Leon A; Melton, Samuel; Menon, Vilas; Ramanathan, Sharad

    2017-01-01

    Computational analysis of gene expression to determine both the sequence of lineage choices made by multipotent cells and to identify the genes influencing these decisions is challenging. Here we discover a pattern in the expression levels of a sparse subset of genes among cell types in B- and T-cell developmental lineages that correlates with developmental topologies. We develop a statistical framework using this pattern to simultaneously infer lineage transitions and the genes that determine these relationships. We use this technique to reconstruct the early hematopoietic and intestinal developmental trees. We extend this framework to analyze single-cell RNA-seq data from early human cortical development, inferring a neocortical-hindbrain split in early progenitor cells and the key genes that could control this lineage decision. Our work allows us to simultaneously infer both the identity and lineage of cell types as well as a small set of key genes whose expression patterns reflect these relationships. DOI: http://dx.doi.org/10.7554/eLife.20488.001 PMID:28296636

  19. Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina.

    PubMed

    Gunter, Helen M; Degnan, Bernard M

    2007-08-01

    Heat shock proteins (Hsps) have dual functions, participating in both the stress response and a broad range of developmental processes. At physiological temperatures, it has been demonstrated in deuterostomes (vertebrates) and ecdysozoans (insects) that Hsps are expressed in tissues that are undergoing differentiation and morphogenesis. Here we investigate the developmental expression of Hsp70, Hsp90 and their regulatory transcription factor heat shock transcription factor (HSF) in the marine gastropod Haliotis asinina, a representative of the 3rd major lineage of bilaterian animals, the Lophotrochozoa. HasHsp70, HasHsp90 and HasHSF are maternally expressed in H. asinina and are progressively restricted to the micromere lineage during cleavage. During larval morphogenesis, they are expressed in unique and overlapping patterns in the prototroch, foot, and mantle. Hsp expression peaked in these tissues during periods of cell differentiation and morphogenesis, returning to lower levels after morphogenesis was complete. These patterns of Hsp and HSF expression in H. asinina are akin to those observed in ecdysozoans and deuterostomes, with Hsps being activated in cells and tissues undergoing morphogenesis.

  20. Patterns of expression of position-dependent integrated transgenes in mouse embryo.

    PubMed Central

    Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

    1990-01-01

    The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

  1. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  2. Neuronal expression of fibroblast growth factor receptors in zebrafish.

    PubMed

    Rohs, Patricia; Ebert, Alicia M; Zuba, Ania; McFarlane, Sarah

    2013-12-01

    Fibroblast growth factor (FGF) signaling is important for a host of developmental processes such as proliferation, differentiation, tissue patterning, and morphogenesis. In vertebrates, FGFs signal through a family of four fibroblast growth factor receptors (FGFR 1-4), one of which is duplicated in zebrafish (FGFR1). Here we report the mRNA expression of the five known zebrafish fibroblast growth factor receptors at five developmental time points (24, 36, 48, 60, and 72h postfertilization), focusing on expression within the central nervous system. We show that the receptors have distinct and dynamic expression in the developing zebrafish brain, eye, inner ear, lateral line, and pharynx. In many cases, the expression patterns are similar to those of homologous FGFRs in mouse, chicken, amphibians, and other teleosts. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

    PubMed

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

    2017-01-01

    Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  4. Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

    PubMed Central

    Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

    2016-01-01

    Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

  5. The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

    PubMed

    Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

    2018-03-01

    Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

  6. MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

    PubMed Central

    Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

    2010-01-01

    Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

  7. Evolutionary stasis in Euphorbiaceae pollen: selection and constraints.

    PubMed

    Matamoro-Vidal, A; Furness, C A; Gouyon, P-H; Wurdack, K J; Albert, B

    2012-06-01

    Although much attention has been paid to the role of stabilizing selection, empirical analyses testing the role of developmental constraints in evolutionary stasis remain rare, particularly for plants. This topic is studied here with a focus on the evolution of a pollen ontogenetic feature, the last points of callose deposition (LPCD) pattern, involved in the determination of an adaptive morphological pollen character (aperture pattern). The LPCD pattern exhibits a low level of evolution in eudicots, as compared to the evolution observed in monocots. Stasis in this pattern might be explained by developmental constraints expressed during male meiosis (microsporogenesis) or by selective pressures expressed through the adaptive role of the aperture pattern. Here, we demonstrate that the LPCD pattern is conserved in Euphorbiaceae s.s. and that this conservatism is primarily due to selective pressures. A phylogenetic association was found between the putative removal of selective pressures on pollen morphology after the origin of inaperturate pollen, and the appearance of variation in microsporogenesis and in the resulting LPCD pattern, suggesting that stasis was due to these selective pressures. However, even in a neutral context, variation in microsporogenesis was biased. This should therefore favour the appearance of some developmental and morphological phenotypes rather than others. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  8. The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

    PubMed

    Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

    2007-03-01

    Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

  9. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  10. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  11. MAEWEST expression in flower development of two petunia species.

    PubMed

    Segatto, Ana Lúcia A; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B; Monte-Bello, Carolina C; Dornelas, Marcelo C; Margis, Rogerio; Freitas, Loreta B

    2013-07-03

    Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription-quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

  12. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    PubMed

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  13. Developmental constraints shape the evolution of the nematode mid-developmental transition.

    PubMed

    Zalts, Harel; Yanai, Itai

    2017-03-27

    Evolutionary theory assumes that genetic variation is uniform and gradual in nature, yet morphological and gene expression studies have revealed that different life-stages exhibit distinct levels of cross-species conservation. In particular, a stage in mid-embryogenesis is highly conserved across species of the same phylum, suggesting that this stage is subject to developmental constraints, either by increased purifying selection or by a strong mutational bias. An alternative explanation, however, holds that the same 'hourglass' pattern of variation may result from increased positive selection at the earlier and later stages of development. To distinguish between these scenarios, we examined gene expression variation in a population of the nematode Caenorhabditis elegans using an experimental design that eliminated the influence of positive selection. By measuring gene expression for all genes throughout development in 20 strains, we found that variations were highly uneven throughout development, with a significant depletion during mid-embryogenesis. In particular, the family of homeodomain transcription factors, whose expression generally coincides with mid-embryogenesis, evolved under high constraint. Our data further show that genes responsible for the integration of germ layers during morphogenesis are the most constrained class of genes. Together, these results provide strong evidence for developmental constraints as the mechanism underlying the hourglass model of animal evolution. Understanding the pattern and mechanism of developmental constraints provides a framework to understand how evolutionary processes have interacted with embryogenesis and led to the diversity of animal life on Earth.

  14. Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers

    PubMed Central

    Naxerova, Kamila; Bult, Carol J; Peaston, Anne; Fancher, Karen; Knowles, Barbara B; Kasif, Simon; Kohane, Isaac S

    2008-01-01

    Background In recent years, the molecular underpinnings of the long-observed resemblance between neoplastic and immature tissue have begun to emerge. Genome-wide transcriptional profiling has revealed similar gene expression signatures in several tumor types and early developmental stages of their tissue of origin. However, it remains unclear whether such a relationship is a universal feature of malignancy, whether heterogeneities exist in the developmental component of different tumor types and to which degree the resemblance between cancer and development is a tissue-specific phenomenon. Results We defined a developmental landscape by summarizing the main features of ten developmental time courses and projected gene expression from a variety of human tumor types onto this landscape. This comparison demonstrates a clear imprint of developmental gene expression in a wide range of tumors and with respect to different, even non-cognate developmental backgrounds. Our analysis reveals three classes of cancers with developmentally distinct transcriptional patterns. We characterize the biological processes dominating these classes and validate the class distinction with respect to a new time series of murine embryonic lung development. Finally, we identify a set of genes that are upregulated in most cancers and we show that this signature is active in early development. Conclusion This systematic and quantitative overview of the relationship between the neoplastic and developmental transcriptome spanning dozens of tissues provides a reliable outline of global trends in cancer gene expression, reveals potentially clinically relevant differences in the gene expression of different cancer types and represents a reference framework for interpretation of smaller-scale functional studies. PMID:18611264

  15. Transcription factors define the neuroanatomical organization of the medullary reticular formation

    PubMed Central

    Gray, Paul A.

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic. PMID:23717265

  16. Transcription factors define the neuroanatomical organization of the medullary reticular formation.

    PubMed

    Gray, Paul A

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic.

  17. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  18. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  19. Impaired Integration of Emotional Faces and Affective Body Context in a Rare Case of Developmental Visual Agnosia

    PubMed Central

    Aviezer, Hillel; Hassin, Ran. R.; Bentin, Shlomo

    2011-01-01

    In the current study we examined the recognition of facial expressions embedded in emotionally expressive bodies in case LG, an individual with a rare form of developmental visual agnosia who suffers from severe prosopagnosia. Neuropsychological testing demonstrated that LG‘s agnosia is characterized by profoundly impaired visual integration. Unlike individuals with typical developmental prosopagnosia who display specific difficulties with face identity (but typically not expression) recognition, LG was also impaired at recognizing isolated facial expressions. By contrast, he successfully recognized the expressions portrayed by faceless emotional bodies handling affective paraphernalia. When presented with contextualized faces in emotional bodies his ability to detect the emotion expressed by a face did not improve even if it was embedded in an emotionally-congruent body context. Furthermore, in contrast to controls, LG displayed an abnormal pattern of contextual influence from emotionally-incongruent bodies. The results are interpreted in the context of a general integration deficit in developmental visual agnosia, suggesting that impaired integration may extend from the level of the face to the level of the full person. PMID:21482423

  20. Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

    PubMed

    Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

    2015-11-05

    Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

  1. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    PubMed

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  2. The RNA-Seq-based high resolution gene expression atlas of chickpea (Cicer arietinum L.) reveals dynamic spatio-temporal changes associated with growth and development.

    PubMed

    Kudapa, Himabindu; Garg, Vanika; Chitikineni, Annapurna; Varshney, Rajeev K

    2018-04-10

    Chickpea is one of the world's largest cultivated food legumes and is an excellent source of high-quality protein to the human diet. Plant growth and development are controlled by programmed expression of a suite of genes at the given time, stage, and tissue. Understanding how the underlying genome sequence translates into specific plant phenotypes at key developmental stages, information on gene expression patterns is crucial. Here, we present a comprehensive Cicer arietinum Gene Expression Atlas (CaGEA) across different plant developmental stages and organs covering the entire life cycle of chickpea. One of the widely used drought tolerant cultivars, ICC 4958 has been used to generate RNA-Seq data from 27 samples at 5 major developmental stages of the plant. A total of 816 million raw reads were generated and of these, 794 million filtered reads after quality control (QC) were subjected to downstream analysis. A total of 15,947 unique number of differentially expressed genes across different pairwise tissue combinations were identified. Significant differences in gene expression patterns contributing in the process of flowering, nodulation, and seed and root development were inferred in this study. Furthermore, differentially expressed candidate genes from "QTL-hotspot" region associated with drought stress response in chickpea were validated. © 2018 The Authors. Plant, Cell & Environment Published by John Wiley & Sons Ltd.

  3. The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

    PubMed Central

    Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

    2007-01-01

    Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

  4. Sodium butyrate improves the cloned yak embryo viability and corrects gene expression patterns.

    PubMed

    Xiong, Xian-rong; Lan, Dao-liang; Li, Jian; Wang, Yong; Zhong, Jin-cheng

    2015-02-01

    Interspecies somatic cell nuclear transfer (iSCNT), a powerful tool in basic scientific research, has been used widely to increase and preserve the population of endangered species. Yak (Bos grunniens) is one of these species. Development to term of interspecies cloned yak embryos has not been achieved, possibly due to abnormal epigenetic reprogramming. Previous studies have demonstrated that treatment of intraspecies cloned embryos with (NaBu) significantly improves nuclear-cytoplasmic reprogramming and viability in vitro. Therefore, in this study, we evaluated the effect of optimal NaBu concentration and exposure time on preimplantation development of yak iSCNT embryos and on the expression patterns of developmentally important genes. The results showed that 8-cell rate, blastocyst formation rate and total cell number increased significantly compared with their untreated counterparts when yak iSCNT embryos were treated with 5 nM NaBu for 12 h after activation, but that the 2-cell stage embryo rate was not significantly different. The treatment of NaBu also increased significantly the expression levels of Oct-4 and decreased the expression levels of HDAC-2, Dnmt-1 and IGF-1; the expression patterns of these genes were more similar to that of their bovine-yak in vitro fertilization (BY-IVF) counterparts. The results described above indicated that NaBu treatment improved developmental competence in vitro and 'corrected' the gene expression patterns of yak iSCNT embryos.

  5. Water Uptake along the Length of Grapevine Fine Roots: Developmental anatomy, tissue specific aquaporin expression, and pathways of water transport

    USDA-ARS?s Scientific Manuscript database

    To better understand water uptake patterns in root systems of woody perennial crops, we detailed the developmental anatomy and hydraulic physiology along the length of grapevine fine roots- from the tip to secondary growth zones. Our characterization included localization of suberized structures an...

  6. MAEWEST Expression in Flower Development of Two Petunia Species

    PubMed Central

    Segatto, Ana Lúcia A.; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B.; Monte-Bello, Carolina C.; Dornelas, Marcelo C.; Margis, Rogerio; Freitas, Loreta B.

    2013-01-01

    Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription–quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions. PMID:23823801

  7. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  8. Influence of Intensity on Children's Sensitivity to Happy, Sad, and Fearful Facial Expressions

    ERIC Educational Resources Information Center

    Gao, Xiaoqing; Maurer, Daphne

    2009-01-01

    Most previous studies investigating children's ability to recognize facial expressions used only intense exemplars. Here we compared the sensitivity of 5-, 7-, and 10-year-olds with that of adults (n = 24 per age group) for less intense expressions of happiness, sadness, and fear. The developmental patterns differed across expressions. For…

  9. Many human accelerated regions are developmental enhancers

    PubMed Central

    Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

    2013-01-01

    The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

  10. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.

    2008-09-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND)more » 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression ({>=} 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans.« less

  11. Differential cadherin expression in the developing postnatal telencephalon of a New World monkey.

    PubMed

    Matsunaga, Eiji; Nambu, Sanae; Oka, Mariko; Iriki, Atsushi

    2013-12-01

    Cadherins are cell adhesion molecules widely expressed in the nervous system, where they play various roles in neural patterning, nuclei formation, axon guidance, and synapse formation and function. Although many published articles have reported on cadherin expression in rodents and ferrets, there are limited data on their expression in primate brains. In this study, in situ hybridization analysis was performed for 10 cadherins [nine classic cadherins (Cdh4, -6, -7, -8, -9, -10, -11, -12, and -20) and T-cadherin (Cdh13)] in the developing postnatal telencephalon of the common marmoset (Callithrix jacchus). Each cadherin showed broad expression in the cerebral cortex, basal ganglia, amygdala, and hippocampus, as previously shown in the rodent brain. However, detailed expression patterns differed between rodents and marmosets. In contrast to rodents, cadherin expression was reduced overall and localized to restricted areas of the brain during the developmental process, suggesting that cadherins are more crucially involved in developmental or maturation processes rather than in neural functioning. These results also highlight the possibility that restricted/less redundant cadherin expression allows primate brains to generate functional diversity among neurons, allowing morphological and functional differences between rodents and primates. Copyright © 2013 Wiley Periodicals, Inc.

  12. Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

    PubMed

    Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

    2016-02-26

    The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

    PubMed Central

    Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

    1997-01-01

    A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

  14. Spatial distribution and expression of intracellular and extracellular acid phosphatases of cluster roots at different developmental stages in white lupin.

    PubMed

    Tang, Hongliang; Li, Xiaoqing; Zu, Chao; Zhang, Fusuo; Shen, Jianbo

    2013-09-15

    Acid phosphatases (APases) play a key role in phosphorus (P) acquisition and recycling in plants. White lupin (Lupinus albus L.) forms cluster roots (CRs) and produces large amounts of APases under P deficiency. However, the relationships between the activity of intracellular and extracellular APases (EC 3.1.3.2) and CR development are not fully understood. Here, comparative studies were conducted to examine the spatial variation pattern of APase activity during CR development using the enzyme-labelled fluorescence-97 (ELF-97) and the p-nitrophenyl phosphate methods. The activity of intracellular and extracellular APases was significantly enhanced under P deficiency in the non-CRs and CRs at different developmental stages. These two APases exhibited different spatial distribution patterns during CR development, and these distribution patterns were highly modified by P deficiency. The activity of extracellular APase increased steadily with CR development from meristematic, juvenile, mature to senescent stages under P deficiency. In comparison, P deficiency-induced increase in the activity of intracellular APase remained relatively constant during CR development. Increased activity of intracellular and extracellular APases was associated with enhanced expression of LaSAP1 encoding intracellular APase and LaSAP2 encoding extracellular APase. The expression levels of these two genes were significantly higher at transcriptional level in both mature and senescent CRs. Taken together, these findings demonstrate that both activity and gene expression of intracellular or extracellular APases exhibit a differential response pattern during CR development, depending on root types, CR developmental stages and P supply. Simultaneous in situ determination of intracellular and extracellular APase activity has proved to be an effective approach for studying spatial variation of APases during CR development. Copyright © 2013 Elsevier GmbH. All rights reserved.

  15. Developmental and Individual Differences in the Neural Processing of Dynamic Expressions of Pain and Anger

    PubMed Central

    Missana, Manuela; Grigutsch, Maren; Grossmann, Tobias

    2014-01-01

    We examined the processing of facial expressions of pain and anger in 8-month-old infants and adults by measuring event-related brain potentials (ERPs) and frontal EEG alpha asymmetry. The ERP results revealed that while adults showed a late positive potential (LPP) to emotional expressions that was enhanced to pain expressions, reflecting increased evaluation and emotional arousal to pain expressions, infants showed a negative component (Nc) to emotional expressions that was enhanced to angry expressions, reflecting increased allocation of attention to angry faces. Moreover, infants and adults showed opposite patterns in their frontal asymmetry responses to pain and anger, suggesting developmental differences in the motivational processes engendered by these facial expressions. These findings are discussed in the light of associated individual differences in infant temperament and adult dispositional empathy. PMID:24705497

  16. Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

    PubMed

    Deschamps, Cícero; Simon, James E

    2010-01-01

    Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

  17. Functional autonomy of distant-acting human enhancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Visel, Axel; Akiyama, Jennifer A.; Shoukry, Malak

    2009-02-19

    Many human genes are associated with dispersed arrays of transcriptional enhancers that regulate their expression in time and space. Studies in invertebrate model systems have suggested that these elements function as discrete and independent regulatory units, but the in vivo combinatorial properties of vertebrate enhancers remain poorly understood. To explore the modularity and regulatory autonomy of human developmental enhancers, we experimentally concatenated up to four enhancers from different genes and used a transgenic mouse assay to compare the in vivo activity of these compound elements with that of the single modules. In all of the six different combinations of elementsmore » tested, the reporter gene activity patterns were additive without signs of interference between the individual modules, indicating that regulatory specificity was maintained despite the presence of closely-positioned heterologous enhancers. Even in cases where two elements drove expression in close anatomical proximity, such as within neighboring subregions of the developing limb bud, the compound patterns did not show signs of cross-inhibition between individual elements or novel expression sites. These data indicate that human developmental enhancers are highly modular and functionally autonomous and suggest that genomic enhancer shuffling may have contributed to the evolution of complex gene expression patterns in vertebrates« less

  18. Evolution and inheritance of early embryonic patterning in D. simulans and D. sechellia

    PubMed Central

    Lott, Susan E.; Ludwig, Michael Z.; Kreitman, Martin

    2010-01-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation which selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth ‘stripe allometry’) in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species D. simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the “margin of error” for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness PMID:21121913

  19. Embryology of the lamprey and evolution of the vertebrate jaw: insights from molecular and developmental perspectives.

    PubMed Central

    Kuratani, S; Nobusada, Y; Horigome, N; Shigetani, Y

    2001-01-01

    Evolution of the vertebrate jaw has been reviewed and discussed based on the developmental pattern of the Japanese marine lamprey, Lampetra japonica. Though it never forms a jointed jaw apparatus, the L. japonica embryo exhibits the typical embryonic structure as well as the conserved regulatory gene expression patterns of vertebrates. The lamprey therefore shares the phylotype of vertebrates, the conserved embryonic pattern that appears at pharyngula stage, rather than representing an intermediate evolutionary state. Both gnathostomes and lampreys exhibit a tripartite configuration of the rostral-most crest-derived ectomesenchyme, each part occupying an anatomically equivalent site. Differentiated oral structure becomes apparent in post-pharyngula development. Due to the solid nasohypophyseal plate, the post-optic ectomesenchyme of the lamprey fails to grow rostromedially to form the medial nasal septum as in gnathostomes, but forms the upper lip instead. The gnathostome jaw may thus have arisen through a process of ontogenetic repatterning, in which a heterotopic shift of mesenchyme-epithelial relationships would have been involved. Further identification of shifts in tissue interaction and expression of regulatory genes are necessary to describe the evolution of the jaw fully from the standpoint of evolutionary developmental biology. PMID:11604127

  20. Reassessing ecdysteroidogenic cells from the cell membrane receptors' perspective.

    PubMed

    Alexandratos, Alexandros; Moulos, Panagiotis; Nellas, Ioannis; Mavridis, Konstantinos; Dedos, Skarlatos G

    2016-02-05

    Ecdysteroids secreted by the prothoracic gland (PG) cells of insects control the developmental timing of their immature life stages. These cells have been historically considered as carrying out a single function in insects, namely the biochemical conversion of cholesterol to ecdysteroids and their secretion. A growing body of evidence shows that PG cells receive multiple cues during insect development so we tested the hypothesis that they carry out more than just one function in insects. We characterised the molecular nature and developmental profiles of cell membrane receptors in PG cells of Bombyx mori during the final larval stage and determined what receptors decode nutritional, developmental and physiological signals. Through iterative approaches we identified a complex repertoire of cell membrane receptors that are expressed in intricate patterns and activate previously unidentified signal transduction cascades in PG cells. The expression patterns of some of these receptors explain precisely the mechanisms that are known to control ecdysteroidogenesis. However, the presence of receptors for the notch, hedgehog and wingless signalling pathways and the expression of innate immunity-related receptors such as phagocytosis receptors, receptors for microbial ligands and Toll-like receptors call for a re-evaluation of the role these cells play in insects.

  1. Hox genes, digit identities and the theropod/bird transition.

    PubMed

    Galis, Frietson; Kundrát, Martin; Metz, Johan A J

    2005-05-15

    Vargas and Fallon (2005. J Exp Zool (Mol Dev Evol) 304B:86-90) propose that Hox gene expression patterns indicate that the most anterior digit in bird wings is homologous to digit 1 rather than to digit 2 in other amniotes. This interpretation is based on the presence of Hoxd13 expression in combination with the absence of Hoxd12 expression in the second digit condensation from which this digit develops (the first condensation is transiently present). This is a pattern that is similar to that in the developing digit 1 of the chicken foot and the mouse hand and foot. They have tested this new hypothesis by analysing Hoxd12 and Hoxd13 expression patterns in two polydactylous chicken mutants, Silkie and talpid2. They conclude that the data support the notion that the most anterior remaining digit of the bird wing is homologous to digit 1 in other amniotes either in a standard phylogenetic sense, or alternatively in a (limited) developmental sense in agreement with the Frameshift Hypothesis of Wagner and Gautier (1999, i.e., that the developmental pathway is homologous to the one that leads to a digit 1 identity in other amniotes, although it occurs in the second instead of the first digit condensation). We argue that the Hoxd12 and Hoxd13 expression patterns found for these and other limb mutants do not allow distinguishing between the hypothesis of Vargas and Fallon (2005. J Exp Zool (Mol Dev Evol) 304B:86-90) and the alternative one, i.e., the most anterior digit in bird wings is homologous to digit 2 in other amniotes, in a phylogenetic or developmental sense. Therefore, at the moment the data on limb mutants does not present a challenge to the hypothesis, based on other developmental data (Holmgren, 1955. Acta Zool 36:243-328; Hinchliffe, 1984. In: Hecht M, Ostrom JH, Viohl G, Wellnhofer P, editors. The beginnings of birds. Eichstätt: Freunde des Jura-Museum. p 141-147; Burke and Feduccia, 1997. Science 278:666-668; Kundrát et al., 2002. J Exp Zool (Mol Dev Evol) 294B:151-159; Larsson and Wagner, 2002. J Exp Zool (Mol Dev Evol) 294B:146-151; Feduccia and Nowicki, 2002. Naturwissenschaften 89:391-393), that the digits of bird wings are homologous to digits 2,3,4 in amniotes. We recommend further testing of the hypothesis by comparing Hoxd expression patterns in different taxa. Copyright 2005 Wiley-Liss, Inc

  2. Function and Evolution of DNA Methylation in Nasonia vitripennis

    PubMed Central

    Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

    2013-01-01

    The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

  3. Differential expression of syndecan isoforms during mouse incisor amelogenesis.

    PubMed

    Muto, Taro; Miyoshi, Keiko; Munesue, Seiichi; Nakada, Hiroshi; Okayama, Minoru; Matsuo, Takashi; Noma, Takafumi

    2007-08-01

    Syndecans are transmembranous heparan sulfate proteoglycans (HSPGs) with covalently attached glycosaminoglycan side-chains located on the cell surface. The mammalian syndecan family is composed of four types of syndecans (syndecan-1 to -4). Syndecans interact with the intracellular cytoskeleton through the cytoplasmic domains of their core proteins and membrane proteins, extracellular enzymes, growth factors, and matrix components, through their heparan-sulfate chains, to regulate developmental processes.Here, as a first step to assess the possible roles of syndecan proteins in amelogenesis, we examined the expression patterns of all syndecan isoforms in continuously growing mouse incisors, in which we can overview major differentiation stages of amelogenesis at a glance. Understanding the expression domain of each syndecan isoform during specific developmental stages seems useful for investigating their physiological roles in amelogenesis. Immunohistochemical analysis of syndecan core proteins in the lower incisors from postnatal day 1 mice revealed spatially and temporally specific expression patterns, with syndecan-1 expressed in undifferentiated epithelial and mesenchymal cells, and syndecan-2, -3, and -4 in more differentiated cells. These findings suggest that each syndecan isoform functions distinctly during the amelogenesis of the incisors of mice.

  4. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  5. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

    PubMed

    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

    2013-01-01

    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  6. Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

    PubMed Central

    Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

    2006-01-01

    Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

  7. Language Experiences. Developmental Skills Series, Booklet IV.

    ERIC Educational Resources Information Center

    University City School District, MO.

    GRADES OR AGES: Not specified. It appears to be for kindergarten and primary grades. SUBJECT MATTER: Language and speech, including language patterns, accurate expression of ideas, creative expression of ideas, connection of sound with symbols, and speech improvement. ORGANIZATION AND PHYSICAL APPEARANCE: The guide is divided into five sections,…

  8. Developmental studies of the lamprey and hierarchical evolutionary steps towards the acquisition of the jaw

    PubMed Central

    Kuratani, Shigeru

    2005-01-01

    The evolution of animal morphology can be understood as a series of changes in developmental programs. Among vertebrates, some developmental stages are conserved across species, representing particular developmental constraints. One of the most conserved stages is the vertebrate pharyngula, in which similar embryonic morphology is observed and the Hox code is clearly expressed. The oral developmental program also appears to be constrained to some extent, as both its morphology and the the Hox-code-default state of the oropharyngeal region are well conserved between the lamprey and gnathostome embryos. These features do not by themselves explain the evolution of jaws, but should be regarded as a prerequisite for evolutionary diversification of the mandibular arch. By comparing the pharyngula morphology of the lamprey and gnathostomes, it has become clear that the oral pattern is not entirely identical; in particular, the positional differentiation of the rostral ectomesenchyme is shifted between these animals. Therefore, the jaw seems to have arisen as an evolutionary novelty by overriding ancestral constraints, a process in which morphological homologies are partially lost. This change involves the heterotopic shift of tissue interaction, which appears to have been preceded by the transition from monorhiny to diplorhiny, as well as separation of the hypophysis. When gene expression patterns are compared between the lamprey and gnathostomes, cell-autonomously functioning genes tend to be associated with identical cell types or equivalent anatomical domains, whereas growth-factor-encoding genes have changed their expression domains during evolution. Thus, the heterotopic evolution may be based on changes in the regulation of signalling-molecule-encoding genes. PMID:16313390

  9. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    PubMed

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  10. Genome-wide identification of 52 cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus and their B[α]P-induced expression patterns.

    PubMed

    Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong

    2017-09-01

    Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Extensive transcriptional response associated with seasonal plasticity of butterfly wing patterns.

    PubMed

    Daniels, Emily V; Murad, Rabi; Mortazavi, Ali; Reed, Robert D

    2014-12-01

    In the eastern United States, the buckeye butterfly, Junonia coenia, shows seasonal wing colour plasticity where adults emerging in the spring are tan, while those emerging in the autumn are dark red. This variation can be artificially induced in laboratory colonies, thus making J. coenia a useful model system to examine the mechanistic basis of plasticity. To better understand the developmental basis of seasonal plasticity, we used RNA-seq to quantify transcription profiles associated with development of alternative seasonal wing morphs. Depending on the developmental stage, between 547 and 1420 transfrags were significantly differentially expressed between morphs. These extensive differences in gene expression stand in contrast to the much smaller numbers of differentially expressed transcripts identified in previous studies of genetic wing pattern variation in other species and suggest that environmentally induced phenotypic shifts arise from very broad systemic processes. Analyses of candidate endocrine and pigmentation transcripts revealed notable genes upregulated in the red morph, including several ecdysone-associated genes, and cinnabar, an ommochrome pigmentation gene implicated in colour pattern variation in other butterflies. We also found multiple melanin-related transcripts strongly upregulated in the red morph, including tan and yellow-family genes, leading us to speculate that dark red pigmentation in autumn J. coenia may involve nonommochrome pigments. While we identified several endocrine and pigmentation genes as obvious candidates for seasonal colour morph differentiation, we speculate that the majority of observed expression differences were due to thermal stress response. The buckeye transcriptome provides a basis for further developmental studies of phenotypic plasticity. © 2014 John Wiley & Sons Ltd.

  12. Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

    PubMed

    Izard, Carroll E; Abe, Jo Ann A

    2004-09-01

    Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

  13. Plastid Transcriptomics and Translatomics of Tomato Fruit Development and Chloroplast-to-Chromoplast Differentiation: Chromoplast Gene Expression Largely Serves the Production of a Single Protein[W][OA

    PubMed Central

    Kahlau, Sabine; Bock, Ralph

    2008-01-01

    Plastid genes are expressed at high levels in photosynthetically active chloroplasts but are generally believed to be drastically downregulated in nongreen plastids. The genome-wide changes in the expression patterns of plastid genes during the development of nongreen plastid types as well as the contributions of transcriptional versus translational regulation are largely unknown. We report here a systematic transcriptomics and translatomics analysis of the tomato (Solanum lycopersicum) plastid genome during fruit development and chloroplast-to-chromoplast conversion. At the level of RNA accumulation, most but not all plastid genes are strongly downregulated in fruits compared with leaves. By contrast, chloroplast-to-chromoplast differentiation during fruit ripening is surprisingly not accompanied by large changes in plastid RNA accumulation. However, most plastid genes are translationally downregulated during chromoplast development. Both transcriptional and translational downregulation are more pronounced for photosynthesis-related genes than for genes involved in gene expression, indicating that some low-level plastid gene expression must be sustained in chromoplasts. High-level expression during chromoplast development identifies accD, the only plastid-encoded gene involved in fatty acid biosynthesis, as the target gene for which gene expression activity in chromoplasts is maintained. In addition, we have determined the developmental patterns of plastid RNA polymerase activities, intron splicing, and RNA editing and report specific developmental changes in the splicing and editing patterns of plastid transcripts. PMID:18441214

  14. Transcriptional dynamics of the developing sweet cherry (Prunus avium L.) fruit: sequencing, annotation and expression profiling of exocarp-associated genes

    PubMed Central

    Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz

    2014-01-01

    The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533

  15. Comparative genome and transcriptome analyses of the social amoeba Acytostelium subglobosum that accomplishes multicellular development without germ-soma differentiation.

    PubMed

    Urushihara, Hideko; Kuwayama, Hidekazu; Fukuhara, Kensuke; Itoh, Takehiko; Kagoshima, Hiroshi; Shin-I, Tadasu; Toyoda, Atsushi; Ohishi, Kazuyo; Taniguchi, Tateaki; Noguchi, Hideki; Kuroki, Yoko; Hata, Takashi; Uchi, Kyoko; Mohri, Kurato; King, Jason S; Insall, Robert H; Kohara, Yuji; Fujiyama, Asao

    2015-02-14

    Social amoebae are lower eukaryotes that inhabit the soil. They are characterized by the construction of a starvation-induced multicellular fruiting body with a spore ball and supportive stalk. In most species, the stalk is filled with motile stalk cells, as represented by the model organism Dictyostelium discoideum, whose developmental mechanisms have been well characterized. However, in the genus Acytostelium, the stalk is acellular and all aggregated cells become spores. Phylogenetic analyses have shown that it is not an ancestral genus but has lost the ability to undergo cell differentiation. We performed genome and transcriptome analyses of Acytostelium subglobosum and compared our findings to other available dictyostelid genome data. Although A. subglobosum adopts a qualitatively different developmental program from other dictyostelids, its gene repertoire was largely conserved. Yet, families of polyketide synthase and extracellular matrix proteins have not expanded and a serine protease and ABC transporter B family gene, tagA, and a few other developmental genes are missing in the A. subglobosum lineage. Temporal gene expression patterns are astonishingly dissimilar from those of D. discoideum, and only a limited fraction of the ortholog pairs shared the same expression patterns, so that some signaling cascades for development seem to be disabled in A. subglobosum. The absence of the ability to undergo cell differentiation in Acytostelium is accompanied by a small change in coding potential and extensive alterations in gene expression patterns.

  16. Commonly dysregulated genes in murine APL cells

    PubMed Central

    Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

    2007-01-01

    To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

  17. Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

    PubMed Central

    Xiao, Han; Radovich, Cheryll; Welty, Nicholas; Hsu, Jason; Li, Dongmei; Meulia, Tea; van der Knaap, Esther

    2009-01-01

    Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7), anthesis-stage flowers (floral landmark 10 and fruit landmark 1), and 5 days post anthesis fruit (fruit landmark 3). To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in the NILs that differ at the sun locus, higher or lower transcript levels for many genes involved in phytohormone biosynthesis or signaling as well as organ identity and patterning of tomato fruit were found between developmental time points. PMID:19422692

  18. Hox genes and chordate evolution.

    PubMed

    Holland, P W; Garcia-Fernàndez, J

    1996-02-01

    Hox genes are implicated in the control of axial patterning during embryonic development of many, perhaps all, animals. Here we review recent data on Hox gene diversity, genomic organization, and embryonic expression in chordates (including tunicates, amphioxus, hagfish, lampreys, teleosts) plus their putative sister group, the hemichordates. We consider the potential of comparative Hox gene data to resolve some outstanding controversies in chordate phylogeny. The use of Hox gene expression patterns to identify homologies between body plans both within the vertebrates and between the chordate subphyla is also discussed. Homology between the vertebrate hindbrain and an extensive region of amphioxus neural tube is suggested by comparison of Hox-3 homologues and strengthened by new data on amphioxus Hox-1 gene expression reported here. Finally, we give two examples of how Hox genes are giving glimpses into chordate developmental evolution. The first relates changes in Hox gene expression to transposition of vertebral of vertebral identities; the second describes a correlation between vertebrate origins and Hox gene cluster duplication. We suggest that the simultaneous duplication of many classes of genes, often interacting in gene networks, allowed the elaboration of new developmental control mechanisms at vertebrate origins.

  19. Developmental expression patterns of candidate co-factors for vertebrate Six family transcription factors

    PubMed Central

    Neilson, Karen M.; Pignoni, Francesca; Yan, Bo; Moody, Sally A.

    2010-01-01

    Six family transcription factors play important roles in craniofacial development. Their transcriptional activity can be modified by co-factor proteins. Two Six genes and one co-factor gene (Eya1) are involved in the human Branchio-otic (BO) and Branchio-otic-renal (BOR) syndromes. However, mutations in Six and Eya genes only account for about half of these patients. To discover potential new causative genes, we searched the Xenopus genome for orthologues of Drosophila co-factor proteins that interact with the fly Six-related factor, SO. We identified 33 Xenopus genes with high sequence identity to 20 of the 25 fly SO-interacting proteins. We provide the developmental expression patterns of the Xenopus orthologues for 11 of the fly genes, and demonstrate that all are expressed in developing craniofacial tissues with at least partial overlap with Six1/Six2. We speculate that these genes may function as Six-interacting partners with important roles in vertebrate craniofacial development and perhaps congenital syndromes. PMID:21089078

  20. Evolution and inheritance of early embryonic patterning in Drosophila simulans and D. sechellia.

    PubMed

    Lott, Susan E; Ludwig, Michael Z; Kreitman, Martin

    2011-05-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation that selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth "stripe allometry") in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species Drosophila simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the "margin of error" for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  1. In vitro developmental model of the gastrointestinal tract from mouse embryonic stem cells.

    PubMed

    Torihashi, Shigeko; Kuwahara, Masaki; Kurahashi, Masaaki

    2007-10-01

    Mouse embryonic stem (ES) cells are pluripotent and retain their potential to form cells, tissues and organs originated from three embryonic germ layers. Recently, we developed in vitro organ--gut-like structures--from mouse ES cells. They had basically similar morphological features to a mouse gastrointestinal tract in vivo composed of three distinct layers (i.e., epithelium, connective tissue and musculature). Gut-like structures showed spontaneous contractions derived from pacemaker cells (interstitial cells of Cajal) in the musculature. We also examined their formation process and expression pattern of transcription factors crucial for gut organogenesis such as Id2, Sox17, HNF3beta/Foxa2 and GATA4. We found that they mimic the development of embryonic gut in vivo and showed a similar expression pattern of common transcription factors. They also maintain their developmental potential after transplantation to a renal capsule. Therefore, gut-like structures are suitable for in vitro models of gastrointestinal tracts and their development. In addition, we pointed out several unique features different from gut in vivo that provide useful and advantageous tools to investigate the developmental mechanism of the gastrointestinal tract.

  2. Differential expression of members of the annexin multigene family in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Clark, G. B.; Sessions, A.; Eastburn, D. J.; Roux, S. J.

    2001-01-01

    Although in most plant species no more than two annexin genes have been reported to date, seven annexin homologs have been identified in Arabidopsis, Annexin Arabidopsis 1-7 (AnnAt1--AnnAt7). This establishes that annexins can be a diverse, multigene protein family in a single plant species. Here we compare and analyze these seven annexin gene sequences and present the in situ RNA localization patterns of two of these genes, AnnAt1 and AnnAt2, during different stages of Arabidopsis development. Sequence analysis of AnnAt1--AnnAt7 reveals that they contain the characteristic four structural repeats including the more highly conserved 17-amino acid endonexin fold region found in vertebrate annexins. Alignment comparisons show that there are differences within the repeat regions that may have functional importance. To assess the relative level of expression in various tissues, reverse transcription-PCR was carried out using gene-specific primers for each of the Arabidopsis annexin genes. In addition, northern blot analysis using gene-specific probes indicates differences in AnnAt1 and AnnAt2 expression levels in different tissues. AnnAt1 is expressed in all tissues examined and is most abundant in stems, whereas AnnAt2 is expressed mainly in root tissue and to a lesser extent in stems and flowers. In situ RNA localization demonstrates that these two annexin genes display developmentally regulated tissue-specific and cell-specific expression patterns. These patterns are both distinct and overlapping. The developmental expression patterns for both annexins provide further support for the hypothesis that annexins are involved in the Golgi-mediated secretion of polysaccharides.

  3. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

    PubMed

    Lee, Sang Yoon; Nam, Yoon Kwon

    2016-11-01

    A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Computational synchronization of microarray data with application to Plasmodium falciparum.

    PubMed

    Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

    2012-06-21

    Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

  5. Color pattern analysis of nymphalid butterfly wings: revision of the nymphalid groundplan.

    PubMed

    Otaki, Joji M

    2012-09-01

    To better understand the developmental mechanisms of color pattern variation in butterfly wings, it is important to construct an accurate representation of pattern elements, known as the "nymphalid groundplan". However, some aspects of the current groundplan remain elusive. Here, I examined wing-wide elemental patterns of various nymphalid butterflies and confirmed that wing-wide color patterns are composed of the border, central, and basal symmetry systems. The central and basal symmetry systems can express circular patterns resembling eyespots, indicating that these systems have developmental mechanisms similar to those of the border symmetry system. The wing root band commonly occurs as a distinct symmetry system independent from the basal symmetry system. In addition, the marginal and submarginal bands are likely generated as a single system, referred to as the "marginal band system". Background spaces between two symmetry systems are sometimes light in coloration and can produce white bands, contributing significantly to color pattern diversity. When an element is enlarged with a pale central area, a visually similar (yet developmentally distinct) white band is produced. Based on the symmetric relationships of elements, I propose that both the central and border symmetry systems are comprised of "core elements" (the discal spot and the border ocelli, respectively) and a pair of "paracore elements" (the distal and proximal bands and the parafocal elements, respectively). Both core and paracore elements can be doubled, or outlined. Developmentally, this system configuration is consistent with the induction model, but not with the concentration gradient model for positional information.

  6. Divergent methylation pattern in adult stage between two forms of Tetranychus urticae (Acari: Tetranychidae).

    PubMed

    Yang, Si-Xia; Guo, Chao; Zhao, Xiu-Ting; Sun, Jing-Tao; Hong, Xiao-Yue

    2017-02-19

    The two-spotted spider mite, Tetranychus urticae Koch has two forms: green form and red form. Understanding the molecular basis of how these two forms established without divergent genetic background is an intriguing area. As a well-known epigenetic process, DNA methylation has particularly important roles in gene regulation and developmental variation across diverse organisms that do not alter genetic background. Here, to investigate whether DNA methylation could be associated with different phenotypic consequences in the two forms of T. urticae, we surveyed the genome-wide cytosine methylation status and expression level of DNA methyltransferase 3 (Tudnmt3) throughout their entire life cycle. Methylation-sensitive amplification polymorphism (MSAP) analyses of 585 loci revealed variable methylation patterns in the different developmental stages. In particular, principal coordinates analysis (PCoA) indicates a significant epigenetic differentiation between female adults of the two forms. The gene expression of Tudnmt3 was detected in all examined developmental stages, which was significantly different in the adult stage of the two forms. Together, our results reveal the epigenetic distance between the two forms of T. urticae, suggesting that DNA methylation might be implicated in different developmental demands, and contribute to different phenotypes in the adult stage of these two forms. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  7. Developmental transitions in C. elegans larval stages.

    PubMed

    Rougvie, Ann E; Moss, Eric G

    2013-01-01

    Molecular mechanisms control the timing, sequence, and synchrony of developmental events in multicellular organisms. In Caenorhabditis elegans, these mechanisms are revealed through the analysis of mutants with "heterochronic" defects: cell division or differentiation patterns that occur in the correct lineage, but simply at the wrong time. Subsets of cells in these mutants thus express temporal identities normally restricted to a different life stage. A seminal finding arising from studies of the heterochronic genes was the discovery of miRNAs; these tiny miRNAs are now a defining feature of the pathway. A series of sequentially expressed miRNAs guide larval transitions through stage-specific repression of key effector molecules. The wild-type lineage patterns are executed as discrete modules programmed between temporal borders imposed by the molting cycles. How these successive events are synchronized with the oscillatory molting cycle is just beginning to come to light. Progression through larval stages can be specifically, yet reversibly, halted in response to environmental cues, including nutrient availability. Here too, heterochronic genes and miRNAs play key roles. Remarkably, developmental arrest can, in some cases, either mask or reveal timing defects associated with mutations. In this chapter, we provide an overview of how the C. elegans heterochronic gene pathway guides developmental transitions during continuous and interrupted larval development. © 2013 Elsevier Inc. All rights reserved.

  8. High-resolution gene expression data from blastoderm embryos of the scuttle fly Megaselia abdita

    PubMed Central

    Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Cicin-Sain, Damjan; Jaeger, Johannes

    2015-01-01

    Gap genes are involved in segment determination during early development in dipteran insects (flies, midges, and mosquitoes). We carried out a systematic quantitative comparative analysis of the gap gene network across different dipteran species. Our work provides mechanistic insights into the evolution of this pattern-forming network. As a central component of our project, we created a high-resolution quantitative spatio-temporal data set of gap and maternal co-ordinate gene expression in the blastoderm embryo of the non-drosophilid scuttle fly, Megaselia abdita. Our data include expression patterns in both wild-type and RNAi-treated embryos. The data—covering 10 genes, 10 time points, and over 1,000 individual embryos—consist of original embryo images, quantified expression profiles, extracted positions of expression boundaries, and integrated expression patterns, plus metadata and intermediate processing steps. These data provide a valuable resource for researchers interested in the comparative study of gene regulatory networks and pattern formation, an essential step towards a more quantitative and mechanistic understanding of developmental evolution. PMID:25977812

  9. Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

    PubMed Central

    Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

    2012-01-01

    The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

  10. Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

    PubMed

    Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

    2008-01-07

    Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

  11. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    PubMed

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Evidence of sex-bias in gene expression in the brain transcriptome of two populations of rainbow trout (Oncorhynchus mykiss) with divergent life histories.

    PubMed

    Hale, Matthew C; McKinney, Garrett J; Thrower, Frank P; Nichols, Krista M

    2018-01-01

    Sex-bias in gene expression is a mechanism that can generate phenotypic variance between the sexes, however, relatively little is known about how patterns of sex-bias vary during development, and how variable sex-bias is between different populations. To that end, we measured sex-bias in gene expression in the brain transcriptome of rainbow trout (Oncorhynchus mykiss) during the first two years of development. Our sampling included from the fry stage through to when O. mykiss either migrate to the ocean or remain resident and undergo sexual maturation. Samples came from two F1 lines: One from migratory steelhead trout and one from resident rainbow trout. All samples were reared in a common garden environment and RNA sequencing (RNA-seq) was used to estimate patterns of gene expression. A total of 1,716 (4.6% of total) genes showed evidence of sex-bias in gene expression in at least one time point. The majority (96.7%) of sex-biased genes were differentially expressed during the second year of development, indicating that patterns of sex-bias in expression are tied to key developmental events, such as migration and sexual maturation. Mapping of differentially expressed genes to the O. mykiss genome revealed that the X chromosome is enriched for female upregulated genes, and this may indicate a lack of dosage compensation in rainbow trout. There were many more sex-biased genes in the migratory line than the resident line suggesting differences in patterns of gene expression in the brain between populations subjected to different forces of selection. Overall, our results suggest that there is considerable variation in the extent and identity of genes exhibiting sex-bias during the first two years of life. These differentially expressed genes may be connected to developmental differences between the sexes, and/or between adopting a resident or migratory life history.

  13. Multiple developmental programs are altered by loss of Zic1 and Zic4 to cause Dandy-Walker malformation cerebellar pathogenesis

    PubMed Central

    Blank, Marissa C.; Grinberg, Inessa; Aryee, Emmanuel; Laliberte, Christine; Chizhikov, Victor V.; Henkelman, R. Mark; Millen, Kathleen J.

    2011-01-01

    Heterozygous deletions encompassing the ZIC1;ZIC4 locus have been identified in a subset of individuals with the common cerebellar birth defect Dandy-Walker malformation (DWM). Deletion of Zic1 and Zic4 in mice produces both cerebellar size and foliation defects similar to human DWM, confirming a requirement for these genes in cerebellar development and providing a model to delineate the developmental basis of this clinically important congenital malformation. Here, we show that reduced cerebellar size in Zic1 and Zic4 mutants results from decreased postnatal granule cell progenitor proliferation. Through genetic and molecular analyses, we show that Zic1 and Zic4 have Shh-dependent function promoting proliferation of granule cell progenitors. Expression of the Shh-downstream genes Ptch1, Gli1 and Mycn was downregulated in Zic1/4 mutants, although Shh production and Purkinje cell gene expression were normal. Reduction of Shh dose on the Zic1+/−;Zic4+/− background also resulted in cerebellar size reductions and gene expression changes comparable with those observed in Zic1−/−;Zic4−/− mice. Zic1 and Zic4 are additionally required to pattern anterior vermis foliation. Zic mutant folial patterning abnormalities correlated with disrupted cerebellar anlage gene expression and Purkinje cell topography during late embryonic stages; however, this phenotype was Shh independent. In Zic1+/−;Zic4+/−;Shh+/−, we observed normal cerebellar anlage patterning and foliation. Furthermore, cerebellar patterning was normal in both Gli2-cko and Smo-cko mutant mice, where all Shh function was removed from the developing cerebellum. Thus, our data demonstrate that Zic1 and Zic4 have both Shh-dependent and -independent roles during cerebellar development and that multiple developmental disruptions underlie Zic1/4-related DWM. PMID:21307096

  14. Transcriptional Analysis of Flowering Time in Switchgrass

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon

    Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

  15. Transcriptional Analysis of Flowering Time in Switchgrass

    DOE PAGES

    Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon; ...

    2017-04-27

    Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

  16. Neutrality and Robustness in Evo-Devo: Emergence of Lateral Inhibition

    PubMed Central

    Munteanu, Andreea; Solé, Ricard V.

    2008-01-01

    Embryonic development is defined by the hierarchical dynamical process that translates genetic information (genotype) into a spatial gene expression pattern (phenotype) providing the positional information for the correct unfolding of the organism. The nature and evolutionary implications of genotype–phenotype mapping still remain key topics in evolutionary developmental biology (evo-devo). We have explored here issues of neutrality, robustness, and diversity in evo-devo by means of a simple model of gene regulatory networks. The small size of the system allowed an exhaustive analysis of the entire fitness landscape and the extent of its neutrality. This analysis shows that evolution leads to a class of robust genetic networks with an expression pattern characteristic of lateral inhibition. This class is a repertoire of distinct implementations of this key developmental process, the diversity of which provides valuable clues about its underlying causal principles. PMID:19023404

  17. A discrete model of Drosophila eggshell patterning reveals cell-autonomous and juxtacrine effects.

    PubMed

    Fauré, Adrien; Vreede, Barbara M I; Sucena, Elio; Chaouiya, Claudine

    2014-03-01

    The Drosophila eggshell constitutes a remarkable system for the study of epithelial patterning, both experimentally and through computational modeling. Dorsal eggshell appendages arise from specific regions in the anterior follicular epithelium that covers the oocyte: two groups of cells expressing broad (roof cells) bordered by rhomboid expressing cells (floor cells). Despite the large number of genes known to participate in defining these domains and the important modeling efforts put into this developmental system, key patterning events still lack a proper mechanistic understanding and/or genetic basis, and the literature appears to conflict on some crucial points. We tackle these issues with an original, discrete framework that considers single-cell models that are integrated to construct epithelial models. We first build a phenomenological model that reproduces wild type follicular epithelial patterns, confirming EGF and BMP signaling input as sufficient to establish the major features of this patterning system within the anterior domain. Importantly, this simple model predicts an instructive juxtacrine signal linking the roof and floor domains. To explore this prediction, we define a mechanistic model that integrates the combined effects of cellular genetic networks, cell communication and network adjustment through developmental events. Moreover, we focus on the anterior competence region, and postulate that early BMP signaling participates with early EGF signaling in its specification. This model accurately simulates wild type pattern formation and is able to reproduce, with unprecedented level of precision and completeness, various published gain-of-function and loss-of-function experiments, including perturbations of the BMP pathway previously seen as conflicting results. The result is a coherent model built upon rules that may be generalized to other epithelia and developmental systems.

  18. Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling.

    PubMed

    Prpic, Nikola-Michael; Janssen, Ralf; Wigand, Barbara; Klingler, Martin; Damen, Wim G M

    2003-12-01

    Leg development in Drosophila has been studied in much detail. However, Drosophila limbs form in the larva as imaginal discs and not during embryogenesis as in most other arthropods. Here, we analyze appendage genes in the spider Cupiennius salei and the beetle Tribolium castaneum. Differences in decapentaplegic (dpp) expression suggest a different mode of distal morphogen signaling suitable for the specific geometry of growing limb buds. Also, expression of the proximal genes homothorax (hth) and extradenticle (exd) is significantly altered: in the spider, exd is restricted to the proximal leg and hth expression extends distally, while in insects, exd is expressed in the entire leg and hth is restricted to proximal parts. This reversal of spatial specificity demonstrates an evolutionary shift, which is nevertheless compatible with a conserved role of this gene pair as instructor of proximal fate. Different expression dynamics of dachshund and Distal-less point to modifications in the regulation of the leg gap gene system. We comment on the significance of this finding for attempts to homologize leg segments in different arthropod classes. Comparison of the expression profiles of H15 and optomotor-blind to the Drosophila patterns suggests modifications also in the dorsal-ventral patterning system of the legs. Together, our results suggest alterations in many components of the leg developmental system, namely proximal-distal and dorsal-ventral patterning, and leg segmentation. Thus, the leg developmental system exhibits a propensity to evolutionary change, which probably forms the basis for the impressive diversity of arthropod leg morphologies.

  19. Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

    PubMed

    Ko, Jae-Heung; Han, Kyung-Hwan

    2004-05-01

    Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

  20. Redeployment of germ layers related TFs shows regionalized expression during two non-embryonic developments.

    PubMed

    Ricci, Lorenzo; Cabrera, Fabien; Lotito, Sonia; Tiozzo, Stefano

    2016-08-01

    In all non-vertebrate metazoan phyla, species that evolved non-embryonic developmental pathways as means of propagation or regeneration can be found. In this context, new bodies arise through asexual reproduction processes (such as budding) or whole body regeneration, that lack the familiar temporal and spatial cues classically associated with embryogenesis, like maternal determinants, or gastrulation. The molecular mechanisms underlying those non-embryonic developments (i.e., regeneration and asexual reproduction), and their relationship to those deployed during embryogenesis are poorly understood. We have addressed this question in the colonial ascidian Botryllus schlosseri, which undergoes an asexual reproductive process via palleal budding (PB), as well as a whole body regeneration by vascular budding (VB). We identified early regenerative structures during VB and then followed the fate of differentiating tissues during both non-embryonic developments (PB and VB) by monitoring the expression of genes known to play key functions in germ layer specification with well conserved expression patterns in solitary ascidian embryogenesis. The expression patterns of FoxA1, GATAa, GATAb, Otx, Bra, Gsc and Tbx2/3 were analysed during both PB and VB. We found that the majority of these transcription factors were expressed during both non-embryonic developmental processes, revealing a regionalization of the palleal and vascular buds. Knockdown of GATAa by siRNA in palleal buds confirmed that preventing the correct development of one of these regions blocks further tissue specification. Our results indicate that during both normal and injury-induced budding, a similar alternative developmental program operates via early commitment of epithelial regions. Copyright © 2016. Published by Elsevier Inc.

  1. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  2. Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken.

    PubMed

    Yokoyama, Shigetoshi; Hashimoto, Megumi; Shimizu, Hirohito; Ueno-Kudoh, Hiroe; Uchibe, Kenta; Kimura, Ichiro; Asahara, Hiroshi

    2008-02-01

    The Caenorhabditis elegans heterochronic gene lin-28 regulates developmental timing in the nematode trunk. We report the dynamic expression patterns of Lin-28 homologues in mouse and chick embryos. Whole mount in situ hybridization revealed specific and intriguing expression patterns of Lin-28 in the developing mouse and chick limb bud. Mouse Lin-28 expression was detected in both the forelimb and hindlimb at E9.5, but disappeared from the forelimb at E10.5, and finally from the forelimb and hindlimb at E11.5. Chicken Lin-28, which was first detected in the limb primordium at stage 15/16, was also downregulated as the stage proceeded. The amino acid sequences of mouse and chicken Lin-28 genes are highly conserved and the similar expression patterns of Lin-28 during limb development in mouse and chicken suggest that this heterochronic gene is also conserved during vertebrate limb development.

  3. Developmental origin of lung macrophage diversity

    PubMed Central

    Tan, Serena Y. S.; Krasnow, Mark A.

    2016-01-01

    Macrophages are specialized phagocytic cells, present in all tissues, which engulf and digest pathogens, infected and dying cells, and debris, and can recruit and regulate other immune cells and the inflammatory response and aid in tissue repair. Macrophage subpopulations play distinct roles in these processes and in disease, and are typically recognized by differences in marker expression, immune function, or tissue of residency. Although macrophage subpopulations in the brain have been found to have distinct developmental origins, the extent to which development contributes to macrophage diversity between tissues and within tissues is not well understood. Here, we investigate the development and maintenance of mouse lung macrophages by marker expression patterns, genetic lineage tracing and parabiosis. We show that macrophages populate the lung in three developmental waves, each giving rise to a distinct lineage. These lineages express different markers, reside in different locations, renew in different ways, and show little or no interconversion. Thus, development contributes significantly to lung macrophage diversity and targets each lineage to a different anatomical domain. PMID:26952982

  4. A 3-dimensional human embryonic stem cell (hESC)-derived model to detect developmental neurotoxicity of nanoparticles.

    PubMed

    Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne

    2013-04-01

    Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.

  5. Root Exudation of Phytochemicals in Arabidopsis Follows Specific Patterns That Are Developmentally Programmed and Correlate with Soil Microbial Functions

    PubMed Central

    Sugiyama, Akifumi; Manter, Daniel K.; Vivanco, Jorge M.

    2013-01-01

    Plant roots constantly secrete compounds into the soil to interact with neighboring organisms presumably to gain certain functional advantages at different stages of development. Accordingly, it has been hypothesized that the phytochemical composition present in the root exudates changes over the course of the lifespan of a plant. Here, root exudates of in vitro grown Arabidopsis plants were collected at different developmental stages and analyzed using GC-MS. Principle component analysis revealed that the composition of root exudates varied at each developmental stage. Cumulative secretion levels of sugars and sugar alcohols were higher in early time points and decreased through development. In contrast, the cumulative secretion levels of amino acids and phenolics increased over time. The expression in roots of genes involved in biosynthesis and transportation of compounds represented in the root exudates were consistent with patterns of root exudation. Correlation analyses were performed of the in vitro root exudation patterns with the functional capacity of the rhizosphere microbiome to metabolize these compounds at different developmental stages of Arabidopsis grown in natural soils. Pyrosequencing of rhizosphere mRNA revealed strong correlations (p<0.05) between microbial functional genes involved in the metabolism of carbohydrates, amino acids and secondary metabolites with the corresponding compounds released by the roots at particular stages of plant development. In summary, our results suggest that the root exudation process of phytochemicals follows a developmental pattern that is genetically programmed. PMID:23383346

  6. Butterfly eyespot serial homology: enter the Hox genes

    PubMed Central

    2011-01-01

    Hox genes modify serial homology patterns in many organisms, exemplified in vertebrates by modification of the axial skeleton and in arthropods by diversification of the body segments. Butterfly wing eyespots also appear in a serial homologous pattern that, in certain species, is subject to local modification. A paper in EvoDevo reports the Hox gene Antp is the earliest known gene to have eyespot-specific expression; however, not all Lepidoptera express Antp in eyespots, suggesting some developmental flexibility. See research article: http://www.evodevojournal.com/content/2/1/9 PMID:21527048

  7. Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

    PubMed Central

    Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

    2013-01-01

    MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

  8. apterous A specifies dorsal wing patterns and sexual traits in butterflies

    PubMed Central

    2018-01-01

    Butterflies have evolved different colour patterns on their dorsal and ventral wing surfaces to serve different signalling functions, yet the developmental mechanisms controlling surface-specific patterning are still unknown. Here, we mutate both copies of the transcription factor apterous in Bicyclus anynana butterflies using CRISPR/Cas9 and show that apterous A, expressed dorsally, functions both as a repressor and modifier of ventral wing colour patterns, as well as a promoter of dorsal sexual ornaments in males. We propose that the surface-specific diversification of wing patterns in butterflies proceeded via the co-option of apterous A or its downstream effectors into various gene regulatory networks involved in the differentiation of discrete wing traits. Further, interactions between apterous and sex-specific factors such as doublesex may have contributed to the origin of sexually dimorphic surface-specific patterns. Finally, we discuss the evolution of eyespot number diversity in the family Nymphalidae within the context of developmental constraints due to apterous regulation. PMID:29467265

  9. Integrating Membrane Transport with Male Gametophyte Development and Function through Transcriptomics.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bock KW; D Honys; JM. Ward

    Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. About 1269 genes encoding classified transporters were collected from themore » Arabidopsis thaliana genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3 and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9); while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, were developmentally-regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::GUS analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.« less

  10. Integrating membrane transport with male gametophyte development and function through transcriptomics.

    PubMed

    Bock, Kevin W; Honys, David; Ward, John M; Padmanaban, Senthilkumar; Nawrocki, Eric P; Hirschi, Kendal D; Twell, David; Sze, Heven

    2006-04-01

    Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth, and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. Approximately 1,269 genes encoding classified transporters were collected from the Arabidopsis (Arabidopsis thaliana) genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3, and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9), while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, was developmentally regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::beta-glucuronidase analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.

  11. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    PubMed

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

    2016-05-01

    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

    USDA-ARS?s Scientific Manuscript database

    MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

  13. Expression analysis of kenaf cinnamate 4-hydroxylase (C4H) ortholog during developmental and stress responses

    USDA-ARS?s Scientific Manuscript database

    This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...

  14. Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

    PubMed

    Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

    2015-06-01

    Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. The body electric 2.0: recent advances in developmental bioelectricity for regenerative and synthetic bioengineering.

    PubMed

    Mathews, Juanita; Levin, Michael

    2018-04-20

    Breakthroughs in biomedicine and synthetic bioengineering require predictive, rational control over anatomical structure and function. Recent successes in manipulating cellular and molecular hardware have not been matched by progress in understanding the patterning software implemented during embryogenesis and regeneration. A fundamental capability gap is driving desired changes in growth and form to address birth defects and traumatic injury. Here we review new tools, results, and conceptual advances in an exciting emerging field: endogenous non-neural bioelectric signaling, which enables cellular collectives to make global decisions and implement large-scale pattern homeostasis. Spatially distributed electric circuits regulate gene expression, organ morphogenesis, and body-wide axial patterning. Developmental bioelectricity facilitates the interface to organ-level modular control points that direct patterning in vivo. Cracking the bioelectric code will enable transformative progress in bioengineering and regenerative medicine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Receptive Vocabulary in Boys with Autism Spectrum Disorder: Cross-Sectional Developmental Trajectories

    PubMed Central

    McDuffie, Andrea S.; Hagerman, Randi J.; Abbeduto, Leonard

    2013-01-01

    In light of evidence that receptive language may be a relative weakness for individuals with autism spectrum disorder (ASD), this study characterized receptive vocabulary profiles in boys with ASD using cross-sectional developmental trajectories relative to age, nonverbal cognition, and expressive vocabulary. Participants were 49 boys with ASD (4–11 years) and 80 typically developing boys (2–11 years). Receptive vocabulary, assessed with the Peabody Picture Vocabulary Test, was a weakness for boys with ASD relative to age and nonverbal cognition. Relative to expressive vocabulary, assessed with the Expressive Vocabulary Test, receptive vocabulary increased at a lower rate for boys with ASD. Vocabulary trajectories in ASD are distinguished from typical development; however, nonverbal cognition largely accounts for the patterns observed. PMID:23588510

  17. Phenotypic Checkpoints Regulate Neuronal Development

    PubMed Central

    Ben-Ari, Yehezkel; Spitzer, Nicholas C.

    2010-01-01

    Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191

  18. Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

    NASA Technical Reports Server (NTRS)

    Stegenga, S. L.; Kalb, R. G.

    2001-01-01

    Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

  19. Volatiles Emitted at Different Flowering Stages of Jasminum sambac and Expression of Genes Related to α-Farnesene Biosynthesis.

    PubMed

    Yu, Ying; Lyu, Shiheng; Chen, Dan; Lin, Yi; Chen, Jianjun; Chen, Guixin; Ye, Naixing

    2017-03-29

    Fresh jasmine flowers have been used to make jasmine teas in China, but there has been no complete information about volatile organic compound emissions in relation to flower developmental stages and no science-based knowledge about which floral stage should be used for the infusion. This study monitored volatile organic compounds emitted from living flowers of Jasminum sambac (L.) Ait. 'Bifoliatum' at five developmental stages and also from excised flowers. Among the compounds identified, α-farnesene, linalool, and benzyl acetate were most abundant. Since α-farnesene is synthesized through the Mevalonate pathway, four genes encoding 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR), farnesyl pyrophosphate synthase, and terpene synthase were isolated. Their expression patterns in living flowers at the five stages and in excised flowers coincided with the emission patterns of α-farnesene. Application of lovastatin, a HMGR inhibitor, significantly reduced the expression of the genes and greatly decreased the emission of α-farnesene. The sweet scent was diminished from lovastatin-treated flowers as well. These results indicate that α-farnesene is an important compound emitted from jasmine flowers, and its emission patterns suggest that flowers at the opening stage or flower buds 8 h after excision should be used for the infusion of tea leaves.

  20. Tooth Morphogenesis and FGF4 Expression During Development of Molar Tooth in Three Muroid Rodents: Calomyscus elburzensis (Calomyscidae), Mesocricetus auratus (Cricetidae) and Mus musculus (Muridae).

    PubMed

    Hamidi, Kordiyeh; Darvish, Jamshid; Matin, Maryam M; Javanmard, Athar Sadat; Kilpatrick, C William

    2017-12-01

    To date, no studies have examined the tooth formation during developmental stages of brush-tailed mice (Calomyscidae) and true hamsters (Cricetidae). Herein, we compared the timing of tooth morphogenesis and FGF4 expression pattern during development of the first lower molar in Goodwin's brush-tailed mouse, Calomyscus elburzensis with two other muroid rodents; the house mouse, Mus musculus (Muridae), model organism for tooth morphogenesis, and the golden hamster, Mesocricetus auratus which shares great similarities in cusp pattern with brush-tailed mice. All three species were bred in captivity and developing embryos were isolated at different embryonic days (E). Histological evaluation of lower molars was performed and spatiotemporal pattern of FGF4 expression was determined by immunohistochemistry. Results indicated that morphogenesis of the tooth cusps starts at the beginning of the cap stage of the first lower molar (E14 in house mouse, about E11.5 in golden hamster and E22 in Goodwin's brush-tailed mouse). During the cap to bell stage (E15 in house mouse, E12 in golden hamster and at about E24 in Goodwin's brush-tailed mouse), a decrease in the expression of FGF4 was observed in the mesenchyme, except for the cusp tips. According to our observations, the developmental process of the first lower molar formation in Goodwin's brush-tailed mouse began much later as compared with the other two species. Despite the differences in the temporal pattern of molar development between these three members of the same superfamily (Muroidea), the correlation in the expression of FGF4 with specific stages of tooth morphogenesis supported its regulatory function. Anat Rec, 300:2138-2149, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Peptide Signaling in Plant Development

    PubMed Central

    Katsir, Leron; Davies, Kelli A.; Bergmann, Dominique C.; Laux, Thomas

    2011-01-01

    Cell-to-cell communication is integral to the evolution of multicellularity. In plant development, peptide signals relay information coordinating cell proliferation and differentiation. These peptides are often encoded by gene families and bind to corresponding families of receptors. The precise spatiotemporal expression of signals and their cognate receptors underlies developmental patterning, and expressional and biochemical changes over evolutionary time have likely contributed to the refinement and complexity of developmental programs. Here, we discuss two major plant peptide families which have central roles in plant development: the CLAVATA3/ENDOSPERM SURROUNDING REGION (CLE) peptide family and the EPIDERMAL PATTERNING FACTOR (EPF) family. We discuss how specialization has enabled the CLE peptides to modulate stem cell differentiation in various tissue types, and how differing activities of EPF peptides precisely regulate the stomatal developmental program, and we examine the contributions of these peptide families to plant development from an evolutionary perspective. PMID:21549958

  2. Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming

    PubMed Central

    Bromer, Jason G.; Wu, Jie; Zhou, Yuping; Taylor, Hugh S.

    2009-01-01

    Diethylstilbestrol (DES) is a nonsteroidal estrogen that induces developmental anomalies of the female reproductive tract. The homeobox gene HOXA10 controls uterine organogenesis, and its expression is altered after in utero DES exposure. We hypothesized that an epigenetic mechanism underlies DES-mediated alterations in HOXA10 expression. We analyzed the expression pattern and methylation profile of HOXA10 after DES exposure. Expression of HOXA10 is increased in human endometrial cells after DES exposure, whereas Hoxa10 expression is repressed and shifted caudally from its normal location in mice exposed in utero. Cytosine guanine dinucleotide methylation frequency in the Hoxa10 intron was higher in DES-exposed offspring compared with controls (P = 0.017). The methylation level of Hoxa10 was also higher in the caudal portion of the uterus after DES exposure at the promoter and intron (P < 0.01). These changes were accompanied by increased expression of DNA methyltransferases 1 and 3b. No changes in methylation were observed after in vitro or adult DES exposure. DES has a dual mechanism of action as an endocrine disruptor; DES functions as a classical estrogen and directly stimulates HOXA10 expression with short-term exposure, however, in utero exposure results in hypermethylation of the HOXA10 gene and long-term altered HOXA10 expression. We identify hypermethylation as a novel mechanism of DES-induced altered developmental programming. PMID:19299448

  3. Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.

    PubMed

    Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B

    2014-03-01

    Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.

  4. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru

    2007-06-29

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics inmore » their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated.« less

  5. Neighboring genes shaping a single adaptive mimetic trait.

    PubMed

    Pardo-Diaz, Carolina; Jiggins, Chris D

    2014-01-01

    The colorful wing patterns of Heliconius butterflies represent an excellent system in which to study the genetic and developmental control of adaptation and convergence. Using qRT-PCR and in situ hybridization on developing wings of the co-mimic species Heliconius melpomene and Heliconius erato, we have profiled the expression of three candidate genes located in the genomic locus controlling red color pattern variation. We found convergent domains of gene expression in H. melpomene and H. erato associated with red wing elements in the two genes optix and kinesin. During early pupal development of both species, the expression of optix perfectly associated with all red pattern elements whereas that of kinesin was specifically correlated with the presence of the red forewing band. These results provide evidence for the use of these two tightly linked patterning genes, acting together to create convergent wing phenotypes in Heliconius and constituting a hotspot of adaptation. © 2013 Wiley Periodicals, Inc.

  6. Enhancer trap expression patterns provide a novel teaching resource.

    PubMed

    Geisler, Matt; Jablonska, Barbara; Springer, Patricia S

    2002-12-01

    A collection of Arabidopsis enhancer trap transposants has been identified for use as a teaching tool. This collection serves to assist students in understanding the patterning and organization of plant tissues and cells, and will be useful in plant anatomy, morphology, and developmental biology courses. Each transposant exhibits reporter gene expression in a specific tissue, cell type, or domain, and these lines collectively offer a glimpse of compartments of gene expression. Some compartments correspond to classical definitions of botanical anatomy and can assist in anatomical identification. Other patterns of reporter gene expression are more complex and do not necessarily correspond to known anatomical features. The sensitivity of the beta-glucuronidase histochemical stain provides the student with a colorful and direct way to visualize difficult aspects of plant development and anatomy, and provides the teacher with an invaluable tool for a practical laboratory session.

  7. A framework for analyzing the relationship between gene expression and morphological, topological, and dynamical patterns in neuronal networks.

    PubMed

    de Arruda, Henrique Ferraz; Comin, Cesar Henrique; Miazaki, Mauro; Viana, Matheus Palhares; Costa, Luciano da Fontoura

    2015-04-30

    A key point in developmental biology is to understand how gene expression influences the morphological and dynamical patterns that are observed in living beings. In this work we propose a methodology capable of addressing this problem that is based on estimating the mutual information and Pearson correlation between the intensity of gene expression and measurements of several morphological properties of the cells. A similar approach is applied in order to identify effects of gene expression over the system dynamics. Neuronal networks were artificially grown over a lattice by considering a reference model used to generate artificial neurons. The input parameters of the artificial neurons were determined according to two distinct patterns of gene expression and the dynamical response was assessed by considering the integrate-and-fire model. As far as single gene dependence is concerned, we found that the interaction between the gene expression and the network topology, as well as between the former and the dynamics response, is strongly affected by the gene expression pattern. In addition, we observed a high correlation between the gene expression and some topological measurements of the neuronal network for particular patterns of gene expression. To our best understanding, there are no similar analyses to compare with. A proper understanding of gene expression influence requires jointly studying the morphology, topology, and dynamics of neurons. The proposed framework represents a first step towards predicting gene expression patterns from morphology and connectivity. Copyright © 2015. Published by Elsevier B.V.

  8. Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

    PubMed

    Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

    2013-12-01

    Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

  9. RNA-Seq identifies SPGs as a ventral skeletal patterning cue in sea urchins.

    PubMed

    Piacentino, Michael L; Zuch, Daniel T; Fishman, Julie; Rose, Sviatlana; Speranza, Emily E; Li, Christy; Yu, Jia; Chung, Oliver; Ramachandran, Janani; Ferrell, Patrick; Patel, Vijeta; Reyna, Arlene; Hameeduddin, Hajerah; Chaves, James; Hewitt, Finnegan B; Bardot, Evan; Lee, David; Core, Amanda B; Hogan, John D; Keenan, Jessica L; Luo, Lingqi; Coulombe-Huntington, Jasmin; Blute, Todd A; Oleinik, Ekaterina; Ibn-Salem, Jonas; Poustka, Albert J; Bradham, Cynthia A

    2016-02-15

    The sea urchin larval skeleton offers a simple model for formation of developmental patterns. The calcium carbonate skeleton is secreted by primary mesenchyme cells (PMCs) in response to largely unknown patterning cues expressed by the ectoderm. To discover novel ectodermal cues, we performed an unbiased RNA-Seq-based screen and functionally tested candidates; we thereby identified several novel skeletal patterning cues. Among these, we show that SLC26a2/7 is a ventrally expressed sulfate transporter that promotes a ventral accumulation of sulfated proteoglycans, which is required for ventral PMC positioning and skeletal patterning. We show that the effects of SLC perturbation are mimicked by manipulation of either external sulfate levels or proteoglycan sulfation. These results identify novel skeletal patterning genes and demonstrate that ventral proteoglycan sulfation serves as a positional cue for sea urchin skeletal patterning. © 2016. Published by The Company of Biologists Ltd.

  10. Developmental expression of Toll‑like receptors in the guinea pig lung.

    PubMed

    Ma, Lingjie; Yang, Jiali; Yang, Li; Shi, Juan; Xue, Jing; Li, Yong; Liu, Xiaoming

    2017-03-01

    The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

  11. Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

    PubMed

    Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

    2014-10-01

    In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

  12. Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

    2000-01-01

    beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

  13. A gene network model accounting for development and evolution of mammalian teeth

    PubMed Central

    Salazar-Ciudad, Isaac; Jernvall, Jukka

    2002-01-01

    Generation of morphological diversity remains a challenge for evolutionary biologists because it is unclear how an ultimately finite number of genes involved in initial pattern formation integrates with morphogenesis. Ideally, models used to search for the simplest developmental principles on how genes produce form should account for both developmental process and evolutionary change. Here we present a model reproducing the morphology of mammalian teeth by integrating experimental data on gene interactions and growth into a morphodynamic mechanism in which developing morphology has a causal role in patterning. The model predicts the course of tooth-shape development in different mammalian species and also reproduces key transitions in evolution. Furthermore, we reproduce the known expression patterns of several genes involved in tooth development and their dynamics over developmental time. Large morphological effects frequently can be achieved by small changes, according to this model, and similar morphologies can be produced by different changes. This finding may be consistent with why predicting the morphological outcomes of molecular experiments is challenging. Nevertheless, models incorporating morphology and gene activity show promise for linking genotypes to phenotypes. PMID:12048258

  14. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    PubMed

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

  15. A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression

    PubMed Central

    Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.

    2009-01-01

    This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256

  16. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    PubMed

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-08-01

    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

    PubMed

    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

    2016-11-01

    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

    PubMed Central

    Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

    2015-01-01

    MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

  19. The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

    PubMed Central

    Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

    2015-01-01

    While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

  20. Developmental Transcriptome of Aplysia californica

    PubMed Central

    HEYLAND, ANDREAS; VUE, ZER; VOOLSTRA, CHRISTIAN R.; MEDINA, MÓNICA; MOROZ, LEONID L.

    2014-01-01

    Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages—many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization—a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. PMID:21328528

  1. Developmental pathways inferred from modularity, morphological integration and fluctuating asymmetry patterns in the human face.

    PubMed

    Quinto-Sánchez, Mirsha; Muñoz-Muñoz, Francesc; Gomez-Valdes, Jorge; Cintas, Celia; Navarro, Pablo; Cerqueira, Caio Cesar Silva de; Paschetta, Carolina; de Azevedo, Soledad; Ramallo, Virginia; Acuña-Alonzo, Victor; Adhikari, Kaustubh; Fuentes-Guajardo, Macarena; Hünemeier, Tábita; Everardo, Paola; de Avila, Francisco; Jaramillo, Claudia; Arias, Williams; Gallo, Carla; Poletti, Giovani; Bedoya, Gabriel; Bortolini, Maria Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Rosique, Javier; Ruiz-Linares, Andres; Gonzalez-Jose, Rolando

    2018-01-17

    Facial asymmetries are usually measured and interpreted as proxies to developmental noise. However, analyses focused on its developmental and genetic architecture are scarce. To advance on this topic, studies based on a comprehensive and simultaneous analysis of modularity, morphological integration and facial asymmetries including both phenotypic and genomic information are needed. Here we explore several modularity hypotheses on a sample of Latin American mestizos, in order to test if modularity and integration patterns differ across several genomic ancestry backgrounds. To do so, 4104 individuals were analyzed using 3D photogrammetry reconstructions and a set of 34 facial landmarks placed on each individual. We found a pattern of modularity and integration that is conserved across sub-samples differing in their genomic ancestry background. Specifically, a signal of modularity based on functional demands and organization of the face is regularly observed across the whole sample. Our results shed more light on previous evidence obtained from Genome Wide Association Studies performed on the same samples, indicating the action of different genomic regions contributing to the expression of the nose and mouth facial phenotypes. Our results also indicate that large samples including phenotypic and genomic metadata enable a better understanding of the developmental and genetic architecture of craniofacial phenotypes.

  2. Dynamic Patterns of Clonal Evolution in Tumor Vasculature Underlie Alterations in Lymphocyte-Endothelial Recognition to Foster Tumor Immune Escape.

    PubMed

    Corey, Daniel M; Rinkevich, Yuval; Weissman, Irving L

    2016-03-15

    Although tumor blood vessels have been a major therapeutic target for cancer chemotherapy, little is known regarding the stepwise development of the tumor microenvironment. Here, we use a multicolor Cre-dependent marker system to trace clonality within the tumor microenvironment to show that tumor blood vessels follow a pattern of dynamic clonal evolution. In an advanced melanoma tumor microenvironment, the vast majority of tumor vasculature clones are derived from a common precursor. Quantitative lineage analysis reveals founder clones diminish in frequency and are replaced by subclones as tumors evolve. These tumor-specific blood vessels are characterized by a developmental switch to a more invasive and immunologically silent phenotype. Gene expression profiling and pathway analysis reveals selection for traits promoting upregulation of alternative angiogenic programs such as unregulated HGF-MET signaling and enhanced autocrine signaling through VEGF and PDGF. Furthermore, we show a developmental switch in the expression of functionally significant primary lymphocyte adhesion molecules on tumor endothelium, such as the loss in expression of the mucosal addressin MAdCAM-1, whose counter receptor a4β7 on lymphocytes controls lymphocyte homing. Changes in adhesive properties on tumor endothelial subclones are accompanied by decreases in expression of lymphocyte chemokines CXCL16, CXCL13, CXCL12, CXCL9, CXCL10, and CCL19. These evolutionary patterns in the expressed genetic program within tumor endothelium will have both a quantitative and functional impact on lymphocyte distribution that may well influence tumor immune function and underlie escape mechanisms from current antiangiogenic pharmacotherapies. ©2015 American Association for Cancer Research.

  3. Developmental exposure to polychlorinated biphenyls (PCBs) interferes with experience-dependent dendritic plasticity and ryanodine receptor expression in weanling rats.

    EPA Science Inventory

    BACKGROUND: Neurodevelopmental disorders are associated with altered patterns of neuronal connectivity. A critical determinant of neuronal connectivity is the dendritic morphology of individual neurons, which is shaped by experience. The identification of environmental exposures ...

  4. Inference of developmental gene regulatory networks beyond classical model systems: new approaches in the post-genomic era.

    PubMed

    Fernandez-Valverde, Selene L; Aguilera, Felipe; Ramos-Díaz, René Alexander

    2018-06-18

    The advent of high-throughput sequencing technologies has revolutionized the way we understand the transformation of genetic information into morphological traits. Elucidating the network of interactions between genes that govern cell differentiation through development is one of the core challenges in genome research. These networks are known as developmental gene regulatory networks (dGRNs) and consist largely of the functional linkage between developmental control genes, cis-regulatory modules and differentiation genes, which generate spatially and temporally refined patterns of gene expression. Over the last 20 years, great advances have been made in determining these gene interactions mainly in classical model systems, including human, mouse, sea urchin, fruit fly, and worm. This has brought about a radical transformation in the fields of developmental biology and evolutionary biology, allowing the generation of high-resolution gene regulatory maps to analyse cell differentiation during animal development. Such maps have enabled the identification of gene regulatory circuits and have led to the development of network inference methods that can recapitulate the differentiation of specific cell-types or developmental stages. In contrast, dGRN research in non-classical model systems has been limited to the identification of developmental control genes via the candidate gene approach and the characterization of their spatiotemporal expression patterns, as well as to the discovery of cis-regulatory modules via patterns of sequence conservation and/or predicted transcription-factor binding sites. However, thanks to the continuous advances in high-throughput sequencing technologies, this scenario is rapidly changing. Here, we give a historical overview on the architecture and elucidation of the dGRNs. Subsequently, we summarize the approaches available to unravel these regulatory networks, highlighting the vast range of possibilities of integrating multiple technical advances and theoretical approaches to expand our understanding on the global of gene regulation during animal development in non-classical model systems. Such new knowledge will not only lead to greater insights into the evolution of molecular mechanisms underlying cell identity and animal body plans, but also into the evolution of morphological key innovations in animals.

  5. Self-organizing human cardiac microchambers mediated by geometric confinement

    NASA Astrophysics Data System (ADS)

    Ma, Zhen; Wang, Jason; Loskill, Peter; Huebsch, Nathaniel; Koo, Sangmo; Svedlund, Felicia L.; Marks, Natalie C.; Hua, Ethan W.; Grigoropoulos, Costas P.; Conklin, Bruce R.; Healy, Kevin E.

    2015-07-01

    Tissue morphogenesis and organ formation are the consequences of biochemical and biophysical cues that lead to cellular spatial patterning in development. To model such events in vitro, we use PEG-patterned substrates to geometrically confine human pluripotent stem cell colonies and spatially present mechanical stress. Modulation of the WNT/β-catenin pathway promotes spatial patterning via geometric confinement of the cell condensation process during epithelial-mesenchymal transition, forcing cells at the perimeter to express an OCT4+ annulus, which is coincident with a region of higher cell density and E-cadherin expression. The biochemical and biophysical cues synergistically induce self-organizing lineage specification and creation of a beating human cardiac microchamber confined by the pattern geometry. These highly defined human cardiac microchambers can be used to study aspects of embryonic spatial patterning, early cardiac development and drug-induced developmental toxicity.

  6. Impaired perception of facial emotion in developmental prosopagnosia.

    PubMed

    Biotti, Federica; Cook, Richard

    2016-08-01

    Developmental prosopagnosia (DP) is a neurodevelopmental condition characterised by difficulties recognising faces. Despite severe difficulties recognising facial identity, expression recognition is typically thought to be intact in DP; case studies have described individuals who are able to correctly label photographic displays of facial emotion, and no group differences have been reported. This pattern of deficits suggests a locus of impairment relatively late in the face processing stream, after the divergence of expression and identity analysis pathways. To date, however, there has been little attempt to investigate emotion recognition systematically in a large sample of developmental prosopagnosics using sensitive tests. In the present study, we describe three complementary experiments that examine emotion recognition in a sample of 17 developmental prosopagnosics. In Experiment 1, we investigated observers' ability to make binary classifications of whole-face expression stimuli drawn from morph continua. In Experiment 2, observers judged facial emotion using only the eye-region (the rest of the face was occluded). Analyses of both experiments revealed diminished ability to classify facial expressions in our sample of developmental prosopagnosics, relative to typical observers. Imprecise expression categorisation was particularly evident in those individuals exhibiting apperceptive profiles, associated with problems encoding facial shape accurately. Having split the sample of prosopagnosics into apperceptive and non-apperceptive subgroups, only the apperceptive prosopagnosics were impaired relative to typical observers. In our third experiment, we examined the ability of observers' to classify the emotion present within segments of vocal affect. Despite difficulties judging facial emotion, the prosopagnosics exhibited excellent recognition of vocal affect. Contrary to the prevailing view, our results suggest that many prosopagnosics do experience difficulties classifying expressions, particularly those with apperceptive profiles. These individuals may have difficulties forming view-invariant structural descriptions at an early stage in the face processing stream, before identity and expression pathways diverge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

    PubMed

    Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

    2016-02-29

    Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

  8. Hox gene expression in the specialized limbs of the Iberian mole (Talpa occidentalis).

    PubMed

    Bickelmann, Constanze; van der Vos, Wessel; de Bakker, Merijn A G; Jiménez, Rafael; Maas, Saskia; Sánchez-Villagra, Marcelo R

    2017-01-01

    Fossorial talpid moles use their limbs predominantly for digging, which explains their highly specialized anatomy. The humerus is particularly short and dorsoventrally rotated, with broadened distal and proximal parts where muscles attach and which facilitate powerful abductive movements. The radius and ulna are exceptionally robust and short. The ulna has an expanded olecranon process. The femur is generalized, but the fused tibia-fibula complex is short and robust. To understand the developmental bases of these specializations, we studied expression patterns of four 5' Hox genes in the fossorial Iberian mole (Talpa occidentalis). These genes are known to play major roles in patterning the developing limb skeleton in the mouse, with which comparisons were made (Mus musculus, C57BL/6Jico strain). We find that HoxA9 expression is spatially expanded in the developing stylopodial area in the mole forelimb, compared to the less specialized mouse forelimb and mole hind limb. HoxD9 expression does not extend into the thoracic body wall in the mole forelimb in contrast to the mouse, and is also reduced in the presumptive zeugopodium in mole forelimb, compared to mouse. Expression of HoxD11 is upregulated in the mole in the postaxial area of the hind limb zeugopod, compared to the mouse. On the other hand, HoxD13 is downregulated in the postaxial zeugopodial area in the forelimb of the mole, compared to the mouse. The differences in the expression patterns of these 5' Hox genes between Talpa and Mus are an indication of the developmental changes going hand in hand with anatomical digging adaptations in the mole adult. © 2016 Wiley Periodicals, Inc.

  9. Evolution of developmental roles of Pax2/5/8 paralogs after independent duplication in urochordate and vertebrate lineages.

    PubMed

    Bassham, Susan; Cañestro, Cristian; Postlethwait, John H

    2008-08-22

    Gene duplication provides opportunities for lineage diversification and evolution of developmental novelties. Duplicated genes generally either disappear by accumulation of mutations (nonfunctionalization), or are preserved either by the origin of positively selected functions in one or both duplicates (neofunctionalization), or by the partitioning of original gene subfunctions between the duplicates (subfunctionalization). The Pax2/5/8 family of important developmental regulators has undergone parallel expansion among chordate groups. After the divergence of urochordate and vertebrate lineages, two rounds of independent gene duplications resulted in the Pax2, Pax5, and Pax8 genes of most vertebrates (the sister group of the urochordates), and an additional duplication provided the pax2a and pax2b duplicates in teleost fish. Separate from the vertebrate genome expansions, a duplication also created two Pax2/5/8 genes in the common ancestor of ascidian and larvacean urochordates. To better understand mechanisms underlying the evolution of duplicated genes, we investigated, in the larvacean urochordate Oikopleura dioica, the embryonic gene expression patterns of Pax2/5/8 paralogs. We compared the larvacean and ascidian expression patterns to infer modular subfunctions present in the single pre-duplication Pax2/5/8 gene of stem urochordates, and we compared vertebrate and urochordate expression to infer the suite of Pax2/5/8 gene subfunctions in the common ancestor of olfactores (vertebrates + urochordates). Expression pattern differences of larvacean and ascidian Pax2/5/8 orthologs in the endostyle, pharynx and hindgut suggest that some ancestral gene functions have been partitioned differently to the duplicates in the two urochordate lineages. Novel expression in the larvacean heart may have resulted from the neofunctionalization of a Pax2/5/8 gene in the urochordates. Expression of larvacean Pax2/5/8 in the endostyle, in sites of epithelial remodeling, and in sensory tissues evokes like functions of Pax2, Pax5 and Pax8 in vertebrate embryos, and may indicate ancient origins for these functions in the chordate common ancestor. Comparative analysis of expression patterns of chordate Pax2/5/8 duplicates, rooted on the single-copy Pax2/5/8 gene of amphioxus, whose lineage diverged basally among chordates, provides new insights into the evolution and development of the heart, thyroid, pharynx, stomodeum and placodes in chordates; supports the controversial conclusion that the atrial siphon of ascidians and the otic placode in vertebrates are homologous; and backs the notion that Pax2/5/8 functioned in ancestral chordates to engineer epithelial fusions and perforations, including gill slit openings.

  10. Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

    2008-07-01

    Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

  11. Function and regulation of heat shock factor 2 during mouse embryogenesis

    PubMed Central

    Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

    1997-01-01

    The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

  12. THE EVOLUTION OF CANALIZATION AND THE BREAKING OF VON BAER'S LAWS: MODELING THE EVOLUTION OF DEVELOPMENT WITH EPISTASIS.

    PubMed

    Rice, Sean H

    1998-06-01

    Evolution can change the developmental processes underlying a character without changing the average expression of the character itself. This sort of change must occur in both the evolution of canalization, in which a character becomes increasingly buffered against genetic or developmental variation, and in the phenomenon of closely related species that show similar adult phenotypes but different underlying developmental patterns. To study such phenomena, I develop a model that follows evolution on a surface representing adult phenotype as a function of underlying developmental characters. A contour on such a "phenotype landscape" is a set of states of developmental characters that produce the same adult phenotype. Epistasis induces curvature of this surface, and degree of canalization is represented by the slope along a contour. I first discuss the geometric properties of phenotype landscapes, relating epistasis to canalization. I then impose a fitness function on the phenotype and model evolution of developmental characters as a function of the fitness function and the local geometry of the surface. This model shows how canalization evolves as a population approaches an optimum phenotype. It further shows that under some circumstances, "decanalization" can occur, in which the expression of adult phenotype becomes increasingly sensitive to developmental variation. This process can cause very similar populations to diverge from one another developmentally even when their adult phenotypes experience identical selection regimes. © 1998 The Society for the Study of Evolution.

  13. Spatial fluctuations in expression of the heterocyst differentiation regulatory gene hetR in Anabaena filaments.

    PubMed

    Corrales-Guerrero, Laura; Tal, Asaf; Arbel-Goren, Rinat; Mariscal, Vicente; Flores, Enrique; Herrero, Antonia; Stavans, Joel

    2015-04-01

    Under nitrogen deprivation, filaments of the cyanobacterium Anabaena undergo a process of development, resulting in a one-dimensional pattern of nitrogen-fixing heterocysts separated by about ten photosynthetic vegetative cells. Many aspects of gene expression before nitrogen deprivation and during the developmental process remain to be elucidated. Furthermore, the coupling of gene expression fluctuations between cells along a multicellular filament is unknown. We studied the statistics of fluctuations of gene expression of HetR, a transcription factor essential for heterocyst differentiation, both under steady-state growth in nitrogen-rich conditions and at different times following nitrogen deprivation, using a chromosomally-encoded translational hetR-gfp fusion. Statistical analysis of fluorescence at the individual cell level in wild-type and mutant filaments demonstrates that expression fluctuations of hetR in nearby cells are coupled, with a characteristic spatial range of circa two to three cells, setting the scale for cellular interactions along a filament. Correlations between cells predominantly arise from intercellular molecular transfer and less from cell division. Fluctuations after nitrogen step-down can build up on those under nitrogen-replete conditions. We found that under nitrogen-rich conditions, basal, steady-state expression of the HetR inhibitor PatS, cell-cell communication influenced by the septal protein SepJ and positive HetR auto-regulation are essential determinants of fluctuations in hetR expression and its distribution along filaments. A comparison between the expression of hetR-gfp under nitrogen-rich and nitrogen-poor conditions highlights the differences between the two HetR inhibitors PatS and HetN, as well as the differences in specificity between the septal proteins SepJ and FraC/FraD. Activation, inhibition and cell-cell communication lie at the heart of developmental processes. Our results show that proteins involved in these basic ingredients combine together in the presence of inevitable stochasticity in gene expression, to control the coupled fluctuations of gene expression that give rise to a one-dimensional developmental pattern in this organism.

  14. Development of hemipenes in the ball python snake Python regius.

    PubMed

    Leal, Francisca; Cohn, Martin J

    2015-01-01

    Within amniotes, external copulatory organs have undergone extensive morphological diversification. One of the most extreme examples is squamate (lizards and snakes) hemipenes, which are paired copulatory organs that extend from the lateral margins of the cloaca. Here, we describe the development of hemipenes in a basal snake, the ball python (Python regius). Snake hemipenes arise as a pair of lateral swellings on either side of the caudal part of the cloaca, and these paired outgrowths persist to form the left and right hemipenes. In non-squamate amniotes, external genitalia form from paired swellings that arise on the anterior side of the cloaca, which then fuse medially to form a single genital tubercle, the anlagen of the penis or clitoris. Whereas in non-squamate amniotes, Sonic hedgehog (Shh)-expressing cells of the cloacal endoderm form the urethral or sulcus epithelium and are required for phallus outgrowth, the hemipenes of squamates lack an endodermal contribution, and the sulcus does not express Shh. Thus, snake hemipenes differ from the genital tubercles of non-squamate amniotes both in their embryonic origins and in at least part of patterning mechanisms, which raises the possibility that hemipenes may not be direct homologs of the unpaired amniote penis. Nonetheless, we find that some developmental genes show similar expression patterns in snake hemipenes buds and non-squamate genital tubercles, suggesting that homologous developmental mechanisms are involved in aspects of external genital development across amniotes, even when these structures may have different developmental origins and may have arisen independently during evolution.

  15. A high resolution atlas of gene expression in the domestic sheep (Ovis aries)

    PubMed Central

    Farquhar, Iseabail L.; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G.; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C. Bruce; Freeman, Tom C.; Archibald, Alan L.; Hume, David A.

    2017-01-01

    Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of ‘guilt by association’ was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages. PMID:28915238

  16. A high resolution atlas of gene expression in the domestic sheep (Ovis aries).

    PubMed

    Clark, Emily L; Bush, Stephen J; McCulloch, Mary E B; Farquhar, Iseabail L; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G; Wu, Chunlei; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C Bruce; Freeman, Tom C; Summers, Kim M; Archibald, Alan L; Hume, David A

    2017-09-01

    Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of 'guilt by association' was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages.

  17. Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

    PubMed

    Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

    2013-08-01

    The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

  18. Expression analysis of genes encoding double B-box zinc finger proteins in maize.

    PubMed

    Li, Wenlan; Wang, Jingchao; Sun, Qi; Li, Wencai; Yu, Yanli; Zhao, Meng; Meng, Zhaodong

    2017-11-01

    The B-box proteins play key roles in plant development. The double B-box (DBB) family is one of the subfamily of the B-box family, with two B-box domains and without a CCT domain. In this study, 12 maize double B-box genes (ZmDBBs) were identified through a genome-wide survey. Phylogenetic analysis of DBB proteins from maize, rice, Sorghum bicolor, Arabidopsis, and poplar classified them into five major clades. Gene duplication analysis indicated that segmental duplications made a large contribution to the expansion of ZmDBBs. Furthermore, a large number of cis-acting regulatory elements related to plant development, response to light and phytohormone were identified in the promoter regions of the ZmDBB genes. The expression patterns of the ZmDBB genes in various tissues and different developmental stages demonstrated that ZmDBBs might play essential roles in plant development, and some ZmDBB genes might have unique function in specific developmental stages. In addition, several ZmDBB genes showed diurnal expression pattern. The expression levels of some ZmDBB genes changed significantly under light/dark treatment conditions and phytohormone treatments, implying that they might participate in light signaling pathway and hormone signaling. Our results will provide new information to better understand the complexity of the DBB gene family in maize.

  19. Developmental changes in face visual scanning in autism spectrum disorder as assessed by data-based analysis

    PubMed Central

    Amestoy, Anouck; Guillaud, Etienne; Bouvard, Manuel P.; Cazalets, Jean-René

    2015-01-01

    Individuals with autism spectrum disorder (ASD) present reduced visual attention to faces. However, contradictory conclusions have been drawn about the strategies involved in visual face scanning due to the various methodologies implemented in the study of facial screening. Here, we used a data-driven approach to compare children and adults with ASD subjected to the same free viewing task and to address developmental aspects of face scanning, including its temporal patterning, in healthy children, and adults. Four groups (54 subjects) were included in the study: typical adults, typically developing children, and adults and children with ASD. Eye tracking was performed on subjects viewing unfamiliar faces. Fixations were analyzed using a data-driven approach that employed spatial statistics to provide an objective, unbiased definition of the areas of interest. Typical adults expressed a spatial and temporal strategy for visual scanning that differed from the three other groups, involving a sequential fixation of the right eye (RE), left eye (LE), and mouth. Typically developing children, adults and children with autism exhibited similar fixation patterns and they always started by looking at the RE. Children (typical or with ASD) subsequently looked at the LE or the mouth. Based on the present results, the patterns of fixation for static faces that mature from childhood to adulthood in typical subjects are not found in adults with ASD. The atypical patterns found after developmental progression and experience in ASD groups appear to remain blocked in an immature state that cannot be differentiated from typical developmental child patterns of fixation. PMID:26236264

  20. Comparative methods for the analysis of gene-expression evolution: an example using yeast functional genomic data.

    PubMed

    Oakley, Todd H; Gu, Zhenglong; Abouheif, Ehab; Patel, Nipam H; Li, Wen-Hsiung

    2005-01-01

    Understanding the evolution of gene function is a primary challenge of modern evolutionary biology. Despite an expanding database from genomic and developmental studies, we are lacking quantitative methods for analyzing the evolution of some important measures of gene function, such as gene-expression patterns. Here, we introduce phylogenetic comparative methods to compare different models of gene-expression evolution in a maximum-likelihood framework. We find that expression of duplicated genes has evolved according to a nonphylogenetic model, where closely related genes are no more likely than more distantly related genes to share common expression patterns. These results are consistent with previous studies that found rapid evolution of gene expression during the history of yeast. The comparative methods presented here are general enough to test a wide range of evolutionary hypotheses using genomic-scale data from any organism.

  1. Embryonic expression of endothelins and their receptors in lamprey and frog reveals stem vertebrate origins of complex Endothelin signaling

    PubMed Central

    Square, Tyler; Jandzik, David; Cattell, Maria; Hansen, Andrew; Medeiros, Daniel Meulemans

    2016-01-01

    Neural crest cells (NCCs) are highly patterned embryonic cells that migrate along stereotyped routes to give rise to a diverse array of adult tissues and cell types. Modern NCCs are thought to have evolved from migratory neural precursors with limited developmental potential and patterning. How this occurred is poorly understood. Endothelin signaling regulates several aspects of NCC development, including their migration, differentiation, and patterning. In jawed vertebrates, Endothelin signaling involves multiple functionally distinct ligands (Edns) and receptors (Ednrs) expressed in various NCC subpopulations. To test the potential role of endothelin signaling diversification in the evolution of modern, highly patterned NCC, we analyzed the expression of the complete set of endothelin ligands and receptors in the jawless vertebrate, the sea lamprey (Petromyzon marinus). To better understand ancestral features of gnathostome edn and ednr expression, we also analyzed all known Endothelin signaling components in the African clawed frog (Xenopus laevis). We found that the sea lamprey has a gnathsotome-like complement of edn and ednr duplicates, and these genes are expressed in patterns highly reminiscent of their gnathostome counterparts. Our results suggest that the duplication and specialization of vertebrate Endothelin signaling coincided with the appearance of highly patterned and multipotent NCCs in stem vertebrates. PMID:27677704

  2. Expression and functional analyses of a Kinesin gene GhKIS13A1 from cotton (Gossypium hirsutum) fiber.

    PubMed

    Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie

    2017-06-12

    Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.

  3. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  4. Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

    PubMed Central

    Preston, Jill C.; Kellogg, Elizabeth A.

    2006-01-01

    Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

  5. Molecular networks and the evolution of human cognitive specializations.

    PubMed

    Fontenot, Miles; Konopka, Genevieve

    2014-12-01

    Inroads into elucidating the origins of human cognitive specializations have taken many forms, including genetic, genomic, anatomical, and behavioral assays that typically compare humans to non-human primates. While the integration of all of these approaches is essential for ultimately understanding human cognition, here, we review the usefulness of coexpression network analysis for specifically addressing this question. An increasing number of studies have incorporated coexpression networks into brain expression studies comparing species, disease versus control tissue, brain regions, or developmental time periods. A clearer picture has emerged of the key genes driving brain evolution, as well as the developmental and regional contributions of gene expression patterns important for normal brain development and those misregulated in cognitive diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

    PubMed Central

    Almoguera, C.; Coca, M. A.; Jordano, J.

    1995-01-01

    We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

  7. The segment polarity network is a robust developmental module

    NASA Astrophysics Data System (ADS)

    von Dassow, George; Meir, Eli; Munro, Edwin M.; Odell, Garrett M.

    2000-07-01

    All insects possess homologous segments, but segment specification differs radically among insect orders. In Drosophila, maternal morphogens control the patterned activation of gap genes, which encode transcriptional regulators that shape the patterned expression of pair-rule genes. This patterning cascade takes place before cellularization. Pair-rule gene products subsequently `imprint' segment polarity genes with reiterated patterns, thus defining the primordial segments. This mechanism must be greatly modified in insect groups in which many segments emerge only after cellularization. In beetles and parasitic wasps, for instance, pair-rule homologues are expressed in patterns consistent with roles during segmentation, but these patterns emerge within cellular fields. In contrast, although in locusts pair-rule homologues may not control segmentation, some segment polarity genes and their interactions are conserved. Perhaps segmentation is modular, with each module autonomously expressing a characteristic intrinsic behaviour in response to transient stimuli. If so, evolution could rearrange inputs to modules without changing their intrinsic behaviours. Here we suggest, using computer simulations, that the Drosophila segment polarity genes constitute such a module, and that this module is resistant to variations in the kinetic constants that govern its behaviour.

  8. Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

    PubMed

    Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

    2016-06-30

    Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage product accumulation (10-16 DAF). The results highlight versatile cellular metabolic activity in the transition phase and strong convergence towards storage product accumulation in the storage phase. Notably, both phases are characterized by particular protective mechanism, such as scavenging of oxidative stress and defence against pathogens, during the transition and the storage phase, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Complex expression patterns of lymphocyte-specific genes during the development of cartilaginous fish implicate unique lymphoid tissues in generating an immune repertoire

    NASA Technical Reports Server (NTRS)

    Miracle, A. L.; Anderson, M. K.; Litman, R. T.; Walsh, C. J.; Luer, C. A.; Rothenberg, E. V.; Litman, G. W.

    2001-01-01

    Cartilaginous fish express canonical B and T cell recognition genes, but their lymphoid organs and lymphocyte development have been poorly defined. Here, the expression of Ig, TCR, recombination-activating gene (Rag)-1 and terminal deoxynucleosidase (TdT) genes has been used to identify roles of various lymphoid tissues throughout development in the cartilaginous fish, Raja eglanteria (clearnose skate). In embryogenesis, Ig and TCR genes are sharply up-regulated at 8 weeks of development. At this stage TCR and TdT expression is limited to the thymus; later, TCR gene expression appears in peripheral sites in hatchlings and adults, suggesting that the thymus is a source of T cells as in mammals. B cell gene expression indicates more complex roles for the spleen and two special organs of cartilaginous fish-the Leydig and epigonal (gonad-associated) organs. In the adult, the Leydig organ is the site of the highest IgM and IgX expression. However, the spleen is the first site of IgM expression, while IgX is expressed first in gonad, liver, Leydig and even thymus. Distinctive spatiotemporal patterns of Ig light chain gene expression also are seen. A subset of Ig genes is pre-rearranged in the germline of the cartilaginous fish, making expression possible without rearrangement. To assess whether this allows differential developmental regulation, IgM and IgX heavy chain cDNA sequences from specific tissues and developmental stages have been compared with known germline-joined genomic sequences. Both non-productively rearranged genes and germline-joined genes are transcribed in the embryo and hatchling, but not in the adult.

  10. Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

    PubMed

    Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

    2006-09-01

    Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

  11. Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

    PubMed

    Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

    2014-01-01

    Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

  12. Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

    PubMed

    Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

    2017-10-01

    Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

  13. Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

    PubMed Central

    Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

    2017-01-01

    Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

  14. The role of social relationships in bipolar disorder: a review.

    PubMed

    Greenberg, Sarah; Rosenblum, Katherine L; McInnis, Melvin G; Muzik, Maria

    2014-10-30

    Social relationships and attachment are core developmental elements of human existence and survival that evolve over the lifetime of an individual. The internal and external factors that influence them include the presence of illness in the individual or in their immediate environment. The developmental aspects of attachment and social relationships have become increasingly of interest and relevance in light of early developmental epigenetic modification of gene expression patterns that may influence subsequent behavioral patterns and outcomes. This review examines extant literature on attachment and social relationships in bipolar cohorts. Despite many methodological challenges, the findings indicate that social relationships and capacity for attachment are significantly compromised in individuals with bipolar disorder compared to other mood disorders and normal controls. Though extant research is limited, research clearly points toward the importance of social relationships on the etiology, course, and consequences of bipolar disorder. We highlight a number of key considerations for future research. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Facial emotion recognition in Williams syndrome and Down syndrome: A matching and developmental study.

    PubMed

    Martínez-Castilla, Pastora; Burt, Michael; Borgatti, Renato; Gagliardi, Chiara

    2015-01-01

    In this study both the matching and developmental trajectories approaches were used to clarify questions that remain open in the literature on facial emotion recognition in Williams syndrome (WS) and Down syndrome (DS). The matching approach showed that individuals with WS or DS exhibit neither proficiency for the expression of happiness nor specific impairments for negative emotions. Instead, they present the same pattern of emotion recognition as typically developing (TD) individuals. Thus, the better performance on the recognition of positive compared to negative emotions usually reported in WS and DS is not specific of these populations but seems to represent a typical pattern. Prior studies based on the matching approach suggested that the development of facial emotion recognition is delayed in WS and atypical in DS. Nevertheless, and even though performance levels were lower in DS than in WS, the developmental trajectories approach used in this study evidenced that not only individuals with DS but also those with WS present atypical development in facial emotion recognition. Unlike in the TD participants, where developmental changes were observed along with age, in the WS and DS groups, the development of facial emotion recognition was static. Both individuals with WS and those with DS reached an early maximum developmental level due to cognitive constraints.

  16. Role of the Hypothalamic-Pituitary-Adrenal Axis in Developmental Programming of Health and Disease

    PubMed Central

    Xiong, Fuxia; Zhang, Lubo

    2012-01-01

    Adverse environments during the fetal and neonatal development period may permanently program physiology and metabolism, and lead to increased risk of diseases in later life. Programming of the hypothalamic-pituitary-adrenal (HPA) axis is one of the key mechanisms that contribute to altered metabolism and response to stress. Programming of the HPA axis often involves epigenetic modification of the glucocorticoid receptor (GR) gene promoter, which influences tissue-specific GR expression patterns and response to stimuli. This review summarizes the current state of research on the HPA axis and programming of health and disease in the adult, focusing on the epigenetic regulation of GR gene expression patterns in response to fetal and neonatal stress. Aberrant GR gene expression patterns in the developing brain may have a significant negative impact on protection of the immature brain against hypoxic-ischemic encephalopathy in the critical period of development during and immediately after birth. PMID:23200813

  17. Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

    PubMed

    Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

    2005-07-01

    Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

  18. Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

    PubMed

    Rosario, Christopher J; Tan, Ming

    2016-01-15

    Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. De novo Assembly of the Burying Beetle Nicrophorus orbicollis (Coleoptera: Silphidae) Transcriptome Across Developmental Stages with Identification of Key Immune Transcripts

    PubMed Central

    Won, Harim I.; Schulze, Thomas T.; Clement, Emalie J.; Watson, Gabrielle F.; Watson, Sean M.; Warner, Rosalie C.; Ramler, Elizabeth A. M.; Witte, Elias J.; Schoenbeck, Mark A.; Rauter, Claudia M.; Davis, Paul H.

    2018-01-01

    Burying beetles (Nicrophorus spp.) are among the relatively few insects that provide parental care while not belonging to the eusocial insects such as ants or bees. This behavior incurs energy costs as evidenced by immune deficits and shorter life-spans in reproducing beetles. In the absence of an assembled transcriptome, relatively little is known concerning the molecular biology of these beetles. This work details the assembly and analysis of the Nicrophorus orbicollis transcriptome at multiple developmental stages. RNA-Seq reads were obtained by next-generation sequencing and the transcriptome was assembled using the Trinity assembler. Validation of the assembly was performed by functional characterization using Gene Ontology (GO), Eukaryotic Orthologous Groups (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Differential expression analysis highlights developmental stage-specific expression patterns, and immunity-related transcripts are discussed. The data presented provides a valuable molecular resource to aid further investigation into immunocompetence throughout this organism's sexual development. PMID:29707046

  20. Australian black field crickets show changes in neural gene expression associated with socially-induced morphological, life-history, and behavioral plasticity.

    PubMed

    Kasumovic, Michael M; Chen, Zhiliang; Wilkins, Marc R

    2016-10-24

    Ecological and evolutionary model organisms have provided extensive insight into the ecological triggers, adaptive benefits, and evolution of life-history driven developmental plasticity. Despite this, we still have a poor understanding of the underlying genetic changes that occur during shifts towards different developmental trajectories. The goal of this study is to determine whether we can identify underlying gene expression patterns that can describe the different life-history trajectories individuals follow in response to social cues of competition. To do this, we use the Australian black field cricket (Teleogryllus commodus), a species with sex-specific developmental trajectories moderated by the density and quality of calls heard during immaturity. In this study, we manipulated the social information males and females could hear by rearing individuals in either calling or silent treatments. We next used RNA-Seq to develop a reference transcriptome to study changes in brain gene expression at two points prior to sexual maturation. We show accelerated development in both sexes when exposed to calling; changes were also seen in growth, lifespan, and reproductive effort. Functional relationships between genes and phenotypes were apparent from ontological enrichment analysis. We demonstrate that increased investment towards traits such as growth and reproductive effort were often associated with the expression of a greater number of genes with similar effect, thus providing a suite of candidate genes for future research in this and other invertebrate organisms. Our results provide interesting insight into the genomic underpinnings of developmental plasticity and highlight the potential of a genomic exploration of other evolutionary theories such as condition dependence and sex-specific developmental strategies.

  1. A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

    PubMed

    Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

    2016-02-01

    Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  2. Modular evolution of the Cetacean vertebral column.

    PubMed

    Buchholtz, Emily A

    2007-01-01

    Modular theory predicts that hierarchical developmental processes generate hierarchical phenotypic units that are capable of independent modification. The vertebral column is an overtly modular structure, and its rapid phenotypic transformation in cetacean evolution provides a case study for modularity. Terrestrial mammals have five morphologically discrete vertebral series that are now known to be coincident with Hox gene expression patterns. Here, I present the hypothesis that in living Carnivora and Artiodactyla, and by inference in the terrestrial ancestors of whales, the series are themselves components of larger precaudal and caudal modular units. Column morphology in a series of fossil and living whales is used to predict the type and sequence of developmental changes responsible for modification of that ancestral pattern. Developmental innovations inferred include independent meristic additions to the precaudal column in basal archaeocetes and basilosaurids, stepwise homeotic reduction of the sacral series in protocetids, and dissociation of the caudal series into anterior tail and fluke subunits in basilosaurids. The most dramatic change was the novel association of lumbar and anterior caudal vertebrae in a module that crosses the precaudal/caudal boundary. This large unit is defined by shared patterns of vertebral morphology, count, and size in all living whales (Neoceti).

  3. Tools for neuroanatomy and neurogenetics in Drosophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.

    2008-08-11

    We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayedmore » for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.« less

  4. Enriched expression of the ciliopathy gene Ick in cell proliferating regions of adult mice.

    PubMed

    Tsutsumi, Ryotaro; Chaya, Taro; Furukawa, Takahisa

    2018-04-07

    Cilia are essential for sensory and motile functions across species. In humans, ciliary dysfunction causes "ciliopathies", which show severe developmental abnormalities in various tissues. Several missense mutations in intestinal cell kinase (ICK) gene lead to endocrine-cerebro-osteodysplasia syndrome or short rib-polydactyly syndrome, lethal recessive developmental ciliopathies. We and others previously reported that Ick-deficient mice exhibit neonatal lethality with developmental defects. Mechanistically, Ick regulates intraflagellar transport and cilia length at ciliary tips. Although Ick plays important roles during mammalian development, roles of Ick at the adult stage are poorly understood. In the current study, we investigated the Ick gene expression in adult mouse tissues. RT-PCR analysis showed that Ick is ubiquitously expressed, with enrichment in the retina, brain, lung, intestine, and reproductive system. In the adult brain, we found that Ick expression is enriched in the walls of the lateral ventricle, in the rostral migratory stream of the olfactory bulb, and in the subgranular zone of the hippocampal dentate gyrus by in situ hybridization analysis. We also observed that Ick staining pattern is similar to pachytene spermatocyte to spermatid markers in the mature testis and to an intestinal stem cell marker in the adult small intestine. These results suggest that Ick is expressed in proliferating regions in the adult mouse brain, testis, and intestine. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Mutation of the murC and murB Genes Impairs Heterocyst Differentiation in Anabaena sp. Strain PCC 7120

    PubMed Central

    Videau, Patrick; Rivers, Orion S.; Ushijima, Blake; Oshiro, Reid T.; Kim, Min Joo; Philmus, Benjamin

    2016-01-01

    ABSTRACT To stabilize cellular integrity in the face of environmental perturbations, most bacteria, including cyanobacteria, synthesize and maintain a strong, flexible, three-dimensional peptidoglycan lattice. Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium capable of differentiating morphologically distinct nitrogen-fixing heterocyst cells in a periodic pattern. While heterocyst development has been shown to require proper peptidoglycan remodeling, the role of peptidoglycan synthesis has remained unclear. Here we report the identification of two peptidoglycan synthesis genes, murC (alr5065) and murB (alr5066), as required for heterocyst development. The murC and murB genes are predicted to encode a UDP-N-acetylmuramate:l-alanine ligase and a UDP-N-acetylenolpyruvoylglucosamine reductase, respectively, and we confirm enzymatic function through complementation of Escherichia coli strains deficient for these enzymes. Cells depleted of either murC or murB expression failed to differentiate heterocysts under normally inducing conditions and displayed decreased filament integrity. To identify the stage(s) of development affected by murC or murB depletion, the spatial distribution of expression of the patterning marker gene, patS, was examined. Whereas murB depletion did not affect the pattern of patS expression, murC depletion led to aberrant expression of patS in all cells of the filament. Finally, expression of gfp controlled by the region of DNA immediately upstream of murC was enriched in differentiating cells and was repressed by the transcription factor NtcA. Collectively, the data in this work provide evidence for a direct link between peptidoglycan synthesis and the maintenance of a biological pattern in a multicellular organism. IMPORTANCE Multicellular organisms that differentiate specialized cells must regulate morphological changes such that both cellular integrity and the dissemination of developmental signals are preserved. Here we show that the multicellular bacterium Anabaena, which differentiates a periodic pattern of specialized heterocyst cells, requires peptidoglycan synthesis by the murine ligase genes murC (alr5065) and murB (alr5066) for maintenance of patterned gene expression, filament integrity, and overall development. This work highlights the significant influence that intracellular structure and intercellular connections can have on the execution of a developmental program. PMID:26811320

  6. Mutation of the murC and murB Genes Impairs Heterocyst Differentiation in Anabaena sp. Strain PCC 7120.

    PubMed

    Videau, Patrick; Rivers, Orion S; Ushijima, Blake; Oshiro, Reid T; Kim, Min Joo; Philmus, Benjamin; Cozy, Loralyn M

    2016-04-01

    To stabilize cellular integrity in the face of environmental perturbations, most bacteria, including cyanobacteria, synthesize and maintain a strong, flexible, three-dimensional peptidoglycan lattice. Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium capable of differentiating morphologically distinct nitrogen-fixing heterocyst cells in a periodic pattern. While heterocyst development has been shown to require proper peptidoglycan remodeling, the role of peptidoglycan synthesis has remained unclear. Here we report the identification of two peptidoglycan synthesis genes, murC (alr5065) and murB (alr5066), as required for heterocyst development. The murC and murB genes are predicted to encode a UDP-N-acetylmuramate:L-alanine ligase and a UDP-N-acetylenolpyruvoylglucosamine reductase, respectively, and we confirm enzymatic function through complementation of Escherichia coli strains deficient for these enzymes. Cells depleted of either murC or murB expression failed to differentiate heterocysts under normally inducing conditions and displayed decreased filament integrity. To identify the stage(s) of development affected by murC or murB depletion, the spatial distribution of expression of the patterning marker gene, patS, was examined. Whereas murB depletion did not affect the pattern of patS expression, murC depletion led to aberrant expression of patS in all cells of the filament. Finally, expression of gfp controlled by the region of DNA immediately upstream of murC was enriched in differentiating cells and was repressed by the transcription factor NtcA. Collectively, the data in this work provide evidence for a direct link between peptidoglycan synthesis and the maintenance of a biological pattern in a multicellular organism. Multicellular organisms that differentiate specialized cells must regulate morphological changes such that both cellular integrity and the dissemination of developmental signals are preserved. Here we show that the multicellular bacterium Anabaena, which differentiates a periodic pattern of specialized heterocyst cells, requires peptidoglycan synthesis by the murine ligase genes murC (alr5065) and murB (alr5066) for maintenance of patterned gene expression, filament integrity, and overall development. This work highlights the significant influence that intracellular structure and intercellular connections can have on the execution of a developmental program. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.

    PubMed

    Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio

    2018-04-01

    Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.

  8. Conserved patterns of integrated developmental plasticity in a group of polyphenic tropical butterflies.

    PubMed

    van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M

    2017-02-27

    Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.

  9. Evolution of developmental regulation in the vertebrate FgfD subfamily.

    PubMed

    Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

    2010-01-15

    Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

  10. Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology1[OPEN

    PubMed Central

    Chitwood, Daniel H.; Kumar, Ravi; Ranjan, Aashish; Pelletier, Julie M.; Townsley, Brad T.; Ichihashi, Yasunori; Martinez, Ciera C.; Zumstein, Kristina; Harada, John J.; Maloof, Julin N.; Sinha, Neelima R.

    2015-01-01

    Plants sense the foliar shade of competitors and alter their developmental programs through the shade-avoidance response. Internode and petiole elongation, and changes in overall leaf area and leaf mass per area, are the stereotypical architectural responses to foliar shade in the shoot. However, changes in leaf shape and complexity in response to shade remain incompletely, and qualitatively, described. Using a meta-analysis of more than 18,000 previously published leaflet outlines, we demonstrate that shade avoidance alters leaf shape in domesticated tomato (Solanum lycopersicum) and wild relatives. The effects of shade avoidance on leaf shape are subtle with respect to individual traits but are combinatorially strong. We then seek to describe the developmental origins of shade-induced changes in leaf shape by swapping plants between light treatments. Leaf size is light responsive late into development, but patterning events, such as stomatal index, are irrevocably specified earlier. Observing that shade induces increases in shoot apical meristem size, we then describe gene expression changes in early leaf primordia and the meristem using laser microdissection. We find that in leaf primordia, shade avoidance is not mediated through canonical pathways described in mature organs but rather through the expression of KNOTTED1-LIKE HOMEOBOX and other indeterminacy genes, altering known developmental pathways responsible for patterning leaf shape. We also demonstrate that shade-induced changes in leaf primordium gene expression largely do not overlap with those found in successively initiated leaf primordia, providing evidence against classic hypotheses that shaded leaf morphology results from the prolonged production of juvenile leaf types. PMID:26381315

  11. Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

    PubMed

    Metzger, David C H; Schulte, Patricia M

    2018-04-14

    Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

  12. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    USGS Publications Warehouse

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  13. Response of heat shock protein genes of the oriental fruit moth under diapause and thermal stress reveals multiple patterns dependent on the nature of stress exposure.

    PubMed

    Zhang, Bo; Peng, Yu; Zheng, Jincheng; Liang, Lina; Hoffmann, Ary A; Ma, Chun-Sen

    2016-07-01

    Heat shock protein gene (Hsp) families are thought to be important in thermal adaptation, but their expression patterns under various thermal stresses have still been poorly characterized outside of model systems. We have therefore characterized Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta, a widespread global orchard pest, and compared patterns of expression in this species to that of other insects. Genes from four Hsp families showed variable expression levels among tissues and developmental stages. Members of the Hsp40, 70, and 90 families were highly expressed under short exposures to heat and cold. Expression of Hsp40, 70, and Hsc70 family members increased in OFM undergoing diapause, while Hsp90 was downregulated. We found that there was strong sequence conservation of members of large Hsp families (Hsp40, Hsp60, Hsp70, Hsc70) across taxa, but this was not always matched by conservation of expression patterns. When the large Hsps as well as small Hsps from OFM were compared under acute and ramping heat stress, two groups of sHsps expression patterns were apparent, depending on whether expression increased or decreased immediately after stress exposure. These results highlight potential differences in conservation of function as opposed to sequence in this gene family and also point to Hsp genes potentially useful as bioindicators of diapause and thermal stress in OFM.

  14. Comparative Transcriptomic Characterization of the Early Development in Pacific White Shrimp Litopenaeus vannamei

    PubMed Central

    Wei, Jiankai; Zhang, Xiaojun; Yu, Yang; Huang, Hao; Li, Fuhua; Xiang, Jianhai

    2014-01-01

    Penaeid shrimp has a distinctive metamorphosis stage during early development. Although morphological and biochemical studies about this ontogeny have been developed for decades, researches on gene expression level are still scarce. In this study, we have investigated the transcriptomes of five continuous developmental stages in Pacific white shrimp (Litopenaeus vannamei) with high throughput Illumina sequencing technology. The reads were assembled and clustered into 66,815 unigenes, of which 32,398 have putative homologues in nr database, 14,981 have been classified into diverse functional categories by Gene Ontology (GO) annotation and 26,257 have been associated with 255 pathways by KEGG pathway mapping. Meanwhile, the differentially expressed genes (DEGs) between adjacent developmental stages were identified and gene expression patterns were clustered. By GO term enrichment analysis, KEGG pathway enrichment analysis and functional gene profiling, the physiological changes during shrimp metamorphosis could be better understood, especially histogenesis, diet transition, muscle development and exoskeleton reconstruction. In conclusion, this is the first study that characterized the integrated transcriptomic profiles during early development of penaeid shrimp, and these findings will serve as significant references for shrimp developmental biology and aquaculture research. PMID:25197823

  15. Participation in Leisure Activities among Boys with Attention Deficit Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Shimoni, Ma'ayan; Engel-Yeger, Batya; Tirosh, Emanuel

    2010-01-01

    ADHD is a neural developmental disorder expressed in various life settings. Yet, previous studies have focused mainly on children's function in school and academic achievement. The purpose of the present study was, therefore, to examine participation patterns in outside formal school activities among boys with ADHD compared to typical boys.…

  16. Early Language Development in Blind and Severely Visually Impaired Children. Interim Report on Pilot Study.

    ERIC Educational Resources Information Center

    Moore, Vanessa; McConachie, Helen

    This study investigated variables that might be associated with outcome differences in language development of 10 children (ages 10-20 months) with blindness or severe visual impairments, attending a developmental vision clinic in southern England. Subjects' early patterns of expressive language development were examined and related to observed…

  17. MicroRNAs: Bioactive molecules at the nexus of nutrition and disease

    USDA-ARS?s Scientific Manuscript database

    Foods contain a diverse array of molecules that impact how, when, and to what extent consumer genes are expressed, which in turn influences growth and development. One elegant example of this is seen in the developmental patterning of bees in a colony. The default programming state for the larvae re...

  18. Characterizing the Grape Transcriptome. Analysis of Expressed Sequence Tags from Multiple Vitis Species and Development of a Compendium of Gene Expression during Berry Development1[w

    PubMed Central

    Silva, Francisco Goes da; Iandolino, Alberto; Al-Kayal, Fadi; Bohlmann, Marlene C.; Cushman, Mary Ann; Lim, Hyunju; Ergul, Ali; Figueroa, Rubi; Kabuloglu, Elif K.; Osborne, Craig; Rowe, Joan; Tattersall, Elizabeth; Leslie, Anna; Xu, Jane; Baek, JongMin; Cramer, Grant R.; Cushman, John C.; Cook, Douglas R.

    2005-01-01

    We report the analysis and annotation of 146,075 expressed sequence tags from Vitis species. The majority of these sequences were derived from different cultivars of Vitis vinifera, comprising an estimated 25,746 unique contig and singleton sequences that survey transcription in various tissues and developmental stages and during biotic and abiotic stress. Putatively homologous proteins were identified for over 17,752 of the transcripts, with 1,962 transcripts further subdivided into one or more Gene Ontology categories. A simple structured vocabulary, with modules for plant genotype, plant development, and stress, was developed to describe the relationship between individual expressed sequence tags and cDNA libraries; the resulting vocabulary provides query terms to facilitate data mining within the context of a relational database. As a measure of the extent to which characterized metabolic pathways were encompassed by the data set, we searched for homologs of the enzymes leading from glycolysis, through the oxidative/nonoxidative pentose phosphate pathway, and into the general phenylpropanoid pathway. Homologs were identified for 65 of these 77 enzymes, with 86% of enzymatic steps represented by paralogous genes. Differentially expressed transcripts were identified by means of a stringent believability index cutoff of ≥98.4%. Correlation analysis and two-dimensional hierarchical clustering grouped these transcripts according to similarity of expression. In the broadest analysis, 665 differentially expressed transcripts were identified across 29 cDNA libraries, representing a range of developmental and stress conditions. The groupings revealed expected associations between plant developmental stages and tissue types, with the notable exception of abiotic stress treatments. A more focused analysis of flower and berry development identified 87 differentially expressed transcripts and provides the basis for a compendium that relates gene expression and annotation to previously characterized aspects of berry development and physiology. Comparison with published results for select genes, as well as correlation analysis between independent data sets, suggests that the inferred in silico patterns of expression are likely to be an accurate representation of transcript abundance for the conditions surveyed. Thus, the combined data set reveals the in silico expression patterns for hundreds of genes in V. vinifera, the majority of which have not been previously studied within this species. PMID:16219919

  19. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    PubMed

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. The histone chaperone ASF1 is essential for sexual development in the filamentous fungus Sordaria macrospora.

    PubMed

    Gesing, Stefan; Schindler, Daniel; Fränzel, Benjamin; Wolters, Dirk; Nowrousian, Minou

    2012-05-01

    Ascomycetes develop four major types of fruiting bodies that share a common ancestor, and a set of common core genes most likely controls this process. One way to identify such genes is to search for conserved expression patterns. We analysed microarray data of Fusarium graminearum and Sordaria macrospora, identifying 78 genes with similar expression patterns during fruiting body development. One of these genes was asf1 (anti-silencing function 1), encoding a predicted histone chaperone. asf1 expression is also upregulated during development in the distantly related ascomycete Pyronema confluens. To test whether asf1 plays a role in fungal development, we generated an S. macrospora asf1 deletion mutant. The mutant is sterile and can be complemented to fertility by transformation with the wild-type asf1 and its P. confluens homologue. An ASF1-EGFP fusion protein localizes to the nucleus. By tandem-affinity purification/mass spectrometry as well as yeast two-hybrid analysis, we identified histones H3 and H4 as ASF1 interaction partners. Several developmental genes are dependent on asf1 for correct transcriptional expression. Deletion of the histone chaperone genes rtt106 and cac2 did not cause any developmental phenotypes. These data indicate that asf1 of S. macrospora encodes a conserved histone chaperone that is required for fruiting body development. © 2012 Blackwell Publishing Ltd.

  1. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids.

    PubMed

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-08-13

    Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.

  2. Conserved developmental expression of Fezf in chordates and Drosophila and the origin of the Zona Limitans Intrathalamica (ZLI) brain organizer

    PubMed Central

    2010-01-01

    Background The zona limitans intrathalamica (ZLI) and the isthmus organizer (IsO) are two major secondary organizers of vertebrate brain development. These organizers are located at the interface of the expression domains of key patterning genes (Fezf-Irx and Otx-Gbx, respectively). To gain insights into the evolutionary origin of the ZLI, we studied Fezf in bilaterians. Results In this paper, we identified a conserved sequence motif (Fezf box) in all bilaterians. We report the expression pattern of Fezf in amphioxus and Drosophila and compare it with those of Gbx, Otx and Irx. We found that the relative expression patterns of these genes in vertebrates are fully conserved in amphioxus and flies, indicating that the genetic subdivisions defining the location of both secondary organizers in early vertebrate brain development were probably present in the last common ancestor of extant bilaterians. However, in contrast to vertebrates, we found that Irx-defective flies do not show an affected Fezf expression pattern. Conclusions The absence of expression of the corresponding morphogens from cells at these conserved genetic boundaries in invertebrates suggests that the organizing properties might have evolved specifically in the vertebrate lineage by the recruitment of key morphogens to these conserved genetic locations. PMID:20849572

  3. Correlation between ZBED6 Gene Upstream CpG Island methylation and mRNA expression in cattle.

    PubMed

    Huang, Yong-Zhen; Zhang, Zi-Jing; He, Hua; Cao, Xiu-Kai; Song, Cheng-Chuang; Liu, Kun-Peng; Lan, Xian-Yong; Lei, Chu-Zhao; Qi, Xing-Lei; Bai, Yue-Yu; Chen, Hong

    2017-04-03

    DNA methylation is essential for the regulation of gene expression and important roles in muscle development. To assess the extent of epigenetic modifications and gene expression on the differentially methylated region (DMR) in ZBED6, we simultaneously examined DNA methylation and expression in six tissues from two different developmental stages (fetal bovine and adult bovine). The DNA methylation pattern was compared using bisulfite sequencing polymerase chain reaction (BSP) and combined bisulfite restriction analysis (COBRA). The result of quantitative real-time PCR (qPCR) analysis showed that ZBED6 has a broad tissue distribution and is highly expressed in adult bovine (P < 0.05 or P < 0.01). The DNA methylation level was significantly different in liver, lung and spleen between the two cattle groups (P < 0.05 or P < 0.01). The adult bovine group exhibited a significantly higher mRNA level and lower DNA methylation level than the fetal bovine group in liver, lung, and spleen. No significant association was detected between DNA methylation level and muscle, heart, and kidney at two different stages. In this study, the statistical analyses indicated that DNA methylation patterns are associated with mRNA level in some tissues, these results may be a useful parameter to investigate muscle developmental in cattle and as a model for studies in other species, potentially contributing to an improvement of growth performance selection in beef cattle breeding program.

  4. Laminar-specific and developmental expression of aquaporin-4 in the mouse hippocampus

    PubMed Central

    Hsu, Mike S.; Seldin, Marcus; Lee, Darrin J.; Seifert, Gerald; Steinhäuser, Christian; Binder, Devin K.

    2011-01-01

    Mice deficient in the water channel AQP4 demonstrate increased seizure duration in response to hippocampal stimulation as well as impaired extracellular K+ clearance. However, the expression of AQP4 in the hippocampus is not well described. In this study, we investigated i) the developmental, laminar and cell-type specificity of AQP4 expression in the hippocampus; ii) the effect of Kir4.1 deletion on AQP4 expression; and iii) performed Western blot and RT-PCR analyses. AQP4 immunohistochemistry on coronal sections from WT or Kir4.1-/- mice revealed a developmentally-regulated and laminar-specific pattern, with highest expression in the CA1 stratum lacunosummoleculare (SLM) and the molecular layer (ML) of the dentate gyrus (DG). AQP4 was colocalized with the glial markers GFAP and S100ß in the hippocampus, and was also ubiquitously expressed on astrocytic endfeet around blood vessels. No difference in AQP4 immunoreactivity was observed in Kir4.1-/- mice. Electrophysiological and postrecording RT-PCR analyses of individual cells revealed that AQP4 and Kir4.1 were co-expressed in nearly all CA1 astrocytes. In NG2 cells, AQP4 was also expressed at the transcript level. This study is the first to examine subregional AQP4 expression during development of the hippocampus. The strikingly high expression of AQP4 in the CA1 SLM and DG ML identifies these regions as potential sites of astrocytic K+ and H2O regulation. These results begin to delineate the functional capabilities of hippocampal subregions and cell types for K+ and H2O homeostasis, which is critical to excitability and serves as a potential target for modulation in diverse diseases. PMID:21256195

  5. Germline transformation of the butterfly Bicyclus anynana.

    PubMed

    Marcus, Jeffrey M; Ramos, Diane M; Monteiro, Antónia

    2004-08-07

    Ecological and evolutionary theory has frequently been inspired by the diversity of colour patterns on the wings of butterflies. More recently, these varied patterns have also become model systems for studying the evolution of developmental mechanisms. A technique that will facilitate our understanding of butterfly colour-pattern development is germline transformation. Germline transformation permits functional tests of candidate gene products and of cis-regulatory regions, and provides a means of generating new colour-pattern mutants by insertional mutagenesis. We report the successful transformation of the African satyrid butterfly Bicyclus anynana with two different transposable element vectors, Hermes and piggyBac, each carrying EGFP coding sequences driven by the 3XP3 synthetic enhancer that drives gene expression in the eyes. Candidate lines identified by screening for EGFP in adult eyes were later confirmed by PCR amplification of a fragment of the EGFP coding sequence from genomic DNA. Flanking DNA surrounding the insertions was amplified by inverse PCR and sequenced. Transformation rates were 5% for piggyBac and 10.2% for Hermes. Ultimately, the new data generated by these techniques may permit an integrated understanding of the developmental genetics of colour-pattern formation and of the ecological and evolutionary processes in which these patterns play a role.

  6. Evolution of developmental roles of Pax2/5/8 paralogs after independent duplication in urochordate and vertebrate lineages

    PubMed Central

    Bassham, Susan; Cañestro, Cristian; Postlethwait, John H

    2008-01-01

    Background Gene duplication provides opportunities for lineage diversification and evolution of developmental novelties. Duplicated genes generally either disappear by accumulation of mutations (nonfunctionalization), or are preserved either by the origin of positively selected functions in one or both duplicates (neofunctionalization), or by the partitioning of original gene subfunctions between the duplicates (subfunctionalization). The Pax2/5/8 family of important developmental regulators has undergone parallel expansion among chordate groups. After the divergence of urochordate and vertebrate lineages, two rounds of independent gene duplications resulted in the Pax2, Pax5, and Pax8 genes of most vertebrates (the sister group of the urochordates), and an additional duplication provided the pax2a and pax2b duplicates in teleost fish. Separate from the vertebrate genome expansions, a duplication also created two Pax2/5/8 genes in the common ancestor of ascidian and larvacean urochordates. Results To better understand mechanisms underlying the evolution of duplicated genes, we investigated, in the larvacean urochordate Oikopleura dioica, the embryonic gene expression patterns of Pax2/5/8 paralogs. We compared the larvacean and ascidian expression patterns to infer modular subfunctions present in the single pre-duplication Pax2/5/8 gene of stem urochordates, and we compared vertebrate and urochordate expression to infer the suite of Pax2/5/8 gene subfunctions in the common ancestor of olfactores (vertebrates + urochordates). Expression pattern differences of larvacean and ascidian Pax2/5/8 orthologs in the endostyle, pharynx and hindgut suggest that some ancestral gene functions have been partitioned differently to the duplicates in the two urochordate lineages. Novel expression in the larvacean heart may have resulted from the neofunctionalization of a Pax2/5/8 gene in the urochordates. Expression of larvacean Pax2/5/8 in the endostyle, in sites of epithelial remodeling, and in sensory tissues evokes like functions of Pax2, Pax5 and Pax8 in vertebrate embryos, and may indicate ancient origins for these functions in the chordate common ancestor. Conclusion Comparative analysis of expression patterns of chordate Pax2/5/8 duplicates, rooted on the single-copy Pax2/5/8 gene of amphioxus, whose lineage diverged basally among chordates, provides new insights into the evolution and development of the heart, thyroid, pharynx, stomodeum and placodes in chordates; supports the controversial conclusion that the atrial siphon of ascidians and the otic placode in vertebrates are homologous; and backs the notion that Pax2/5/8 functioned in ancestral chordates to engineer epithelial fusions and perforations, including gill slit openings. PMID:18721460

  7. A Burst of miRNA Innovation in the Early Evolution of Butterflies and Moths

    PubMed Central

    Quah, Shan; Hui, Jerome H.L.; Holland, Peter W.H.

    2015-01-01

    MicroRNAs (miRNAs) are involved in posttranscriptional regulation of gene expression. Because several miRNAs are known to affect the stability or translation of developmental regulatory genes, the origin of novel miRNAs may have contributed to the evolution of developmental processes and morphology. Lepidoptera (butterflies and moths) is a species-rich clade with a well-established phylogeny and abundant genomic resources, thereby representing an ideal system in which to study miRNA evolution. We sequenced small RNA libraries from developmental stages of two divergent lepidopterans, Cameraria ohridella (Horse chestnut Leafminer) and Pararge aegeria (Speckled Wood butterfly), discovering 90 and 81 conserved miRNAs, respectively, and many species-specific miRNA sequences. Mapping miRNAs onto the lepidopteran phylogeny reveals rapid miRNA turnover and an episode of miRNA fixation early in lepidopteran evolution, implying that miRNA acquisition accompanied the early radiation of the Lepidoptera. One lepidopteran-specific miRNA gene, miR-2768, is located within an intron of the homeobox gene invected, involved in insect segmental and wing patterning. We identified cubitus interruptus (ci) as a likely direct target of miR-2768, and validated this suppression using a luciferase assay system. We propose a model by which miR-2768 modulates expression of ci in the segmentation pathway and in patterning of lepidopteran wing primordia. PMID:25576364

  8. Can the Fear Recognition Deficits Associated with Callous-Unemotional Traits be Identified in Early Childhood?

    PubMed Central

    Briggs-Gowan, Margaret J.; Voss, Joel L.; Petitclerc, Amelie; McCarthy, Kimberly; Blair, R. James R.; Wakschlag, Lauren S.

    2016-01-01

    Introduction Callous-unemotional (CU) traits in the presence of conduct problems are associated with increased risk of severe antisocial behavior. Developmentally sensitive methods of assessing CU traits have recently been generated, but their construct validity in relation to neurocognitive underpinnings of CU has not been demonstrated. The current study sought to investigate whether the fear-specific emotion recognition deficits associated with CU traits in older individuals are developmentally expressed in young children as low concern for others and punishment insensitivity. Methods A sub-sample of 337 preschoolers (mean age 4.8 years [SD=.8]) who completed neurocognitive tasks was taken from a larger project of preschool psychopathology. Children completed an emotional recognition task in which they were asked to identify the emotional face from the neutral faces in an array. CU traits were assessed using the Low Concern (LC) and Punishment Insensitivity (PI) subscales of the Multidimensional Assessment Profile of Disruptive Behavior (MAP-DB), which were specifically designed to differentiate the normative misbehavior of early childhood from atypical patterns. Results High LC, but not PI, scores were associated with a fear-specific deficit in emotion recognition. Girls were more accurate than boys in identifying emotional expressions but no significant interaction between LC or PI and sex was observed. Conclusions Fear recognition deficits associated with CU traits in older individuals were observed in preschoolers with developmentally-defined patterns of low concern for others. Confirming that the link between CU-related impairments in empathy and distinct neurocognitive deficits is present in very young children suggests that developmentally-specified measurement can detect the substrates of these severe behavioral patterns beginning much earlier than prior work. Exploring the development of CU traits and disruptive behavior disorders at very early ages may provide insights critical to early intervention and prevention of severe antisocial behavior. PMID:27167866

  9. Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

    PubMed

    Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

    2016-09-08

    The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

  10. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

    PubMed

    Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

  11. Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

    PubMed Central

    Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

    2015-01-01

    The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

  12. Systems biology of embryonic development: Prospects for a complete understanding of the Caenorhabditis elegans embryo.

    PubMed

    Murray, John Isaac

    2018-05-01

    The convergence of developmental biology and modern genomics tools brings the potential for a comprehensive understanding of developmental systems. This is especially true for the Caenorhabditis elegans embryo because its small size, invariant developmental lineage, and powerful genetic and genomic tools provide the prospect of a cellular resolution understanding of messenger RNA (mRNA) expression and regulation across the organism. We describe here how a systems biology framework might allow large-scale determination of the embryonic regulatory relationships encoded in the C. elegans genome. This framework consists of two broad steps: (a) defining the "parts list"-all genes expressed in all cells at each time during development and (b) iterative steps of computational modeling and refinement of these models by experimental perturbation. Substantial progress has been made towards defining the parts list through imaging methods such as large-scale green fluorescent protein (GFP) reporter analysis. Imaging results are now being augmented by high-resolution transcriptome methods such as single-cell RNA sequencing, and it is likely the complete expression patterns of all genes across the embryo will be known within the next few years. In contrast, the modeling and perturbation experiments performed so far have focused largely on individual cell types or genes, and improved methods will be needed to expand them to the full genome and organism. This emerging comprehensive map of embryonic expression and regulatory function will provide a powerful resource for developmental biologists, and would also allow scientists to ask questions not accessible without a comprehensive picture. This article is categorized under: Invertebrate Organogenesis > Worms Technologies > Analysis of the Transcriptome Gene Expression and Transcriptional Hierarchies > Gene Networks and Genomics. © 2018 Wiley Periodicals, Inc.

  13. Mix-and-match: ligand-receptor pairs in stomatal development and beyond.

    PubMed

    Torii, Keiko U

    2012-12-01

    Stomata are small valves on the plant epidermis balancing gas exchange and water loss. Stomata are formed according to positional cues. In Arabidopsis, two EPIDERMAL PATTERNING FACTOR (EPF) peptides, EPF1 and EPF2, are secreted from stomatal precursors enforcing proper stomatal patterning. Here, I review recent studies revealing the ligand-receptor pairs and revising the previously predicted relations between receptors specifying stomatal patterning: ERECTA-family and TOO MANY MOUTHS (TMM). Furthermore, EPF-LIKE9 (EPFL9/Stomagen) promotes stomatal differentiation from internal tissues. Two EPFL peptides specify inflorescence architecture, a process beyond stomatal development, as ligands for ERECTA. Thus, broadly expressed receptor kinases may regulate multiple developmental processes through perceiving different peptide ligands, each with a specialized expression pattern. TMM in the epidermis may fine-tune multiple EPF/EPFL signals to prevent signal interference. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

    PubMed

    Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

    2018-02-13

    With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

  15. Comparative transcriptomics among floral organs of the basal eudicot Eschscholzia californica as reference for floral evolutionary developmental studies

    PubMed Central

    2010-01-01

    Background Molecular genetic studies of floral development have concentrated on several core eudicots and grasses (monocots), which have canalized floral forms. Basal eudicots possess a wider range of floral morphologies than the core eudicots and grasses and can serve as an evolutionary link between core eudicots and monocots, and provide a reference for studies of other basal angiosperms. Recent advances in genomics have enabled researchers to profile gene activities during floral development, primarily in the eudicot Arabidopsis thaliana and the monocots rice and maize. However, our understanding of floral developmental processes among the basal eudicots remains limited. Results Using a recently generated expressed sequence tag (EST) set, we have designed an oligonucleotide microarray for the basal eudicot Eschscholzia californica (California poppy). We performed microarray experiments with an interwoven-loop design in order to characterize the E. californica floral transcriptome and to identify differentially expressed genes in flower buds with pre-meiotic and meiotic cells, four floral organs at pre-anthesis stages (sepals, petals, stamens and carpels), developing fruits, and leaves. Conclusions Our results provide a foundation for comparative gene expression studies between eudicots and basal angiosperms. We identified whorl-specific gene expression patterns in E. californica and examined the floral expression of several gene families. Interestingly, most E. californica homologs of Arabidopsis genes important for flower development, except for genes encoding MADS-box transcription factors, show different expression patterns between the two species. Our comparative transcriptomics study highlights the unique evolutionary position of E. californica compared with basal angiosperms and core eudicots. PMID:20950453

  16. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    PubMed

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis

    2014-09-01

    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of FOXP2 and CNTNAP2, suggests that the genetic neuropathological origins of stuttering differ from those of verbal dyspraxia and SLI. Published by Elsevier Inc.

  17. Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

    PubMed

    Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

    2007-01-01

    Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

  18. Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development.

    PubMed

    Deluc, Laurent G; Grimplet, Jérôme; Wheatley, Matthew D; Tillett, Richard L; Quilici, David R; Osborne, Craig; Schooley, David A; Schlauch, Karen A; Cushman, John C; Cramer, Grant R

    2007-11-22

    Grape berry development is a dynamic process that involves a complex series of molecular genetic and biochemical changes divided into three major phases. During initial berry growth (Phase I), berry size increases along a sigmoidal growth curve due to cell division and subsequent cell expansion, and organic acids (mainly malate and tartrate), tannins, and hydroxycinnamates accumulate to peak levels. The second major phase (Phase II) is defined as a lag phase in which cell expansion ceases and sugars begin to accumulate. Véraison (the onset of ripening) marks the beginning of the third major phase (Phase III) in which berries undergo a second period of sigmoidal growth due to additional mesocarp cell expansion, accumulation of anthocyanin pigments for berry color, accumulation of volatile compounds for aroma, softening, peak accumulation of sugars (mainly glucose and fructose), and a decline in organic acid accumulation. In order to understand the transcriptional network responsible for controlling berry development, mRNA expression profiling was conducted on berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip Vitis oligonucleotide microarray ver. 1.0 spanning seven stages of berry development from small pea size berries (E-L stages 31 to 33 as defined by the modified E-L system), through véraison (E-L stages 34 and 35), to mature berries (E-L stages 36 and 38). Selected metabolites were profiled in parallel with mRNA expression profiling to understand the effect of transcriptional regulatory processes on specific metabolite production that ultimately influence the organoleptic properties of wine. Over the course of berry development whole fruit tissues were found to express an average of 74.5% of probes represented on the Vitis microarray, which has 14,470 Unigenes. Approximately 60% of the expressed transcripts were differentially expressed between at least two out of the seven stages of berry development (28% of transcripts, 4,151 Unigenes, had pronounced (> or =2 fold) differences in mRNA expression) illustrating the dynamic nature of the developmental process. The subset of 4,151 Unigenes was split into twenty well-correlated expression profiles. Expression profile patterns included those with declining or increasing mRNA expression over the course of berry development as well as transient peak or trough patterns across various developmental stages as defined by the modified E-L system. These detailed surveys revealed the expression patterns for genes that play key functional roles in phytohormone biosynthesis and response, calcium sequestration, transport and signaling, cell wall metabolism mediating expansion, ripening, and softening, flavonoid metabolism and transport, organic and amino acid metabolism, hexose sugar and triose phosphate metabolism and transport, starch metabolism, photosynthesis, circadian cycles and pathogen resistance. In particular, mRNA expression patterns of transcription factors, abscisic acid (ABA) biosynthesis, and calcium signaling genes identified candidate factors likely to participate in the progression of key developmental events such as véraison and potential candidate genes associated with such processes as auxin partitioning within berry cells, aroma compound production, and pathway regulation and sequestration of flavonoid compounds. Finally, analysis of sugar metabolism gene expression patterns indicated the existence of an alternative pathway for glucose and triose phosphate production that is invoked from véraison to mature berries. These results reveal the first high-resolution picture of the transcriptome dynamics that occur during seven stages of grape berry development. This work also establishes an extensive catalog of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern berry development in a widely grown cultivar of wine grape. More importantly, this analysis identified a set of previously unknown genes potentially involved in critical steps associated with fruit development that can now be subjected to functional testing.

  19. Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development

    PubMed Central

    Deluc, Laurent G; Grimplet, Jérôme; Wheatley, Matthew D; Tillett, Richard L; Quilici, David R; Osborne, Craig; Schooley, David A; Schlauch, Karen A; Cushman, John C; Cramer, Grant R

    2007-01-01

    Background Grape berry development is a dynamic process that involves a complex series of molecular genetic and biochemical changes divided into three major phases. During initial berry growth (Phase I), berry size increases along a sigmoidal growth curve due to cell division and subsequent cell expansion, and organic acids (mainly malate and tartrate), tannins, and hydroxycinnamates accumulate to peak levels. The second major phase (Phase II) is defined as a lag phase in which cell expansion ceases and sugars begin to accumulate. Véraison (the onset of ripening) marks the beginning of the third major phase (Phase III) in which berries undergo a second period of sigmoidal growth due to additional mesocarp cell expansion, accumulation of anthocyanin pigments for berry color, accumulation of volatile compounds for aroma, softening, peak accumulation of sugars (mainly glucose and fructose), and a decline in organic acid accumulation. In order to understand the transcriptional network responsible for controlling berry development, mRNA expression profiling was conducted on berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0 spanning seven stages of berry development from small pea size berries (E-L stages 31 to 33 as defined by the modified E-L system), through véraison (E-L stages 34 and 35), to mature berries (E-L stages 36 and 38). Selected metabolites were profiled in parallel with mRNA expression profiling to understand the effect of transcriptional regulatory processes on specific metabolite production that ultimately influence the organoleptic properties of wine. Results Over the course of berry development whole fruit tissues were found to express an average of 74.5% of probes represented on the Vitis microarray, which has 14,470 Unigenes. Approximately 60% of the expressed transcripts were differentially expressed between at least two out of the seven stages of berry development (28% of transcripts, 4,151 Unigenes, had pronounced (≥2 fold) differences in mRNA expression) illustrating the dynamic nature of the developmental process. The subset of 4,151 Unigenes was split into twenty well-correlated expression profiles. Expression profile patterns included those with declining or increasing mRNA expression over the course of berry development as well as transient peak or trough patterns across various developmental stages as defined by the modified E-L system. These detailed surveys revealed the expression patterns for genes that play key functional roles in phytohormone biosynthesis and response, calcium sequestration, transport and signaling, cell wall metabolism mediating expansion, ripening, and softening, flavonoid metabolism and transport, organic and amino acid metabolism, hexose sugar and triose phosphate metabolism and transport, starch metabolism, photosynthesis, circadian cycles and pathogen resistance. In particular, mRNA expression patterns of transcription factors, abscisic acid (ABA) biosynthesis, and calcium signaling genes identified candidate factors likely to participate in the progression of key developmental events such as véraison and potential candidate genes associated with such processes as auxin partitioning within berry cells, aroma compound production, and pathway regulation and sequestration of flavonoid compounds. Finally, analysis of sugar metabolism gene expression patterns indicated the existence of an alternative pathway for glucose and triose phosphate production that is invoked from véraison to mature berries. Conclusion These results reveal the first high-resolution picture of the transcriptome dynamics that occur during seven stages of grape berry development. This work also establishes an extensive catalog of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern berry development in a widely grown cultivar of wine grape. More importantly, this analysis identified a set of previously unknown genes potentially involved in critical steps associated with fruit development that can now be subjected to functional testing. PMID:18034876

  20. Molecular signaling in intervertebral disk development.

    PubMed

    DiPaola, Christian P; Farmer, James C; Manova, Katia; Niswander, Lee A

    2005-09-01

    The purpose of this investigation is to identify and study the expression pattern of pertinent molecular factors involved in the differentiation of the intervertebral disk (IVD). It is likely that hedgehog genes and the BMP inhibitors are key factors involved in spinal joint formation. Radioactive in situ hybridization with mRNA probes for pax-1, SHH, IHH and Noggin gene was performed on mouse embryo and adult tissue. Immunohistochemistry was performed to localize hedgehog receptor, "patched" (ptc). From 14.5 dpc until birth pax-1 mRNA was expressed in the developing anulus fibrosus (AF). During the same developmental period Noggin mRNA is highly expressed throughout the spine, in the developing AF, while ptc protein and SHH mRNA were expressed in the developing nucleus pulposus (NP). IHH mRNA was expressed by condensing chondrocytes of the vertebral bodies and later becomes confined to the vertebral endplate. We show for the first time that pax-1 is expressed in the adult intervertebral disk. Ptc expression in the NP is an indicator of hedgehog protein signaling in the developing IVD. The expression pattern of the BMP inhibitor Noggin appears to be important for the normal formation of the IVD and may prove to play a role in its segmental pattern formation.

  1. Expression profiles of the Gα subunits during Xenopus tropicalis embryonic development.

    PubMed

    Fuentealba, Jaime; Toro-Tapia, Gabriela; Rodriguez, Marion; Arriagada, Cecilia; Maureira, Alejandro; Beyer, Andrea; Villaseca, Soraya; Leal, Juan I; Hinrichs, Maria V; Olate, Juan; Caprile, Teresa; Torrejón, Marcela

    2016-09-01

    Heterotrimeric G protein signaling plays major roles during different cellular events. However, there is a limited understanding of the molecular mechanisms underlying G protein control during embryogenesis. G proteins are highly conserved and can be grouped into four subfamilies according to sequence homology and function. To further studies on G protein function during embryogenesis, the present analysis identified four Gα subunits representative of the different subfamilies and determined their spatiotemporal expression patterns during Xenopus tropicalis embryogenesis. Each of the Gα subunit transcripts was maternally and zygotically expressed, and, as development progressed, dynamic expression patterns were observed. In the early developmental stages, the Gα subunits were expressed in the animal hemisphere and dorsal marginal zone. While expression was observed at the somite boundaries, in vascular structures, in the eye, and in the otic vesicle during the later stages, expression was mainly found in neural tissues, such as the neural tube and, especially, in the cephalic vesicles, neural crest region, and neural crest-derived structures. Together, these results support the pleiotropism and complexity of G protein subfamily functions in different cellular events. The present study constitutes the most comprehensive description to date of the spatiotemporal expression patterns of Gα subunits during vertebrate development. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Development of the head and trunk mesoderm in the dogfish, Scyliorhinus torazame: II. Comparison of gene expression between the head mesoderm and somites with reference to the origin of the vertebrate head.

    PubMed

    Adachi, Noritaka; Takechi, Masaki; Hirai, Tamami; Kuratani, Shigeru

    2012-01-01

    The vertebrate mesoderm differs distinctly between the head and trunk, and the evolutionary origin of the head mesoderm remains enigmatic. Although the presence of somite-like segmentation in the head mesoderm of model animals is generally denied at molecular developmental levels, the appearance of head cavities in elasmobranch embryos has not been explained, and the possibility that they may represent vestigial head somites once present in an amphioxus-like ancestor has not been ruled out entirely. To examine whether the head cavities in the shark embryo exhibit any molecular signatures reminiscent of trunk somites, we isolated several developmentally key genes, including Pax1, Pax3, Pax7, Pax9, Myf5, Sonic hedgehog, and Patched2, which are involved in myogenic and chondrogenic differentiation in somites, and Pitx2, Tbx1, and Engrailed2, which are related to the patterning of the head mesoderm, from an elasmobranch species, Scyliorhinus torazame. Observation of the expression patterns of these genes revealed that most were expressed in patterns that resembled those found in amniote embryos. In addition, the head cavities did not exhibit an overt similarity to somites; that is, the similarity was no greater than that of the unsegmented head mesoderm in other vertebrates. Moreover, the shark head mesoderm showed an amniote-like somatic/visceral distinction according to the expression of Pitx2, Tbx1, and Engrailed2. We conclude that the head cavities do not represent a manifestation of ancestral head somites; rather, they are more likely to represent a derived trait obtained in the lineage of gnathostomes. © 2012 Wiley Periodicals, Inc.

  3. A wing expressed sequence tag resource for Bicyclus anynana butterflies, an evo-devo model

    PubMed Central

    Beldade, Patrícia; Rudd, Stephen; Gruber, Jonathan D; Long, Anthony D

    2006-01-01

    Background Butterfly wing color patterns are a key model for integrating evolutionary developmental biology and the study of adaptive morphological evolution. Yet, despite the biological, economical and educational value of butterflies they are still relatively under-represented in terms of available genomic resources. Here, we describe an Expression Sequence Tag (EST) project for Bicyclus anynana that has identified the largest available collection to date of expressed genes for any butterfly. Results By targeting cDNAs from developing wings at the stages when pattern is specified, we biased gene discovery towards genes potentially involved in pattern formation. Assembly of 9,903 ESTs from a subtracted library allowed us to identify 4,251 genes of which 2,461 were annotated based on BLAST analyses against relevant gene collections. Gene prediction software identified 2,202 peptides, of which 215 longer than 100 amino acids had no homology to any known proteins and, thus, potentially represent novel or highly diverged butterfly genes. We combined gene and Single Nucleotide Polymorphism (SNP) identification by constructing cDNA libraries from pools of outbred individuals, and by sequencing clones from the 3' end to maximize alignment depth. Alignments of multi-member contigs allowed us to identify over 14,000 putative SNPs, with 316 genes having at least one high confidence double-hit SNP. We furthermore identified 320 microsatellites in transcribed genes that can potentially be used as genetic markers. Conclusion Our project was designed to combine gene and sequence polymorphism discovery and has generated the largest gene collection available for any butterfly and many potential markers in expressed genes. These resources will be invaluable for exploring the potential of B. anynana in particular, and butterflies in general, as models in ecological, evolutionary, and developmental genetics. PMID:16737530

  4. Artemisinin resistance in Plasmodium falciparum is associated with an altered temporal pattern of transcription

    PubMed Central

    2011-01-01

    Background Artemisinin resistance in Plasmodium falciparum malaria has emerged in Western Cambodia. This is a major threat to global plans to control and eliminate malaria as the artemisinins are a key component of antimalarial treatment throughout the world. To identify key features associated with the delayed parasite clearance phenotype, we employed DNA microarrays to profile the physiological gene expression pattern of the resistant isolates. Results In the ring and trophozoite stages, we observed reduced expression of many basic metabolic and cellular pathways which suggests a slower growth and maturation of these parasites during the first half of the asexual intraerythrocytic developmental cycle (IDC). In the schizont stage, there is an increased expression of essentially all functionalities associated with protein metabolism which indicates the prolonged and thus increased capacity of protein synthesis during the second half of the resistant parasite IDC. This modulation of the P. falciparum intraerythrocytic transcriptome may result from differential expression of regulatory proteins such as transcription factors or chromatin remodeling associated proteins. In addition, there is a unique and uniform copy number variation pattern in the Cambodian parasites which may represent an underlying genetic background that contributes to the resistance phenotype. Conclusions The decreased metabolic activities in the ring stages are consistent with previous suggestions of higher resilience of the early developmental stages to artemisinin. Moreover, the increased capacity of protein synthesis and protein turnover in the schizont stage may contribute to artemisinin resistance by counteracting the protein damage caused by the oxidative stress and/or protein alkylation effect of this drug. This study reports the first global transcriptional survey of artemisinin resistant parasites and provides insight to the complexities of the molecular basis of pathogens with drug resistance phenotypes in vivo. PMID:21810278

  5. PINK1 is required for timely cell-type specific mitochondrial clearance during Drosophila midgut metamorphosis.

    PubMed

    Liu, Yan; Lin, Jingjing; Zhang, Minjie; Chen, Kai; Yang, Shengxi; Wang, Qun; Yang, Hongqin; Xie, Shusen; Zhou, Yongjian; Zhang, Xi; Chen, Fei; Yang, Yufeng

    2016-11-15

    Mitophagy is the selective degradation of mitochondria by autophagy, which is an important mitochondrial quality and quantity control process. During Drosophila metamorphosis, the degradation of midgut involves a large change in length and organization, which is mediated by autophagy. Here we noticed a cell-type specific mitochondrial clearance process that occurs in enterocytes (ECs), while most mitochondria remain in intestinal stem cells (ISCs) during metamorphosis. Although PINK1/PARKIN represent the canonical pathway for the elimination of impaired mitochondria in varied pathological conditions, their roles in developmental processes or normal physiological conditions have been less studied. To examine the potential contribution of PINK1 in developmental processes, we monitored the dynamic expression pattern of PINK1 in the midgut development by taking advantage of a newly CRISPR/Cas9 generated knock-in fly strain expressing PINK1-mCherry fusion protein that presumably recapitulates the endogenous expression pattern of PINK1. We disclosed a spatiotemporal correlation between the expression pattern of PINK1 and the mitochondrial clearance or persistence in ECs or ISCs respectively. By mosaic genetic analysis, we then demonstrated that PINK1 and PARKIN function epistatically to mediate the specific timely removal of mitochondria, and are involved in global autophagy in ECs during Drosophila midgut metamorphosis, with kinase-dead PINK1 exerting dominant negative effects. Taken together, our studies concluded that the PINK1/PARKIN is crucial for timely cell-type specific mitophagy under physiological conditions and demonstrated again that Drosophila midgut metamorphosis might serve as an elegant in vivo model to study autophagy. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Differential gene expression patterns in developing sexually dimorphic rat brain regions exposed to antiandrogenic, estrogenic, or complex endocrine disruptor mixtures: glutamatergic synapses as target.

    PubMed

    Lichtensteiger, Walter; Bassetti-Gaille, Catherine; Faass, Oliver; Axelstad, Marta; Boberg, Julie; Christiansen, Sofie; Rehrauer, Hubert; Georgijevic, Jelena Kühn; Hass, Ulla; Kortenkamp, Andreas; Schlumpf, Margret

    2015-04-01

    The study addressed the question whether gene expression patterns induced by different mixtures of endocrine disrupting chemicals (EDCs) administered in a higher dose range, corresponding to 450×, 200×, and 100× high-end human exposure levels, could be characterized in developing brain with respect to endocrine activity of mixture components, and which developmental processes were preferentially targeted. Three EDC mixtures, A-Mix (anti-androgenic mixture) with 8 antiandrogenic chemicals (di-n-butylphthalate, diethylhexylphthalate, vinclozolin, prochloraz, procymidone, linuron, epoxiconazole, and DDE), E-Mix (estrogenic mixture) with 4 estrogenic chemicals (bisphenol A, 4-methylbenzylidene camphor, 2-ethylhexyl 4-methoxycinnamate, and butylparaben), a complex mixture, AEP-Mix, containing the components of A-Mix and E-Mix plus paracetamol, and paracetamol alone, were administered by oral gavage to rat dams from gestation day 7 until weaning. General developmental endpoints were not affected by EDC mixtures or paracetamol. Gene expression was analyzed on postnatal day 6, during sexual brain differentiation, by exon microarray in medial preoptic area in the high-dose group, and by real-time RT-PCR in medial preoptic area and ventromedial hypothalamus in all dose groups. Expression patterns were mixture, sex, and region specific. Effects of the analgesic drug paracetamol, which exhibits antiandrogenic activity in peripheral systems, differed from those of A-Mix. All mixtures had a strong, mixture-specific impact on genes encoding for components of excitatory glutamatergic synapses and genes controlling migration and pathfinding of glutamatergic and GABAergic neurons, as well as genes linked with increased risk of autism spectrum disorders. Because development of glutamatergic synapses is regulated by sex steroids also in hippocampus, this may represent a general target of ECD mixtures.

  7. Pervasive Effects of Aging on Gene Expression in Wild Wolves

    PubMed Central

    Charruau, Pauline; Johnston, Rachel A.; Stahler, Daniel R.; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W.; vonHoldt, Bridgett M.; Cole, Steven W.; Tung, Jenny; Wayne, Robert K.

    2016-01-01

    Abstract Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species’ high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. PMID:27189566

  8. Novel R2R3-MYB transcription factors from Prunus Americana regulates differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The levels of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  9. Novel R2R3-MYB transcription factors from Prunus americana regulate differential patterns of anthocyanin accumulation in tobacco and citrus

    USDA-ARS?s Scientific Manuscript database

    The level of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

  10. Making teeth to order: conserved genes reveal an ancient molecular pattern in paddlefish (Actinopterygii)

    PubMed Central

    Smith, Moya M.; Johanson, Zerina; Butts, Thomas; Ericsson, Rolf; Modrell, Melinda; Tulenko, Frank J.; Davis, Marcus C.; Fraser, Gareth J.

    2015-01-01

    Ray-finned fishes (Actinopterygii) are the dominant vertebrate group today (+30 000 species, predominantly teleosts), with great morphological diversity, including their dentitions. How dental morphological variation evolved is best addressed by considering a range of taxa across actinopterygian phylogeny; here we examine the dentition of Polyodon spathula (American paddlefish), assigned to the basal group Acipenseriformes. Although teeth are present and functional in young individuals of Polyodon, they are completely absent in adults. Our current understanding of developmental genes operating in the dentition is primarily restricted to teleosts; we show that shh and bmp4, as highly conserved epithelial and mesenchymal genes for gnathostome tooth development, are similarly expressed at Polyodon tooth loci, thus extending this conserved developmental pattern within the Actinopterygii. These genes map spatio-temporal tooth initiation in Polyodon larvae and provide new data in both oral and pharyngeal tooth sites. Variation in cellular intensity of shh maps timing of tooth morphogenesis, revealing a second odontogenic wave as alternate sites within tooth rows, a dental pattern also present in more derived actinopterygians. Developmental timing for each tooth field in Polyodon follows a gradient, from rostral to caudal and ventral to dorsal, repeated during subsequent loss of teeth. The transitory Polyodon dentition is modified by cessation of tooth addition and loss. As such, Polyodon represents a basal actinopterygian model for the evolution of developmental novelty: initial conservation, followed by tooth loss, accommodating the adult trophic modification to filter-feeding. PMID:25788604

  11. Expression of PAT and NPT II proteins during the developmental stages of a genetically modified pepper developed in Korea.

    PubMed

    Kim, Hyo Jin; Lee, Si Myung; Kim, Jae Kwang; Ryu, Tae Hun; Suh, Seok Cheol; Cho, Hyun Suk

    2010-10-27

    Estimation of the protein levels introduced in a biotechnology-derived product is conducted as part of an overall safety assessment. An enzyme-linked immunosorbent assay (ELISA) was used to analyze phosphinothricin acetyltransferase (PAT) and neomycin phosphotransferase II (NPT II) protein expression in a genetically modified (GM) pepper plant developed in Korea. PAT and NPT II expression levels, based on both dry weight and fresh weight, were variable among different plant generations and plant sections from isolated genetically modified organism (GMO) fields at four developmental stages. PAT expression was highest in leaves at anthesis (11.44 μg/gdw and 2.17 μg/gfw) and lowest in roots (0.12 μg/gdw and 0.01 μg/gfw). NPT II expression was also highest in leaves at anthesis (17.31 μg/gdw and 3.41 μg/gfw) and lowest in red pepper (0.65 μg/gdw and 0.12 μg/gfw). In pollen, PAT expression was 0.59-0.62 μg/gdw, while NPT II was not detected. Both PAT and NPT II showed a general pattern of decreased expression with progression of the growing season. As expected, PAT and NPT II protein expression was not detectable in control pepper plants.

  12. A small molecule screen identifies a novel compound that induces a homeotic transformation in Hydra

    PubMed Central

    Glauber, Kristine M.; Dana, Catherine E.; Park, Steve S.; Colby, David A.; Noro, Yukihiko; Fujisawa, Toshitaka; Chamberlin, A. Richard; Steele, Robert E.

    2013-01-01

    Developmental processes such as morphogenesis, patterning and differentiation are continuously active in the adult Hydra polyp. We carried out a small molecule screen to identify compounds that affect patterning in Hydra. We identified a novel molecule, DAC-2-25, that causes a homeotic transformation of body column into tentacle zone. This transformation occurs in a progressive and polar fashion, beginning at the oral end of the animal. We have identified several strains that respond to DAC-2-25 and one that does not, and we used chimeras from these strains to identify the ectoderm as the target tissue for DAC-2-25. Using transgenic Hydra that express green fluorescent protein under the control of relevant promoters, we examined how DAC-2-25 affects tentacle patterning. Genes whose expression is associated with the tentacle zone are ectopically expressed upon exposure to DAC-2-25, whereas those associated with body column tissue are turned off as the tentacle zone expands. The expression patterns of the organizer-associated gene HyWnt3 and the hypostome-specific gene HyBra2 are unchanged. Structure-activity relationship studies have identified features of DAC-2-25 that are required for activity and potency. This study shows that small molecule screens in Hydra can be used to dissect patterning processes. PMID:24255098

  13. A small molecule screen identifies a novel compound that induces a homeotic transformation in Hydra.

    PubMed

    Glauber, Kristine M; Dana, Catherine E; Park, Steve S; Colby, David A; Noro, Yukihiko; Fujisawa, Toshitaka; Chamberlin, A Richard; Steele, Robert E

    2013-12-01

    Developmental processes such as morphogenesis, patterning and differentiation are continuously active in the adult Hydra polyp. We carried out a small molecule screen to identify compounds that affect patterning in Hydra. We identified a novel molecule, DAC-2-25, that causes a homeotic transformation of body column into tentacle zone. This transformation occurs in a progressive and polar fashion, beginning at the oral end of the animal. We have identified several strains that respond to DAC-2-25 and one that does not, and we used chimeras from these strains to identify the ectoderm as the target tissue for DAC-2-25. Using transgenic Hydra that express green fluorescent protein under the control of relevant promoters, we examined how DAC-2-25 affects tentacle patterning. Genes whose expression is associated with the tentacle zone are ectopically expressed upon exposure to DAC-2-25, whereas those associated with body column tissue are turned off as the tentacle zone expands. The expression patterns of the organizer-associated gene HyWnt3 and the hypostome-specific gene HyBra2 are unchanged. Structure-activity relationship studies have identified features of DAC-2-25 that are required for activity and potency. This study shows that small molecule screens in Hydra can be used to dissect patterning processes.

  14. Genetic variation and gene expression across multiple tissues and developmental stages in a nonhuman primate.

    PubMed

    Jasinska, Anna J; Zelaya, Ivette; Service, Susan K; Peterson, Christine B; Cantor, Rita M; Choi, Oi-Wa; DeYoung, Joseph; Eskin, Eleazar; Fairbanks, Lynn A; Fears, Scott; Furterer, Allison E; Huang, Yu S; Ramensky, Vasily; Schmitt, Christopher A; Svardal, Hannes; Jorgensen, Matthew J; Kaplan, Jay R; Villar, Diego; Aken, Bronwen L; Flicek, Paul; Nag, Rishi; Wong, Emily S; Blangero, John; Dyer, Thomas D; Bogomolov, Marina; Benjamini, Yoav; Weinstock, George M; Dewar, Ken; Sabatti, Chiara; Wilson, Richard K; Jentsch, J David; Warren, Wesley; Coppola, Giovanni; Woods, Roger P; Freimer, Nelson B

    2017-12-01

    By analyzing multitissue gene expression and genome-wide genetic variation data in samples from a vervet monkey pedigree, we generated a transcriptome resource and produced the first catalog of expression quantitative trait loci (eQTLs) in a nonhuman primate model. This catalog contains more genome-wide significant eQTLs per sample than comparable human resources and identifies sex- and age-related expression patterns. Findings include a master regulatory locus that likely has a role in immune function and a locus regulating hippocampal long noncoding RNAs (lncRNAs), whose expression correlates with hippocampal volume. This resource will facilitate genetic investigation of quantitative traits, including brain and behavioral phenotypes relevant to neuropsychiatric disorders.

  15. SoxB2 in sea urchin development: implications in neurogenesis, ciliogenesis and skeletal patterning.

    PubMed

    Anishchenko, Evgeniya; Arnone, Maria Ina; D'Aniello, Salvatore

    2018-01-01

    Current studies in evolutionary developmental biology are focused on the reconstruction of gene regulatory networks in target animal species. From decades, the scientific interest on genetic mechanisms orchestrating embryos development has been increasing in consequence to the fact that common features shared by evolutionarily distant phyla are being clarified. In 2011, a study across eumetazoan species showed for the first time the existence of a highly conserved non-coding element controlling the SoxB2 gene, which is involved in the early specification of the nervous system. This discovery raised several questions about SoxB2 function and regulation in deuterostomes from an evolutionary point of view. Due to the relevant phylogenetic position within deuterostomes, the sea urchin Strongylocentrotus purpuratus represents an advantageous animal model in the field of evolutionary developmental biology. Herein, we show a comprehensive study of SoxB2 functions in sea urchins, in particular its expression pattern in a wide range of developmental stages, and its co-localization with other neurogenic markers, as SoxB1 , SoxC and Elav . Moreover, this work provides a detailed description of the phenotype of sea urchin SoxB2 knocked-down embryos, confirming its key function in neurogenesis and revealing, for the first time, its additional roles in oral and aboral ectoderm cilia and skeletal rod morphology. We concluded that SoxB2 in sea urchins has a neurogenic function; however, this gene could have multiple roles in sea urchin embryogenesis, expanding its expression in non-neurogenic cells. We showed that SoxB2 is functionally conserved among deuterostomes and suggested that in S. purpuratus this gene acquired additional functions, being involved in ciliogenesis and skeletal patterning.

  16. Comparative transcriptome analysis reveals vertebrate phylotypic period during organogenesis

    PubMed Central

    Irie, Naoki; Kuratani, Shigeru

    2011-01-01

    One of the central issues in evolutionary developmental biology is how we can formulate the relationships between evolutionary and developmental processes. Two major models have been proposed: the 'funnel-like' model, in which the earliest embryo shows the most conserved morphological pattern, followed by diversifying later stages, and the 'hourglass' model, in which constraints are imposed to conserve organogenesis stages, which is called the phylotypic period. Here we perform a quantitative comparative transcriptome analysis of several model vertebrate embryos and show that the pharyngula stage is most conserved, whereas earlier and later stages are rather divergent. These results allow us to predict approximate developmental timetables between different species, and indicate that pharyngula embryos have the most conserved gene expression profiles, which may be the source of the basic body plan of vertebrates. PMID:21427719

  17. Limb movements during embryonic development in the chick: evidence for a continuum in limb motor control antecedent to locomotion.

    PubMed

    Bradley, Nina S; Solanki, Dhara; Zhao, Dawn

    2005-12-01

    New imaging technologies are revealing ever-greater details of motor behavior in fetuses for clinical diagnosis and treatment. Understanding the form, mechanisms, and significance of fetal behavior will maximize imaging applications. The chick is readily available for experimentation throughout embryogenesis, making it an excellent model for this purpose. Yet in 40 yr since Hamburger and colleagues described chick embryonic behavior, we have not determined if motility belongs to a developmental continuum fundamental to posthatching behavior. This study examined kinematics and synchronized electromyography (EMG) during spontaneous limb movements in chicks at four time points between embryonic days (E) 9-18. We report that coordinated kinematic and/or EMG patterns were expressed at each time point. Variability observed in knee and ankle excursions at E15-E18 sorted into distinct in-phase and out-of-phase patterns. EMG patterns did not directly account for out-of-phase patterns, indicating study of movement biomechanics will be critical to fully understand motor control in the embryo. We also provide the first descriptions of 2- to 10-Hz limb movements emerging E15-E18 and a shift from in-phase to out-of-phase interlimb coordination E9-E18. Our findings revealed that coordinated limb movements persist across development and suggest they belong to a developmental continuum for locomotion. Limb patterns were consistent with the half center model for a locomotor pattern generator. Achievement of these patterns by E9 may thus indicate the embryo has completed a critical phase beyond which developmental progression may be less vulnerable to experimental perturbations or prenatal events.

  18. Unique pattern of dietary adaptation in the dentition of Carnivora: its advantage and developmental origin

    PubMed Central

    Saito, Kazuyuki; Kishida, Takushi; Takahashi, Katsu; Bessho, Kazuhisa

    2016-01-01

    Carnivora is a successful taxon in terms of dietary diversity. We investigated the dietary adaptations of carnivoran dentition and the developmental background of their dental diversity, which may have contributed to the success of the lineage. A developmental model was tested and extended to explain the unique variability and exceptional phenotypes observed in carnivoran dentition. Carnivorous mammalian orders exhibited two distinct patterns of dietary adaptation in molars and only Carnivora evolved novel variability, exhibiting a high correlation between relative molar size and the shape of the first molar. Studies of Bmp7-hetero-deficient mice, which may exhibit lower Bmp7 expression, suggested that Bmp7 has pleiotropic effects on these two dental traits. Its effects are consistent with the pattern of dietary adaptation observed in Carnivora, but not that observed in other carnivorous mammals. A molecular evolutionary analysis revealed that Bmp7 sequence evolved by natural selection during ursid evolution, suggesting that it plays an evolutionary role in the variation of carnivoran dentition. Using mouse experiments and a molecular evolutionary analysis, we extrapolated the causal mechanism of the hitherto enigmatic ursid dentition (larger M2 than M1 and M3). Our results demonstrate how carnivorans acquired novel dental variability that benefits their dietary divergence.

  19. The unique structural and biochemical development of single cell C4 photosynthesis along longitudinal leaf gradients in Bienertia sinuspersici and Suaeda aralocaspica (Chenopodiaceae)

    PubMed Central

    Koteyeva, Nuria K.; Voznesenskaya, Elena V.; Berry, James O.; Cousins, Asaph B.; Edwards, Gerald E.

    2016-01-01

    Temporal and spatial patterns of photosynthetic enzyme expression and structural maturation of chlorenchyma cells along longitudinal developmental gradients were characterized in young leaves of two single cell C4 species, Bienertia sinuspersici and Suaeda aralocaspica. Both species partition photosynthetic functions between distinct intracellular domains. In the C4-C domain, C4 acids are formed in the C4 cycle during capture of atmospheric CO2 by phosphoenolpyruvate carboxylase. In the C4-D domain, CO2 released in the C4 cycle via mitochondrial NAD-malic enzyme is refixed by Rubisco. Despite striking differences in origin and intracellular positioning of domains, these species show strong convergence in C4 developmental patterns. Both progress through a gradual developmental transition towards full C4 photosynthesis, with an associated increase in levels of photosynthetic enzymes. Analysis of longitudinal sections showed undeveloped domains at the leaf base, with Rubisco rbcL mRNA and protein contained within all chloroplasts. The two domains were first distinguishable in chlorenchyma cells at the leaf mid-regions, but still contained structurally similar chloroplasts with equivalent amounts of rbcL mRNA and protein; while mitochondria had become confined to just one domain (proto-C4-D). The C4 state was fully formed towards the leaf tips, Rubisco transcripts and protein were compartmentalized specifically to structurally distinct chloroplasts in the C4-D domains indicating selective regulation of Rubisco expression may occur by control of transcription or stability of rbcL mRNA. Determination of CO2 compensation points showed young leaves were not functionally C4, consistent with cytological observations of the developmental progression from C3 default to intermediate to C4 photosynthesis. PMID:26957565

  20. Evidence for the temporal regulation of insect segmentation by a conserved sequence of transcription factors

    PubMed Central

    2018-01-01

    ABSTRACT Long-germ insects, such as the fruit fly Drosophila melanogaster, pattern their segments simultaneously, whereas short-germ insects, such as the beetle Tribolium castaneum, pattern their segments sequentially, from anterior to posterior. Although the two modes of segmentation at first appear quite distinct, much of this difference might simply reflect developmental heterochrony. We now show here that, in both Drosophila and Tribolium, segment patterning occurs within a common framework of sequential Caudal, Dichaete and Odd-paired expression. In Drosophila, these transcription factors are expressed like simple timers within the blastoderm, whereas in Tribolium they form wavefronts that sweep from anterior to posterior across the germband. In Drosophila, all three are known to regulate pair-rule gene expression and influence the temporal progression of segmentation. We propose that these regulatory roles are conserved in short-germ embryos, and that therefore the changing expression profiles of these genes across insects provide a mechanistic explanation for observed differences in the timing of segmentation. In support of this hypothesis, we demonstrate that Odd-paired is essential for segmentation in Tribolium, contrary to previous reports. PMID:29724758

  1. A rat RNA-Seq transcriptomic BodyMap across 11 organs and 4 developmental stages

    PubMed Central

    Yu, Ying; Fuscoe, James C.; Zhao, Chen; Guo, Chao; Jia, Meiwen; Qing, Tao; Bannon, Desmond I.; Lancashire, Lee; Bao, Wenjun; Du, Tingting; Luo, Heng; Su, Zhenqiang; Jones, Wendell D.; Moland, Carrie L.; Branham, William S.; Qian, Feng; Ning, Baitang; Li, Yan; Hong, Huixiao; Guo, Lei; Mei, Nan; Shi, Tieliu; Wang, Kevin Y.; Wolfinger, Russell D.; Nikolsky, Yuri; Walker, Stephen J.; Duerksen-Hughes, Penelope; Mason, Christopher E.; Tong, Weida; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Shi, Leming; Wang, Charles

    2014-01-01

    The rat has been used extensively as a model for evaluating chemical toxicities and for understanding drug mechanisms. However, its transcriptome across multiple organs, or developmental stages, has not yet been reported. Here we show, as part of the SEQC consortium efforts, a comprehensive rat transcriptomic BodyMap created by performing RNA-Seq on 320 samples from 11 organs of both sexes of juvenile, adolescent, adult and aged Fischer 344 rats. We catalogue the expression profiles of 40,064 genes, 65,167 transcripts, 31,909 alternatively spliced transcript variants and 2,367 non-coding genes/non-coding RNAs (ncRNAs) annotated in AceView. We find that organ-enriched, differentially expressed genes reflect the known organ-specific biological activities. A large number of transcripts show organ-specific, age-dependent or sex-specific differential expression patterns. We create a web-based, open-access rat BodyMap database of expression profiles with crosslinks to other widely used databases, anticipating that it will serve as a primary resource for biomedical research using the rat model. PMID:24510058

  2. Developmental fate and lineage commitment of singled mouse blastomeres.

    PubMed

    Lorthongpanich, Chanchao; Doris, Tham Puay Yoke; Limviphuvadh, Vachiranee; Knowles, Barbara B; Solter, Davor

    2012-10-01

    The inside-outside model has been invoked to explain cell-fate specification of the pre-implantation mammalian embryo. Here, we investigate whether cell-cell interaction can influence the fate specification of embryonic blastomeres by sequentially separating the blastomeres in two-cell stage mouse embryos and continuing separation after each cell division throughout pre-implantation development. This procedure eliminates information provided by cell-cell interaction and cell positioning. Gene expression profiles, polarity protein localization and functional tests of these separated blastomeres reveal that cell interactions, through cell position, influence the fate of the blastomere. Blastomeres, in the absence of cell contact and inner-outer positional information, have a unique pattern of gene expression that is characteristic of neither inner cell mass nor trophectoderm, but overall they have a tendency towards a 'trophectoderm-like' gene expression pattern and preferentially contribute to the trophectoderm lineage.

  3. The Composite Regulatory Basis of the Large X-Effect in Mouse Speciation.

    PubMed

    Larson, Erica L; Keeble, Sara; Vanderpool, Dan; Dean, Matthew D; Good, Jeffrey M

    2017-02-01

    The disruption of meiotic sex chromosome inactivation (MSCI) has been proposed to be a major developmental mechanism underlying the rapid evolution of hybrid male sterility. We tested this idea by analyzing cell-specific gene expression across spermatogenesis in two lineages of house mice and their sterile and fertile reciprocal hybrids. We found pervasive disruption of sex chromosome gene expression in sterile hybrids at every stage of spermatogenesis. Failure of MSCI was developmentally preceded by increased silencing of autosomal genes, supporting the hypothesis that divergence at the hybrid incompatibility gene, Prdm9, results in increased rates of autosomal asynapsis which in turn triggers widespread silencing of unsynapsed chromatin. We also detected opposite patterns of postmeiotic overexpression or hyper-repression of the sex chromosomes in reciprocal hybrids, supporting the hypothesis that genomic conflict has driven functional divergence that leads to deleterious X-Y dosage imbalances in hybrids. Our developmental timeline also exposed more subtle patterns of mitotic misregulation on the X chromosome, a previously undocumented stage of spermatogenic disruption in this cross. These results indicate that multiple hybrid incompatibilities have converged on a common regulatory phenotype, the disrupted expression of the sex chromosomes during spermatogenesis. Collectively, these data reveal a composite regulatory basis to hybrid male sterility in mice that helps resolve the mechanistic underpinnings of the well-documented large X-effect in mice speciation. We propose that the inherent sensitivity of spermatogenesis to X-linked regulatory disruption has the potential to be a major driver of reproductive isolation in species with chromosomal sex determination. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Developmental changes in the primacy of facial cues for emotion recognition.

    PubMed

    Leitzke, Brian T; Pollak, Seth D

    2016-04-01

    There have been long-standing differences of opinion regarding the influence of the face relative to that of contextual information on how individuals process and judge facial expressions of emotion. However, developmental changes in how individuals use such information have remained largely unexplored and could be informative in attempting to reconcile these opposing views. The current study tested for age-related differences in how individuals prioritize viewing emotional faces versus contexts when making emotion judgments. To do so, we asked 4-, 8-, and 12-year-old children as well as college students to categorize facial expressions of emotion that were presented with scenes that were either congruent or incongruent with the facial displays. During this time, we recorded participants' gaze patterns via eye tracking. College students directed their visual attention primarily to the face, regardless of contextual information. Children, however, divided their attention between both the face and the context as sources of emotional information depending on the valence of the context. These findings reveal a developmental shift in how individuals process and integrate emotional cues. (c) 2016 APA, all rights reserved).

  5. Expression patterns of wnt8 orthologs in two sand dollar species with different developmental modes.

    PubMed

    Nakata, Hidewo; Minokawa, Takuya

    2009-03-01

    Two wnt8 orthologs, Smwnt8 and Pjwnt8, were isolated from an indirect developing sand dollar, Scaphechinus mirabilis, and a direct developing sand dollar, Peronella japonica, respectively. The expression patterns of two genes during early development were examined by whole mount in situ hybridization. The expression of Smwnt8 was initiated in the micromeres at the late 16-cell stage and expanded at the 64-cell stage to the whole vegetal hemisphere, including the presumptive endomesodermal regions. The timing of the initiation of Pjwnt8 transcription in the presumptive endomesoderm region was delayed by 2-3 cell cycles compared to that of Smwnt8. The delay, or molecular heterochrony, of Pjwnt8 transcription strongly suggests the existence of a substantial evolutionary change in the early endomesodermal specification of P. japonica. In addition to the endomesodermal expression during early embryogenesis, bilateral expressions were observed commonly in the ectoderm of two sand dollar species during larval stages.

  6. The Maize (Zea mays L.) AUXIN/INDOLE-3-ACETIC ACID Gene Family: Phylogeny, Synteny, and Unique Root-Type and Tissue-Specific Expression Patterns during Development

    PubMed Central

    Ludwig, Yvonne; Zhang, Yanxiang; Hochholdinger, Frank

    2013-01-01

    The plant hormone auxin plays a key role in the coordination of many aspects of growth and development. AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) genes encode instable primary auxin responsive regulators of plant development that display a protein structure with four characteristic domains. In the present study, a comprehensive analysis of the 34 members of the maize Aux/IAA gene family was performed. Phylogenetic reconstructions revealed two classes of Aux/IAA proteins that can be distinguished by alterations in their domain III. Seven pairs of paralogous maize Aux/IAA proteins were discovered. Comprehensive root-type and tissue-specific expression profiling revealed unique expression patterns of the diverse members of the gene family. Remarkably, five of seven pairs of paralogous genes displayed highly correlated expression patterns in roots. All but one (ZmIAA23) tested maize Aux/IAA genes were auxin inducible, displaying two types of auxin induction within three hours of treatment. Moreover, 51 of 55 (93%) differential Aux/IAA expression patterns between different root-types followed the expression tendency: crown roots > seminal roots > primary roots > lateral roots. This pattern might imply root-type-specific regulation of Aux/IAA transcript abundance. In summary, the detailed analysis of the maize Aux/IAA gene family provides novel insights in the evolution and developmental regulation and thus the function of these genes in different root-types and tissues. PMID:24223858

  7. The maize (Zea mays L.) AUXIN/INDOLE-3-ACETIC ACID gene family: phylogeny, synteny, and unique root-type and tissue-specific expression patterns during development.

    PubMed

    Ludwig, Yvonne; Zhang, Yanxiang; Hochholdinger, Frank

    2013-01-01

    The plant hormone auxin plays a key role in the coordination of many aspects of growth and development. AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) genes encode instable primary auxin responsive regulators of plant development that display a protein structure with four characteristic domains. In the present study, a comprehensive analysis of the 34 members of the maize Aux/IAA gene family was performed. Phylogenetic reconstructions revealed two classes of Aux/IAA proteins that can be distinguished by alterations in their domain III. Seven pairs of paralogous maize Aux/IAA proteins were discovered. Comprehensive root-type and tissue-specific expression profiling revealed unique expression patterns of the diverse members of the gene family. Remarkably, five of seven pairs of paralogous genes displayed highly correlated expression patterns in roots. All but one (ZmIAA23) tested maize Aux/IAA genes were auxin inducible, displaying two types of auxin induction within three hours of treatment. Moreover, 51 of 55 (93%) differential Aux/IAA expression patterns between different root-types followed the expression tendency: crown roots > seminal roots > primary roots > lateral roots. This pattern might imply root-type-specific regulation of Aux/IAA transcript abundance. In summary, the detailed analysis of the maize Aux/IAA gene family provides novel insights in the evolution and developmental regulation and thus the function of these genes in different root-types and tissues.

  8. Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

    PubMed

    Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

    2018-04-11

    The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

  9. Differential expression of decorin and biglycan genes during mouse tooth development

    NASA Technical Reports Server (NTRS)

    Matsuura, T.; Duarte, W. R.; Cheng, H.; Uzawa, K.; Yamauchi, M.

    2001-01-01

    Small leucine-rich proteoglycans (SLRPs) have a number of biological functions and some of them are thought to regulate collagen mineralizaton in bone and tooth. We have previously identified and immunolocalized two members of the SLRPs family, decorin and biglycan, in bovine tooth/periodontium. To investigate their potential roles in tooth development, we examined the mRNA expression patterns of decorin, biglycan and type I collagen in newborn (day 19) mice tooth germs by in situ hybridization. At this developmental stage, the first maxillary and mandibular molars include stages before and after secretion of the predentin matrix, respectively. The expression of decorin mRNA coincided with that of type I collagen mRNA and was mostly observed in secretory odontoblasts, while the biglycan mRNA was expressed throughout the tooth germ, including pre-secretory odontoblasts/ameloblasts, dental papilla and stellate reticulum. However, its signal in secretory odontoblasts was not as evident as that of decorin. In mandibular incisors, where a significant amount of predentin matrix and a small amount of enamel matrix were already secreted, a similar differential expression pattern was observed. In secretory ameloblasts the biglycan mRNA expression was apparent, while that of decorin was not. These differential expression patterns suggest the distinct roles of biglycan and decorin in the process of tooth development.

  10. Developmental and Regional Patterns of GAP-43 Immunoreactivity in a Metamorphosing Brain

    PubMed Central

    Simmons, Andrea Megela; Tanyu, Leslie H.; Horowitz, Seth S.; Chapman, Judith A.; Brown, Rebecca A.

    2012-01-01

    Growth-associated protein-43 is typically expressed at high levels in the nervous system during development. In adult animals, its expression is lower, but still observable in brain areas showing structural or functional plasticity. We examined patterns of GAP-43 immunoreactivity in the brain of the bullfrog, an animal whose nervous system undergoes considerable reorganization across metamorphic development and retains a strong capacity for plasticity in adulthood. Immunolabeling was mostly diffuse in hatchling tadpoles, but became progressively more discrete as larval development proceeded. In many brain areas, intensity of immunolabel peaked at metamorphic climax, the time of final transition from aquatic to semi-terrestrial life. Changes in intensity of GAP-43 expression in the medial vestibular nucleus, superior olivary nucleus, and torus semicircularis appeared correlated with stage-dependent functional changes in processing auditory stimuli. Immunolabeling in the Purkinje cell layer of the cerebellum and in the cerebellar nucleus was detectable at most developmental time points. Heavy immunolabel was present from early larval stages through the end of climax in the thalamus (ventromedial, anterior, posterior, central nuclei). Immunolabel in the tadpole telencephalon was observed around the lateral ventricles, and in the medial septum and ventral striatum. In postmetamorphic animals, immunoreactivity was confined mainly to the ventricular zones and immediately adjacent cell layers. GAP-43 expression was present in olfactory, auditory and optic cranial nerves throughout larval and postmetamorphic life. The continued expression of GAP-43 in brain nuclei and in cranial nerves throughout development and into adulthood reflects the high regenerative potential of the bullfrog’s central nervous system. PMID:18431052

  11. Dynamic gene and protein expression patterns of the autism-associated met receptor tyrosine kinase in the developing mouse forebrain.

    PubMed

    Judson, Matthew C; Bergman, Mica Y; Campbell, Daniel B; Eagleson, Kathie L; Levitt, Pat

    2009-04-10

    The establishment of appropriate neural circuitry depends on the coordination of multiple developmental events across space and time. These events include proliferation, migration, differentiation, and survival-all of which can be mediated by hepatocyte growth factor (HGF) signaling through the Met receptor tyrosine kinase. We previously found a functional promoter variant of the MET gene to be associated with autism spectrum disorder, suggesting that forebrain circuits governing social and emotional function may be especially vulnerable to developmental disruptions in HGF/Met signaling. However, little is known about the spatiotemporal distribution of Met expression in the forebrain during the development of such circuits. To advance our understanding of the neurodevelopmental influences of Met activation, we employed complementary Western blotting, in situ hybridization, and immunohistochemistry to comprehensively map Met transcript and protein expression throughout perinatal and postnatal development of the mouse forebrain. Our studies reveal complex and dynamic spatiotemporal patterns of expression during this period. Spatially, Met transcript is localized primarily to specific populations of projection neurons within the neocortex and in structures of the limbic system, including the amygdala, hippocampus, and septum. Met protein appears to be principally located in axon tracts. Temporally, peak expression of transcript and protein occurs during the second postnatal week. This period is characterized by extensive neurite outgrowth and synaptogenesis, supporting a role for the receptor in these processes. Collectively, these data suggest that Met signaling may be necessary for the appropriate wiring of forebrain circuits, with particular relevance to the social and emotional dimensions of behavior. (c) 2009 Wiley-Liss, Inc.

  12. Three Drought-Responsive Members of the Nonspecific Lipid-Transfer Protein Gene Family in Lycopersicon pennellii Show Different Developmental Patterns of Expression1

    PubMed Central

    Treviño, Marcela B.; Connell, Mary A. O'

    1998-01-01

    Genomic clones of two nonspecific lipid-transfer protein genes from a drought-tolerant wild species of tomato (Lycopersicon pennellii Corr.) were isolated using as a probe a drought- and abscisic acid (ABA)-induced cDNA clone (pLE16) from cultivated tomato (Lycopersicon esculentum Mill.). Both genes (LpLtp1 and LpLtp2) were sequenced and their corresponding mRNAs were characterized; they are both interrupted by a single intron at identical positions and predict basic proteins of 114 amino acid residues. Genomic Southern data indicated that these genes are members of a small gene family in Lycopersicon spp. The 3′-untranslated regions from LpLtp1 and LpLtp2, as well as a polymerase chain reaction-amplified 3′-untranslated region from pLE16 (cross-hybridizing to a third gene in L. pennellii, namely LpLtp3), were used as gene-specific probes to describe expression in L. pennellii through northern-blot analyses. All LpLtp genes were exclusively expressed in the aerial tissues of the plant and all were drought and ABA inducible. Each gene had a different pattern of expression in fruit, and LpLtp1 and LpLtp2, unlike LpLtp3, were both primarily developmentally regulated in leaf tissue. Putative ABA-responsive elements were found in the proximal promoter regions of LpLtp1 and LpLtp2. PMID:9536064

  13. Salience network response to changes in emotional expressions of others is heightened during early adolescence: relevance for social functioning.

    PubMed

    Rosen, Maya L; Sheridan, Margaret A; Sambrook, Kelly A; Dennison, Meg J; Jenness, Jessica L; Askren, Mary K; Meltzoff, Andrew N; McLaughlin, Katie A

    2018-05-01

    Adolescence is a unique developmental period when the salience of social and emotional information becomes particularly pronounced. Although this increased sensitivity to social and emotional information has frequently been considered with respect to risk behaviors and psychopathology, evidence suggests that increased adolescent sensitivity to social and emotional cues may confer advantages. For example, greater sensitivity to shifts in the emotions of others is likely to promote flexible and adaptive social behavior. In this study, a sample of 54 children and adolescents (age 8-19 years) performed a delayed match-to-sample task for emotional faces while undergoing fMRI scanning. Recruitment of the anterior cingulate and anterior insula when the emotion of the probe face did not match the emotion held in memory followed a quadratic developmental pattern that peaked during early adolescence. These findings indicate meaningful developmental variation in the neural mechanisms underlying sensitivity to changes in the emotional expressions. Across all participants, greater activation of this network for changes in emotional expression was associated with less social anxiety and fewer social problems. These results suggest that the heightened salience of social and emotional information during adolescence may confer important advantages for social behavior, providing sensitivity to others' emotions that facilitates flexible social responding. © 2017 John Wiley & Sons Ltd.

  14. Interspecies modulation of bacterial development through iron competition and siderophore piracy

    PubMed Central

    Traxler, Matthew F.; Seyedsayamdost, Mohammad R.; Clardy, Jon; Kolter, Roberto

    2012-01-01

    Summary While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key down-stream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were down-regulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. PMID:22931126

  15. Interspecies modulation of bacterial development through iron competition and siderophore piracy.

    PubMed

    Traxler, Matthew F; Seyedsayamdost, Mohammad R; Clardy, Jon; Kolter, Roberto

    2012-11-01

    While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key downstream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were downregulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. © 2012 Blackwell Publishing Ltd.

  16. Analyses of the NAC transcription factor gene family in Gossypium raimondii Ulbr.: chromosomal location, structure, phylogeny, and expression patterns.

    PubMed

    Shang, Haihong; Li, Wei; Zou, Changsong; Yuan, Youlu

    2013-07-01

    NAC domain proteins are plant-specific transcription factors known to play diverse roles in various plant developmental processes. In the present study, we performed the first comprehensive study of the NAC gene family in Gossypium raimondii Ulbr., incorporating phylogenetic, chromosomal location, gene structure, conserved motif, and expression profiling analyses. We identified 145 NAC transcription factor (NAC-TF) genes that were phylogenetically clustered into 18 distinct subfamilies. Of these, 127 NAC-TF genes were distributed across the 13 chromosomes, 80 (55%) were preferentially retained duplicates located in both duplicated regions and six were located in triplicated chromosomal regions. The majority of NAC-TF genes showed temporal-, spatial-, and tissue-specific expression patterns based on transcriptomic and qRT-PCR analyses. However, the expression patterns of several duplicate genes were partially redundant, suggesting the occurrence of sub-functionalization during their evolution. Based on their genomic organization, we concluded that genomic duplications contributed significantly to the expansion of the NAC-TF gene family in G. raimondii. Comprehensive analysis of their expression profiles could provide novel insights into the functional divergence among members of the NAC gene family in G. raimondii. © 2013 Institute of Botany, Chinese Academy of Sciences.

  17. Unique patterns of organization and migration of FGF-expressing cells during Drosophila morphogenesis.

    PubMed

    Du, Lijuan; Zhou, Amy; Patel, Akshay; Rao, Mishal; Anderson, Kelsey; Roy, Sougata

    2017-07-01

    Fibroblast growth factors (FGF) are essential signaling proteins that regulate diverse cellular functions in developmental and metabolic processes. In Drosophila, the FGF homolog, branchless (bnl) is expressed in a dynamic and spatiotemporally restricted pattern to induce branching morphogenesis of the trachea, which expresses the Bnl-receptor, breathless (btl). Here we have developed a new strategy to determine bnl- expressing cells and study their interactions with the btl-expressing cells in the range of tissue patterning during Drosophila development. To enable targeted gene expression specifically in the bnl expressing cells, a new LexA based bnl enhancer trap line was generated using CRISPR/Cas9 based genome editing. Analyses of the spatiotemporal expression of the reporter in various embryonic stages, larval or adult tissues and in metabolic hypoxia, confirmed its target specificity and versatility. With this tool, new bnl expressing cells, their unique organization and functional interactions with the btl-expressing cells were uncovered in a larval tracheoblast niche in the leg imaginal discs, in larval photoreceptors of the developing retina, and in the embryonic central nervous system. The targeted expression system also facilitated live imaging of simultaneously labeled Bnl sources and tracheal cells, which revealed a unique morphogenetic movement of the embryonic bnl- source. Migration of bnl- expressing cells may create a dynamic spatiotemporal pattern of the signal source necessary for the directional growth of the tracheal branch. The genetic tool and the comprehensive profile of expression, organization, and activity of various types of bnl-expressing cells described in this study provided us with an important foundation for future research investigating the mechanisms underlying Bnl signaling in tissue morphogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Aryl hydrocarbon receptor (AHR) in the cnidarian Nematostella vectensis: comparative expression, protein interactions, and ligand binding.

    PubMed

    Reitzel, Adam M; Passamaneck, Yale J; Karchner, Sibel I; Franks, Diana G; Martindale, Mark Q; Tarrant, Ann M; Hahn, Mark E

    2014-02-01

    The aryl hydrocarbon receptor (AHR) is a member of the basic helix-loop-helix/Per-ARNT-Sim (bHLH-PAS) family of transcription factors and has diverse roles in development, physiology, and environmental sensing in bilaterian animals. Studying the expression of conserved genes and function of proteins in outgroups to protostomes and deuterostomes assists in understanding the antiquity of gene function and deciphering lineage-specific differences in these bilaterian clades. We describe the developmental expression of AHR from the sea anemone Nematostella vectensis and compare its expression with three other members of the bHLH-PAS family (AHR nuclear translocator (ARNT), Cycle, and a proto-Single-Minded/Trachealess). NvAHR expression was highest early in the larval stage with spatial expression in the basal portion of the ectoderm that became increasingly restricted to the oral pole with concentrated expression in tentacles of the juvenile polyp. The other bHLH-PAS genes showed a divergent expression pattern in later larval stages and polyps, in which gene expression was concentrated in the aboral end, with broader expression in the endoderm later in development. In co-immunoprecipitation assays, we found no evidence for heterodimerization of AHR with ARNT, contrary to the conservation of this specific interaction in all bilaterians studied to date. Similar to results with other invertebrate AHRs but in contrast to vertebrate AHRs, NvAHR failed to bind two prototypical xenobiotic AHR ligands (2,3,7,8-tetrachlorodibenzo-p-dioxin, β-naphthoflavone). Together, our data suggest that AHR's original function in Eumetazoa likely involved developmental patterning, potentially of neural tissue. The role of heterodimerization in the function of AHR may have arisen after the cnidarian-bilaterian ancestor. The absence of xenobiotic binding to NvAHR further supports a hypothesis for a derived role of this protein in chemical sensing within the chordates.

  19. Aryl hydrocarbon receptor (AHR) in the cnidarian Nematostella vectensis: comparative expression, protein interactions, and ligand binding

    PubMed Central

    Reitzel, Adam M.; Passamaneck, Yale J.; Karchner, Sibel I.; Franks, Diana G.; Martindale, Mark Q.; Tarrant, Ann M.; Hahn, Mark E.

    2014-01-01

    The aryl hydrocarbon receptor (AHR) is a member of the basic-helix-loop-helix/Per-ARNT-Sim (bHLH-PAS) family of transcription factors and has diverse roles in development, physiology, and environmental sensing in bilaterian animals. Studying the expression of conserved genes and function of proteins in outgroups to protostomes and deuterostomes assists in understanding the antiquity of gene function and deciphering lineage-specific differences in these bilaterian clades. We describe the developmental expression of AHR from the sea anemone Nematostella vectensis and compare its expression with three other members of the bHLH-PAS family (AHR nuclear translocator (ARNT), Cycle, and a proto-Single-Minded/Trachaeless). NvAHR expression was highest early in the larval stage with spatial expression in the basal portion of the ectoderm that became increasingly restricted to the oral pole with concentrated expression in tentacles of the juvenile polyp. The other bHLH-PAS genes showed a divergent expression pattern in later larval stages and polyps, in which gene expression was concentrated in the aboral end, with broader expression in the endoderm later in development. In co-immunoprecipitation assays, we found no evidence for heterodimerization of AHR with ARNT, contrary to the conservation of this specific interaction in all bilaterians studied to date. Similar to results with other invertebrate AHRs but in contrast to vertebrate AHRs, NvAHR failed to bind two prototypical xenobiotic AHR ligands (TCDD, BNF). Together, our data suggest that AHR's original function in Eumetazoa likely involved developmental patterning, potentially of neural tissue. The role of heterodimerization in the function of AHR may have arisen after the cnidarian-bilaterian ancestor. The absence of xenobiotic binding to NvAHR further supports a hypothesis for a derived role of this protein in chemical sensing within the chordates. PMID:24292160

  20. In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

    PubMed Central

    Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

    2014-01-01

    Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

  1. Genomic regulatory blocks encompass multiple neighboring genes and maintain conserved synteny in vertebrates

    PubMed Central

    Kikuta, Hiroshi; Laplante, Mary; Navratilova, Pavla; Komisarczuk, Anna Z.; Engström, Pär G.; Fredman, David; Akalin, Altuna; Caccamo, Mario; Sealy, Ian; Howe, Kerstin; Ghislain, Julien; Pezeron, Guillaume; Mourrain, Philippe; Ellingsen, Staale; Oates, Andrew C.; Thisse, Christine; Thisse, Bernard; Foucher, Isabelle; Adolf, Birgit; Geling, Andrea; Lenhard, Boris; Becker, Thomas S.

    2007-01-01

    We report evidence for a mechanism for the maintenance of long-range conserved synteny across vertebrate genomes. We found the largest mammal-teleost conserved chromosomal segments to be spanned by highly conserved noncoding elements (HCNEs), their developmental regulatory target genes, and phylogenetically and functionally unrelated “bystander” genes. Bystander genes are not specifically under the control of the regulatory elements that drive the target genes and are expressed in patterns that are different from those of the target genes. Reporter insertions distal to zebrafish developmental regulatory genes pax6.1/2, rx3, id1, and fgf8 and miRNA genes mirn9-1 and mirn9-5 recapitulate the expression patterns of these genes even if located inside or beyond bystander genes, suggesting that the regulatory domain of a developmental regulatory gene can extend into and beyond adjacent transcriptional units. We termed these chromosomal segments genomic regulatory blocks (GRBs). After whole genome duplication in teleosts, GRBs, including HCNEs and target genes, were often maintained in both copies, while bystander genes were typically lost from one GRB, strongly suggesting that evolutionary pressure acts to keep the single-copy GRBs of higher vertebrates intact. We show that loss of bystander genes and other mutational events suffered by duplicated GRBs in teleost genomes permits target gene identification and HCNE/target gene assignment. These findings explain the absence of evolutionary breakpoints from large vertebrate chromosomal segments and will aid in the recognition of position effect mutations within human GRBs. PMID:17387144

  2. Comparative analysis of miRNA expression during the development of insects of different metamorphosis modes and germ-band types.

    PubMed

    Ylla, Guillem; Piulachs, Maria-Dolors; Belles, Xavier

    2017-10-11

    Do miRNAs contribute to specify the germ-band type and the body structure in the insect embryo? Our goal was to address that issue by studying the changes in miRNA expression along the ontogeny of the German cockroach Blattella germanica, which is a short germ-band and hemimetabolan species. We sequenced small RNA libraries representing 11 developmental stages of B. germanica ontogeny (with especial emphasis on embryogenesis) and the changes in miRNA expression were examined. Data were compared with equivalent data for two long germ-band holometabolan species Drosophila melanogaster and Drosophila virilis, and the short germ-band holometabolan species Tribolium castaneum. The identification of B. germanica embryo small RNA sequences unveiled miRNAs not detected in previous studies, such as those of the MIR-309 family and 54 novel miRNAs. Four main waves of miRNA expression were recognized (with most miRNA changes occurring during the embryonic stages): the first from day 0 to day 1 of embryogenesis, the second during mid-embryogenesis (days 0-6), the third (with an acute expression peak) on day 2 of embryonic development, and the fourth during post-embryonic development. The second wave defined the boundaries of maternal-to-zygotic transition, with maternal mRNAs being cleared, presumably by Mir-309 and associated scavenger miRNAs. miRNAs follow well-defined patterns of expression over hemimetabolan ontogeny, patterns that are more diverse during embryonic development than during the nymphal stages. The results suggest that miRNAs play important roles in the developmental transitions between the embryonic stages of development (starting with maternal loading), during which they might influence the germ-band type and metamorphosis mode.

  3. The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

    PubMed

    Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

    2017-06-14

    Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

  4. FoxK1 splice variants show developmental stage-specific plasticity of expression with temperature in the tiger pufferfish.

    PubMed

    Fernandes, Jorge M O; MacKenzie, Matthew G; Kinghorn, James R; Johnston, Ian A

    2007-10-01

    FoxK1 is a member of the highly conserved forkhead/winged helix (Fox) family of transcription factors and it is known to play a key role in mammalian muscle development and myogenic stem cell function. The tiger pufferfish (Takifugu rubripes) orthologue of mammalian FoxK1 (TFoxK1) has seven exons and is located in a region of conserved synteny between pufferfish and mouse. TFoxK1 is expressed as three alternative transcripts: TFoxK1-alpha, TFoxK1-gamma and TFoxK1-delta. TFoxK1-alpha is the orthologue of mouse FoxK1-alpha, coding for a putative protein of 558 residues that contains the forkhead and forkhead-associated domains typical of Fox proteins and shares 53% global identity with its mammalian homologue. TFoxK1-gamma and TFoxK1-delta arise from intron retention events and these transcripts translate into the same 344-amino acid protein with a truncated forkhead domain. Neither are orthologues of mouse FoxK1-beta. In adult fish, the TFoxK1 splice variants were differentially expressed between fast and slow myotomal muscle, as well as other tissues, and the FoxK1-alpha protein was expressed in myogenic progenitor cells of fast myotomal muscle. During embryonic development, TFoxK1 was transiently expressed in the developing somites, heart, brain and eye. The relative expression of TFoxK1-alpha and the other two alternative transcripts varied with the incubation temperature regime for equivalent embryonic stages and the differences were particularly marked at later developmental stages. The developmental expression pattern of TFoxK1 and its localisation to mononuclear myogenic progenitor cells in adult fast muscle indicate that it may play an essential role in myogenesis in T. rubripes.

  5. Where Is My Attention? Children's Metaknowledge Expressed through Drawings

    ERIC Educational Resources Information Center

    Pezzica, Sara; Pinto, Giuliana; Bigozzi, Lucia; Vezzani, Claudio

    2016-01-01

    The aim of the present research is to assess the developmental pattern of the metacognitive knowledge of attention in Italian primary school students. Data were collected from 95 pupils divided into two age groups: the first (6-8 years) and second primary school cycles (8-10 years). The children were asked to perform two specific thematic drawings…

  6. The Interplay Between Digital Media Use and Development.

    PubMed

    Gerwin, Roslyn L; Kaliebe, Kristopher; Daigle, Monica

    2018-04-01

    Today's youth develop immersed in a digital media world and the effects are specific to their developmental stage. Clinicians and caretakers should be mindful regarding digital media use patterns; however, this complex and reciprocal relationship defies simple linear descriptions. The impacts of digital media can be powerful. It is important to be cautious but not over-pathologize media use because digital media enables social connections, allows self-soothing in some children, and fills needs for stimulation and self-expression. Young children or those with psychiatric disorders or developmental delays should be considered vulnerable to harmful effects of media content and overuse. Copyright © 2017. Published by Elsevier Inc.

  7. Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

    PubMed Central

    Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

    2007-01-01

    Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

  8. Hox genes and the parasitic flatworms: new opportunities, challenges and lessons from the free-living.

    PubMed

    Olson, P D

    2008-03-01

    Research into the roles played by Hox and related homeotic gene families in the diverse and complex developmental programmes exhibited by parasitic flatworms (Platyhelminthes) can hardly be said to have begun, and thus presents considerable opportunity for new research. Although featured in some of the earliest screens for homeotic genes outside Drosophila and mice, surveys in parasitic flatworms are few in number and almost nothing is yet known of where or when the genes are expressed during ontogeny. This contrasts sharply with a significant body of literature concerning Hox genes in free-living flatworms which have long served as models for the study of regeneration and the maintenance of omnipotent cell lines. Nevertheless, available information suggests that the complement of Hox genes and other classes of homeobox-containing genes in parasitic flatworms is typical of their free-living cousins and of other members of the Lophotrochozoa. Recent work on Schistosoma combined with information on Hox gene expression in planarians indicates that at least some disruption of the clustered genomic arrangement of the genes, as well as of the strict spatial and temporal colinear patterns of expression typical in other groups, may be characteristic of flatworms. However, available data on the genomic arrangement and expression of flatworm Hox genes is so limited at present that such generalities are highly tenuous. Moreover, a basic underlying pattern of colinearity is still observed in their spatial expression patterns making them suitable as cell or region-specific markers. I discuss a number of fundamental developmental questions and some of the challenges to addressing them in relation to each of the major parasitic lineages. In addition, I present newly characterized Hox genes from the model tapeworm Hymenolepis and analyze these by Bayesian inference together with >100 Hox and ParaHox homeodomains of flatworms and select lophotrochozoan taxa, providing a phylogenetic scaffold for their identification.

  9. Developmental expression of the neuroligins and neurexins in fragile X mice.

    PubMed

    Lai, Jonathan K Y; Doering, Laurie C; Foster, Jane A

    2016-03-01

    Neuroligins and neurexins are transsynaptic proteins involved in the maturation of glutamatergic and GABAergic synapses. Research has identified synaptic proteins and function as primary contributors to the development of fragile X syndrome. Fragile X mental retardation protein (FMRP), the protein that is lacking in fragile X syndrome, binds neuroligin-1 and -3 mRNA. Using in situ hybridization, we examined temporal and spatial expression patterns of neuroligin (NLGN) and neurexin (NRXN) mRNAs in the somatosensory (S1) cortex and hippocampus in wild-type (WT) and fragile X knockout (FMR1-KO) mice during the first 5 weeks of postnatal life. Genotype-based differences in expression included increased NLGN1 mRNA in CA1 and S1 cortex, decreased NLGN2 mRNA in CA1 and dentate gyrus (DG) regions of the hippocampus, and increased NRXN3 mRNA in CA1, DG, and S1 cortex between female WT and FMR1-KO mice. In male mice, decreased expression of NRXN3 mRNA was observed in CA1 and DG regions of FMR1-KO mice. Sex differences in hippocampal expression of NLGN2, NRXN1, NRXN2, and NRXN3 mRNAs and in S1 cortex expression of NRXN3 mRNAs were observed WT mice, whereas sex differences in NLGN3, NRXN1, NRXN2, and NRXN3 mRNA expression in the hippocampus and in NLGN1, NRXN2 and NRXN3 mRNA expression in S1 cortex were detected in FMR1-KO mice. These results provide a neuroanatomical map of NLGN and NRXN expression patterns over postnatal development in WT and FMR1-KO mice. The differences in developmental trajectory of these synaptic proteins could contribute to long-term differences in CNS wiring and synaptic function. © 2015 Wiley Periodicals, Inc.

  10. Near-isogenic cotton germplasm lines that differ in fiber-bundle strength have temporal differences in fiber gene expression patterns as revealed by comparative high-throughput profiling.

    PubMed

    Hinchliffe, Doug J; Meredith, William R; Yeater, Kathleen M; Kim, Hee Jin; Woodward, Andrew W; Chen, Z Jeffrey; Triplett, Barbara A

    2010-05-01

    Gene expression profiles of developing cotton (Gossypium hirsutum L.) fibers from two near-isogenic lines (NILs) that differ in fiber-bundle strength, short-fiber content, and in fewer than two genetic loci were compared using an oligonucleotide microarray. Fiber gene expression was compared at five time points spanning fiber elongation and secondary cell wall (SCW) biosynthesis. Fiber samples were collected from field plots in a randomized, complete block design, with three spatially distinct biological replications for each NIL at each time point. Microarray hybridizations were performed in a loop experimental design that allowed comparisons of fiber gene expression profiles as a function of time between the two NILs. Overall, developmental expression patterns revealed by the microarray experiment agreed with previously reported cotton fiber gene expression patterns for specific genes. Additionally, genes expressed coordinately with the onset of SCW biosynthesis in cotton fiber correlated with gene expression patterns of other SCW-producing plant tissues. Functional classification and enrichment analysis of differentially expressed genes between the two NILs revealed that genes associated with SCW biosynthesis were significantly up-regulated in fibers of the high-fiber quality line at the transition stage of cotton fiber development. For independent corroboration of the microarray results, 15 genes were selected for quantitative reverse transcription PCR analysis of fiber gene expression. These analyses, conducted over multiple field years, confirmed the temporal difference in fiber gene expression between the two NILs. We hypothesize that the loci conferring temporal differences in fiber gene expression between the NILs are important regulatory sequences that offer the potential for more targeted manipulation of cotton fiber quality.

  11. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization[OPEN

    PubMed Central

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Peng, Huiru; Sun, Qixin; Ni, Zhongfu

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid (Aegilops spp), tetraploid, and hexaploid wheat (Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. PMID:29298834

  12. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    PubMed

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

    2013-09-01

    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Nodal patterning without Lefty inhibitory feedback is functional but fragile

    PubMed Central

    Gagnon, James A; Pauli, Andrea; Zimmerman, Steven; Aksel, Deniz C; Reyon, Deepak; Tsai, Shengdar Q; Joung, J Keith

    2017-01-01

    Developmental signaling pathways often activate their own inhibitors. Such inhibitory feedback has been suggested to restrict the spatial and temporal extent of signaling or mitigate signaling fluctuations, but these models are difficult to rigorously test. Here, we determine whether the ability of the mesendoderm inducer Nodal to activate its inhibitor Lefty is required for development. We find that zebrafish lefty mutants exhibit excess Nodal signaling and increased specification of mesendoderm, resulting in embryonic lethality. Strikingly, development can be fully restored without feedback: Lethal patterning defects in lefty mutants can be rescued by ectopic expression of lefty far from its normal expression domain or by spatially and temporally uniform exposure to a Nodal inhibitor drug. While drug-treated mutants are less tolerant of mild perturbations to Nodal signaling levels than wild type embryos, they can develop into healthy adults. These results indicate that patterning without inhibitory feedback is functional but fragile. PMID:29215332

  14. Genetic variation and gene expression across multiple tissues and developmental stages in a non-human primate

    PubMed Central

    Jasinska, Anna J.; Zelaya, Ivette; Service, Susan K.; Peterson, Christine B.; Cantor, Rita M.; Choi, Oi-Wa; DeYoung, Joseph; Eskin, Eleazar; Fairbanks, Lynn A.; Fears, Scott; Furterer, Allison E.; Huang, Yu S.; Ramensky, Vasily; Schmitt, Christopher A.; Svardal, Hannes; Jorgensen, Matthew J.; Kaplan, Jay R.; Villar, Diego; Aken, Bronwen L.; Flicek, Paul; Nag, Rishi; Wong, Emily S.; Blangero, John; Dyer, Thomas D.; Bogomolov, Marina; Benjamini, Yoav; Weinstock, George M.; Dewar, Ken; Sabatti, Chiara; Wilson, Richard K.; Jentsch, J. David; Warren, Wesley; Coppola, Giovanni; Woods, Roger P.; Freimer, Nelson B.

    2017-01-01

    By analyzing multi-tissue gene expression and genome-wide genetic variation data in samples from a vervet monkey pedigree, we generated a transcriptome resource and produced the first catalogue of expression quantitative trait loci (eQTLs) in a non-human primate model. This catalogue contains more genome-wide significant eQTLs, per sample, than comparable human resources, and reveals sex and age-related expression patterns. Findings include a master regulatory locus that likely plays a role in immune function, and a locus regulating hippocampal long non-coding RNAs (lncRNAs), whose expression correlates with hippocampal volume. This resource will facilitate genetic investigation of quantitative traits, including brain and behavioral phenotypes relevant to neuropsychiatric disorders. PMID:29083405

  15. Characterisation and expression of microRNAs in developing wings of the neotropical butterfly Heliconius melpomene

    PubMed Central

    2011-01-01

    Background Heliconius butterflies are an excellent system for studies of adaptive convergent and divergent phenotypic traits. Wing colour patterns are used as signals to both predators and potential mates and are inherited in a Mendelian manner. The underlying genetic mechanisms of pattern formation have been studied for many years and shed light on broad issues, such as the repeatability of evolution. In Heliconius melpomene, the yellow hindwing bar is controlled by the HmYb locus. MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that have key roles in many biological processes, including development. miRNAs could act as regulators of genes involved in wing development, patterning and pigmentation. For this reason we characterised miRNAs in developing butterfly wings and examined differences in their expression between colour pattern races. Results We sequenced small RNA libraries from two colour pattern races and detected 142 Heliconius miRNAs with homology to others found in miRBase. Several highly abundant miRNAs were differentially represented in the libraries between colour pattern races. These candidates were tested further using Northern blots, showing that differences in expression were primarily due to developmental stage rather than colour pattern. Assembly of sequenced reads to the HmYb region identified hme-miR-193 and hme-miR-2788; located 2380 bp apart in an intergenic region. These two miRNAs are expressed in wings and show an upregulation between 24 and 72 hours post-pupation, indicating a potential role in butterfly wing development. A search for miRNAs in all available H. melpomene BAC sequences (~ 2.5 Mb) did not reveal any other miRNAs and no novel miRNAs were predicted. Conclusions Here we describe the first butterfly miRNAs and characterise their expression in developing wings. Some show differences in expression across developing pupal stages and may have important functions in butterfly wing development. Two miRNAs were located in the HmYb region and were expressed in developing pupal wings. Future work will examine the expression of these miRNAs in different colour pattern races and identify miRNA targets among wing patterning genes. PMID:21266089

  16. Characterisation and expression of microRNAs in developing wings of the neotropical butterfly Heliconius melpomene.

    PubMed

    Surridge, Alison K; Lopez-Gomollon, Sara; Moxon, Simon; Maroja, Luana S; Rathjen, Tina; Nadeau, Nicola J; Dalmay, Tamas; Jiggins, Chris D

    2011-01-26

    Heliconius butterflies are an excellent system for studies of adaptive convergent and divergent phenotypic traits. Wing colour patterns are used as signals to both predators and potential mates and are inherited in a Mendelian manner. The underlying genetic mechanisms of pattern formation have been studied for many years and shed light on broad issues, such as the repeatability of evolution. In Heliconius melpomene, the yellow hindwing bar is controlled by the HmYb locus. MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that have key roles in many biological processes, including development. miRNAs could act as regulators of genes involved in wing development, patterning and pigmentation. For this reason we characterised miRNAs in developing butterfly wings and examined differences in their expression between colour pattern races. We sequenced small RNA libraries from two colour pattern races and detected 142 Heliconius miRNAs with homology to others found in miRBase. Several highly abundant miRNAs were differentially represented in the libraries between colour pattern races. These candidates were tested further using Northern blots, showing that differences in expression were primarily due to developmental stage rather than colour pattern. Assembly of sequenced reads to the HmYb region identified hme-miR-193 and hme-miR-2788; located 2380 bp apart in an intergenic region. These two miRNAs are expressed in wings and show an upregulation between 24 and 72 hours post-pupation, indicating a potential role in butterfly wing development. A search for miRNAs in all available H. melpomene BAC sequences (~2.5 Mb) did not reveal any other miRNAs and no novel miRNAs were predicted. Here we describe the first butterfly miRNAs and characterise their expression in developing wings. Some show differences in expression across developing pupal stages and may have important functions in butterfly wing development. Two miRNAs were located in the HmYb region and were expressed in developing pupal wings. Future work will examine the expression of these miRNAs in different colour pattern races and identify miRNA targets among wing patterning genes.

  17. Building quantitative, three-dimensional atlases of gene expression and morphology at cellular resolution.

    PubMed

    Knowles, David W; Biggin, Mark D

    2013-01-01

    Animals comprise dynamic three-dimensional arrays of cells that express gene products in intricate spatial and temporal patterns that determine cellular differentiation and morphogenesis. A rigorous understanding of these developmental processes requires automated methods that quantitatively record and analyze complex morphologies and their associated patterns of gene expression at cellular resolution. Here we summarize light microscopy-based approaches to establish permanent, quantitative datasets-atlases-that record this information. We focus on experiments that capture data for whole embryos or large areas of tissue in three dimensions, often at multiple time points. We compare and contrast the advantages and limitations of different methods and highlight some of the discoveries made. We emphasize the need for interdisciplinary collaborations and integrated experimental pipelines that link sample preparation, image acquisition, image analysis, database design, visualization, and quantitative analysis. Copyright © 2013 Wiley Periodicals, Inc.

  18. Single master regulatory gene coordinates the evolution and development of butterfly color and iridescence

    PubMed Central

    Zhang, Linlin

    2017-01-01

    The optix gene has been implicated in butterfly wing pattern adaptation by genetic association, mapping, and expression studies. The actual developmental function of this gene has remained unclear, however. Here we used CRISPR/Cas9 genome editing to show that optix plays a fundamental role in nymphalid butterfly wing pattern development, where it is required for determination of all chromatic coloration. optix knockouts in four species show complete replacement of color pigments with melanins, with corresponding changes in pigment-related gene expression, resulting in black and gray butterflies. We also show that optix simultaneously acts as a switch gene for blue structural iridescence in some butterflies, demonstrating simple regulatory coordination of structural and pigmentary coloration. Remarkably, these optix knockouts phenocopy the recurring “black and blue” wing pattern archetype that has arisen on many independent occasions in butterflies. Here we demonstrate a simple genetic basis for structural coloration, and show that optix plays a deeply conserved role in butterfly wing pattern development. PMID:28923944

  19. Single master regulatory gene coordinates the evolution and development of butterfly color and iridescence.

    PubMed

    Zhang, Linlin; Mazo-Vargas, Anyi; Reed, Robert D

    2017-10-03

    The optix gene has been implicated in butterfly wing pattern adaptation by genetic association, mapping, and expression studies. The actual developmental function of this gene has remained unclear, however. Here we used CRISPR/Cas9 genome editing to show that optix plays a fundamental role in nymphalid butterfly wing pattern development, where it is required for determination of all chromatic coloration. optix knockouts in four species show complete replacement of color pigments with melanins, with corresponding changes in pigment-related gene expression, resulting in black and gray butterflies. We also show that optix simultaneously acts as a switch gene for blue structural iridescence in some butterflies, demonstrating simple regulatory coordination of structural and pigmentary coloration. Remarkably, these optix knockouts phenocopy the recurring "black and blue" wing pattern archetype that has arisen on many independent occasions in butterflies. Here we demonstrate a simple genetic basis for structural coloration, and show that optix plays a deeply conserved role in butterfly wing pattern development.

  20. Structural and metabolic transitions of C4 leaf development and differentiation defined by microscopy and quantitative proteomics in maize.

    PubMed

    Majeran, Wojciech; Friso, Giulia; Ponnala, Lalit; Connolly, Brian; Huang, Mingshu; Reidel, Edwin; Zhang, Cankui; Asakura, Yukari; Bhuiyan, Nazmul H; Sun, Qi; Turgeon, Robert; van Wijk, Klaas J

    2010-11-01

    C(4) grasses, such as maize (Zea mays), have high photosynthetic efficiency through combined biochemical and structural adaptations. C(4) photosynthesis is established along the developmental axis of the leaf blade, leading from an undifferentiated leaf base just above the ligule into highly specialized mesophyll cells (MCs) and bundle sheath cells (BSCs) at the tip. To resolve the kinetics of maize leaf development and C(4) differentiation and to obtain a systems-level understanding of maize leaf formation, the accumulation profiles of proteomes of the leaf and the isolated BSCs with their vascular bundle along the developmental gradient were determined using large-scale mass spectrometry. This was complemented by extensive qualitative and quantitative microscopy analysis of structural features (e.g., Kranz anatomy, plasmodesmata, cell wall, and organelles). More than 4300 proteins were identified and functionally annotated. Developmental protein accumulation profiles and hierarchical cluster analysis then determined the kinetics of organelle biogenesis, formation of cellular structures, metabolism, and coexpression patterns. Two main expression clusters were observed, each divided in subclusters, suggesting that a limited number of developmental regulatory networks organize concerted protein accumulation along the leaf gradient. The coexpression with BSC and MC markers provided strong candidates for further analysis of C(4) specialization, in particular transporters and biogenesis factors. Based on the integrated information, we describe five developmental transitions that provide a conceptual and practical template for further analysis. An online protein expression viewer is provided through the Plant Proteome Database.

  1. Bisphenol-A exposure in utero leads to epigenetic alterations in the developmental programming of uterine estrogen response

    PubMed Central

    Bromer, Jason G.; Zhou, Yuping; Taylor, Melissa B.; Doherty, Leo; Taylor, Hugh S.

    2010-01-01

    Bisphenol-A (BPA) is a nonsteroidal estrogen that is ubiquitous in the environment. The homeobox gene Hoxa10 controls uterine organogenesis, and its expression is affected by in utero BPA exposure. We hypothesized that an epigenetic mechanism underlies BPA-mediated alterations in Hoxa10 expression. We analyzed the expression pattern and methylation profile of Hoxa10 after in utero BPA exposure. Pregnant CD-1 mice were treated with BPA (5 mg/kg IP) or vehicle control on d 9–16 of pregnancy. Hoxa10 mRNA and protein expression were increased by 25% in the reproductive tract of mice exposed in utero. Bisulfite sequencing revealed that cytosine-guanine dinucleotide methylation was decreased from 67 to 14% in the promoter and from 71 to 3% in the intron of Hoxa10 after in utero BPA exposure. Decreased DNA methylation led to an increase in binding of ER-α to the Hoxa10 ERE both in vitro as and in vivo as determined by EMSA and chromatin immunoprecipitation, respectively. Diminished methylation of the ERE-containing promoter sequence resulted in an increase in ERE-driven gene expression in reporter assays. We identify altered methylation as a novel mechanism of BPA-induced altered developmental programming. Permanent epigenetic alteration of ERE sensitivity to estrogen may be a general mechanism through which endocrine disruptors exert their action.—Bromer, J. G., Zhou, Y., Taylor, M. B., Doherty, L., Taylor, H. S.. Bisphenol-A exposure in utero leads to epigenetic alterations in the developmental programming of uterine estrogen response. PMID:20181937

  2. A chronological expression profile of gene activity during embryonic mouse brain development.

    PubMed

    Goggolidou, P; Soneji, S; Powles-Glover, N; Williams, D; Sethi, S; Baban, D; Simon, M M; Ragoussis, I; Norris, D P

    2013-12-01

    The brain is a functionally complex organ, the patterning and development of which are key to adult health. To help elucidate the genetic networks underlying mammalian brain patterning, we conducted detailed transcriptional profiling during embryonic development of the mouse brain. A total of 2,400 genes were identified as showing differential expression between three developmental stages. Analysis of the data identified nine gene clusters to demonstrate analogous expression profiles. A significant group of novel genes of as yet undiscovered biological function were detected as being potentially relevant to brain development and function, in addition to genes that have previously identified roles in the brain. Furthermore, analysis for genes that display asymmetric expression between the left and right brain hemispheres during development revealed 35 genes as putatively asymmetric from a combined data set. Our data constitute a valuable new resource for neuroscience and neurodevelopment, exposing possible functional associations between genes, including novel loci, and encouraging their further investigation in human neurological and behavioural disorders.

  3. Comparative floral development in Lithospermum (Boraginaceae) and implications for the evolution and development of heterostyly.

    PubMed

    Cohen, James I; Litt, Amy; Davis, Jerrold I

    2012-05-01

    The evolution and development of floral developmental patterns were investigated in three heterostylous and three homostylous species of Lithospermum to determine whether species that independently acquired the same floral form follow the same pattern of development or different patterns. Using light and scanning electron microscopy, we observed developmental patterns in flowers at different stages of maturity. These patterns were compared within individual species, between heterostylous morphs, and among heterostylous and homostylous species. Although heterostyly has been determined by phylogenetic analysis to have originated independently in each of the heterostylous species, flowers of the long-style morph of each species follow similar patterns of gross development, as do those of the short-style morph. In addition, the flowers of each morph develop in a manner similar to those of their respective homostylous, herkogamous relatives. However, the developmental patterns of the stylar epidermal cells differ among these species and between heterostylous and homostylous species. Floral developmental patterns in homostylous species provide evidence that modification of specific traits, such as patterns of stylar growth, can lead to the evolution of heterostyly. The developmental changes that affect the positions of the stigmas and anthers in each morph likely involve either temporal or spatial modifications of gene function. The floral developmental patterns described here and the occurrence of multiple types of herkogamy within some species of Lithospermum provide evidence that heterostylous species in the genus have originated via distinct evolutionary developmental pathways.

  4. Is Transcriptomic Regulation of Berry Development More Important at Night than During the Day?

    PubMed Central

    Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T.; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

    2014-01-01

    Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far. PMID:24551177

  5. Is transcriptomic regulation of berry development more important at night than during the day?

    PubMed

    Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

    2014-01-01

    Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

  6. High-Throughput Sequencing of RNA Silencing-Associated Small RNAs in Olive (Olea europaea L.)

    PubMed Central

    Donaire, Livia; Pedrola, Laia; de la Rosa, Raúl; Llave, César

    2011-01-01

    Small RNAs (sRNAs) of 20 to 25 nucleotides (nt) in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.). sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA) regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive. PMID:22140484

  7. Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

    PubMed Central

    Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

    2017-01-01

    Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

  8. Segmentation gene expression patterns in Bactrocera dorsalis and related insects: regulation and shape of blastoderm and larval cuticle.

    PubMed

    Suksuwan, Worramin; Cai, Xiaoli; Ngernsiri, Lertluk; Baumgartner, Stefan

    2017-01-01

    The oriental fruit fly, Bactrocera dorsalis, is regarded as a severe pest of fruit production in Asia. Despite its economic importance, only limited information regarding the molecular and developmental biology of this insect is known to date. We provide a detailed analysis of B. dorsalis embryology, as well as the expression patterns of a number of segmentation genes known to act during patterning of Drosophila and compare these to the patterns of other insect families. An anterior shift of the expression of gap genes was detected when compared to Drosophila. This shift was largely restored during the step where the gap genes control expression of the pair-rule genes. We analyzed and compared the shapes of the embryos of insects of different families, B. dorsalis and the blow fly Lucilia sericata with that of the well-characterized Drosophila melanogaster. We found distinct shapes as well as differences in the ratios of the length of the anterior-posterior axis and the dorsal-ventral axis. These features were integrated into a profile of how the expression patterns of the gap gene Krüppel and the pair-rule gene even-skipped were observed along the A-P axis in three insects families. Since significant differences were observed, we discuss how Krüppel controls the even-skipped stripes. Furthermore, we discuss how the position and angles of the segmentation gene stripes differed from other insects. Finally, we analyzed the outcome of the expression patterns of the late acting segment polarity genes in relation to the anlagen of the naked-cuticle and denticle belt area of the B. dorsalis larva.

  9. Postnatal choline supplementation selectively attenuates hippocampal microRNA alterations associated with developmental alcohol exposure

    PubMed Central

    Balaraman, Sridevi; Idrus, Nirelia M.; Miranda, Rajesh C.; Thomas, Jennifer D.

    2017-01-01

    Prenatal alcohol exposure can result in a range of physical, neuropathological, and behavioral alterations, collectively termed fetal alcohol spectrum disorders (FASD). We have shown that supplementation with the nutrient choline reduces the severity of developmental alcohol-associated deficits in hippocampal-dependent behaviors and normalizes some aspects of hippocampal cholinergic development and DNA methylation patterns. Alcohol’s developmental effects may also be mediated, in part, by altering microRNAs (miRNAs) that serve as negative regulators of gene translation. To determine whether choline supplementation alters ethanol’s long-lasting effects on miRNAs, Sprague-Dawley rats were exposed to 5.25 g/kg/day ethanol from postnatal days (PD) 4–9 via intubation; controls received sham intubations. Subjects were treated with choline chloride (100 mg/kg/day) or saline vehicle subcutaneously (s.c.) from PD 4–21. On PD 22, subjects were sacrificed, and RNA isolated from the hippocampus. MiRNA expression was assessed with TaqMan Human MicroRNA Panel Low-Density Arrays. Ethanol significantly increased miRNA expression variance, an effect that was normalized with choline supplementation. Cluster analysis of stably expressed miRNAs that exceeded an ANOVA p<0.05 criterion indicated that for both male and female offspring, control and ethanol-exposed groups were most dissimilar from each other, with choline-supplemented groups in between. MiRNAs that expressed an average 2-fold change due to ethanol exposure were further analyzed to identify which ethanol-sensitive miRNAs were protected by choline supplementation. We found that at a false discovery rate (FDR)-adjusted criterion of p<0.05, miR-200c was induced by ethanol exposure and that choline prevented this effect. Collectively, our data show that choline supplementation can normalize disturbances in miRNA expression following developmental alcohol exposure and can protect specific miRNAs from induction by ethanol. These findings have important implications for the mechanisms by which choline may serve as a potential treatment for FASD. PMID:28433422

  10. Lamellar pro-inflammatory cytokine expression patterns in laminitis at the developmental stage and at the onset of lameness: innate vs. adaptive immune response.

    PubMed

    Belknap, J K; Giguère, S; Pettigrew, A; Cochran, A M; Van Eps, A W; Pollitt, C C

    2007-01-01

    Recent research has indicated that inflammation plays a role in the early stages of laminitis and that, similar to organ failure in human sepsis, early inflammatory mechanisms may lead to downstream events resulting in lamellar failure. Characterisation of the type of immune response (i.e. innate vs. adaptive) is essential in order to develop therapeutic strategies to counteract these deleterious events. To quantitate gene expression of pro-inflammatory cytokines known to be important in the innate and adaptive immune response during the early stages of laminitis, using both the black walnut extract (BWE) and oligofructose (OF) models of laminitis. Real-time qPCR was used to assess lamellar mRNA expression of interleukins-1beta, 2, 4, 6, 8, 10, 12 and 18, and tumour necrosis factor alpha and interferon gamma at the developmental stage and at the onset of lameness. Significantly increased lamellar mRNA expression of cytokines important in the innate immune response were present at the developmental stage of the BWE model, and at the onset of acute lameness in both the BWE model and OF model. Of the cytokines characteristic of the Th1 and Th2 arms of the adaptive immune response, a mixed response was noted at the onset of acute lameness in the BWE model, whereas the response was skewed towards a Th1 response at the onset of lameness in the OF model. Lamellar inflammation is characterised by strong innate immune response in the developmental stages of laminitis; and a mixture of innate and adaptive immune responses at the onset of lameness. These results indicate that anti-inflammatory treatment of early stage laminitis (and the horse at risk of laminitis) should include not only therapeutic drugs that address prostanoid activity, but should also address the marked increases in lamellar cytokine expression.

  11. Monocrotophos, an organophosphorus insecticide, disrupts the expression of HpNetrin and its receptor neogenin during early development in the sea urchin (Hemicentrotus pulcherrimus).

    PubMed

    Zhang, Xiaona; Xu, Lei; Tian, Hua; Wang, Cuicui; Wang, Wei; Ru, Shaoguo

    2017-09-01

    Netrins, chemotropic guidance cues, can guide the extension of serotonergic axons by binding to netrin receptors during neural development. However, little is known about whether disruption of netrin signaling is involved in the mechanisms by which organophosphorus pesticides affect serotonergic nervous system (SNS) development. In this study, we evaluated the effects of the pesticide monocrotophos (MCP) on the expression patterns of HpNetrin and its receptor neogenin as well as on the intracellular calcium ion (Ca 2+ ) levels in Hemicentrotus pulcherrimus (sea urchin) by exposing fertilized embryos to 0, 0.01, 0.10, and 1.00mg/L MCP. The results showed that MCP disrupted HpNetrin and neogenin expression at different developmental stages in H. pulcherrimus and that Ca 2+ appeared to be involved in the MCP-induced developmental neurotoxicity. Specifically, the lower concentrations of MCP elevated HpNetrin and neogenin transcription, resulting in higher intracellular Ca 2+ levels during the early developmental stages in the sea urchin; this may affect netrin-directed cell migration/axon extension and subsequently disrupt serotonergic axon branching and synapse formation. In contrast, 1.00mg/L MCP exhibited an inhibitory effect on HpNetrin and neogenin transcription. This finding implies that the regulatory roles of these factors may be diminished during early development, thereby causing developmental defects in the sea urchin. Collectively, our results provide a basis for exploring the involvement of netrin and neogenin in the organophosphate-induced disruption of the SNS during development. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. FGF signaling refines Wnt gradients to regulate the patterning of taste papillae.

    PubMed

    Prochazkova, Michaela; Häkkinen, Teemu J; Prochazka, Jan; Spoutil, Frantisek; Jheon, Andrew H; Ahn, Youngwook; Krumlauf, Robb; Jernvall, Jukka; Klein, Ophir D

    2017-06-15

    The patterning of repeated structures is a major theme in developmental biology, and the inter-relationship between spacing and size of such structures is an unresolved issue. Fungiform papillae are repeated epithelial structures that house taste buds on the anterior tongue. Here, we report that FGF signaling is a crucial regulator of fungiform papillae development. We found that mesenchymal FGF10 controls the size of the papillary area, while overall patterning remains unchanged. Our results show that FGF signaling negatively affects the extent of canonical Wnt signaling, which is the main activation pathway during fungiform papillae development; however, this effect does not occur at the level of gene transcription. Rather, our experimental data, together with computational modeling, indicate that FGF10 modulates the range of Wnt effects, likely via induction of Sostdc1 expression. We suggest that modification of the reach of Wnt signaling could be due to local changes in morphogen diffusion, representing a novel mechanism in this tissue context, and we propose that this phenomenon might be involved in a broader array of mammalian developmental processes. © 2017. Published by The Company of Biologists Ltd.

  13. Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae)

    PubMed Central

    Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

    2015-01-01

    The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture. PMID:26352931

  14. Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae).

    PubMed

    Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

    2015-01-01

    The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture.

  15. EphrinA5 protein distribution in the developing mouse brain

    PubMed Central

    2010-01-01

    Background EphrinA5 is one of the best-studied members of the Eph-ephrin family of guidance molecules, known to be involved in brain developmental processes. Using in situ hybridization, ephrinA5 mRNA expression has been detected in the retinotectal, the thalamocortical, and the olfactory systems; however, no study focused on the distribution of the protein. Considering that this membrane-anchored molecule may act far from the neuron soma expressing the transcript, it is of a crucial interest to localize ephrinA5 protein to better understand its function. Results Using immunohistochemistry, we found that ephrinA5 protein is highly expressed in the developing mouse brain from E12.5 to E16.5. The olfactory bulb, the cortex, the striatum, the thalamus, and the colliculi showed high intensity of labelling, suggesting its implication in topographic mapping of olfactory, retinocollicular, thalamocortical, corticothalamic and mesostriatal systems. In the olfactory nerve, we found an early ephrinA5 protein expression at E12.5 suggesting its implication in the guidance of primary olfactory neurons into the olfactory bulb. In the thalamus, we detected a dynamic graduated protein expression, suggesting its role in the corticothalamic patterning, whereas ephrinA5 protein expression in the target region of mesencephalic dopaminergic neurones indicated its involvement in the mesostriatal topographic mapping. Following E16.5, the signal faded gradually and was barely detectable at P0, suggesting a main role for ephrinA5 in primary molecular events in topographic map formation. Conclusion Our work shows that ephrinA5 protein is expressed in restrictive regions of the developing mouse brain. This expression pattern points out the potential sites of action of this molecule in the olfactory, retinotectal, thalamocortical, corticothalamic and mesostriatal systems, during development. This study is essential to better understand the role of ephrinA5 during developmental topographic mapping of connections and to further characterise the mechanisms involved in pathway restoration following cell transplantation in the damaged brain. PMID:20738842

  16. Dithiocarbamates have a common toxic effect on zebrafish body axis formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tilton, Fred; La Du, Jane K.; Vue, Meng

    2006-10-01

    We previously determined that the dithiocarbamate pesticide sodium metam (NaM) and its active ingredient methylisothiocyanate (MITC) were developmentally toxic causing notochord distortions in the zebrafish. In this study, developing zebrafish were exposed to isothiocyanates (ITCs), dithiocarbamates (DTCs) and several degradation products to determine the teratogenic relationship of these chemical classes at the molecular level. All dithiocarbamates tested elicited notochord distortions with notochord NOELs from <4 to 40 ppb, while none of the ITCs caused notochord distortions with the exception of MITC. Carbon disulfide (CS{sub 2}), a common DTC degradate, also caused distortions at concentrations >200 times the DTCs. Whole mountmore » in situ hybridization of developmental markers for collagen (collagen2a1), muscle (myoD), and body axis formation (no tail) was perturbed well after cessation of treatment with pyrolidine-DTC (PDTC), dimethyl-DTC (DMDTC), NaM, MITC, and CS{sub 2}. Therefore, distinct albeit related chemical classes share a common toxic effect on zebrafish notochord development. To test the responsiveness of the distortion to metal perturbation, five metal chelators and 2 metals were studied. The membrane permeable copper chelator neocuproine (NCu) was found to cause notochord distortions similar to DTC-related molecules. DMDTC and NCu treated animals were protected with copper, and collagen 2a1 and no tail gene expression patterns were identical to controls in these animals. PDTC, NaM, MITC, and CS{sub 2} were not responsive to copper indicating that the chelation of metals is not the primary means by which these molecules elicit their developmental toxicity. Embryos treated with DMDTC, NaM, and NCu were rescued by adding triciaine (MS-222) which abolishes the spontaneous muscle contractions that begin at 18 hpf. In these animals, only collagen 2a1 expression showed a similar pattern to the other notochord distorting molecules. This indicates that the perturbation of no tail expression is in response to the muscle contractions distorting the notochord, while collagen 2a1 is associated with the impact of these molecules on much earlier developmental processes.« less

  17. Variations in Developmental Patterns across Pragmatic Features

    ERIC Educational Resources Information Center

    Li, Qiong

    2016-01-01

    Drawing on the findings of longitudinal studies in uninstructed contexts over the last two decades, this synthesis explores variations in developmental patterns across second language (L2) pragmatic features. Two synthesis questions were addressed: (a) What are the variations in developmental patterns across pragmatic features?, and (b) What are…

  18. Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

    PubMed

    Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

    2016-05-01

    Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

  19. Gap Gene Regulatory Dynamics Evolve along a Genotype Network

    PubMed Central

    Crombach, Anton; Wotton, Karl R.; Jiménez-Guri, Eva; Jaeger, Johannes

    2016-01-01

    Developmental gene networks implement the dynamic regulatory mechanisms that pattern and shape the organism. Over evolutionary time, the wiring of these networks changes, yet the patterning outcome is often preserved, a phenomenon known as “system drift.” System drift is illustrated by the gap gene network—involved in segmental patterning—in dipteran insects. In the classic model organism Drosophila melanogaster and the nonmodel scuttle fly Megaselia abdita, early activation and placement of gap gene expression domains show significant quantitative differences, yet the final patterning output of the system is essentially identical in both species. In this detailed modeling analysis of system drift, we use gene circuits which are fit to quantitative gap gene expression data in M. abdita and compare them with an equivalent set of models from D. melanogaster. The results of this comparative analysis show precisely how compensatory regulatory mechanisms achieve equivalent final patterns in both species. We discuss the larger implications of the work in terms of “genotype networks” and the ways in which the structure of regulatory networks can influence patterns of evolutionary change (evolvability). PMID:26796549

  20. Soybean kinome: functional classification and gene expression patterns

    PubMed Central

    Liu, Jinyi; Chen, Nana; Grant, Joshua N.; Cheng, Zong-Ming (Max); Stewart, C. Neal; Hewezi, Tarek

    2015-01-01

    The protein kinase (PK) gene family is one of the largest and most highly conserved gene families in plants and plays a role in nearly all biological functions. While a large number of genes have been predicted to encode PKs in soybean, a comprehensive functional classification and global analysis of expression patterns of this large gene family is lacking. In this study, we identified the entire soybean PK repertoire or kinome, which comprised 2166 putative PK genes, representing 4.67% of all soybean protein-coding genes. The soybean kinome was classified into 19 groups, 81 families, and 122 subfamilies. The receptor-like kinase (RLK) group was remarkably large, containing 1418 genes. Collinearity analysis indicated that whole-genome segmental duplication events may have played a key role in the expansion of the soybean kinome, whereas tandem duplications might have contributed to the expansion of specific subfamilies. Gene structure, subcellular localization prediction, and gene expression patterns indicated extensive functional divergence of PK subfamilies. Global gene expression analysis of soybean PK subfamilies revealed tissue- and stress-specific expression patterns, implying regulatory functions over a wide range of developmental and physiological processes. In addition, tissue and stress co-expression network analysis uncovered specific subfamilies with narrow or wide interconnected relationships, indicative of their association with particular or broad signalling pathways, respectively. Taken together, our analyses provide a foundation for further functional studies to reveal the biological and molecular functions of PKs in soybean. PMID:25614662

  1. Cadherins in cerebellar development: translation of embryonic patterning into mature functional compartmentalization.

    PubMed

    Redies, Christoph; Neudert, Franziska; Lin, Juntang

    2011-09-01

    Cadherins are cell adhesion molecules with multiple morphogenic functions in brain development, for example, in neuroblast migration and aggregation, axon navigation, neural circuit formation, and synaptogenesis. More than 100 members of the cadherin superfamily are expressed in the developing and mature brain. Most of the cadherins investigated, in particular classic cadherins and δ-protocadherins, are expressed in the cerebellum. For several cadherin subtypes, expression begins at early embryonic stages and persists until mature stages of cerebellar development. At intermediate stages, distinct Purkinje cell clusters exhibit unique rostrocaudal and mediolateral expression profiles for each cadherin. In the chicken, mouse, and other species, the Purkinje cell clusters are separated by intervening raphes of migrating granule cells. This pattern of Purkinje cell clusters/raphes is, at least in part, continuous with the parasagittal striping pattern that is apparent in the mature cerebellar cortex, for example, for zebrin II/aldolase C. Moreover, subregions of the deep cerebellar nuclei, vestibular nuclei and the olivary complex also express cadherins differentially. Neuroanatomical evidence suggests that the nuclear subregions and cortical domains that express the same cadherin subtype are connected to each other, to form neural subcircuits of the cerebellar system. Cadherins thus provide a molecular code that specifies not only embryonic structures but also functional cerebellar compartmentalization. By following the implementation of this code, it can be revealed how mature functional architecture emerges from embryonic patterning during cerebellar development. Dysfunction of some cadherins is associated with psychiatric diseases and developmental impairments and may also affect cerebellar function.

  2. Expression of Glycosaminoglycan Epitopes During Zebrafish Skeletogenesis

    PubMed Central

    Hayes, Anthony J; Mitchell, Ruth E; Bashford, Andrew; Reynolds, Scott; Caterson, Bruce; Hammond, Chrissy L

    2013-01-01

    Background: The zebrafish is an important developmental model. Surprisingly, there are few studies that describe the glycosaminoglycan composition of its extracellular matrix during skeletogenesis. Glycosaminoglycans on proteoglycans contribute to the material properties of musculo skeletal connective tissues, and are important in regulating signalling events during morphogenesis. Sulfation motifs within the chain structure of glycosaminoglycans on cell-associated and extracellular matrix proteoglycans allow them to bind and regulate the sequestration/presentation of bioactive signalling molecules important in musculo-skeletal development. Results: We describe the spatio-temporal expression of different glycosaminoglycan moieties during zebrafish skeletogenesis with antibodies recognising (1) native sulfation motifs within chondroitin and keratan sulfate chains, and (2) enzyme-generated neoepitope sequences within the chain structure of chondroitin sulfate (i.e., 0-, 4-, and 6-sulfated isoforms) and heparan sulfate glycosaminoglycans. We show that all the glycosaminoglycan moieties investigated are expressed within the developing skeletal tissues of larval zebrafish. However, subtle changes in their patterns of spatio-temporal expression over the period examined suggest that their expression is tightly and dynamically controlled during development. Conclusions: The subtle differences observed in the domains of expression between different glycosaminoglycan moieties suggest differences in their functional roles during establishment of the primitive analogues of the skeleton. Developmental Dynamics 242:778–789, 2013. © 2013 Wiley Periodicals, Inc. Key Findings The developing zebrafish skeleton expresses many different glycosaminoglycan modifications. Multiple different glycosaminoglycan epitopes are dynamically expressed in the craniofacial skeleton. Expression of chondroitin sulfate moieties are dynamically expressed in the vertebral column and precede mineralisation. PMID:23576310

  3. Culture medium composition affects the gene expression pattern and in vitro development potential of bovine somatic cell nuclear transfer (SCNT) embryos.

    PubMed

    Arias, María E; Ross, Pablo J; Felmer, Ricardo N

    2013-01-01

    Different culture systems have been studied that support development of somatic cell nuclear transfer (SCNT) embryos up to the blastocyst stage. However, the use of sequential and two-step culture systems has been less studied. The objective of the present study was to examine the developmental potential and quality of bovine SCNT embryos cultured in different two-step culture media based on KSOM, SOF and the macromolecules FBS and BSA (K-K/FBS, K-S/BSA and K-K/BSA, respectively). No differences were observed in the cleavage rate for any of the culture systems. However, there was a significant difference (P<0.01) in the rate of blastocyst development, with the K-K/ FBS culture system yielding a higher rate of blastocysts (28%) compared to other treatments (18 and 15%, for K-S/BSA and K-K/BSA, respectively). Although quality of embryos, as assessed by the total number of cells, was not different, the apoptosis index was significantly affected in the sequential culture system (K-S/BSA). Gene expression analysis showed alterations of DNMT1, IGF2, LIF, and PRDX6 genes in embryos cultured in K-S/FBS and of SOD2 in embryos cultured in K-K/BSA. In conclusion, we demonstrated that culture medium may affect not only the developmental potential of SCNT embryos but also, more importantly, the gene expression pattern and apoptotic index, presenting the possibility to manipulate the culture medium composition to modulate global gene expression and improve the overall efficiency of this technique.

  4. A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

    PubMed

    Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

    2013-07-18

    Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

  5. Developmental Role and Auxin Responsiveness of Class III Homeodomain Leucine Zipper Gene Family Members in Rice1[C][W][OA

    PubMed Central

    Itoh, Jun-Ichi; Hibara, Ken-Ichiro; Sato, Yutaka; Nagato, Yasuo

    2008-01-01

    Members of the Class III homeodomain leucine zipper (Class III HD-Zip) gene family are central regulators of crucial aspects of plant development. To better understand the roles of five Class III HD-Zip genes in rice (Oryza sativa) development, we investigated their expression patterns, ectopic expression phenotypes, and auxin responsiveness. Four genes, OSHB1 to OSHB4, were expressed in a localized domain of the shoot apical meristem (SAM), the adaxial cells of leaf primordia, the leaf margins, and the xylem tissue of vascular bundles. In contrast, expression of OSHB5 was observed only in phloem tissue. Plants ectopically expressing microRNA166-resistant versions of the OSHB3 gene exhibited severe defects, including the ectopic production of leaf margins, shoots, and radialized leaves. The treatment of seedlings with auxin quickly induced ectopic OSHB3 expression in the entire region of the SAM, but not in other tissues. Furthermore, this ectopic expression of OSHB3 was correlated with leaf initiation defects. Our findings suggest that rice Class III HD-Zip genes have conserved functions with their homologs in Arabidopsis (Arabidopsis thaliana), but have also acquired specific developmental roles in grasses or monocots. In addition, some Class III HD-Zip genes may regulate the leaf initiation process in the SAM in an auxin-dependent manner. PMID:18567825

  6. Suppression of the endoplasmic reticulum calcium pump during zebrafish gastrulation affects left-right asymmetry of the heart and brain.

    PubMed

    Kreiling, Jill A; Balantac, Zaneta L; Crawford, Andrew R; Ren, Yuexin; Toure, Jamal; Zchut, Sigalit; Kochilas, Lazaros; Creton, Robbert

    2008-01-01

    Vertebrate embryos generate striking Ca(2+) patterns, which are unique regulators of dynamic developmental events. In the present study, we used zebrafish embryos as a model system to examine the developmental roles of Ca(2+) during gastrulation. We found that gastrula stage embryos maintain a distinct pattern of cytosolic Ca(2+) along the dorsal-ventral axis, with higher Ca(2+) concentrations in the ventral margin and lower Ca(2+) concentrations in the dorsal margin and dorsal forerunner cells. Suppression of the endoplasmic reticulum Ca(2+) pump with 0.5 microM thapsigargin elevates cytosolic Ca(2+) in all embryonic regions and induces a randomization of laterality in the heart and brain. Affected hearts, visualized in living embryos by a subtractive imaging technique, displayed either a reversal or loss of left-right asymmetry. Brain defects include a left-right reversal of pitx2 expression in the dorsal diencephalon and a left-right reversal of the prominent habenular nucleus in the brain. Embryos are sensitive to inhibition of the endoplasmic reticulum Ca(2+) pump during early and mid gastrulation and lose their sensitivity during late gastrulation and early segmentation. Suppression of the endoplasmic reticulum Ca(2+) pump during gastrulation inhibits expression of no tail (ntl) and left-right dynein related (lrdr) in the dorsal forerunner cells and affects development of Kupffer's vesicle, a ciliated organ that generates a counter-clockwise flow of fluid. Previous studies have shown that Ca(2+) plays a role in Kupffer's vesicle function, influencing ciliary motility and translating the vesicle's counter-clockwise flow into asymmetric patterns of gene expression. The present results suggest that Ca(2+) plays an additional role in the formation of Kupffer's vesicle.

  7. The vertebrate Hox gene regulatory network for hindbrain segmentation: Evolution and diversification: Coupling of a Hox gene regulatory network to hindbrain segmentation is an ancient trait originating at the base of vertebrates.

    PubMed

    Parker, Hugo J; Bronner, Marianne E; Krumlauf, Robb

    2016-06-01

    Hindbrain development is orchestrated by a vertebrate gene regulatory network that generates segmental patterning along the anterior-posterior axis via Hox genes. Here, we review analyses of vertebrate and invertebrate chordate models that inform upon the evolutionary origin and diversification of this network. Evidence from the sea lamprey reveals that the hindbrain regulatory network generates rhombomeric compartments with segmental Hox expression and an underlying Hox code. We infer that this basal feature was present in ancestral vertebrates and, as an evolutionarily constrained developmental state, is fundamentally important for patterning of the vertebrate hindbrain across diverse lineages. Despite the common ground plan, vertebrates exhibit neuroanatomical diversity in lineage-specific patterns, with different vertebrates revealing variations of Hox expression in the hindbrain that could underlie this diversification. Invertebrate chordates lack hindbrain segmentation but exhibit some conserved aspects of this network, with retinoic acid signaling playing a role in establishing nested domains of Hox expression. © 2016 WILEY Periodicals, Inc.

  8. Developmental biology of the innate immune response: implications for neonatal and infant vaccine development.

    PubMed

    Philbin, Victoria Jane; Levy, Ofer

    2009-05-01

    Molecular characterization of mechanisms by which human pattern recognition receptors (PRRs) detect danger signals has greatly expanded our understanding of the innate immune system. PRRs include Toll-like receptors, nucleotide oligomerization domain-like receptors, retinoic acid inducible gene-like receptors, and C-type lectin receptors. Characterization of the developmental expression of these systems in the fetus, newborn, and infant is incomplete but has yielded important insights into neonatal susceptibility to infection. Activation of PRRs on antigen-presenting cells enhances costimulatory function, and thus PRR agonists are potential vaccine adjuvants, some of which are already in clinical use. Thus, study of PRRs has also revealed how previously mysterious immunomodulators are able to mediate their actions, including the vaccine adjuvant aluminum hydroxide that activates a cytosolic protein complex known as the Nacht domain leucine-rich repeat and pyrin domain-containing protein 3 inflammasome leading to interleukin-1beta production. Progress in characterizing PRRs is thus informing and expanding the design of improved adjuvants. This review summarizes recent developments in the field of innate immunity emphasizing developmental expression in the fetus, newborn, and infant and its implications for the design of more effective neonatal and infant vaccines.

  9. Expression and evolution of Tiki1 and Tiki2 genes in vertebrates

    PubMed Central

    FEISTEL, KERSTIN; BRITO, JOSE M.; AMADO, NATHALIA G.; XU, CHIWEI; ABREU, JOSE G.; HE, XI

    2015-01-01

    Tiki1 is a Wnt protease and antagonist specifically expressed in the Spemann-Mangold Organizer and is required for head formation in Xenopus embryos. Here we report neighbor-joining phylogenetic analysis of vertebrate Tiki genes and their mRNA expression patterns in chick, mouse, and rabbit embryos. Tiki1 and Tiki2 orthologues are highly conserved, and exhibit similar but also different developmental expression patterns among the vertebrate/mammalian species analyzed. The Tiki1 gene is noticeably absent in the rodent lineage, but is present in lagomorphs and all other vertebrate/mammalian species examined. Expression in Hensen’s node, the equivalent of the Xenopus Organizer, was observed for Chick Tiki2 and Rabbit Tiki1 and Tiki2. Mouse Tiki2 was detected at low levels at gastrulation and head fold stages, but not in the node. Mouse Tiki2 and chick Tiki1 display similar expression in the dorsal spinal cord. Chick Tiki1 expression was also detected in the surface ectoderm and maxillary bud, while chick Tiki2 was found in the anterior intestinal portal, head mensenchyme and primitive atrium. Our expression analyses provide evidence that Tiki1 and Tiki2 are evolutionary conserved among vertebrate species and their expression in the Organizer and other regions suggests contributions of these Wnt inhibitors to embryonic patterning as well as organogenesis. Our analyses further reveal mis-regulation of TIKI1 and TIKI2 in human cancer and diseases. PMID:25354456

  10. Spatio-Temporal Accumulation and Activity of Calcium-Dependent Protein Kinases during Embryogenesis, Seed Development, and Germination in Sandalwood1

    PubMed Central

    Anil, Veena S.; Harmon, Alice C.; Rao, K. Sankara

    2000-01-01

    Western-blot analysis and protein kinase assays identified two Ca2+-dependent protein kinases (CDPKs) of 55 to 60 kD in soluble protein extracts of embryogenic cultures of sandalwood (Santalum album L.). However, these sandalwood CDPKs (swCDPKs) were absent in plantlets regenerated from somatic embryos. swCDPKs exhibited differential expression (monitored at the level of the protein) and activity in different developmental stages. Zygotic embryos, seedlings, and endosperm showed high accumulation of swCDPK, but the enzyme was not detected in the soluble proteins of shoots and flowers. swCDPK exhibited a temporal pattern of expression in endosperm, showing high accumulation and activity in mature fruit and germinating stages; the enzyme was localized strongly in the storage bodies of the endosperm cells. The study also reports for the first time to our knowledge a post-translational inhibition/inactivation of swCDPK in zygotic embryos during seed dormancy and early stages of germination. The temporal expression of swCDPK during somatic/zygotic embryogenesis, seed maturation, and germination suggests involvement of the enzyme in these developmental processes. PMID:10759499

  11. Spatio-temporal accumulation and activity of calcium-dependent protein kinases during embryogenesis, seed development, and germination in sandalwood.

    PubMed

    Anil, V S; Harmon, A C; Rao, K S

    2000-04-01

    Western-blot analysis and protein kinase assays identified two Ca(2+)-dependent protein kinases (CDPKs) of 55 to 60 kD in soluble protein extracts of embryogenic cultures of sandalwood (Santalum album L.). However, these sandalwood CDPKs (swCDPKs) were absent in plantlets regenerated from somatic embryos. swCDPKs exhibited differential expression (monitored at the level of the protein) and activity in different developmental stages. Zygotic embryos, seedlings, and endosperm showed high accumulation of swCDPK, but the enzyme was not detected in the soluble proteins of shoots and flowers. swCDPK exhibited a temporal pattern of expression in endosperm, showing high accumulation and activity in mature fruit and germinating stages; the enzyme was localized strongly in the storage bodies of the endosperm cells. The study also reports for the first time to our knowledge a post-translational inhibition/inactivation of swCDPK in zygotic embryos during seed dormancy and early stages of germination. The temporal expression of swCDPK during somatic/zygotic embryogenesis, seed maturation, and germination suggests involvement of the enzyme in these developmental processes.

  12. Differential Expression of Anthocyanin Biosynthetic Genes and Transcription Factor PcMYB10 in Pears (Pyrus communis L.)

    PubMed Central

    Li, Xi-Hong; Wu, Mao-Yu; Wang, Ai-Li; Jiang, Yu-Qian; Jiang, Yun-Hong

    2012-01-01

    Anthocyanin biosynthesis in various plants is affected by environmental conditions and controlled by the transcription level of the corresponding genes. In pears (Pyrus communis cv. ‘Wujiuxiang’), anthocyanin biosynthesis is significantly induced during low temperature storage compared with that at room temperature. We further examined the transcriptional levels of anthocyanin biosynthetic genes in ‘Wujiuxiang’ pears during developmental ripening and temperature-induced storage. The expression of genes that encode flavanone 3-hydroxylase, dihydroflavonol 4-reductase, anthocyanidin synthase, UDP-glucose: flavonoid 3-O-glucosyltransferase, and R2R3 MYB transcription factor (PcMYB10) was strongly positively correlated with anthocyanin accumulation in ‘Wujiuxiang’ pears in response to both developmental and cold-temperature induction. Hierarchical clustering analysis revealed the expression patterns of the set of target genes, of which PcMYB10 and most anthocyanin biosynthetic genes were related to the same cluster. The present work may help explore the molecular mechanism that regulates anthocyanin biosynthesis and its response to abiotic stress at the transcriptional level in plants. PMID:23029391

  13. Specification of posterior midbrain region in zebrafish neuroepithelium.

    PubMed

    Miyagawa, T; Amanuma, H; Kuroiwa, A; Takeda, H

    1996-04-01

    The developing vertebrate nervous system displays a pronounced anterior-posterior (A-P) pattern, but the mechanism that generates this pattern is poorly understood. We examined through cell-transplantation experiments, when and how the cells in the zebrafish posterior midbrain acquire regional specificity along the A-P axis as shown by pax[b] gene expression. Labelled donor cells from the presumptive midbrain region at various stages were transplanted into more anterior part of unlabelled host embryos of the same developmental stage, and the expression of pax[b] in the donor cells were examined by in situ hybridization. The results indicated that, in the cells from the presumptive midbrain region, expression of pax[b] was determined as early as the 55%-epiboly (6.5 h, early gastrulation) when the underlying hypoblastic layer reached the presumptive midbrain region. We also found that when transplanted heterotopically, anterior, but not posterior, hypoblast cells induced expression of pax[b] in the overlying ectoderm. Expression of a midbrain specific gene is determined during early gastrulation and the hypoblastic layer plays an important role in this determination process.

  14. Geometric Morphometrics on Gene Expression Patterns Within Phenotypes: A Case Example on Limb Development

    PubMed Central

    Martínez-Abadías, Neus; Mateu, Roger; Niksic, Martina; Russo, Lucia; Sharpe, James

    2016-01-01

    How the genotype translates into the phenotype through development is critical to fully understand the evolution of phenotypes. We propose a novel approach to directly assess how changes in gene expression patterns are associated with changes in morphology using the limb as a case example. Our method combines molecular biology techniques, such as whole-mount in situ hybridization, with image and shape analysis, extending the use of Geometric Morphometrics to the analysis of nonanatomical shapes, such as gene expression domains. Elliptical Fourier and Procrustes-based semilandmark analyses were used to analyze the variation and covariation patterns of the limb bud shape with the expression patterns of two relevant genes for limb morphogenesis, Hoxa11 and Hoxa13. We devised a multiple thresholding method to semiautomatically segment gene domains at several expression levels in large samples of limb buds from C57Bl6 mouse embryos between 10 and 12 postfertilization days. Besides providing an accurate phenotyping tool to quantify the spatiotemporal dynamics of gene expression patterns within developing structures, our morphometric analyses revealed high, non-random, and gene-specific variation undergoing canalization during limb development. Our results demonstrate that Hoxa11 and Hoxa13, despite being paralogs with analogous functions in limb patterning, show clearly distinct dynamic patterns, both in shape and size, and are associated differently with the limb bud shape. The correspondence between our results and already well-established molecular processes underlying limb development confirms that this morphometric approach is a powerful tool to extract features of development regulating morphogenesis. Such multilevel analyses are promising in systems where not so much molecular information is available and will advance our understanding of the genotype–phenotype map. In systematics, this knowledge will increase our ability to infer how evolution modified a common developmental pattern to generate a wide diversity of morphologies, as in the vertebrate limb. PMID:26377442

  15. Spatial and temporal expression of the Grainyhead-like transcription factor family during murine development.

    PubMed

    Auden, Alana; Caddy, Jacinta; Wilanowski, Tomasz; Ting, Stephen B; Cunningham, John M; Jane, Stephen M

    2006-10-01

    The Drosophila transcription factor Grainyhead (grh) is expressed in ectoderm-derived tissues where it regulates several key developmental events including cuticle formation, tracheal elongation and dorsal closure. Our laboratory has recently identified three novel mammalian homologues of the grh gene, Grainyhead-like 1, -2 and -3 (Grhl1-3) that rewrite the phylogeny of this family. Using gene targeting in mice, we have shown that Grhl3 is essential for neural tube closure, skin barrier formation and wound healing. Despite their extensive sequence homology, Grhl1 and Grhl2 are unable to compensate for loss of Grhl3 in these developmental processes. To explore this lack of redundancy, and to gain further insights into the functions of this gene family in mammalian development we have performed an extensive in situ hybridisation analysis. We demonstrate that, although all three Grhl genes are highly expressed in the developing epidermis, they display subtle differences in the timing and level of expression. Surprisingly, we also demonstrate differential expression patterns in non-ectoderm-derived tissues, including the heart, the lung, and the metanephric kidney. These findings expand our understanding of the unique role of Grhl3 in neurulation and epidermal morphogenesis, and provide a focus for further functional analysis of the Grhl genes during mouse embryogenesis.

  16. Evo-devo models of tooth development and the origin of hominoid molar diversity

    PubMed Central

    Bailey, Shara E.; Schwartz, Gary T.; Skinner, Matthew M.

    2018-01-01

    The detailed anatomical features that characterize fossil hominin molars figure prominently in the reconstruction of their taxonomy, phylogeny, and paleobiology. Despite the prominence of molar form in human origins research, the underlying developmental mechanisms generating the diversity of tooth crown features remain poorly understood. A model of tooth morphogenesis—the patterning cascade model (PCM)—provides a developmental framework to explore how and why the varying molar morphologies arose throughout human evolution. We generated virtual maps of the inner enamel epithelium—an indelibly preserved record of enamel knot arrangement—in 17 living and fossil hominoid species to investigate whether the PCM explains the expression of all major accessory cusps. We found that most of the variation and evolutionary changes in hominoid molar morphology followed the general developmental rule shared by all mammals, outlined by the PCM. Our results have implications for the accurate interpretation of molar crown configuration in hominoid systematics. PMID:29651459

  17. Pervasive Effects of Aging on Gene Expression in Wild Wolves.

    PubMed

    Charruau, Pauline; Johnston, Rachel A; Stahler, Daniel R; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W; vonHoldt, Bridgett M; Cole, Steven W; Tung, Jenny; Wayne, Robert K

    2016-08-01

    Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species' high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. A Single-Wing Removal Method to Assess Correspondence Between Gene Expression and Phenotype in Butterflies: The Case of Distal-less.

    PubMed

    Adhikari, Kiran; Otaki, Joji M

    2016-02-01

    It is often desirable but difficult to retrieve information on the mature phenotype of an immature tissue sample that has been subjected to gene expression analysis. This problem cannot be ignored when individual variation within a species is large. To circumvent this problem in the butterfly wing system, we developed a new surgical method for removing a single forewing from a pupa using Junonia orithya; the operated pupa was left to develop to an adult without eclosion. The removed right forewing was subjected to gene expression analysis, whereas the non-removed left forewing was examined for color patterns. As a test case, we focused on Distal-less (Dll), which likely plays an active role in inducing elemental patterns, including eyespots. The Dll expression level in forewings was paired with eyespot size data from the same individual. One third of the operated pupae survived and developed wing color patterns. Dll expression levels were significantly higher in males than in females, although male eyespots were smaller in size than female eyespots. Eyespot size data showed weak but significant correlations with the Dll expression level in females. These results demonstrate that a single-wing removal method was successfully applied to the butterfly wing system and suggest the weak and non-exclusive contribution of Dll to eyespot size determination in this butterfly. Our novel methodology for establishing correspondence between gene expression and phenotype can be applied to other candidate genes for color pattern development in butterflies. Conceptually similar methods may also be applicable in other developmental systems.

  19. Analysis of expression patterns of IGF-1, caspase-3 and HSP-70 in developing human tooth germs.

    PubMed

    Kero, Darko; Kalibovic Govorko, Danijela; Medvedec Mikic, Ivana; Vukojevic, Katarina; Cigic, Livia; Saraga-Babic, Mirna

    2015-10-01

    To analyze expression patterns of IGF-1, caspase-3 and HSP-70 in human incisor and canine tooth germs during the late bud, cap and bell stages of odontogenesis. Head areas or parts of jaw containing teeth from 10 human fetuses aged between 9th and 20th developmental weeks were immunohistochemically analyzed using IGF-1, active caspase-3 and HSP-70 markers. Semi-quantitative analysis of each marker's expression pattern was also performed. During the analyzed period, IGF-1 and HSP-70 were mostly expressed in enamel organ. As development progressed, expression of IGF-1 and HSP-70 became more confined to differentiating tissues in the future cusp tip area, as well as in highly proliferating cervical loops. Few apoptotic bodies highly positive to active caspase-3 were observed in enamel organ and dental papilla from the cap stage onward. However, both enamel epithelia moderately expressed active caspase-3 throughout the investigated period. Expression patterns of IGF-1, active caspase-3 and HSP-70 imply importance of these factors for early human tooth development. IGF-1 and HSP-70 have versatile functions in control of proliferation, differentiation and anti-apoptotic protection of epithelial parts of human enamel organ. Active caspase-3 is partially involved in formation and apoptotic removal of primary enamel knot, although present findings might reflect its ability to perform other non-death functions such as differentiation of hard dental tissues secreting cells and guidance of ingrowth of proliferating cervical loops. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    PubMed

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  1. Patterning of leaf vein networks by convergent auxin transport pathways.

    PubMed

    Sawchuk, Megan G; Edgar, Alexander; Scarpella, Enrico

    2013-01-01

    The formation of leaf vein patterns has fascinated biologists for centuries. Transport of the plant signal auxin has long been implicated in vein patterning, but molecular details have remained unclear. Varied evidence suggests a central role for the plasma-membrane (PM)-localized PIN-FORMED1 (PIN1) intercellular auxin transporter of Arabidopsis thaliana in auxin-transport-dependent vein patterning. However, in contrast to the severe vein-pattern defects induced by auxin transport inhibitors, pin1 mutant leaves have only mild vein-pattern defects. These defects have been interpreted as evidence of redundancy between PIN1 and the other four PM-localized PIN proteins in vein patterning, redundancy that underlies many developmental processes. By contrast, we show here that vein patterning in the Arabidopsis leaf is controlled by two distinct and convergent auxin-transport pathways: intercellular auxin transport mediated by PM-localized PIN1 and intracellular auxin transport mediated by the evolutionarily older, endoplasmic-reticulum-localized PIN6, PIN8, and PIN5. PIN6 and PIN8 are expressed, as PIN1 and PIN5, at sites of vein formation. pin6 synthetically enhances pin1 vein-pattern defects, and pin8 quantitatively enhances pin1pin6 vein-pattern defects. Function of PIN6 is necessary, redundantly with that of PIN8, and sufficient to control auxin response levels, PIN1 expression, and vein network formation; and the vein pattern defects induced by ectopic PIN6 expression are mimicked by ectopic PIN8 expression. Finally, vein patterning functions of PIN6 and PIN8 are antagonized by PIN5 function. Our data define a new level of control of vein patterning, one with repercussions on other patterning processes in the plant, and suggest a mechanism to select cell files specialized for vascular function that predates evolution of PM-localized PIN proteins.

  2. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    PubMed

    Cheniany, Monireh; Ganjeali, Ali

    2016-12-01

    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  3. Separable roles of UFO during floral development revealed by conditional restoration of gene function.

    PubMed

    Laufs, Patrick; Coen, Enrico; Kronenberger, Jocelyne; Traas, Jan; Doonan, John

    2003-02-01

    The UNUSUAL FLORAL ORGANS (UFO) gene is required for several aspects of floral development in Arabidopsis including specification of organ identity in the second and third whorls and the proper pattern of primordium initiation in the inner three whorls. UFO is expressed in a dynamic pattern during the early phases of flower development. Here we dissect the role of UFO by ubiquitously expressing it in ufo loss-of-function flowers at different developmental stages and for various durations using an ethanol-inducible expression system. The previously known functions of UFO could be separated and related to its expression at specific stages of development. We show that a 24- to 48-hour period of UFO expression from floral stage 2, before any floral organs are visible, is sufficient to restore normal petal and stamen development. The earliest requirement for UFO is during stage 2, when the endogenous UFO gene is transiently expressed in the centre of the wild-type flower and is required to specify the initiation patterns of petal, stamen and carpel primordia. Petal and stamen identity is determined during stages 2 or 3, when UFO is normally expressed in the presumptive second and third whorl. Although endogenous UFO expression is absent from the stamen whorl from stage 4 onwards, stamen identity can be restored by UFO activation up to stage 6. We also observed floral phenotypes not observed in loss-of-function or constitutive gain-of-function backgrounds, revealing additional roles of UFO in outgrowth of petal primordia.

  4. Cadmium affects muscle type development and axon growth in zebrafish embryonic somitogenesis.

    PubMed

    Hen Chow, Elly Suk; Cheng, Shuk Han

    2003-05-01

    We have previously reported that exposure to cadmium during zebrafish embryonic development caused morphological malformations of organs and ectopic expression of genes involved in regulating developmental process. One of the most common developmental defects observed was altered axial curvature resulting from defects in the myotomes of the somites. In this study, we investigated the mechanisms of cadmium-induced toxicity in zebrafish somitogenesis. We showed that the critical period of exposure was the gastrulation period, which actually preceded the formation of the first morphologically distinct somites. The somites thus formed lost the typical chevron V-shape and are packed disorderly. The myogenic lineage commitment of the axial mesodermal cells was not affected, as the myogenic regulatory transcription factors were expressed normally. There were, however, losses of fast and slow muscle fibers in the myotomes. The innervation of the muscle blocks by spinal motoneurons is an important process of the somitogenesis. Both primary and secondary motoneurons appear to form normally while the axon growth is affected in cadmium-treated embryos. The notochord, which is essential in the patterning of the somites and the central nervous system, showed abnormal morphological features and failed to extend to the tail region. Taken together, it appears that cadmium exposure led to abnormal somite patterning of the muscle fibers and defects in axonogenesis.

  5. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization.

    PubMed

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu; Xin, Mingming

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid ( Aegilops spp), tetraploid, and hexaploid wheat ( Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. © 2018 American Society of Plant Biologists. All rights reserved.

  6. Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

    PubMed Central

    Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

    2014-01-01

    Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

  7. X chromosome regulation: diverse patterns in development, tissues and disease

    PubMed Central

    Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.

    2014-01-01

    Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023

  8. An RNA-Seq based gene expression atlas of the common bean.

    PubMed

    O'Rourke, Jamie A; Iniguez, Luis P; Fu, Fengli; Bucciarelli, Bruna; Miller, Susan S; Jackson, Scott A; McClean, Philip E; Li, Jun; Dai, Xinbin; Zhao, Patrick X; Hernandez, Georgina; Vance, Carroll P

    2014-10-06

    Common bean (Phaseolus vulgaris) is grown throughout the world and comprises roughly 50% of the grain legumes consumed worldwide. Despite this, genetic resources for common beans have been lacking. Next generation sequencing, has facilitated our investigation of the gene expression profiles associated with biologically important traits in common bean. An increased understanding of gene expression in common bean will improve our understanding of gene expression patterns in other legume species. Combining recently developed genomic resources for Phaseolus vulgaris, including predicted gene calls, with RNA-Seq technology, we measured the gene expression patterns from 24 samples collected from seven tissues at developmentally important stages and from three nitrogen treatments. Gene expression patterns throughout the plant were analyzed to better understand changes due to nodulation, seed development, and nitrogen utilization. We have identified 11,010 genes differentially expressed with a fold change ≥ 2 and a P-value < 0.05 between different tissues at the same time point, 15,752 genes differentially expressed within a tissue due to changes in development, and 2,315 genes expressed only in a single tissue. These analyses identified 2,970 genes with expression patterns that appear to be directly dependent on the source of available nitrogen. Finally, we have assembled this data in a publicly available database, The Phaseolus vulgaris Gene Expression Atlas (Pv GEA), http://plantgrn.noble.org/PvGEA/ . Using the website, researchers can query gene expression profiles of their gene of interest, search for genes expressed in different tissues, or download the dataset in a tabular form. These data provide the basis for a gene expression atlas, which will facilitate functional genomic studies in common bean. Analysis of this dataset has identified genes important in regulating seed composition and has increased our understanding of nodulation and impact of the nitrogen source on assimilation and distribution throughout the plant.

  9. Buffalo embryos produced by handmade cloning from oocytes selected using brilliant cresyl blue staining have better developmental competence and quality and are closer to embryos produced by in vitro fertilization in terms of their epigenetic status and gene expression pattern.

    PubMed

    Mohapatra, Sushil K; Sandhu, Anjit; Neerukattu, Venkata S; Singh, Karn P; Selokar, Naresh L; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat

    2015-04-01

    We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB-). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB- oocytes (43.41 ± 2.54 vs. 22.74 ± 1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB- blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB- blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB- blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB- blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC.

  10. Buffalo Embryos Produced by Handmade Cloning from Oocytes Selected Using Brilliant Cresyl Blue Staining Have Better Developmental Competence and Quality and Are Closer to Embryos Produced by In Vitro Fertilization in Terms of Their Epigenetic Status and Gene Expression Pattern

    PubMed Central

    Mohapatra, Sushil K.; Sandhu, Anjit; Neerukattu, Venkata S.; Singh, Karn P.; Selokar, Naresh L.; Singla, Suresh K.; Chauhan, Manmohan S.; Manik, Radhey S.

    2015-01-01

    Abstract We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB−). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB− oocytes (43.41±2.54 vs. 22.74±1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB− blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB− blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB− blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB− blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC. PMID:25826727

  11. Transcriptome analysis of starch and sucrose metabolism across bulb development in Sagittaria sagittifolia.

    PubMed

    Gao, Meiping; Zhang, Shangwen; Luo, Cong; He, Xinhua; Wei, Shaolong; Jiang, Wen; He, Fanglian; Lin, Zhicheng; Yan, Meixin; Dong, Weiqong

    2018-04-05

    Sagittaria sagittifolia L is an important bulb vegetable that has high nutritional and medical value. Bulb formation and development are crucial to Sagittaria sagittifolia; however, its sucrose metabolism is poorly understood and there are a lack of sufficient transcriptomic and genomic data available to fully understand the molecular mechanisms underlying bulb formation and development as well as the bulb transcriptome. Five cDNA libraries were constructed at different developmental stages and sequenced using high-throughput Illumina RNA sequencing. From approximately 63.53 Gb clean reads, a total of 60,884 unigenes, with an average length of 897.34 bp and N50 of 1.368 kb, were obtained. A total of 36,590 unigenes were successfully annotated using five public databases. Across different developmental stages, 4195, 827, 832, 851, and 1494 were differentially expressed in T02, T03, T04, T05, and T06 libraries, respectively. Gene ontology (GO) analysis revealed several differentially-expressed genes (DEGs) associated with catalytic activity, binding, and transporter activity. The Kyoto encyclopedia of genes and genomes (KEGG) revealed that these DEGs are involved in physiological and biochemical processes. RT-qPCR was used to profile the expression of these unigenes and revealed that the expression patterns of the DEGs were consistent with the transcriptome data. In this study, we conducted a comparative gene expression analysis at the transcriptional level using RNA-seq across the different developmental stages of Sagittaria sagittifolia. We identified a set of genes that might contribute to starch and sucrose metabolism, and the genetic mechanisms related to bulblet development were also explored. This study provides important data for future studies of the genetic and molecular mechanisms underlying bulb formation and development in Sagittaria sagittifolia. Copyright © 2018. Published by Elsevier B.V.

  12. Patterns of gender development.

    PubMed

    Martin, Carol Lynn; Ruble, Diane N

    2010-01-01

    A comprehensive theory of gender development must describe and explain long-term developmental patterning and changes and how gender is experienced in the short term. This review considers multiple views on gender patterning, illustrated with contemporary research. First, because developmental research involves understanding normative patterns of change with age, several theoretically important topics illustrate gender development: how children come to recognize gender distinctions and understand stereotypes, and the emergence of prejudice and sexism. Second, developmental researchers study the stability of individual differences over time, which elucidates developmental processes. We review stability in two domains-sex segregation and activities/interests. Finally, a new approach advances understanding of developmental patterns, based on dynamic systems theory. Dynamic systems theory is a metatheoretical framework for studying stability and change, which developed from the study of complex and nonlinear systems in physics and mathematics. Some major features and examples show how dynamic approaches have been and could be applied in studying gender development.

  13. Patterns of Gender Development

    PubMed Central

    Martin, Carol Lynn; Ruble, Diane N.

    2013-01-01

    A comprehensive theory of gender development must describe and explain long-term developmental patterning and changes and how gender is experienced in the short term. This review considers multiple views on gender patterning, illustrated with contemporary research. First, because developmental research involves understanding normative patterns of change with age, several theoretically important topics illustrate gender development: how children come to recognize gender distinctions and understand stereotypes, and the emergence of prejudice and sexism. Second, developmental researchers study the stability of individual differences over time, which elucidates developmental processes. We review stability in two domains—sex segregation and activities/interests. Finally, a new approach advances understanding of developmental patterns, based on dynamic systems theory. Dynamic systems theory is a metatheoretical framework for studying stability and change, which developed from the study of complex and nonlinear systems in physics and mathematics. Some major features and examples show how dynamic approaches have been and could be applied in studying gender development. PMID:19575615

  14. Developmental Considerations of Sperm Protein 17 Gene Expression in Rheumatoid Arthritis Synoviocytes

    PubMed Central

    Takeoka, Yuichi; Kenny, Thomas P.; Yago, Hisashi; Naiki, Mitsuru; Gershwin, M. Eric; Robbins, Dick L.

    2002-01-01

    Rheumatoid arthritis (RA) is an autoimmune disease characterized by proliferative synovial tissue. We used mRNA differential display and library subtraction to compare mRNA expression in RA and osteoarthritis (OA) synoviocytes. We initially compared the mRNA expression patterns in 1 female RA and 1 OA synovia and found a differentially expressed 350 bp transcript in the RA synoviocytes which was, by sequence analysis, 100% homologous to sperm protein 17 (Sp17). Moreover, the Sp17 transcript was found differentially expressed in a RA synovial library that was subtracted with an OA synovial library. Using specific primers for full length Sp17, a 1.1 kb transcript was amplified from the synoviocytes of 7 additional female RA patients, sequenced and found to 100% homologous to Sp17. Thus, we found the unexpected expression of Sp17, a thought to be gamete-specific protein, in the synoviocytes of 8/8 female RA patients in contrast to control OA synoviocytes. Interestingly, Sp17's structural relationship with cell-binding and recognition proteins, suggests that Sp17 may function in cell-cell recognition and signaling in the RA synoviocyte. Further, Sp17 could have a significant regulatory role in RA synoviocyte gene transcription and/or signal transduction. Thus, Sp17 could have an important role in RA synoviocyte proliferation or defective apoptosis. Finally, the presence of Sp17 in synoviocytes has interesting developmental considerations. PMID:12739786

  15. Expression of GFP under the control of the RNA helicase VASA permits fluorescence-activated cell sorting isolation of human primordial germ cells.

    PubMed

    Tilgner, Katarzyna; Atkinson, Stuart P; Yung, Sun; Golebiewska, Anna; Stojkovic, Miodrag; Moreno, Ruben; Lako, Majlinda; Armstrong, Lyle

    2010-01-01

    The isolation of significant numbers of human primordial germ cells at several developmental stages is important for investigations of the mechanisms by which they are able to undergo epigenetic reprogramming. Only small numbers of these cells can be obtained from embryos of appropriate developmental stages, so the differentiation of human embryonic stem cells is essential to obtain sufficient numbers of primordial germ cells to permit epigenetic examination. Despite progress in the enrichment of human primordial germ cells using fluorescence-activated cell sorting (FACS), there is still no definitive marker of the germ cell phenotype. Expression of the widely conserved RNA helicase VASA is restricted to germline cells, but in contrast to species such as Mus musculus in which reporter constructs expressing green fluorescent protein (GFP) under the control of a Vasa promoter have been developed, such reporter systems are lacking in human in vitro models. We report here the generation and characterization of human embryonic stem cell lines stably carrying a VASA-pEGFP-1 reporter construct that expresses GFP in a population of differentiating human embryonic stem cells that show expression of characteristic markers of primordial germ cells. This population shows a different pattern of chromatin modifications to those obtained by FACS enrichment of Stage Specific Antigen one expressing cells in our previous publication.

  16. Expression pattern of the thrombopoietin receptor (Mpl) in the murine central nervous system.

    PubMed

    Ivanova, Anna; Wuerfel, Jens; Zhang, Juan; Hoffmann, Olaf; Ballmaier, Matthias; Dame, Christof

    2010-07-28

    Thrombopoietin (Thpo) and its receptor (Mpl), which regulate megakaryopoiesis, are expressed in the central nervous system (CNS), where Thpo is thought to exert pro-apoptotic effects on newly generated neurons. Mpl expression has been analysed in brain tissue on transcript level and in cultured primary rat neurons and astrocytes on protein level. Herein, we analysed Mpl expression in the developing and adult murine CNS by immunohistochemistry and investigated the brain of mice with homozygous Mpl deficiency (Mpl-/-) by MRI. Mpl was not detectable at developmental stages E12 to E15 in any resident cells of the CNS. From E18 onwards, robust Mpl expression was found in various brain areas, including cerebral cortex, olfactory bulb, thalamus, hypothalamus, medulla, pons, and the grey matter of spinal cord. However, major developmental changes became obvious: In the subventricular zone of the cerebral cortex Mpl expression occurred only during late gestation, while in the hippocampus Mpl expression was detectable for first time at stage P4. In the white matter of the cerebellum Mpl expression was restricted to the perinatal period. In the adult cerebellum, Mpl expression switched to Purkinje cell. The majority of other Mpl-positive cells were NeuN-positive neurons. None of the cells could be double-labelled with astrocyte marker GFAP. Mpl-/- mice showed no gross abnormalities of the brain. Our data locate Mpl expression to neurons at different subdivisions of the spinal cord, rhombencephalon, midbrain and prosencephalon. Besides neuronal cells Mpl protein is also expressed in Purkinje cells of the adult cerebellum.

  17. Patterns of threshold evolution in polyphenic insects under different developmental models.

    PubMed

    Tomkins, Joseph L; Moczek, Armin P

    2009-02-01

    Two hypotheses address the evolution of polyphenic traits in insects. Under the developmental reprogramming model, individuals exceeding a threshold follow a different developmental pathway from individuals below the threshold. This decoupling is thought to free selection to independently hone alternative morphologies, increasing phenotypic plasticity and morphological diversity. Under the alternative model, extreme positive allometry explains the existence of alternative phenotypes and divergent phenotypes are developmentally coupled by a continuous reaction norm, such that selection on either morph acts on both. We test the hypothesis that continuous reaction norm polyphenisms, evolve through changes in the allometric parameters of even the smallest males with minimal trait expression, whereas threshold polyphenisms evolve independent of the allometric parameters of individuals below the threshold. We compare two polyphenic species; the dung beetle Onthophagus taurus, whose allometry has been modeled both as a threshold polyphenism and a continuous reaction norm and the earwig Forficula auricularia, whose allometry is best modeled with a discontinuous threshold. We find that across populations of both species, variation in forceps or horn allometry in minor males are correlated to the population's threshold. These findings suggest that regardless of developmental mode, alternative morphs do not evolve independently of one another.

  18. Heterogeneous conservation of Dlx paralog co-expression in jawed vertebrates.

    PubMed

    Debiais-Thibaud, Mélanie; Metcalfe, Cushla J; Pollack, Jacob; Germon, Isabelle; Ekker, Marc; Depew, Michael; Laurenti, Patrick; Borday-Birraux, Véronique; Casane, Didier

    2013-01-01

    The Dlx gene family encodes transcription factors involved in the development of a wide variety of morphological innovations that first evolved at the origins of vertebrates or of the jawed vertebrates. This gene family expanded with the two rounds of genome duplications that occurred before jawed vertebrates diversified. It includes at least three bigene pairs sharing conserved regulatory sequences in tetrapods and teleost fish, but has been only partially characterized in chondrichthyans, the third major group of jawed vertebrates. Here we take advantage of developmental and molecular tools applied to the shark Scyliorhinus canicula to fill in the gap and provide an overview of the evolution of the Dlx family in the jawed vertebrates. These results are analyzed in the theoretical framework of the DDC (Duplication-Degeneration-Complementation) model. The genomic organisation of the catshark Dlx genes is similar to that previously described for tetrapods. Conserved non-coding elements identified in bony fish were also identified in catshark Dlx clusters and showed regulatory activity in transgenic zebrafish. Gene expression patterns in the catshark showed that there are some expression sites with high conservation of the expressed paralog(s) and other expression sites with events of paralog sub-functionalization during jawed vertebrate diversification, resulting in a wide variety of evolutionary scenarios within this gene family. Dlx gene expression patterns in the catshark show that there has been little neo-functionalization in Dlx genes over gnathostome evolution. In most cases, one tandem duplication and two rounds of vertebrate genome duplication have led to at least six Dlx coding sequences with redundant expression patterns followed by some instances of paralog sub-functionalization. Regulatory constraints such as shared enhancers, and functional constraints including gene pleiotropy, may have contributed to the evolutionary inertia leading to high redundancy between gene expression patterns.

  19. The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity.

    PubMed

    Caddell, Daniel F; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C

    2015-05-05

    Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21 , recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas , and confers robust resistance to X. oryzae pv. oryzae ( Xoo ). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21 . Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.

  20. Aniline exposure associated with up-regulated transcriptional responses of three glutathione S-transferase Delta genes in Drosophila melanogaster.

    PubMed

    Chan, Wen-Chiao; Chien, Yi-Chih; Chien, Cheng-I

    2015-03-01

    Complex transcriptional profile of glutathione S-transferase Delta cluster genes occurred in the developmental process of the fruit fly Drosophila melanogaster. The purpose of this project was to quantify the expression levels of Gst Delta class genes altered by aniline exposure and to understand the relationship between aniline dosages and the variation of Gst Delta genes expressed in D. melanogaster. Using RT-PCR expression assays, the expression patterns of the transcript mRNAs of the glutathione S-transferase Delta genes were revealed and their expression levels were measured at eggs, larvae, pupae and adults. The adult stage was selected for further dose-response assays. After analysis, the results indicated that three Gst Delta genes (Gst D2, Gst D5 and Gst D6) were found to show a peak of up-regulated transcriptional response at 6-8h of exposure of aniline. Furthermore, the dose-response relationship of their induction levels within the dose regiments (from 1.2 to 2.0 μl/tube) had been measured. The expression patterns and annotations of these genes were discussed in the context. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity

    PubMed Central

    Caddell, Daniel F.; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C.

    2016-01-01

    Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression. PMID:27525297

  2. Developmental expression of Drosophila Wiskott-Aldrich Syndrome family proteins

    PubMed Central

    Rodriguez-Mesa, Evelyn; Abreu-Blanco, Maria Teresa; Rosales-Nieves, Alicia E.; Parkhurst, Susan M.

    2012-01-01

    Background Wiskott-Aldrich Syndrome (WASP) family proteins participate in many cellular processes involving rearrangements of the actin cytoskeleton. To the date, four WASP subfamily members have been described in Drosophila: Wash, WASp, SCAR, and Whamy. Wash, WASp, and SCAR are essential during early Drosophila development where they function in orchestrating cytoplasmic events including membrane-cytoskeleton interactions. A mutant for Whamy has not yet been reported. Results We generated monoclonal antibodies that are specific to Drosophila Wash, WASp, SCAR, and Whamy, and use these to describe their spatial and temporal localization patterns. Consistent with the importance of WASP family proteins in flies, we find that Wash, WASp, SCAR, and Whamy are dynamically expressed throughout oogenesis and embryogenesis. For example, we find that Wash accumulates at the oocyte cortex. WASp is highly expressed in the PNS, while SCAR is the most abundantly expressed in the CNS. Whamy exhibits an asymmetric subcellular localization that overlaps with mitochondria and is highly expressed in muscle. Conclusion All four WASP family members show specific expression patterns, some of which reflect their previously known roles and others revealing new potential functions. The monoclonal antibodies developed offer valuable new tools to investigate how WASP family proteins regulate actin cytoskeleton dynamics. PMID:22275148

  3. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    PubMed

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  4. Distinct Cell-Specific Expression of Homospermidine Synthase Involved in Pyrrolizidine Alkaloid Biosynthesis in Three Species of the Boraginales1[C][W][OA

    PubMed Central

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-01-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491

  5. On the evolution of developmental mechanisms: Divergent polarities in leaf growth as a case study.

    PubMed

    Gupta, Mainak Das; Nath, Utpal

    2016-01-01

    Most model plants used to study leaf growth share a common developmental mechanism, namely basipetal growth polarity, wherein the distal end differentiates first with progressively more proliferative cells toward the base. Therefore, this base-to-tip growth pattern has served as a paradigm to explain leaf growth and also formed the basis for several computational models. However, our recent report in The Plant Cell on the investigation of leaf growth in 75 eudicot species covering a wide range of eudicot families showed that leaves grow with divergent polarities in the proximo-distal axis or without any obvious polarity. This divergence in growth polarity is linked to the expression divergence of a conserved microRNA-transcription factor module. This study raises several questions on the evolutionary origin of leaf growth pattern, such as 'when and why in evolution did the divergent growth polarities arise?' and 'what were the molecular changes that led to this divergence?'. Here, we discuss a few of these questions in some detail.

  6. DEVELOPMENTAL DIVERSITY OF AMPHIBIANS

    PubMed Central

    Elinson, Richard P.; del Pino, Eugenia M.

    2011-01-01

    The current model amphibian, Xenopus laevis, develops rapidly in water to a tadpole which metamorphoses into a frog. Many amphibians deviate from the X. laevis developmental pattern. Among other adaptations, their embryos develop in foam nests on land or in pouches on their mother’s back or on a leaf guarded by a parent. The diversity of developmental patterns includes multinucleated oogenesis, lack of RNA localization, huge non-pigmented eggs, and asynchronous, irregular early cleavages. Variations in patterns of gastrulation highlight the modularity of this critical developmental period. Many species have eliminated the larva or tadpole and directly develop to the adult. The wealth of developmental diversity among amphibians coupled with the wealth of mechanistic information from X. laevis permit comparisons that provide deeper insights into developmental processes. PMID:22662314

  7. Molecular anatomy of the developing limb in the coquí frog, Eleutherodactylus coqui.

    PubMed

    Gross, Joshua B; Kerney, Ryan; Hanken, James; Tabin, Clifford J

    2011-01-01

    The vertebrate limb demonstrates remarkable similarity in basic organization across phylogenetically disparate groups. To gain further insight into how this morphological similarity is maintained in different developmental contexts, we explored the molecular anatomy of size-reduced embryos of the Puerto Rican coquí frog, Eleutherodactylus coqui. This animal demonstrates direct development, a life-history strategy marked by rapid progression from egg to adult and absence of a free-living, aquatic larva. Nonetheless, coquí exhibits a basal anuran limb structure, with four toes on the forelimb and five toes on the hind limb. We investigated the extent to which coquí limb bud development conforms to the model of limb development derived from amniote studies. Toward this end, we characterized dynamic patterns of expression for 13 critical patterning genes across three principle stages of limb development. As expected, most genes demonstrate expression patterns that are essentially unchanged compared to amniote species. For example, we identified an EcFgf8-expression domain within the apical ectodermal ridge (AER). This expression pattern defines a putatively functional AER signaling domain, despite the absence of a morphological ridge in coquí embryos. However, two genes, EcMeis2 and EcAlx4, demonstrate altered domains of expression, which imply a potential shift in gene function between coquí frogs and amniote model systems. Unexpectedly, several genes thought to be critical for limb patterning in other systems, including EcFgf4, EcWnt3a, EcWnt7a, and EcGremlin, demonstrated no evident expression pattern in the limb at the three stages we analyzed. The absence of EcFgf4 and EcWnt3a expression during limb patterning is perhaps not surprising, given that neither gene is critical for proper limb development in the mouse, based on knockout and expression analyses. In contrast, absence of EcWnt7a and EcGremlin is surprising, given that expression of these molecules appears to be absolutely essential in all other model systems so far examined. Although this analysis substantiates the existence of a core set of ancient limb-patterning molecules, which likely mediate identical functions across highly diverse vertebrate forms, it also reveals remarkable evolutionary flexibility in the genetic control of a conserved morphological pattern across evolutionary time. © 2011 Wiley Periodicals, Inc.

  8. RNA-sequencing of the sturgeon Acipenser baeri provides insights into expression dynamics of morphogenic differentiation and developmental regulatory genes in early versus late developmental stages.

    PubMed

    Song, Wei; Jiang, Keji; Zhang, Fengying; Lin, Yu; Ma, Lingbo

    2016-08-08

    Acipenser baeri, one of the critically endangered animals on the verge of extinction, is a key species for evolutionary, developmental, physiology and conservation studies and a standout amongst the most important food products worldwide. Though the transcriptome of the early development of A. baeri has been published recently, the transcriptome changes occurring in the transition from embryonic to late stages are still unknown. The aim of this work was to analyze the transcriptomes of embryonic and post-embryonic stages of A. baeri and identify differentially expressed genes (DEGs) and their expression patterns using mRNA collected from specimens at big yolk plug, wide neural plate and 64 day old sturgeon developmental stages for RNA-Seq. The paired-end sequencing of the transcriptome of samples of A. baeri collected at two early (big yolk plug (T1, 32 h after fertilization) and wide neural plate formation (T2, 45 h after fertilization)) and one late (T22, 64 day old sturgeon) developmental stages using Illumina Hiseq2000 platform generated 64039846, 64635214 and 75293762 clean paired-end reads for T1, T2 and T22, respectively. After quality control, the sequencing reads were de novo assembled to generate a set of 149,265 unigenes with N50 value of 1277 bp. Functional annotation indicated that a substantial number of these unigenes had significant similarity with proteins in public databases. Differential expression profiling allowed the identification of 2789, 12,819 and 10,824 DEGs from the respective T1 vs. T2, T1 vs. T22 and T2 vs. T22 comparisons. High correlation of DEGs' features was recorded among early stages while significant divergences were observed when comparing the late stage with early stages. GO and KEGG enrichment analyses revealed the biological processes, cellular component, molecular functions and metabolic pathways associated with identified DEGs. The qRT-PCR performed for candidate genes in specimens confirmed the validity of the RNA-seq data. This study presents, for the first time, an extensive overview of RNA-Seq based characterization of the early and post-embryonic developmental transcriptomes of A. baeri and provided 149,265 gene sequences that will be potentially valuable for future molecular and genetic studies in A. baeri.

  9. Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

    PubMed

    Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

    2014-01-01

    Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

  10. Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

    PubMed Central

    Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

    2014-01-01

    Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

  11. The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning.

    PubMed

    Jung, Jae-Hoon; Lee, Sangmin; Yun, Ju; Lee, Minyoung; Park, Chung-Mo

    2014-02-01

    microRNA172 (miR172) regulates phase transition and floral patterning in Arabidopsis by repressing targets that encode the APETALA2 (AP2) and AP2-like transcription factors. The miR172-mediated repression of the AP2 gene restricts AGAMOUS (AG) expression. In addition, most miR172 targets, including AP2, redundantly act as floral repressors, and the overexpression of the target genes causes delayed flowering. However, how miR172 targets other than AP2 regulate both of the developmental processes remains unclear. Here, we demonstrate that miR172-mediated repression of the TARGET OF EAT 3 (TOE3) gene is critical for floral patterning in Arabidopsis. Transgenic plants that overexpress a miR172-resistant TOE3 gene (rTOE3-ox) exhibit indeterminate flowers with numerous stamens and carpelloid organs, which is consistent with previous observations in transgenic plants that overexpress a miR172-resistant AP2 gene. TOE3 binds to the second intron of the AG gene. Accordingly, AG expression is significantly reduced in rTOE3-ox plants. TOE3 also interacts with AP2 in the nucleus. Given the major role of AP2 in floral patterning, miR172 likely regulates TOE3 in floral patterning, at least in part via AP2. In addition, a miR156 target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 directly activates TOE3 expression, revealing a novel signaling interaction between miR156 and miR172 in floral patterning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Neurally Derived Tissues in Xenopus laevis Embryos Exhibit a Consistent Bioelectrical Left-Right Asymmetry

    PubMed Central

    Pai, Vaibhav P.; Vandenberg, Laura N.; Blackiston, Douglas; Levin, Michael

    2012-01-01

    Consistent left-right asymmetry in organ morphogenesis is a fascinating aspect of bilaterian development. Although embryonic patterning of asymmetric viscera, heart, and brain is beginning to be understood, less is known about possible subtle asymmetries present in anatomically identical paired structures. We investigated two important developmental events: physiological controls of eye development and specification of neural crest derivatives, in Xenopus laevis embryos. We found that the striking hyperpolarization of transmembrane potential (V mem) demarcating eye induction usually occurs in the right eye field first. This asymmetry is randomized by perturbing visceral left-right patterning, suggesting that eye asymmetry is linked to mechanisms establishing primary laterality. Bilateral misexpression of a depolarizing channel mRNA affects primarily the right eye, revealing an additional functional asymmetry in the control of eye patterning by V mem. The ATP-sensitive K+ channel subunit transcript, SUR1, is asymmetrically expressed in the eye primordia, thus being a good candidate for the observed physiological asymmetries. Such subtle asymmetries are not only seen in the eye: consistent asymmetry was also observed in the migration of differentiated melanocytes on the left and right sides. These data suggest that even anatomically symmetrical structures may possess subtle but consistent laterality and interact with other developmental left-right patterning pathways. PMID:23346115

  13. Neurally Derived Tissues in Xenopus laevis Embryos Exhibit a Consistent Bioelectrical Left-Right Asymmetry.

    PubMed

    Pai, Vaibhav P; Vandenberg, Laura N; Blackiston, Douglas; Levin, Michael

    2012-01-01

    Consistent left-right asymmetry in organ morphogenesis is a fascinating aspect of bilaterian development. Although embryonic patterning of asymmetric viscera, heart, and brain is beginning to be understood, less is known about possible subtle asymmetries present in anatomically identical paired structures. We investigated two important developmental events: physiological controls of eye development and specification of neural crest derivatives, in Xenopus laevis embryos. We found that the striking hyperpolarization of transmembrane potential (V(mem)) demarcating eye induction usually occurs in the right eye field first. This asymmetry is randomized by perturbing visceral left-right patterning, suggesting that eye asymmetry is linked to mechanisms establishing primary laterality. Bilateral misexpression of a depolarizing channel mRNA affects primarily the right eye, revealing an additional functional asymmetry in the control of eye patterning by V(mem). The ATP-sensitive K(+) channel subunit transcript, SUR1, is asymmetrically expressed in the eye primordia, thus being a good candidate for the observed physiological asymmetries. Such subtle asymmetries are not only seen in the eye: consistent asymmetry was also observed in the migration of differentiated melanocytes on the left and right sides. These data suggest that even anatomically symmetrical structures may possess subtle but consistent laterality and interact with other developmental left-right patterning pathways.

  14. pySAPC, a python package for sparse affinity propagation clustering: Application to odontogenesis whole genome time series gene-expression data.

    PubMed

    Cao, Huojun; Amendt, Brad A

    2016-11-01

    Developmental dental anomalies are common forms of congenital defects. The molecular mechanisms of dental anomalies are poorly understood. Systematic approaches such as clustering genes based on similar expression patterns could identify novel genes involved in dental anomalies and provide a framework for understanding molecular regulatory mechanisms of these genes during tooth development (odontogenesis). A python package (pySAPC) of sparse affinity propagation clustering algorithm for large datasets was developed. Whole genome pair-wise similarity was calculated based on expression pattern similarity based on 45 microarrays of several stages during odontogenesis. pySAPC identified 743 gene clusters based on expression pattern similarity during mouse tooth development. Three clusters are significantly enriched for genes associated with dental anomalies (with FDR <0.1). The three clusters of genes have distinct expression patterns during odontogenesis. Clustering genes based on similar expression profiles recovered several known regulatory relationships for genes involved in odontogenesis, as well as many novel genes that may be involved with the same genetic pathways as genes that have already been shown to contribute to dental defects. By using sparse similarity matrix, pySAPC use much less memory and CPU time compared with the original affinity propagation program that uses a full similarity matrix. This python package will be useful for many applications where dataset(s) are too large to use full similarity matrix. This article is part of a Special Issue entitled "System Genetics" Guest Editor: Dr. Yudong Cai and Dr. Tao Huang. Copyright © 2016. Published by Elsevier B.V.

  15. Tissue distribution and early developmental expression patterns of aldolase A, B, and C in grass carp Ctenopharyngodon idellus.

    PubMed

    Fan, J J; Bai, J J; Ma, D M; Yu, L Y; Jiang, P

    2017-09-27

    Aldolase is a key enzyme involved in glycolysis, gluconeogenesis, and the pentose phosphate pathway. To establish the expression patterns of all three aldolase isozyme genes in different tissues and during early embryogenesis in lower vertebrates, as well as to explore the functional differences between these three isozymes, the grass carp was selected as a model owing to its relatively high glucose-metabolizing capability. Based on the cDNA sequences of the aldolase A, B, and C genes, the expression patterns of these three isozymes were analyzed in different tissues and during early embryogenesis using quantitative real-time polymerase chain reaction (qRT-PCR). Sequence analysis of cDNAs indicated that aldolase A, B, and C (GenBank accession numbers: KM192250, KM192251, and KM192252) consist of 364, 364, and 363 amino acids, respectively. The qRT-PCR results showed that the expression levels of aldolase A, B, and C were highest in the muscle, liver, and brain, respectively. Aldolase A and C exhibited similar expression patterns during embryogenesis, with high levels observed in unfertilized and fertilized eggs and at the blastocyst stage, followed by a decline and then increase after organogenesis. In contrast, aldolase B transcript was not detected during the unfertilized egg stage, and appeared only from gastrulation; the expression increased markedly during the feeding period (72 h after hatching), at which point the level was higher than those of aldolase A and C. These data suggest that the glucose content of grass carp starter feed should be adjusted according to the metabolic activity of aldolase B.

  16. Landscape of histone modifications in a sponge reveals the origin of animal cis-regulatory complexity

    PubMed Central

    Gaiti, Federico; Jindrich, Katia; Fernandez-Valverde, Selene L; Roper, Kathrein E; Degnan, Bernard M; Tanurdžić, Miloš

    2017-01-01

    Combinatorial patterns of histone modifications regulate developmental and cell type-specific gene expression and underpin animal complexity, but it is unclear when this regulatory system evolved. By analysing histone modifications in a morphologically-simple, early branching animal, the sponge Amphimedonqueenslandica, we show that the regulatory landscape used by complex bilaterians was already in place at the dawn of animal multicellularity. This includes distal enhancers, repressive chromatin and transcriptional units marked by H3K4me3 that vary with levels of developmental regulation. Strikingly, Amphimedon enhancers are enriched in metazoan-specific microsyntenic units, suggesting that their genomic location is extremely ancient and likely to place constraints on the evolution of surrounding genes. These results suggest that the regulatory foundation for spatiotemporal gene expression evolved prior to the divergence of sponges and eumetazoans, and was necessary for the evolution of animal multicellularity. DOI: http://dx.doi.org/10.7554/eLife.22194.001 PMID:28395144

  17. Developmental evidence for serial homology of the vertebrate jaw and gill arch skeleton

    PubMed Central

    Gillis, J. Andrew; Modrell, Melinda S.; Baker, Clare V. H.

    2013-01-01

    Gegenbaur’s classical hypothesis of jaw-gill arch serial homology is widely cited, but remains unsupported by either paleontological evidence (e.g. a series of fossils reflecting the stepwise transformation of a gill arch into a jaw) or developmental genetic data (e.g. shared molecular mechanisms underlying segment identity in the mandibular, hyoid and gill arch endoskeletons). Here we show that nested expression of Dlx genes – the “Dlx code” that specifies upper and lower jaw identity in mammals and teleosts – is a primitive feature of the mandibular, hyoid and gill arches of jawed vertebrates. Using fate-mapping techniques, we demonstrate that the principal dorsal and ventral endoskeletal segments of the jaw, hyoid and gill arches of the skate Leucoraja erinacea derive from molecularly equivalent mesenchymal domains of combinatorial Dlx gene expression. Our data suggest that vertebrate jaw, hyoid and gill arch cartilages are serially homologous, and were primitively patterned dorsoventrally by a common Dlx blueprint. PMID:23385581

  18. The First Morphometric Study of the Horn Morphological Pattern in a Geotrupidae: The Case of the Dor Beetle Ceratophyus rossii Jekel, 1865.

    PubMed

    Pizzo, Astrid; Mazzone, Fabio; Palestrini, Claudia

    2015-01-01

    Among beetles, thousands of species develop horns, the size of which is often extraordinarily disproportionate with respect to body size. The Scarabaeidae is the family in which horned species are most predominant, but other families, such as the Geotrupidae (dor beetles), also show remarkable horns, although in a more limited number of species. Horn expression mechanisms are well documented in Scarabaeidae but, despite the wealth of studies on this family, the horn morphological pattern of the Geotrupidae, to our knowledge, has never been investigated. In this paper, we describe for the first time the horn expression pattern in a dor beetle. As a study species, we chose Ceratophyus rossii, an Italian endemic dor beetle of the protected Mediterranean maquis in Tuscany, which shows remarkable head and pronotal horns in males and a notable cephalic horn in females. We identified and modeled shape and size horn patterns combining traditional and geometric morphometric approaches. We discuss the results in the wider landscape of developmental models described for other, more well-characterized, scarab beetles.

  19. New features of triacylglycerol biosynthetic pathways of peanut seeds in early developmental stages.

    PubMed

    Yu, Mingli; Liu, Fengzhen; Zhu, Weiwei; Sun, Meihong; Liu, Jiang; Li, Xinzheng

    2015-11-01

    The peanut (Arachis hypogaea L.) is one of the three most important oil crops in the world due to its high average oil content (50 %). To reveal the biosynthetic pathways of seed oil in the early developmental stages of peanut pods with the goal of improving the oil quality, we presented a method combining deep sequencing analysis of the peanut pod transcriptome and quantitative real-time PCR (RT-PCR) verification of seed oil-related genes. From the sequencing data, approximately 1500 lipid metabolism-associated Unigenes were identified. The RT-PCR results quantified the different expression patterns of these triacylglycerol (TAG) synthesis-related genes in the early developmental stages of peanut pods. Based on these results and analysis, we proposed a novel construct of the metabolic pathways involved in the biosynthesis of TAG, including the Kennedy pathway, acyl-CoA-independent pathway and proposed monoacylglycerol pathway. It showed that the biosynthetic pathways of TAG in the early developmental stages of peanut pods were much more complicated than a simple, unidirectional, linear pathway.

  20. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    PubMed Central

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to discover whether there are rules or regularities governing development and evolution of complex multi-cellular organisms. PMID:22807664

  1. Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

    PubMed Central

    2010-01-01

    Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

  2. Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum.

    PubMed

    Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S

    1995-09-01

    The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.

  3. Expression pattern of Anosmin-1 during pre- and postnatal rat brain development.

    PubMed

    Clemente, Diego; Esteban, Pedro F; Del Valle, Ignacio; Bribián, Ana; Soussi-Yanicostas, Nadia; Silva, Augusto; De Castro, Fernando

    2008-09-01

    Anosmin-1 participates in the development of the olfactory and GnRH systems. Defects in this protein are responsible for both the anosmia and the hypogonadotrophic hypogonadism found in Kallmann's syndrome patients. Sporadically, these patients also manifest some neurological symptoms that are not explained in terms of the developmental defects in the olfactory system. We describe the pattern of Anosmin-1 expression in the central nervous system during rat development using a novel antibody raised against Anosmin-1 (Anos1). The areas with Anos1-stained neurons and glial cells were classified into three groups: (1) areas with immunoreactivity from embryonic day 16 to postnatal day (P) 15; (2) areas with Anosmin-1 expression only at postnatal development; (3) nuclei with immunoreactivity only at P15. Our data show that Anos1 immunoreactivity is detected in projecting neurons and interneurons within areas of the brain that may be affected in patients with Kallmann's syndrome that develop both the principal as well as sporadic symptoms.

  4. Cerebrotendinous xanthomatosis (CTX): an association of pulverulent cataracts and pseudo-dominant developmental delay in a family with a splice site mutation in CYP27A1--a case report.

    PubMed

    Bourkiza, Rabia; Joyce, Sarah; Patel, Himanshu; Chan, Michelle; Meyer, Esther; Maher, Eamonn R; Reddy, M Ashwin

    2010-06-01

    A 15-year-old boy with developmental delay presented to the pediatric ophthalmology clinic with bilateral pulverulent cataracts. The family was examined for developmental delay, cataracts and systemic problems. The parents were consanguineous and originally from Bangladesh. All the children were born in the UK. The mother and 5 children had developmental delay. Three children had global developmental delay, diarrhea and pulverulent cataracts. Two children had microcephaly, developmental delay, constipation and no cataracts. The mother did not have microcephaly, cataracts or gastrointestinal problems. Linkage analysis via autozygosity testing was performed for detection of loci and candidate genes. The patients with cataracts were segregated with homozygous mutations in the CYP27A1 (G to A substitution at position +1 of intron 6). The complex nature of this family's findings suggested that it had an unusual autosomal dominant condition with variable expression. Autozygosity testing demonstrated that three members had Cerebrotendinous xanthomatosis (CTX), which is inherited in an autosomal recessive manner. The aetiology of the developmental delay in other family members remains unknown. Cerebrotendinous xanthomatosis is a rare autosomal recessive condition that can result in neurological deficits and early death if left untreated. In view of the reversible nature of the condition with appropriate treatment, there needs to be a high level of suspicion of CTX for any child with cataracts and developmental delay even if the pattern of inheritance is not straightforward at initial assessment.

  5. Homeotic genes and the arthropod head: Expression patterns of the labial, proboscipedia, and Deformed genes in crustaceans and insects

    PubMed Central

    Abzhanov, Arhat; Kaufman, Thomas C.

    1999-01-01

    cDNA fragments of the homologues of the Drosophila head homeotic genes labial (lab), proboscipedia (pb), and Deformed (Dfd) have been isolated from the crustacean Porcellio scaber. Because the accumulation domains of the head homeotic complex (Hox) genes had not been previously reported for crustaceans, we studied the expression patterns of these genes in P. scaber embryos by using in situ hybridization. The P. scaber lab homologue is expressed in the developing second antennal segment and its appendages. This expression domain in crustaceans and in the homologous intercalary segment of insects suggests that the lab gene specified this metamere in the last common ancestor of these two groups. The expression domain of the P. scaber pb gene is in the posterior part of the second antennal segment. This domain, in contrast to that in insects, is colinear with the domains of other head genes in P. scaber, and it differs from the insect pb gene expression domain in the posterior mouthparts, suggesting that the insect and crustacean patterns evolved independently from a broader ancestral domain similar to that found in modern chelicerates. P. scaber Dfd is expressed in the mandibular segment and paragnaths (a pair of ventral mouthpart structures associated with the stomodeum) and differs from insects, where expression is in the mandibular and maxillary segments. Thus, like pb, Dfd shows a divergent Hox gene deployment. We conclude that homologous structures of the mandibulate head display striking differences in their underlying developmental programs related to Hox gene expression. PMID:10468590

  6. Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

    PubMed

    Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

    2014-01-01

    Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

  7. Functional signaling and gene regulatory networks between the oocyte and the surrounding cumulus cells.

    PubMed

    Biase, Fernando H; Kimble, Katelyn M

    2018-05-10

    The maturation and successful acquisition of developmental competence by an oocyte, the female gamete, during folliculogenesis is highly dependent on molecular interactions with somatic cells. Most of the cellular interactions identified, thus far, are modulated by growth factors, ions or metabolites. We hypothesized that this interaction is also modulated at the transcriptional level, which leads to the formation of gene regulatory networks between the oocyte and cumulus cells. We tested this hypothesis by analyzing transcriptome data from single oocytes and the surrounding cumulus cells collected from antral follicles employing an analytical framework to determine interdependencies at the transcript level. We overlapped our transcriptome data with putative protein-protein interactions and identified hundreds of ligand-receptor pairs that can transduce paracrine signaling between an oocyte and cumulus cells. We determined that 499 ligand-encoding genes expressed in oocytes and cumulus cells are functionally associated with transcription regulation (FDR < 0.05). Ligand-encoding genes with specific expression in oocytes or cumulus cells were enriched for biological functions that are likely associated with the coordinated formation of transzonal projections from cumulus cells that reach the oocyte's membrane. Thousands of gene pairs exhibit significant linear co-expression (absolute correlation > 0.85, FDR < 1.8 × 10 - 5 ) patterns between oocytes and cumulus cells. Hundreds of co-expressing genes showed clustering patterns associated with biological functions (FDR < 0.5) necessary for a coordinated function between the oocyte and cumulus cells during folliculogenesis (i.e. regulation of transcription, translation, apoptosis, cell differentiation and transport). Our analyses revealed a complex and functional gene regulatory circuit between the oocyte and surrounding cumulus cells. The regulatory profile of each cumulus-oocyte complex is likely associated with the oocytes' developmental potential to derive an embryo.

  8. Molecular Characterisation of Transport Mechanisms at the Developing Mouse Blood–CSF Interface: A Transcriptome Approach

    PubMed Central

    Liddelow, Shane A.; Temple, Sally; Møllgård, Kjeld; Gehwolf, Renate; Wagner, Andrea; Bauer, Hannelore; Bauer, Hans-Christian; Phoenix, Timothy N.; Dziegielewska, Katarzyna M.; Saunders, Norman R.

    2012-01-01

    Exchange mechanisms across the blood–cerebrospinal fluid (CSF) barrier in the choroid plexuses within the cerebral ventricles control access of molecules to the central nervous system, especially in early development when the brain is poorly vascularised. However, little is known about their molecular or developmental characteristics. We examined the transcriptome of lateral ventricular choroid plexus in embryonic day 15 (E15) and adult mice. Numerous genes identified in the adult were expressed at similar levels at E15, indicating substantial plexus maturity early in development. Some genes coding for key functions (intercellular/tight junctions, influx/efflux transporters) changed expression during development and their expression patterns are discussed in the context of available physiological/permeability results in the developing brain. Three genes: Secreted protein acidic and rich in cysteine (Sparc), Glycophorin A (Gypa) and C (Gypc), were identified as those whose gene products are candidates to target plasma proteins to choroid plexus cells. These were investigated using quantitative- and single-cell-PCR on plexus epithelial cells that were albumin- or total plasma protein-immunopositive. Results showed a significant degree of concordance between plasma protein/albumin immunoreactivity and expression of the putative transporters. Immunohistochemistry identified SPARC and GYPA in choroid plexus epithelial cells in the embryo with a subcellular distribution that was consistent with transport of albumin from blood to cerebrospinal fluid. In adult plexus this pattern of immunostaining was absent. We propose a model of the cellular mechanism in which SPARC and GYPA, together with identified vesicle-associated membrane proteins (VAMPs) may act as receptors/transporters in developmentally regulated transfer of plasma proteins at the blood–CSF interface. PMID:22457777

  9. Classic and Golli Myelin Basic Protein have distinct developmental trajectories in human visual cortex.

    PubMed

    Siu, Caitlin R; Balsor, Justin L; Jones, David G; Murphy, Kathryn M

    2015-01-01

    Traditionally, myelin is viewed as insulation around axons, however, more recent studies have shown it also plays an important role in plasticity, axonal metabolism, and neuroimmune signaling. Myelin is a complex multi-protein structure composed of hundreds of proteins, with Myelin Basic Protein (MBP) being the most studied. MBP has two families: Classic-MBP that is necessary for activity driven compaction of myelin around axons, and Golli-MBP that is found in neurons, oligodendrocytes, and T-cells. Furthermore, Golli-MBP has been called a "molecular link" between the nervous and immune systems. In visual cortex specifically, myelin proteins interact with immune processes to affect experience-dependent plasticity. We studied myelin in human visual cortex using Western blotting to quantify Classic- and Golli-MBP expression in post-mortem tissue samples ranging in age from 20 days to 80 years. We found that Classic- and Golli-MBP have different patterns of change across the lifespan. Classic-MBP gradually increases to 42 years and then declines into aging. Golli-MBP has early developmental changes that are coincident with milestones in visual system sensitive period, and gradually increases into aging. There are three stages in the balance between Classic- and Golli-MBP expression, with Golli-MBP dominating early, then shifting to Classic-MBP, and back to Golli-MBP in aging. Also Golli-MBP has a wave of high inter-individual variability during childhood. These results about cortical MBP expression are timely because they compliment recent advances in MRI techniques that produce high resolution maps of cortical myelin in normal and diseased brain. In addition, the unique pattern of Golli-MBP expression across the lifespan suggests that it supports high levels of neuroimmune interaction in cortical development and in aging.

  10. Expression of a Rho guanine nucleotide exchange factor, Ect2, in the developing mouse pituitary.

    PubMed

    Islam, M S; Tsuji, T; Higashida, C; Takahashi, M; Higashida, H; Koizumi, K

    2010-05-01

    The pituitary gland is a highly mitotically active tissue after birth. Various cell types are known to undergo proliferation in the anterior pituitary. However, little is known about the mechanisms regulating mitotic activity in this tissue. When searching for genes specifically expressed in the pituitary gland among those that we previously screened in Drosophila, we found epithelial cell-transforming gene 2 (Ect2). Ect2 is a guanine nucleotide exchange factor for Rho GTPases, which is known to play an essential role in cytokinesis. Although there have been many cellular studies regarding the function of Ect2, the temporal and spatial expression patterns of Ect2 in vivo have not been determined. In the present study, we examined the postnatal developmental expression of Ect2 in the mouse pituitary. Enhanced Ect2 expression was detected in the mouse pituitary gland during the first 3 weeks after birth, which coincided well with the period of rapid pituitary expansion associated with increased growth rate. Immunostaining analysis showed that Ect2-expressing cells were distributed in the anterior and intermediate lobes, but not the posterior lobe, of the pituitary. These Ect2-expressing cells frequently incorporated the thymidine analogue, EdU (5-ethynyl-2'-deoxyuridine), indicating that these cells were mitotically active. Taken together, the results demonstrate the functional role of Ect2 in postnatal proliferating cells in the two lobes of the pituitary, thereby suggesting roles in developmental growth of the mammalian pituitary.

  11. Of mice and genes: evolution of vertebrate brain development

    NASA Technical Reports Server (NTRS)

    Fritzsch, B.

    1998-01-01

    In this review the current understanding of genetic and molecular evolution of development, in particular the formation of the major axis of bilateral animals, is critically evaluated, and the early pattern formation in the hindbrain is related as much as possible to these processes. On the genetic level it is proposed that the exuberant multiplication of regulatory genes compared to that of structural genes relates to the increased flexibility of early vertebrate development. In comparisons to fruit flies, many conserved genes are found to be expressed very differently, while many others seem to reflect a comparable pattern and thus suggest a conservation of function. Even genes with a largely conserved pattern of expression may change the level at which they are expressed and the mechanisms by which they are regulated in their expression. Evolution and development of hindbrain motoneurons is reviewed, and it is concluded that both comparative data as well as more recent experimental data suggest a limited importance for the rhombomeres. Clearly, many cell fate-specifying processes work below the level of rhombomeres or in the absence of rhombomeres. It is suggested that more comparative developmental data are needed to establish firmly the relationship between homeobox genes and rhombomere specification in vertebrates other than a few model species.

  12. Dual odontogenic origins develop at the early stage of rat maxillary incisor development.

    PubMed

    Kriangkrai, Rungarun; Iseki, Sachiko; Eto, Kazuhiro; Chareonvit, Suconta

    2006-03-01

    Developmental process of rat maxillary incisor has been studied through histological analysis and investigation of tooth-related gene expression patterns at initial tooth development. The tooth-related genes studied here are fibroblast growth factor-8 (Fgf-8), pituitary homeobox gene-2 (Pitx-2), sonic hedgehog (Shh), muscle segment homeobox-1 (Msx-1), paired box-9 (Pax-9) and bone morphogenetic protein-4 (Bmp-4). The genes are expressed in oral epithelium and/or ectomesenchyme at the stage of epithelial thickening to the early bud stage of tooth development. Both the histological observation and tooth-related gene expression patterns during early stage of maxillary incisor development demonstrate that dual odontogenic origins aligned medio-laterally in the medial nasal process develop, subsequently only single functional maxillary incisor dental placode forms. The cascade of tooth-related gene expression patterns in rat maxillary incisor studied here is quite similar to those of the previous studies in mouse mandibular molar, even though the origins of oral epithelium and ectomesenchyme involved in development of maxillary incisor and mandibular molar are different. Thus, we conclude that maxillary incisor and mandibular molar share a similar signaling control of Fgf-8, Pitx-2, Shh, Msx-1, Pax-9 and Bmp-4 genes at the stage of oral epithelial thickening to the early bud stage of tooth development.

  13. Step-by-Step Construction of Gene Co-expression Networks from High-Throughput Arabidopsis RNA Sequencing Data.

    PubMed

    Contreras-López, Orlando; Moyano, Tomás C; Soto, Daniela C; Gutiérrez, Rodrigo A

    2018-01-01

    The rapid increase in the availability of transcriptomics data generated by RNA sequencing represents both a challenge and an opportunity for biologists without bioinformatics training. The challenge is handling, integrating, and interpreting these data sets. The opportunity is to use this information to generate testable hypothesis to understand molecular mechanisms controlling gene expression and biological processes (Fig. 1). A successful strategy to generate tractable hypotheses from transcriptomics data has been to build undirected network graphs based on patterns of gene co-expression. Many examples of new hypothesis derived from network analyses can be found in the literature, spanning different organisms including plants and specific fields such as root developmental biology.In order to make the process of constructing a gene co-expression network more accessible to biologists, here we provide step-by-step instructions using published RNA-seq experimental data obtained from a public database. Similar strategies have been used in previous studies to advance root developmental biology. This guide includes basic instructions for the operation of widely used open source platforms such as Bio-Linux, R, and Cytoscape. Even though the data we used in this example was obtained from Arabidopsis thaliana, the workflow developed in this guide can be easily adapted to work with RNA-seq data from any organism.

  14. Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer

    PubMed Central

    An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

    2015-01-01

    Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan–Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients. PMID:26691761

  15. Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer.

    PubMed

    An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

    2015-12-22

    Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan-Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients.

  16. Transcriptome analysis at four developmental stages of grape berry (Vitis vinifera cv. Shiraz) provides insights into regulated and coordinated gene expression

    PubMed Central

    2012-01-01

    Background Vitis vinifera berry development is characterised by an initial phase where the fruit is small, hard and acidic, followed by a lag phase known as veraison. In the final phase, berries become larger, softer and sweeter and accumulate an array of organoleptic compounds. Since the physiological and biochemical makeup of grape berries at harvest has a profound impact on the characteristics of wine, there is great interest in characterising the molecular and biophysical changes that occur from flowering through veraison and ripening, including the coordination and temporal regulation of metabolic gene pathways. Advances in deep-sequencing technologies, combined with the availability of increasingly accurate V. vinifera genomic and transcriptomic data, have enabled us to carry out RNA-transcript expression analysis on a global scale at key points during berry development. Results A total of 162 million 100-base pair reads were generated from pooled Vitis vinifera (cv. Shiraz) berries sampled at 3-weeks post-anthesis, 10- and 11-weeks post-anthesis (corresponding to early and late veraison) and at 17-weeks post-anthesis (harvest). Mapping reads from each developmental stage (36-45 million) onto the NCBI RefSeq transcriptome of 23,720 V. vinifera mRNAs revealed that at least 75% of these transcripts were detected in each sample. RNA-Seq analysis uncovered 4,185 transcripts that were significantly upregulated at a single developmental stage, including 161 transcription factors. Clustering transcripts according to distinct patterns of transcription revealed coordination in metabolic pathways such as organic acid, stilbene and terpenoid metabolism. From the phenylpropanoid/stilbene biosynthetic pathway at least 46 transcripts were upregulated in ripe berries when compared to veraison and immature berries, and 12 terpene synthases were predominantly detected only in a single sample. Quantitative real-time PCR was used to validate the expression pattern of 12 differentially expressed genes from primary and secondary metabolic pathways. Conclusions In this study we report the global transcriptional profile of Shiraz grapes at key stages of development. We have undertaken a comprehensive analysis of gene families contributing to commercially important berry characteristics and present examples of co-regulation and differential gene expression. The data reported here will provide an invaluable resource for the on-going molecular investigation of wine grapes. PMID:23227855

  17. Comparison of the Structure and Expression of Odd-Skipped and Two Related Genes That Encode a New Family of Zinc Finger Proteins in Drosophila

    PubMed Central

    Hart, M. C.; Wang, L.; Coulter, D. E.

    1996-01-01

    The odd-skipped (odd) gene, which was identified on the basis of a pair-rule segmentation phenotype in mutant embryos, is initially expressed in the Drosophila embryo in seven pair-rule stripes, but later exhibits a segment polarity-like pattern for which no phenotypic correlate is apparent. We have molecularly characterized two embryonically expressed odd-cognate genes, sob and bowel (bowl), that encode proteins with highly conserved C(2)H(2) zinc fingers. While the Sob and Bowl proteins each contain five tandem fingers, the Odd protein lacks a fifth (C-terminal) finger and is also less conserved among the four common fingers. Reminiscent of many segmentation gene paralogues, the closely linked odd and sob genes are expressed during embryogenesis in similar striped patterns; in contrast, the less-tightly linked bowl gene is expressed in a distinctly different pattern at the termini of the early embryo. Although our results indicate that odd and sob are more likely than bowl to share overlapping developmental roles, some functional divergence between the Odd and Sob proteins is suggested by the absence of homology outside the zinc fingers, and also by amino acid substitutions in the Odd zinc fingers at positions that appear to be constrained in Sob and Bowl. PMID:8878683

  18. Cellular expression of C3 and C4 photosynthetic enzymes in the amphibious sedge Eleocharis retroflexa ssp. chaetaria.

    PubMed

    Ueno, Osamu; Wakayama, Masataka

    2004-12-01

    The amphibious leafless sedge Eleocharis retroflexa ssp. chaetaria expresses C(4)-like biochemical characteristics in both the terrestrial and submerged forms. Culms of the terrestrial form have Kranz anatomy, whereas those of the submerged form have Kranz-like anatomy combined with anatomical features of aquatic plant leaves. We examined the immunolocalization of C(3) and C(4) enzymes in culms of the two forms. In both forms, phosphoenolpyruvate carboxylase; pyruvate, Pi dikinase; and NAD-malic enzyme were compartmentalized between the mesophyll (M) and Kranz cells, but their levels were somewhat reduced in the submerged form. In the terrestrial form, ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) occurred mainly in the Kranz cells, and weakly in the M chloroplasts. In the submerged form, the rubisco occurred at higher levels in the M cells than in the terrestrial form. In both forms, the C(4) pattern of enzyme expression was clearer in the M cells adjacent to Kranz cells than in distant M cells. During the transition from terrestrial to submerged conditions, the enzyme expression pattern changed in submerged mature culms that had been formed in air before submergence, and matched that in culms newly developed underwater. It seems that effects of both environmental and developmental factors overlap in the C(4) pattern expression in this plant.

  19. A new molecular logic for BMP-mediated dorsoventral patterning in the leech Helobdella.

    PubMed

    Kuo, Dian-Han; Weisblat, David A

    2011-08-09

    Bone morphogenetic protein (BMP) signaling is broadly implicated in dorsoventral (DV) patterning of bilaterally symmetric animals [1-3], and its role in axial patterning apparently predates the birth of Bilateria [4-7]. In fly and vertebrate embryos, BMPs and their antagonists (primarily Sog/chordin) diffuse and interact to generate signaling gradients that pattern fields of cells [8-10]. Work in other species reveals diversity in essential facets of this ancient patterning process, however. Here, we report that BMP signaling patterns the DV axis of segmental ectoderm in the leech Helobdella, a clitellate annelid (superphylum Lophotrochozoa) featuring stereotyped developmental cell lineages, but the detailed mechanisms of DV patterning in Helobdella differ markedly from fly and vertebrates. In Helobdella, BMP2/4s are expressed broadly, rather than in dorsal territory, whereas a dorsally expressed BMP5-8 specifies dorsal fate by short-range signaling. A BMP antagonist, gremlin, is upregulated by BMP5-8 in dorsolateral, rather than ventral territory, and yet the BMP-antagonizing activity of gremlin is required for normal ventral cell fates. Gremlin promotes ventral fates without disrupting dorsal fates by selectively inhibiting BMP2/4s, not BMP5-8. Thus, DV patterning in the development of the leech revealed unexpected evolutionary plasticity of the conserved BMP patterning system, presumably reflecting its adaptation to different modes of embryogenesis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. The zebrafish orphan nuclear receptor genes nr2e1 and nr2e3 are expressed in developing eye and forebrain.

    PubMed

    Kitambi, Satish Srinivas; Hauptmann, Giselbert

    2007-02-01

    Mammalian Nr2e1 (Tailless, Mtll or Tlx) and Nr2e3 (photoreceptor-specific nuclear receptor, Pnr) are highly related orphan nuclear receptors, that are expressed in eye and forebrain-derived structures. In this study, we analyzed the developmental expression patterns of zebrafish nr2e1 and nr2e3. RT-PCR analysis showed that nr2e1 and nr2e3 are both expressed during embryonic and post-embryonic development. To examine the spatial distribution of nr2e1 and nr2e3 during development whole-mount in situ hybridization was performed. At tailbud stage, initial nr2e1 expression was localized to the rostral brain rudiment anterior to pax2.1 and eng2 expression at the prospective midbrain-hindbrain boundary. During subsequent stages, nr2e1 became widely expressed in fore- and midbrain primordia, eye and olfactory placodes. At 24hpf, strong nr2e1 expression was detected in telencephalon, hypothalamus, dorsal thalamus, pretectum, midbrain tectum, and retina. At 2dpf, the initially widespread nr2e1 expression became more restricted to distinct regions within the fore- and midbrain and to the retinal ciliary margin, the germinal zone which gives rise to retina and presumptive iris. Expression of nr2e3 was exclusively found in the developing retina and epiphysis. In both structures, nr2e3 expression was found in photoreceptor cells. The developmental expression profile of zebrafish nr2e1 and nr2e3 is consistent with evolutionary conserved functions in eye and rostral brain structures.

  1. Spatiotemporal expression of caveolin-1 and EMMPRIN during mouse tooth development.

    PubMed

    Shi, Lu; Li, Lingyun; Wang, Ding; Li, Shu; Chen, Zhi; An, Zhengwen

    2016-06-01

    Caveolin-1 is a scaffolding protein involved in the formation of cholesterol-rich caveolae lipid rafts within the plasma membrane and is capable of collecting signaling molecules into the caveolae and regulating their activity, including extracellular matrix metalloproteinase inducer (EMMPRIN). However, detailed expression patterns of caveolin-1 and EMMPRIN in the developing dental germ are largely unknown. The present study investigated the expression patterns of caveolin-1 and EMMPRIN in the developing mouse tooth germ by immunohistochemistry and real-time polymerase chain reaction. At the bud stage, caveolin-1 expression was initiated in the epithelium bud and mesenchymal cells, while EMMPRIN was weakly expressed at this stage. At the cap stage, caveolin-1 protein was located in the lingual part of the tooth germ; however, EMMPRIN protein was located in the labial part. From the bell stage to 2 days postnatal, caveolin-1 expression was detected in the ameloblasts and cervical loop area; with EMMPRIN expression in the ameloblasts and odontoblasts. Real-time polymerase chain reaction results showed that both caveolin-1 and EMMPRIN mRNA levels increased gradually with progression of developmental stages, and peaked at day two postnatal. The current finding suggests that both caveolin-1 and EMMPRIN take part in mouse tooth development, especially in the differentiation and organization of odontogenic tissues.

  2. The Sterol Methyltransferases SMT1, SMT2, and SMT3 Influence Arabidopsis Development through Nonbrassinosteroid Products1[W][OA

    PubMed Central

    Carland, Francine; Fujioka, Shozo; Nelson, Timothy

    2010-01-01

    Plant sterols are structural components of cell membranes that provide rigidity, permeability, and regional identity to membranes. Sterols are also the precursors to the brassinosteroid signaling molecules. Evidence is accumulating that specific sterols have roles in pattern formation during development. COTYLEDON VASCULAR PATTERNING1 (CVP1) encodes C-24 STEROL METHYLTRANSFERASE2 (SMT2), one of three SMTs in Arabidopsis (Arabidopsis thaliana). SMT2 and SMT3, which also encodes a C-24 SMT, catalyze the reaction that distinguishes the synthesis of structural sterols from signaling brassinosteroid derivatives and are highly regulated. The deficiency of SMT2 in the cvp1 mutant results in moderate developmental defects, including aberrant cotyledon vein patterning, serrated floral organs, and reduced stature, but plants are viable, suggesting that SMT3 activity can substitute for the loss of SMT2. To test the distinct developmental roles of SMT2 and SMT3, we identified a transcript null smt3 mutant. Although smt3 single mutants appear wild type, cvp1 smt3 double mutants show enhanced defects relative to cvp1 mutants, such as discontinuous cotyledon vein pattern, and produce novel phenotypes, including defective root growth, loss of apical dominance, sterility, and homeotic floral transformations. These phenotypes are correlated with major alterations in the profiles of specific sterols but without significant alterations to brassinosteroid profiles. The alterations to sterol profiles in cvp1 mutants affect auxin response, demonstrated by weak auxin insensitivity, enhanced axr1 auxin resistance, ectopically expressed DR5:β-glucuronidase in developing embryos, and defective response to auxin-inhibited PIN2-green fluorescent protein endocytosis. We discuss the developmental roles of sterols implied by these results. PMID:20421456

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cui Xiangshun; Li Xingyu; Kim, Nam-Hyung

    To gain insights into the roles the paternal genome and chromosome number play in pre-implantation development, we cultured fertilized embryos and diploid and haploid parthenotes (DPs and HPs, respectively), and compared their development and gene expression patterns. The DPs and fertilized embryos did not differ in developmental ability but HPs development was slower and characterized by impaired compaction and blastocoel formation. Microarray analysis revealed that fertilized blastocysts expressed several genes at higher levels than DP blastocysts; these included the Y-chromosome-specific gene eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked (Eif2s3y) and the imprinting gene U2 small nuclear ribonucleoproteinmore » auxiliary factor 1, related sequence 1 (U2af1-rs1). We also found that when DPs and HPs were both harvested at 44 and 58 h of culture, they differed in the expression of 38 and 665 genes, respectively. However, when DPs and HPs were harvested at the midpoints of 4-cell stage (44 and 49 h, respectively), no differences in expression was observed. Similarly, when the DPs and HPs were harvested when they became blastocysts (102 and 138 h, respectively), only 15 genes showed disparate expression. These results suggest that while transcripts needed for early development are delayed in HPs, it does progress sufficiently for the generation of the various developmental stages despite the lack of genetic components.« less

  4. The grapevine kinome: annotation, classification and expression patterns in developmental processes and stress responses.

    PubMed

    Zhu, Kaikai; Wang, Xiaolong; Liu, Jinyi; Tang, Jun; Cheng, Qunkang; Chen, Jin-Gui; Cheng, Zong-Ming Max

    2018-01-01

    Protein kinases (PKs) have evolved as the largest family of molecular switches that regulate protein activities associated with almost all essential cellular functions. Only a fraction of plant PKs, however, have been functionally characterized even in model plant species. In the present study, the entire grapevine kinome was identified and annotated using the most recent version of the grapevine genome. A total of 1168 PK-encoding genes were identified and classified into 20 groups and 121 families, with the RLK-Pelle group being the largest, with 872 members. The 1168 kinase genes were unevenly distributed over all 19 chromosomes, and both tandem and segmental duplications contributed to the expansion of the grapevine kinome, especially of the RLK-Pelle group. Ka/Ks values indicated that most of the tandem and segmental duplication events were under purifying selection. The grapevine kinome families exhibited different expression patterns during plant development and in response to various stress treatments, with many being coexpressed. The comprehensive annotation of grapevine kinase genes, their patterns of expression and coexpression, and the related information facilitate a more complete understanding of the roles of various grapevine kinases in growth and development, responses to abiotic stress, and evolutionary history.

  5. Transcriptomic insights into the genetic basis of mammalian limb diversity.

    PubMed

    Maier, Jennifer A; Rivas-Astroza, Marcelo; Deng, Jenny; Dowling, Anna; Oboikovitz, Paige; Cao, Xiaoyi; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Zhong, Sheng; Sears, Karen E

    2017-03-23

    From bat wings to whale flippers, limb diversification has been crucial to the evolutionary success of mammals. We performed the first transcriptome-wide study of limb development in multiple species to explore the hypothesis that mammalian limb diversification has proceeded through the differential expression of conserved shared genes, rather than by major changes to limb patterning. Specifically, we investigated the manner in which the expression of shared genes has evolved within and among mammalian species. We assembled and compared transcriptomes of bat, mouse, opossum, and pig fore- and hind limbs at the ridge, bud, and paddle stages of development. Results suggest that gene expression patterns exhibit larger variation among species during later than earlier stages of limb development, while within species results are more mixed. Consistent with the former, results also suggest that genes expressed at later developmental stages tend to have a younger evolutionary age than genes expressed at earlier stages. A suite of key limb-patterning genes was identified as being differentially expressed among the homologous limbs of all species. However, only a small subset of shared genes is differentially expressed in the fore- and hind limbs of all examined species. Similarly, a small subset of shared genes is differentially expressed within the fore- and hind limb of a single species and among the forelimbs of different species. Taken together, results of this study do not support the existence of a phylotypic period of limb development ending at chondrogenesis, but do support the hypothesis that the hierarchical nature of development translates into increasing variation among species as development progresses.

  6. Postnatal choline supplementation selectively attenuates hippocampal microRNA alterations associated with developmental alcohol exposure.

    PubMed

    Balaraman, Sridevi; Idrus, Nirelia M; Miranda, Rajesh C; Thomas, Jennifer D

    2017-05-01

    Prenatal alcohol exposure can result in a range of physical, neuropathological, and behavioral alterations, collectively termed fetal alcohol spectrum disorders (FASD). We have shown that supplementation with the nutrient choline reduces the severity of developmental alcohol-associated deficits in hippocampal-dependent behaviors and normalizes some aspects of hippocampal cholinergic development and DNA methylation patterns. Alcohol's developmental effects may also be mediated, in part, by altering microRNAs (miRNAs) that serve as negative regulators of gene translation. To determine whether choline supplementation alters ethanol's long-lasting effects on miRNAs, Sprague-Dawley rats were exposed to 5.25 g/kg/day ethanol from postnatal days (PD) 4-9 via intubation; controls received sham intubations. Subjects were treated with choline chloride (100 mg/kg/day) or saline vehicle subcutaneously (s.c.) from PD 4-21. On PD 22, subjects were sacrificed, and RNA was isolated from the hippocampus. MiRNA expression was assessed with TaqMan Human MicroRNA Panel Low-Density Arrays. Ethanol significantly increased miRNA expression variance, an effect that was attenuated with choline supplementation. Cluster analysis of stably expressed miRNAs that exceeded an ANOVA p < 0.05 criterion indicated that for both male and female offspring, control and ethanol-exposed groups were most dissimilar from each other, with choline-supplemented groups in between. MiRNAs that expressed an average 2-fold change due to ethanol exposure were further analyzed to identify which ethanol-sensitive miRNAs were protected by choline supplementation. We found that at a false discovery rate (FDR)-adjusted criterion of p < 0.05, miR-200c was induced by ethanol exposure and that choline prevented this effect. Collectively, our data show that choline supplementation can normalize disturbances in miRNA expression following developmental alcohol exposure and can protect specific miRNAs from induction by ethanol. These findings have important implications for the mechanisms by which choline may serve as a potential treatment for FASD. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Transcriptome Analysis of Differentially Expressed Genes Provides Insight into Stolon Formation in Tulipa edulis

    PubMed Central

    Miao, Yuanyuan; Zhu, Zaibiao; Guo, Qiaosheng; Zhu, Yunhao; Yang, Xiaohua; Sun, Yuan

    2016-01-01

    Tulipa edulis (Miq.) Baker is an important medicinal plant with a variety of anti-cancer properties. The stolon is one of the main asexual reproductive organs of T. edulis and possesses a unique morphology. To explore the molecular mechanism of stolon formation, we performed an RNA-seq analysis of the transcriptomes of stolons at three developmental stages. In the present study, 15.49 Gb of raw data were generated and assembled into 74,006 unigenes, and a total of 2,811 simple sequence repeats were detected in T. edulis. Among the three libraries of stolons at different developmental stages, there were 5,119 differentially expressed genes (DEGs). A functional annotation analysis based on sequence similarity queries of the GO, COG, KEGG databases showed that these DEGs were mainly involved in many physiological and biochemical processes, such as material and energy metabolism, hormone signaling, cell growth, and transcription regulation. In addition, quantitative real-time PCR analysis revealed that the expression patterns of the DEGs were consistent with the transcriptome data, which further supported a role for the DEGs in stolon formation. This study provides novel resources for future genetic and molecular studies in T. edulis. PMID:27064558

  8. Transcriptome Analysis of Differentially Expressed Genes Provides Insight into Stolon Formation in Tulipa edulis.

    PubMed

    Miao, Yuanyuan; Zhu, Zaibiao; Guo, Qiaosheng; Zhu, Yunhao; Yang, Xiaohua; Sun, Yuan

    2016-01-01

    Tulipa edulis (Miq.) Baker is an important medicinal plant with a variety of anti-cancer properties. The stolon is one of the main asexual reproductive organs of T. edulis and possesses a unique morphology. To explore the molecular mechanism of stolon formation, we performed an RNA-seq analysis of the transcriptomes of stolons at three developmental stages. In the present study, 15.49 Gb of raw data were generated and assembled into 74,006 unigenes, and a total of 2,811 simple sequence repeats were detected in T. edulis. Among the three libraries of stolons at different developmental stages, there were 5,119 differentially expressed genes (DEGs). A functional annotation analysis based on sequence similarity queries of the GO, COG, KEGG databases showed that these DEGs were mainly involved in many physiological and biochemical processes, such as material and energy metabolism, hormone signaling, cell growth, and transcription regulation. In addition, quantitative real-time PCR analysis revealed that the expression patterns of the DEGs were consistent with the transcriptome data, which further supported a role for the DEGs in stolon formation. This study provides novel resources for future genetic and molecular studies in T. edulis.

  9. Identification of the homolog of cell-counting factor in the cellular slime mold Dictyostelium discoideum.

    PubMed

    Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo

    2002-10-01

    Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.

  10. Sequential pattern formation governed by signaling gradients

    NASA Astrophysics Data System (ADS)

    Jörg, David J.; Oates, Andrew C.; Jülicher, Frank

    2016-10-01

    Rhythmic and sequential segmentation of the embryonic body plan is a vital developmental patterning process in all vertebrate species. However, a theoretical framework capturing the emergence of dynamic patterns of gene expression from the interplay of cell oscillations with tissue elongation and shortening and with signaling gradients, is still missing. Here we show that a set of coupled genetic oscillators in an elongating tissue that is regulated by diffusing and advected signaling molecules can account for segmentation as a self-organized patterning process. This system can form a finite number of segments and the dynamics of segmentation and the total number of segments formed depend strongly on kinetic parameters describing tissue elongation and signaling molecules. The model accounts for existing experimental perturbations to signaling gradients, and makes testable predictions about novel perturbations. The variety of different patterns formed in our model can account for the variability of segmentation between different animal species.

  11. Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain

    PubMed Central

    Okamura-Oho, Yuko; Shimokawa, Kazuro; Nishimura, Masaomi; Takemoto, Satoko; Sato, Akira; Furuichi, Teiichi; Yokota, Hideo

    2014-01-01

    Using a recently invented technique for gene expression mapping in the whole-anatomy context, termed transcriptome tomography, we have generated a dataset of 36,000 maps of overall gene expression in the adult-mouse brain. Here, using an informatics approach, we identified a broad co-expression network that follows an inverse power law and is rich in functional interaction and gene-ontology terms. Our framework for the integrated analysis of expression maps and graphs of co-expression networks revealed that groups of combinatorially expressed genes, which regulate cell differentiation during development, were present in the adult brain and each of these groups was associated with a discrete cell types. These groups included non-coding genes of unknown function. We found that these genes specifically linked developmentally conserved groups in the network. A previously unrecognized robust expression pattern covering the whole brain was related to the molecular anatomy of key biological processes occurring in particular areas. PMID:25382412

  12. WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

    PubMed

    Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

    2017-03-01

    Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans.

    PubMed

    Sinha, Amit; Sommer, Ralf J; Dieterich, Christoph

    2012-06-19

    An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution.

  14. Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans

    PubMed Central

    2012-01-01

    Background An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. Results We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Conclusion Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution. PMID:22712530

  15. Temperature induced variation in gene expression of thyroid hormone receptors and deiodinases of European eel (Anguilla anguilla) larvae.

    PubMed

    Politis, S N; Servili, A; Mazurais, D; Zambonino-Infante, J-L; Miest, J J; Tomkiewicz, J; Butts, I A E

    2018-04-01

    Thyroid hormones (THs) are key regulators of growth, development, and metabolism in vertebrates and influence early life development of fish. TH is produced in the thyroid gland (or thyroid follicles) mainly as T4 (thyroxine), which is metabolized to T3 (3,5,3'-triiodothyronine) and T2 (3,5-diiodothyronine) by deiodinase (DIO) enzymes in peripheral tissues. The action of these hormones is mostly exerted by binding to a specific nuclear thyroid hormone receptor (THR). In this study, we i) cloned and characterized thr sequences, ii) investigated the expression pattern of the different subtypes of thrs and dios, and iii) studied how temperature affects the expression of those genes in artificially produced early life history stages of European eel (Anguilla anguilla), reared in different thermal regimes (16, 18, 20 and 22 °C) from hatch until first-feeding. We identified 2 subtypes of thr (thrα and thrβ) with 2 isoforms each (thrαA, thrαB, thrβA, thrβB) and 3 subtypes of deiodinases (dio1, dio2, dio3). All thr genes identified showed high similarity to the closely related Japanese eel (Anguilla japonica). We found that all genes investigated in this study were affected by larval age (in real time or at specific developmental stages), temperature, and/or their interaction. More specifically, the warmer the temperature the earlier the expression response of a specific target gene. In real time, the expression profiles appeared very similar and only shifted with temperature. In developmental time, gene expression of all genes differed across selected developmental stages, such as at hatch, during teeth formation or at first-feeding. Thus, we demonstrate that thrs and dios show sensitivity to temperature and are involved in and during early life development of European eel. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Cell Alignment Required in Differentiation of Myxococcus xanthus

    NASA Astrophysics Data System (ADS)

    Kim, Seung K.; Kaiser, Dale

    1990-08-01

    During fruiting body morphogenesis of Myxococcus xanthus, cell movement is required for transmission of C-factor, a short range intercellular signaling protein necessary for sporulation and developmental gene expression. Nonmotile cells fail to sporulate and to express C-factor-dependent genes, but both defects were rescued by a simple manipulation of cell position that oriented the cells in aligned, parallel groups. A similar pattern of aligned cells normally results from coordinated recruitment of wild-type cells into multicellular aggregates, which later form mature fruiting bodies. It is proposed that directed cell movement establishes critical contacts between adjacent cells, which are required for efficient intercellular C-factor transmission.

  17. High-throughput characterization of Echinococcus spp. metacestode miRNomes.

    PubMed

    Cucher, Marcela; Macchiaroli, Natalia; Kamenetzky, Laura; Maldonado, Lucas; Brehm, Klaus; Rosenzvit, Mara Cecilia

    2015-03-01

    Echinococcosis is a worldwide zoonosis of great public health concern, considered a neglected disease by the World Health Organisation. The cestode parasites Echinococcus granulosus sensu lato (s. l.) and Echinococcus multilocularis are the main aetiological agents. In the intermediate host, these parasites display particular developmental traits that lead to different patterns of disease progression. In an attempt to understand the causes of these differences, we focused on the analysis of microRNAs (miRNAs), small non-coding regulatory RNAs with major roles in development of animals and plants. In this work, we analysed the small RNA expression pattern of the metacestode, the stage of sanitary relevance, and provide a detailed description of Echinococcus miRNAs. Using high-throughput small RNA sequencing, we believe that we have carried out the first experimental identification of miRNAs in E. multilocularis and have expanded the Echinococcus miRNA catalogue to 38 miRNA genes, including one miRNA only present in E. granulosus s. l. Our findings show that although both species share the top five highest expressed miRNAs, 13 are differentially expressed, which could be related to developmental differences. We also provide evidence that uridylation is the main miRNA processing mechanism in Echinococcus spp. These results provide detailed information on Echinococcus miRNAs, which is the first step in understanding their role in parasite biology and disease establishment and/or progression, and their future potential use as drug or diagnostic targets. Copyright © 2015 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  18. Genome-wide analyses of four major histone modifications in Arabidopsis hybrids at the germinating seed stage.

    PubMed

    Zhu, Anyu; Greaves, Ian K; Dennis, Elizabeth S; Peacock, W James

    2017-02-07

    Hybrid vigour (heterosis) has been used for decades in cropping agriculture, especially in the production of maize and rice, because hybrid varieties exceed their parents in plant biomass and seed yield. The molecular basis of hybrid vigour is not fully understood. Previous studies have suggested that epigenetic systems could play a role in heterosis. In this project, we investigated genome-wide patterns of four histone modifications in Arabidopsis hybrids in germinating seeds. We found that although hybrids have similar histone modification patterns to the parents in most regions of the genome, they have altered patterns at specific loci. A small subset of genes show changes in histone modifications in the hybrids that correlate with changes in gene expression. Our results also show that genome-wide patterns of histone modifications in geminating seeds parallel those at later developmental stages of seedlings. Ler/C24 hybrids showed similar genome-wide patterns of histone modifications as the parents at an early germination stage. However, a small subset of genes, such as FLC, showed correlated changes in histone modification and in gene expression in the hybrids. The altered patterns of histone modifications for those genes in hybrids could be related to some heterotic traits in Arabidopsis, such as flowering time, and could play a role in hybrid vigour establishment.

  19. Identification and Expression Analysis of microRNAs at the Grain Filling Stage in Rice(Oryza sativa L.)via Deep Sequencing

    PubMed Central

    Yi, Rong; Zhu, Zhixuan; Hu, Jihong; Qian, Qian; Dai, Jincheng; Ding, Yi

    2013-01-01

    MicroRNAs (miRNAs) have been shown to play crucial roles in the regulation of plant development. In this study, high-throughput RNA-sequencing technology was used to identify novel miRNAs, and to reveal miRNAs expression patterns at different developmental stages during rice (Oryza sativa L.) grain filling. A total of 434 known miRNAs (380, 402, 390 and 392 at 5, 7, 12 and 17 days after fertilization, respectively.) were obtained from rice grain. The expression profiles of these identified miRNAs were analyzed and the results showed that 161 known miRNAs were differentially expressed during grain development, a high proportion of which were up-regulated from 5 to 7 days after fertilization. In addition, sixty novel miRNAs were identified, and five of these were further validated experimentally. Additional analysis showed that the predicted targets of the differentially expressed miRNAs may participate in signal transduction, carbohydrate and nitrogen metabolism, the response to stimuli and epigenetic regulation. In this study, differences were revealed in the composition and expression profiles of miRNAs among individual developmental stages during the rice grain filling process, and miRNA editing events were also observed, analyzed and validated during this process. The results provide novel insight into the dynamic profiles of miRNAs in developing rice grain and contribute to the understanding of the regulatory roles of miRNAs in grain filling. PMID:23469249

  20. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  1. Aberrant ligand-induced activation of G protein-coupled estrogen receptor 1 (GPER) results in developmental malformations during vertebrate embryogenesis.

    PubMed

    Jayasinghe, B Sumith; Volz, David C

    2012-01-01

    G protein-coupled estrogen receptor 1 (GPER) is a G protein-coupled receptor (GPCR) unrelated to nuclear estrogen receptors but strongly activated by 17β-estradiol in both mammals and fish. To date, the distribution and functional characterization of GPER within reproductive and nonreproductive vertebrate organs have been restricted to juvenile and adult animals. In contrast, virtually nothing is known about the spatiotemporal distribution and function of GPER during vertebrate embryogenesis. Using zebrafish as an animal model, we investigated the potential functional role and expression of GPER during embryogenesis. Based on real-time PCR and whole-mount in situ hybridization, gper was expressed as early as 1 h postfertilization (hpf) and exhibited strong stage-dependent expression patterns during embryogenesis. At 26 and 38 hpf, gper mRNA was broadly distributed throughout the body, whereas from 50 to 98 hpf, gper expression was increasingly localized to the heart, brain, neuromasts, craniofacial region, and somite boundaries of developing zebrafish. Continuous exposure to a selective GPER agonist (G-1)-but not continuous exposure to a selective GPER antagonist (G-15)-from 5 to 96 hpf, or within three developmental windows ranging from 10 to 72 hpf, resulted in adverse concentration-dependent effects on survival, gross morphology, and somite formation within the trunk of developing zebrafish embryos. Importantly, based on co-exposure studies, G-15 blocked severe G-1-induced developmental toxicity, suggesting that G-1 toxicity is mediated via aberrant activation of GPER. Overall, our findings suggest that xenobiotic-induced GPER activation represents a potentially novel and understudied mechanism of toxicity for environmentally relevant chemicals that affect vertebrate embryogenesis.

  2. Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

    PubMed

    Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

    2017-10-01

    Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Homologs of the Xenopus developmental gene DG42 are present in zebrafish and mouse and are involved in the synthesis of Nod-like chitin oligosaccharides during early embryogenesis.

    PubMed

    Semino, C E; Specht, C A; Raimondi, A; Robbins, P W

    1996-05-14

    The Xenopus developmental gene DG42 is expressed during early embryonic development, between the midblastula and neurulation stages. The deduced protein sequence of Xenopus DG42 shows similarity to Rhizobium Nod C, Streptococcus Has A, and fungal chitin synthases. Previously, we found that the DG42 protein made in an in vitro transcription/translation system catalyzed synthesis of an array of chitin oligosaccharides. Here we show that cell extracts from early Xenopus and zebrafish embryos also synthesize chitooligosaccharides. cDNA fragments homologous to DG42 from zebrafish and mouse were also cloned and sequenced. Expression of these homologs was similar to that described for Xenopus based on Northern and Western blot analysis. The Xenopus anti-DG42 antibody recognized a 63-kDa protein in extracts from zebrafish embryos that followed a similar developmental expression pattern to that previously described for Xenopus. The chitin oligosaccharide synthase activity found in extracts was inactivated by a specific DG42 antibody; synthesis of hyaluronic acid (HA) was not affected under the conditions tested. Other experiments demonstrate that expression of DG42 under plasmid control in mouse 3T3 cells gives rise to chitooligosaccharide synthase activity without an increase in HA synthase level. A possible relationship between our results and those of other investigators, which show stimulation of HA synthesis by DG42 in mammalian cell culture systems, is provided by structural analyses to be published elsewhere that suggest that chitin oligosaccharides are present at the reducing ends of HA chains. Since in at least one vertebrate system hyaluronic acid formation can be inhibited by a pure chitinase, it seems possible that chitin oligosaccharides serve as primers for hyaluronic acid synthesis.

  4. Digit loss in archosaur evolution and the interplay between selection and constraints.

    PubMed

    de Bakker, Merijn A G; Fowler, Donald A; den Oude, Kelly; Dondorp, Esther M; Navas, M Carmen Garrido; Horbanczuk, Jaroslaw O; Sire, Jean-Yves; Szczerbińska, Danuta; Richardson, Michael K

    2013-08-22

    Evolution involves interplay between natural selection and developmental constraints. This is seen, for example, when digits are lost from the limbs during evolution. Extant archosaurs (crocodiles and birds) show several instances of digit loss under different selective regimes, and show limbs with one, two, three, four or the ancestral number of five digits. The 'lost' digits sometimes persist for millions of years as developmental vestiges. Here we examine digit loss in the Nile crocodile and five birds, using markers of three successive stages of digit development. In two independent lineages under different selection, wing digit I and all its markers disappear. In contrast, hindlimb digit V persists in all species sampled, both as cartilage, and as Sox9- expressing precartilage domains, 250 million years after the adult digit disappeared. There is therefore a mismatch between evolution of the embryonic and adult phenotypes. All limbs, regardless of digit number, showed similar expression of sonic hedgehog (Shh). Even in the one-fingered emu wing, expression of posterior genes Hoxd11 and Hoxd12 was conserved, whereas expression of anterior genes Gli3 and Alx4 was not. We suggest that the persistence of digit V in the embryo may reflect constraints, particularly the conserved posterior gene networks associated with the zone of polarizing activity (ZPA). The more rapid and complete disappearance of digit I may reflect its ZPA-independent specification, and hence, weaker developmental constraints. Interacting with these constraints are selection pressures for limb functions such as flying and perching. This model may help to explain the diverse patterns of digit loss in tetrapods. Our study may also help to understand how selection on adults leads to changes in development.

  5. Attention Deficit Hyperactivity Disorder (ADHD): Controversy, Developmental Mechanisms, and Multiple Levels of Analysis.

    PubMed

    Hinshaw, Stephen P

    2018-05-07

    Controversy abounds regarding the symptom dimensions of attention problems, impulsivity, and hyperactivity, developmentally extreme and impairing levels of which compose the diagnostic category of attention deficit hyperactivity disorder (ADHD). I highlight causal factors, underlying mechanisms, developmental trajectories, and female manifestations of ADHD, integrating the psychobiological underpinnings of this syndrome with contextual factors related to its clinical presentation, impairments, and soaring increases in diagnosed prevalence. Indeed, despite strong heritability, ADHD is expressed via transactional patterns of influence linked to family-, school-, peer-, neighborhood-, and policy-related factors. Moreover, intervention strategies must take into account both pharmacologic and behavioral modalities if the goal is to enhance competencies, rather than symptom reduction per se. A comprehensive understanding of ADHD mandates multiple levels of analysis-spanning genes, neurotransmission, brain pathways, individual skill levels, family socialization, peer relationships, and educational and cultural forces-which must be integrated and synthesized to surpass reductionist accounts, reduce stigma, and maximize the impact of prevention- and intervention-related efforts.

  6. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species

    PubMed Central

    Yuan, Yao-Wu; Rebocho, Alexandra B.; Sagawa, Janelle M.; Stanley, Lauren E.; Bradshaw, Harvey D.

    2016-01-01

    Flower color patterns have long served as a model for developmental genetics because pigment phenotypes are visually striking, yet generally not required for plant viability, facilitating the genetic analysis of color and pattern mutants. The evolution of novel flower colors and patterns has played a key role in the adaptive radiation of flowering plants via their specialized interactions with different pollinator guilds (e.g., bees, butterflies, birds), motivating the search for allelic differences affecting flower color pattern in closely related plant species with different pollinators. We have identified LIGHT AREAS1 (LAR1), encoding an R2R3-MYB transcription factor, as the causal gene underlying the spatial pattern variation of floral anthocyanin pigmentation between two sister species of monkeyflower: the bumblebee-pollinated Mimulus lewisii and the hummingbird-pollinated Mimulus cardinalis. We demonstrated that LAR1 positively regulates FLAVONOL SYNTHASE (FLS), essentially eliminating anthocyanin biosynthesis in the white region (i.e., light areas) around the corolla throat of M. lewisii flowers by diverting dihydroflavonol into flavonol biosynthesis from the anthocyanin pigment pathway. FLS is preferentially expressed in the light areas of the M. lewisii flower, thus prepatterning the corolla. LAR1 expression in M. cardinalis flowers is much lower than in M. lewisii, explaining the unpatterned phenotype and recessive inheritance of the M. cardinalis allele. Furthermore, our gene-expression analysis and genetic mapping results suggest that cis-regulatory change at the LAR1 gene played a critical role in the evolution of different pigmentation patterns between the two species. PMID:26884205

  7. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species.

    PubMed

    Yuan, Yao-Wu; Rebocho, Alexandra B; Sagawa, Janelle M; Stanley, Lauren E; Bradshaw, Harvey D

    2016-03-01

    Flower color patterns have long served as a model for developmental genetics because pigment phenotypes are visually striking, yet generally not required for plant viability, facilitating the genetic analysis of color and pattern mutants. The evolution of novel flower colors and patterns has played a key role in the adaptive radiation of flowering plants via their specialized interactions with different pollinator guilds (e.g., bees, butterflies, birds), motivating the search for allelic differences affecting flower color pattern in closely related plant species with different pollinators. We have identified LIGHT AREAS1 (LAR1), encoding an R2R3-MYB transcription factor, as the causal gene underlying the spatial pattern variation of floral anthocyanin pigmentation between two sister species of monkeyflower: the bumblebee-pollinated Mimulus lewisii and the hummingbird-pollinated Mimulus cardinalis. We demonstrated that LAR1 positively regulates FLAVONOL SYNTHASE (FLS), essentially eliminating anthocyanin biosynthesis in the white region (i.e., light areas) around the corolla throat of M. lewisii flowers by diverting dihydroflavonol into flavonol biosynthesis from the anthocyanin pigment pathway. FLS is preferentially expressed in the light areas of the M. lewisii flower, thus prepatterning the corolla. LAR1 expression in M. cardinalis flowers is much lower than in M. lewisii, explaining the unpatterned phenotype and recessive inheritance of the M. cardinalis allele. Furthermore, our gene-expression analysis and genetic mapping results suggest that cis-regulatory change at the LAR1 gene played a critical role in the evolution of different pigmentation patterns between the two species.

  8. Sex differences and left-right asymmetries in expression of insulin and insulin-like growth factor-1 receptors in developing rat hippocampus.

    PubMed

    Hami, Javad; Sadr-Nabavi, Ariane; Sankian, Mojtaba; Haghir, Hossein

    2012-04-01

    Sex differences and laterality of rat hippocampus with respect to insulin-like growth factor-1 receptor (IGF-1R) and insulin receptor (InsR) expression as two important contributors to/regulators of developmental and cognitive functions were examined using real-time PCR and western blot analysis at P0, P7 and P14. Expression of the IGF-1R gene was lowest at P0 in all studied hippocampi. In males, we found the highest expression at P7 in the right hippocampus, and at P14 in the left one. In contrast, the peaked IGF-1R expression occurred at P7 in female hippocampi independent of laterality. Hippocampal InsR expression in males decreased significantly between P0 and P7, followed by a marked upregulation at P14. Conversely, the expression of InsR in females peaked at P7 and then decreased again significantly at P14. We found significant interhemispheric differences in IGF-1R mRNA levels in both male and female hippocampi at different time points. In contrast, we only found significant interhemispheric differences in InsR mRNA expression in P14 male rats, with higher values in the left hippocampus. Interestingly, changes in mRNA expression and in protein levels followed the same developmental pattern, indicating that IGF-1R and InsR transcription is not subject to modulatory effects during the first two weeks of development. These findings indicate that there are prominent interhemispheric and sex differences in IGF-1R and InsR expression in the developing rat hippocampus, suggesting a probable mechanism for the control of gender and laterality differences in development and function of the hippocampus.

  9. Regulation of Banana Phytoene Synthase (MaPSY) Expression, Characterization and Their Modulation under Various Abiotic Stress Conditions

    PubMed Central

    Kaur, Navneet; Pandey, Ashutosh; Shivani; Kumar, Prateek; Pandey, Pankaj; Kesarwani, Atul K.; Mantri, Shrikant S.; Awasthi, Praveen; Tiwari, Siddharth

    2017-01-01

    Phytoene synthase (PSY) is a key regulatory enzyme of carotenoid biosynthesis pathway in plants. The present study examines the role of PSY in carotenogenesis and stress management in banana. Germplasm screening of 10 Indian cultivars showed that Nendran (3011.94 μg/100 g dry weight) and Rasthali (105.35 μg/100 g dry weight) contained the highest and lowest amounts of β-carotene, respectively in ripe fruit-pulp. Nendran ripe pulp also showed significantly higher antioxidant activity as compared to Rasthali. Meta-analysis of three banana PSY genes (MaPSY1, MaPSY2, and MaPSY3) was performed to identify their structural features, subcellular, and chromosomal localization in banana genome. The distinct expression patterns of MaPSY1, MaPSY2, and MaPSY3 genes were observed in various tissues, and fruit developmental stages of these two contrasting cultivars, suggesting differential regulation of the banana PSY genes. A positive correlation was observed between the expression of MaPSY1 and β-carotene accumulation in the ripe fruit-peel and pulp of Nendran. The presence of stress responsive cis-regulatory motifs in promoter region of MaPSY genes were correlated with the expression pattern during various stress (abscisic acid, methyl jasmonate, salicylic acid and dark) treatments. The positive modulation of MaPSY1 noticed under abiotic stresses suggested its role in plant physiological functions and defense response. The amino acid sequence analysis of the PSY proteins in contrasting cultivars revealed that all PSY comprises conserved domains related to enzyme activity. Bacterial complementation assay has validated the functional activity of six PSY proteins and among them PSY1 of Nendran (Nen-PSY1) gave the highest activity. These data provide new insights into the regulation of PSY expression in banana by developmental and stress related signals that can be explored in the banana improvement programs. PMID:28421096

  10. FoxP in bees: A comparative study on the developmental and adult expression pattern in three bee species considering isoforms and circuitry.

    PubMed

    Schatton, Adriana; Mendoza, Ezequiel; Grube, Kathrin; Scharff, Constance

    2018-06-15

    Mutations in the transcription factors FOXP1, FOXP2, and FOXP4 affect human cognition, including language. The FoxP gene locus is evolutionarily ancient and highly conserved in its DNA-binding domain. In Drosophila melanogaster FoxP has been implicated in courtship behavior, decision making, and specific types of motor-learning. Because honeybees (Apis mellifera, Am) excel at navigation and symbolic dance communication, they are a particularly suitable insect species to investigate a potential link between neural FoxP expression and cognition. We characterized two AmFoxP isoforms and mapped their expression in the brain during development and in adult foragers. Using a custom-made antiserum and in situ hybridization, we describe 11 AmFoxP expressing neuron populations. FoxP was expressed in equivalent patterns in two other representatives of Apidae; a closely related dwarf bee and a bumblebee species. Neural tracing revealed that the largest FoxP expressing neuron cluster in honeybees projects into a posterior tract that connects the optic lobe to the posterior lateral protocerebrum, predicting a function in visual processing. Our data provide an entry point for future experiments assessing the function of FoxP in eusocial Hymenoptera. © 2018 Wiley Periodicals, Inc.

  11. Expression pattern of cdkl5 during zebrafish early development: implications for use as model for atypical Rett syndrome.

    PubMed

    Vitorino, Marta; Cunha, Nídia; Conceição, Natércia; Cancela, M Leonor

    2018-05-11

    Atypical Rett syndrome is a child neurodevelopmental disorder induced by mutations in CDKL5 gene and characterized by a progressive regression in development with loss of purposeful use of the hands, slowed brain and head growth, problems with walking, seizures, and intellectual disability. At the moment, there is no cure for this pathology and little information is available concerning animal models capable of mimicking its phenotypes, thus the development of additional animal models should be of interest to gain more knowledge about the disease. Zebrafish has been used successfully as model organism for many human genetic diseases; however, no information is available concerning the spatial and temporal expression of cdkl5 orthologous in this organism. In the present study, we identified the developmental expression patterns of cdkl5 in zebrafish by quantitative PCR and whole-mount in situ hybridization. cdkl5 is expressed maternally at low levels during the first 24 h of development. After that the expression of the gene increases significantly and it starts to be expressed mainly in the nervous system and in several brain structures, such as telencephalon, mesencephalon and diencephalon. The expression patterns of cdkl5 in zebrafish is in accordance with the tissues known to be affected in humans and associated to symptoms and deficits observed in Rett syndrome patients thus providing the first evidence that zebrafish could be an alternative model to study the molecular pathways of this disease as well as to test possible therapeutic approaches capable of rescuing the phenotype.

  12. A mesh generation and machine learning framework for Drosophila gene expression pattern image analysis

    PubMed Central

    2013-01-01

    Background Multicellular organisms consist of cells of many different types that are established during development. Each type of cell is characterized by the unique combination of expressed gene products as a result of spatiotemporal gene regulation. Currently, a fundamental challenge in regulatory biology is to elucidate the gene expression controls that generate the complex body plans during development. Recent advances in high-throughput biotechnologies have generated spatiotemporal expression patterns for thousands of genes in the model organism fruit fly Drosophila melanogaster. Existing qualitative methods enhanced by a quantitative analysis based on computational tools we present in this paper would provide promising ways for addressing key scientific questions. Results We develop a set of computational methods and open source tools for identifying co-expressed embryonic domains and the associated genes simultaneously. To map the expression patterns of many genes into the same coordinate space and account for the embryonic shape variations, we develop a mesh generation method to deform a meshed generic ellipse to each individual embryo. We then develop a co-clustering formulation to cluster the genes and the mesh elements, thereby identifying co-expressed embryonic domains and the associated genes simultaneously. Experimental results indicate that the gene and mesh co-clusters can be correlated to key developmental events during the stages of embryogenesis we study. The open source software tool has been made available at http://compbio.cs.odu.edu/fly/. Conclusions Our mesh generation and machine learning methods and tools improve upon the flexibility, ease-of-use and accuracy of existing methods. PMID:24373308

  13. Expression patterns of ABA and GA metabolism genes and hormone levels during rice seed development and imbibition: a comparison of dormant and non-dormant rice cultivars.

    PubMed

    Liu, Yang; Fang, Jun; Xu, Fan; Chu, Jinfang; Yan, Cunyu; Schläppi, Michael R; Wang, Youping; Chu, Chengcai

    2014-06-20

    Seed dormancy is an important agronomic trait in cereals. Using deep dormant (N22), medium dormant (ZH11), and non-dormant (G46B) rice cultivars, we correlated seed dormancy phenotypes with abscisic acid (ABA) and gibberellin (GA) metabolism gene expression profiles and phytohormone levels during seed development and imbibition. A time course analysis of ABA and GA content during seed development showed that N22 had a high ABA level at early and middle seed developmental stages, while at late developmental stage it declined to the level of ZH11; however, its ABA/GA ratio maintained at a high level throughout seed development. By contrast, G46B had the lowest ABA content during seed development though at early developmental stage its ABA level was close to that of ZH11, and its ABA/GA ratio peaked at late developmental stage that was at the same level of ZH11. Compared with N22 and G46B, ZH11 had an even and medium ABA level during seed development and its ABA/GA ratio peaked at the middle developmental stage. Moreover, the seed development time-point having high ABA/GA ratio also had relatively high transcript levels for key genes in ABA and GA metabolism pathways across three cultivars. These indicated that the embryo-imposed dormancy has been induced before the late developmental stage and is determined by ABA/GA ratio. A similar analysis during seed imbibition showed that ABA was synthesized in different degrees for the three cultivars. In addition, water uptake assay for intact mature seeds suggested that water could permeate through husk barrier into seed embryo for all three cultivars; however, all three cultivars showed distinct colors by vanillin-staining indicative of the existence of flavans in their husks, which are dormancy inhibition compounds responsible for the husk-imposed dormancy. Copyright © 2014. Published by Elsevier Ltd.

  14. Epigenetic mechanisms in developmental programming of adult disease

    PubMed Central

    Chen, Man; Zhang, Lubo

    2011-01-01

    Adverse insults during intrauterine life can result in permanent changes in the physiology and metabolism of the offspring, which in turn leads to an increased risk of disease in adulthood. This is an adaptational response by the fetus to changes in the environmental signals that it receives during early life to ensure its survival and prepare itself for postnatal life. Increasing evidence suggests that the epigenetic regulation of gene expression patterns has a crucial role in the developmental programming of adult disease. This review summarizes recent studies of epigenetic mechanisms and focuses particularly on studies that explore identifiable epigenetic biomarkers in the promoters of specific disease-associated genes. Such biomarkers would enable early recognition of children who might be at risk of developing adult disease with fetal origins. PMID:21945859

  15. Periconceptional maternal micronutrient supplementation is associated with widespread gender related changes in the epigenome: a study of a unique resource in the Gambia.

    PubMed

    Khulan, Batbayar; Cooper, Wendy N; Skinner, Benjamin M; Bauer, Julien; Owens, Stephen; Prentice, Andrew M; Belteki, Gusztav; Constancia, Miguel; Dunger, David; Affara, Nabeel A

    2012-05-01

    In addition to the genetic constitution inherited by an organism, the developmental trajectory and resulting mature phenotype are also determined by mechanisms acting during critical windows in early life that influence and establish stable patterns of gene expression. This is the crux of the developmental origins of health and disease hypothesis that suggests undernutrition during gestation and infancy predisposes to ill health in later life. The hypothesis that periconceptional maternal micronutrient supplementation might affect fetal genome-wide methylation within gene promoters was explored in cord blood samples from offspring of Gambian women enrolled into a unique randomized, double blind controlled trial. Significant changes in the epigenome in cord blood DNA samples were further explored in a subset of offspring at 9 months. Gender-specific changes related to periconceptional nutritional supplementation were identified in cord blood DNA samples, some of which showed persistent changes in infant blood DNA samples. Significant effects of periconceptional micronutrient supplementation were also observed in postnatal samples which were not evident in cord blood. In this Gambian population, the increased death rate of individuals born in nutritionally poor seasons has been related to infection and it is of interest that we identified differential methylation at genes associated with defence against infection and immune response. Although the sample size was relatively small, these pilot data suggest that periconceptional nutrition in humans is an important determinant of newborn whole genome methylation patterns but may also influence postnatal developmental patterns of gene promoter methylation linking early with disease risk.

  16. Dream content of Canadian males from adolescence to old age: An exploration of ontogenetic patterns.

    PubMed

    Dale, Allyson; Lafrenière, Alexandre; De Koninck, Joseph

    2017-03-01

    The present study was a first look at the ontogenetic pattern of dream content across the lifespan for men. The participants included 50 Canadian men in each of 5 age groups, from adolescence to old age including 12-17, 18-24, 25-39, 40-64, and 65-85. The last age group included 31 participants, totaling 231 males. One dream per participant was scored by two independent judges using content analysis. Trend analysis was used to determine the lifespan-developmental pattern of the dream content categories. Results demonstrated a predominance of aggressive dream imagery in the adolescent age group in line with social-developmental research. These patterns of dream imagery reflect the waking developmental patterns as proposed by social theories and recognized features of aging. Limitations and suggestions for future research, including the examining of the developmental pattern of gender differences across the lifespan, are discussed. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. A Developmental Systems Perspective on Epistasis: Computational Exploration of Mutational Interactions in Model Developmental Regulatory Networks

    PubMed Central

    Gutiérrez, Jayson

    2009-01-01

    The way in which the information contained in genotypes is translated into complex phenotypic traits (i.e. embryonic expression patterns) depends on its decoding by a multilayered hierarchy of biomolecular systems (regulatory networks). Each layer of this hierarchy displays its own regulatory schemes (i.e. operational rules such as +/− feedback) and associated control parameters, resulting in characteristic variational constraints. This process can be conceptualized as a mapping issue, and in the context of highly-dimensional genotype-phenotype mappings (GPMs) epistatic events have been shown to be ubiquitous, manifested in non-linear correspondences between changes in the genotype and their phenotypic effects. In this study I concentrate on epistatic phenomena pervading levels of biological organization above the genetic material, more specifically the realm of molecular networks. At this level, systems approaches to studying GPMs are specially suitable to shed light on the mechanistic basis of epistatic phenomena. To this aim, I constructed and analyzed ensembles of highly-modular (fully interconnected) networks with distinctive topologies, each displaying dynamic behaviors that were categorized as either arbitrary or functional according to early patterning processes in the Drosophila embryo. Spatio-temporal expression trajectories in virtual syncytial embryos were simulated via reaction-diffusion models. My in silico mutational experiments show that: 1) the average fitness decay tendency to successively accumulated mutations in ensembles of functional networks indicates the prevalence of positive epistasis, whereas in ensembles of arbitrary networks negative epistasis is the dominant tendency; and 2) the evaluation of epistatic coefficients of diverse interaction orders indicates that, both positive and negative epistasis are more prevalent in functional networks than in arbitrary ones. Overall, I conclude that the phenotypic and fitness effects of multiple perturbations are strongly conditioned by both the regulatory architecture (i.e. pattern of coupled feedback structures) and the dynamic nature of the spatio-temporal expression trajectories displayed by the simulated networks. PMID:19738908

  18. Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken.

    PubMed

    Houweling, Arjan C; Somi, Semir; Van Den Hoff, Maurice J B; Moorman, Antoon F M; Christoffels, Vincent M

    2002-02-01

    In mouse, atrial natriuretic factor (ANF) gene expression was shown to be a marker for chamber formation within the embryonic heart. To gain insight into the process of chamber formation in the chicken embryonic heart, we analyzed the expression pattern of cANF during development. We found cANF to be specifically expressed in the myocardium of the morphologically distinguishable atrial and ventricular chambers, similar to ANF in mouse. cANF expression was never detected in the myocardium of the atrioventricular canal (AVC), inner curvature, and outflow tract (OFT), which is lined by endocardial cushions. Expression was strictly excluded from the interventricular myocardium and most proximal part of the bundle branches, as identified by the expression of Msx-2, whereas the rest of the bundle branches, trabeculae, and surrounding working myocardium did express cANF. The myocardium that forms de novo within the cushions after looping did not express cANF. At HH9 cANF expression was first observed in a subset of cardiomyocytes, which was localized ventrally in the fused heart tube and laterally in the unfused cardiac sheets. Together, these results show that cANF expression can be used to distinguish differentiated chamber (working) myocardium, including the peripheral ventricular conduction system, from embryonic myocardium. We conclude that differentiation of chamber myocardium takes place already at HH9 at the ventral side of the linear heart tube, possibly preceded by latero-medial signals in the unfused cardiac sheets. Copyright 2002 Wiley-Liss, Inc.

  19. Caste- and development-associated gene expression in a lower termite

    PubMed Central

    Scharf, Michael E; Wu-Scharf, Dancia; Pittendrigh, Barry R; Bennett, Gary W

    2003-01-01

    Background Social insects such as termites express dramatic polyphenism (the occurrence of multiple forms in a species on the basis of differential gene expression) both in association with caste differentiation and between castes after differentiation. We have used cDNA macroarrays to compare gene expression between polyphenic castes and intermediary developmental stages of the termite Reticulitermes flavipes. Results We identified differentially expressed genes from nine ontogenic categories. Quantitative PCR was used to quantify precise differences in gene expression between castes and between intermediary developmental stages. We found worker and nymph-biased expression of transcripts encoding termite and endosymbiont cellulases; presoldier-biased expression of transcripts encoding the storage/hormone-binding protein vitellogenin; and soldier-biased expression of gene transcripts encoding two transcription/translation factors, two signal transduction factors and four cytoskeletal/muscle proteins. The two transcription/translation factors showed significant homology to the bicaudal and bric-a-brac developmental genes of Drosophila. Conclusions Our results show differential expression of regulatory, structural and enzyme-coding genes in association with termite castes and their developmental precursor stages. They also provide the first glimpse into how insect endosymbiont cellulase gene expression can vary in association with the caste of a host. These findings shed light on molecular processes associated with termite biology, polyphenism, caste differentiation and development and highlight potentially interesting variations in developmental themes between termites, other insects, and higher animals. PMID:14519197

  20. Effects of developmental lead exposure on the hippocampal methylome: Influences of sex and timing and level of exposure.

    PubMed

    Singh, G; Singh, V; Wang, Zi-Xuan; Voisin, G; Lefebvre, F; Navenot, J-M; Evans, B; Verma, M; Anderson, D W; Schneider, J S

    2018-06-15

    Developmental lead (Pb) exposure results in persistent cognitive/behavioral impairments as well as an elevated risk for developing a variety of diseases in later life. Environmental exposures during development can result in a variety of epigenetic changes, including alterations in DNA methylation, that can influence gene expression patterns and affect the function and development of the nervous system. The present promoter-based methylation microarray profiling study explored the extent to which developmental Pb exposure may modify the methylome of a brain region, hippocampus, known to be sensitive to the effects of Pb exposure. Male and female Long Evans rats were exposed to 0 ppm, 150 ppm, 375 ppm, or 750 ppm Pb through perinatal exposures (gestation through lactation), early postnatal exposures (birth through weaning), or long-term postnatal exposures (birth through postnatal day 55). Results showed a significant contribution of sex to the hippocampal methylome and effects of Pb exposure level, with non-linear dose response effects on methylation. Surprisingly, the developmental period of exposure contributed only a small amount of variance to the overall data and gene ontology (GO) analysis revealed the largest number of overrepresented GO terms in the groups with the lowest level of exposure. The highest number of significant differentially methylated regions was found in females exposed to Pb at the lowest exposure level. Our data reinforce the significant effect that low level Pb exposure may have on gene-specific DNA methylation patterns in brain and that this occurs in a sex-dependent manner. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Exploratory behavior in mice selectively bred for developmental differences in aggressive behavior.

    PubMed

    Hood, Kathryn E; Quigley, Karen S

    2008-01-01

    The development and expression of exploratory behavior was assessed in the Cairns lines of Institute for Cancer Research (ICR) mice that were selectively bred for differences in aggressive behavior, with a high-aggressive 900 line, low-aggressive 100 line, and control 500 line. Four paradigms were employed. Developmental changes were evident in the complex novel arena, with older males faster to contact a novel object, and ambulating more than young males. Within the control 500 line, older males showed longer latency to emerge from the home cage, and shorter latency to contact novel objects. In the 900 line, younger males showed this same pattern. R. B. Cairns proposed that line differences in aggressive behavior arise through alterations in developmental timing [Cairns et al. [1983] Life-span developmental psychology (Vol. 5). New York: Academic Press; Gariépy et al. [2001] Animal Behaviour 61: 933-947]. The early appearance of mature patterns of exploratory behavior in 900 line males supports this interpretation. The 900 line males also appear to be behaviorally inhibited in novel settings such as the light-dark box and the neohypophagia paradigm, compared to the 500 and 100 lines (Experiments 1, 2, and 4). Moreover, in the most complex apparatus, the novel arena, 900 line males were slowest to exit the home cage, and fastest to contact a novel object. The apparent contrast in these parameters of exploratory behavior is discussed in relation to T. C. Schneirla's [1965 Advances in the study of behavior (Vol. 1). New York: PN Academic] approach-withdrawal theory. (c) 2007 Wiley Periodicals, Inc.

  2. Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

    PubMed Central

    Veldman, Matthew B.; Lin, Shuo

    2012-01-01

    Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

  3. Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

    PubMed

    Veldman, Matthew B; Lin, Shuo

    2012-01-20

    Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

  4. Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

    PubMed Central

    van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

    1999-01-01

    The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

  5. Developmental Patterning as a Quantitative Trait: Genetic Modulation of the Hoxb6 Mutant Skeletal Phenotype

    PubMed Central

    Kappen, Claudia

    2016-01-01

    The process of patterning along the anterior-posterior axis in vertebrates is highly conserved. The function of Hox genes in the axis patterning process is particularly well documented for bone development in the vertebral column and the limbs. We here show that Hoxb6, in skeletal elements at the cervico-thoracic junction, controls multiple independent aspects of skeletal pattern, implicating discrete developmental pathways as substrates for this transcription factor. In addition, we demonstrate that Hoxb6 function is subject to modulation by genetic factors. These results establish Hox-controlled skeletal pattern as a quantitative trait modulated by gene-gene interactions, and provide evidence that distinct modifiers influence the function of conserved developmental genes in fundamental patterning processes. PMID:26800342

  6. The generation and diversification of butterfly eyespot color patterns.

    PubMed

    Brunetti, C R; Selegue, J E; Monteiro, A; French, V; Brakefield, P M; Carroll, S B

    2001-10-16

    A fundamental challenge of evolutionary and developmental biology is understanding how new characters arise and change. The recently derived eyespots on butterfly wings vary extensively in number and pattern between species and play important roles in predator avoidance. Eyespots form through the activity of inductive organizers (foci) at the center of developing eyespot fields. Foci are the proposed source of a morphogen, the levels of which determine the color of surrounding wing scale cells. However, it is unknown how reception of the focal signal translates into rings of different-colored scales, nor how different color schemes arise in different species. We have identified several transcription factors, including butterfly homologs of the Drosophila Engrailed/Invected and Spalt proteins, that are deployed in concentric territories corresponding to the future rings of pigmented scales that compose the adult eyespot. We have isolated a new Bicyclus anynana wing pattern mutant, Goldeneye, in which the scales of one inner color ring become the color of a different ring. These changes correlate with shifts in transcription factor expression, suggesting that Goldeneye affects an early regulatory step in eyespot color patterning. In different butterfly species, the same transcription factors are expressed in eyespot fields, but in different relative spatial domains that correlate with divergent eyespot color schemes. Our results suggest that signaling from the focus induces nested rings of regulatory gene expression that subsequently control the final color pattern. Furthermore, the remarkably plastic regulatory interactions downstream of focal signaling have facilitated the evolution of eyespot diversity.

  7. The marginal band system in nymphalid butterfly wings.

    PubMed

    Taira, Wataru; Kinjo, Seira; Otaki, Joji M

    2015-01-01

    Butterfly wing color patterns are highly complex and diverse, but they are believed to be derived from the nymphalid groundplan, which is composed of several color pattern systems. Among these pattern systems, the marginal band system, including marginal and submarginal bands, has rarely been studied. Here, we examined the color pattern diversity of the marginal band system among nymphalid butterflies. Marginal and submarginal bands are usually expressed as a pair of linear bands aligned with the wing margin. However, a submarginal band can be expressed as a broken band, an elongated oval, or a single dot. The marginal focus, usually a white dot at the middle of a wing compartment along the wing edge, corresponds to the pupal edge spot, one of the pupal cuticle spots that signify the locations of color pattern organizing centers. A marginal band can be expressed as a semicircle, an elongated oval, or a pair of eyespot-like structures, which suggest the organizing activity of the marginal focus. Physical damage at the pupal edge spot leads to distal dislocation of the submarginal band in Junonia almana and in Vanessa indica, suggesting that the marginal focus functions as an organizing center for the marginal band system. Taken together, we conclude that the marginal band system is developmentally equivalent to other symmetry systems. Additionally, the marginal band is likely a core element and the submarginal band a paracore element of the marginal band system, and both bands are primarily specified by the marginal focus organizing center.

  8. A Simulation Study of Mutations in the Genetic Regulatory Hierarchy for Butterfly Eyespot Focus Determination

    PubMed Central

    Marcus, Jeffrey M.; Evans, Travis M.

    2008-01-01

    The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci (Evans and Marcus, 2006). The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci. PMID:18586070

  9. Wnt affects symmetry and morphogenesis during post-embryonic development in colonial chordates.

    PubMed

    Di Maio, Alessandro; Setar, Leah; Tiozzo, Stefano; De Tomaso, Anthony W

    2015-01-01

    Wnt signaling is one of the earliest and most highly conserved regulatory pathways for the establishment of the body axes during regeneration and early development. In regeneration, body axes determination occurs independently of tissue rearrangement and early developmental cues. Modulation of the Wnt signaling in either process has shown to result in unusual body axis phenotypes. Botryllus schlosseri is a colonial ascidian that can regenerate its entire body through asexual budding. This processes leads to an adult body via a stereotypical developmental pathway (called blastogenesis), without proceeding through any embryonic developmental stages. In this study, we describe the role of the canonical Wnt pathway during the early stages of asexual development. We characterized expression of three Wnt ligands (Wnt2B, Wnt5A, and Wnt9A) by in situ hybridization and qRT-PCR. Chemical manipulation of the pathway resulted in atypical budding due to the duplication of the A/P axes, supernumerary budding, and loss of the overall cell apical-basal polarity. Our results suggest that Wnt signaling is used for equivalent developmental processes both during embryogenesis and asexual development in an adult organism, suggesting that patterning mechanisms driving morphogenesis are conserved, independent of embryonic, or regenerative development.

  10. Baicalin increases developmental competence of mouse embryos in vitro by inhibiting cellular apoptosis and modulating HSP70 and DNMT expression

    PubMed Central

    QI, Xiaonan; LI, Huatao; CONG, Xia; WANG, Xin; JIANG, Zhongling; CAO, Rongfeng; TIAN, Wenru

    2016-01-01

    Scutellaria baicalensis has been effectively used in Chinese traditional medicine to prevent miscarriages. However, little information is available on its mechanism of action. This study is designed specifically to reveal how baicalin, the main effective ingredient of S. baicalensis, improves developmental competence of embryos in vitro, using the mouse as a model. Mouse pronuclear embryos were cultured in KSOM medium supplemented with (0, 2, 4 and 8 μg/ml) baicalin. The results demonstrated that in vitro culture conditions significantly decreased the blastocyst developmental rate and blastocyst quality, possibly due to increased cellular stress and apoptosis. Baicalin (4 µg/ml) significantly increased 2- and 4-cell cleavage rates, morula developmental rate, and blastocyst developmental rate and cell number of in vitro-cultured mouse embryos. Moreover, baicalin increased the expression of Gja1, Cdh1, Bcl-2, and Dnmt3a genes, decreased the expression of Dnmt1 gene, and decreased cellular stress and apoptosis as it decreased the expression of HSP70, CASP3, and BAX and increased BCL-2 expression in blastocysts cultured in vitro. In conclusion, baicalin improves developmental competence of in vitro-cultured mouse embryos through inhibition of cellular apoptosis and HSP70 expression, and improvement of DNA methylation. PMID:27478062

  11. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus.

    PubMed

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-10-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .

  12. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner

    PubMed Central

    Pai, Vaibhav P.; Willocq, Valerie; Pitcairn, Emily J.; Lemire, Joan M.; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A.

    2017-01-01

    ABSTRACT Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels (Ih currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal, Lefty, and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. PMID:28818840

  13. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    PubMed

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  14. Characterization of the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in female and male cones of the conifer genera Picea, Podocarpus, and Taxus: implications for current evo-devo hypotheses for gymnosperms.

    PubMed

    Vázquez-Lobo, Alejandra; Carlsbecker, Annelie; Vergara-Silva, Francisco; Alvarez-Buylla, Elena R; Piñero, Daniel; Engström, Peter

    2007-01-01

    The identity of genes causally implicated in the development and evolutionary origin of reproductive characters in gymnosperms is largely unknown. Working within the framework of plant evolutionary developmental biology, here we have cloned, sequenced, performed phylogenetic analyses upon and tested the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in reproductive structures from selected species of the conifer genera Picea, Podocarpus, and Taxus. Contrary to expectations based on previous assessments, expression of LFY/FLO and NLY in cones of these taxa was found to occur simultaneously in a single reproductive axis, initially overlapping but later in mutually exclusive primordia and/or groups of developing cells in both female and male structures. These observations directly affect the status of the "mostly male theory" for the origin of the angiosperm flower. On the other hand, comparative spatiotemporal patterns of the expression of these genes suggest a complex genetic regulatory network of cone development, as well as a scheme of functional divergence for LFY/FLO with respect to NLY homologs in gymnosperms, both with clear heterochronic aspects. Results presented in this study contribute to the understanding of the molecular-genetic basis of morphological evolution in conifer cones, and may aid in establishing a foundation for gymnosperm-specific, testable evo-devo hypotheses.

  15. A novel X-linked disorder with developmental delay and autistic features.

    PubMed

    Kaya, Namik; Colak, Dilek; Albakheet, Albandary; Al-Owain, Mohammad; Abu-Dheim, Nada; Al-Younes, Banan; Al-Zahrani, Jawaher; Mukaddes, Nahit M; Dervent, Aysin; Al-Dosari, Naji; Al-Odaib, Ali; Kayaalp, Inci V; Al-Sayed, Moeenaladin; Al-Hassnan, Zuhair; Nester, Michael J; Al-Dosari, Mohammad; Al-Dhalaan, Hesham; Chedrawi, Aziza; Gunoz, Hulya; Karakas, Bedri; Sakati, Nadia; Alkuraya, Fowzan S; Gascon, Generaso G; Ozand, Pinar T

    2012-04-01

    Genomic duplications that lead to autism and other human diseases are interesting pathological lesions since the underlying mechanism almost certainly involves dosage sensitive genes. We aim to understand a novel genomic disorder with profound phenotypic consequences, most notably global developmental delay, autism, psychosis, and anorexia nervosa. We evaluated the affected individuals, all maternally related, using childhood autism rating scale (CARS) and Vineland Adaptive scales, magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS) brain, electroencephalography (EEG), electromyography (EMG), muscle biopsy, high-resolution molecular karyotype arrays, Giemsa banding (G-banding) and fluorescent in situ hybridization (FISH) experiments, mitochondrial DNA (mtDNA) sequencing, X-chromosome inactivation study, global gene expression analysis on Epstein-Barr virus (EBV)-transformed lymphoblasts, and quantitative reverse-transcription polymerase chain reaction (qRT-PCR). We have identified a novel Xq12-q13.3 duplication in an extended family. Clinically normal mothers were completely skewed in favor of the normal chromosome X. Global transcriptional profiling of affected individuals and controls revealed significant alterations of genes and pathways in a pattern consistent with previous microarray studies of autism spectrum disorder patients. Moreover, expression analysis revealed copy number-dependent increased messenger RNA (mRNA) levels in affected patients compared to control individuals. A subset of differentially expressed genes was validated using qRT-PCR. Xq12-q13.3 duplication is a novel global developmental delay and autism-predisposing chromosomal aberration; pathogenesis of which may be mediated by increased dosage of genes contained in the duplication, including NLGN3, OPHN1, AR, EFNB1, TAF1, GJB1, and MED12. Copyright © 2011 American Neurological Association.

  16. Gene regulatory network architecture in different developmental contexts influences the genetic basis of morphological evolution.

    PubMed

    Kittelmann, Sebastian; Buffry, Alexandra D; Franke, Franziska A; Almudi, Isabel; Yoth, Marianne; Sabaris, Gonzalo; Couso, Juan Pablo; Nunes, Maria D S; Frankel, Nicolás; Gómez-Skarmeta, José Luis; Pueyo-Marques, Jose; Arif, Saad; McGregor, Alistair P

    2018-05-01

    Convergent phenotypic evolution is often caused by recurrent changes at particular nodes in the underlying gene regulatory networks (GRNs). The genes at such evolutionary 'hotspots' are thought to maximally affect the phenotype with minimal pleiotropic consequences. This has led to the suggestion that if a GRN is understood in sufficient detail, the path of evolution may be predictable. The repeated evolutionary loss of larval trichomes among Drosophila species is caused by the loss of shavenbaby (svb) expression. svb is also required for development of leg trichomes, but the evolutionary gain of trichomes in the 'naked valley' on T2 femurs in Drosophila melanogaster is caused by reduced microRNA-92a (miR-92a) expression rather than changes in svb. We compared the expression and function of components between the larval and leg trichome GRNs to investigate why the genetic basis of trichome pattern evolution differs in these developmental contexts. We found key differences between the two networks in both the genes employed, and in the regulation and function of common genes. These differences in the GRNs reveal why mutations in svb are unlikely to contribute to leg trichome evolution and how instead miR-92a represents the key evolutionary switch in this context. Our work shows that variability in GRNs across different developmental contexts, as well as whether a morphological feature is lost versus gained, influence the nodes at which a GRN evolves to cause morphological change. Therefore, our findings have important implications for understanding the pathways and predictability of evolution.

  17. Exogenous plant hormones and cyclotide expression in Viola uliginosa (Violaceae).

    PubMed

    Slazak, Blazej; Jacobsson, Erik; Kuta, Elżbieta; Göransson, Ulf

    2015-09-01

    Plants from Violaceae produce cyclotides, peptides characterized by a circular peptide backbone and a cystine knot. This signature motif gives stability that can harness a wide spectrum of biological activities, with implications in plant defense and with applications in medicine and biotechnology. In the current work, cyclotide expressing in vitro cultures were established from Viola uliginosa. These cultures are useful models for studying biosynthesis of cyclotides and can also be used in their production. The cyclotide expression pattern is shown to be dependent on exogenous plant growth regulators, both on peptide and gene expression levels. The highest yields of cyclotides were obtained on media containing only a cytokinin and were correlated with storage material accumulation. Exposure to auxins decreased cyclotide production and caused shifting of the biosynthesis pattern to root specific cyclotides. The response to stimuli in terms of cyclotide expression pattern appears to be developmental, and related to polar auxin transportation and the auxin/cytokinin ratio regulating tissue differentiation. By the use of whole transcriptome shotgun sequencing (WTSS) and peptidomics, 20 cyclotide sequences from V. uliginosa (including 12 new) and 12 complete precursor proteins could be identified. The most abundant cyclotides were cycloviolacin O3 (CyO3), CyO8 and CyO13. A suspension culture was obtained that grew exponentially with a doubling time of approximately 3 days. After ten days of growth, the culture provided a yield of more than 4 mg CyO13 per gram dry mass. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Overexpression of AtGRDP2, a novel glycine-rich domain protein, accelerates plant growth and improves stress tolerance

    PubMed Central

    Ortega-Amaro, María A.; Rodríguez-Hernández, Aída A.; Rodríguez-Kessler, Margarita; Hernández-Lucero, Eloísa; Rosales-Mendoza, Sergio; Ibáñez-Salazar, Alejandro; Delgado-Sánchez, Pablo; Jiménez-Bremont, Juan F.

    2015-01-01

    Proteins with glycine-rich signatures have been reported in a wide variety of organisms including plants, mammalians, fungi, and bacteria. Plant glycine-rich protein genes exhibit developmental and tissue-specific expression patterns. Herein, we present the characterization of the AtGRDP2 gene using Arabidopsis null and knockdown mutants and, Arabidopsis and lettuce over-expression lines. AtGRDP2 encodes a short glycine-rich domain protein, containing a DUF1399 domain and a putative RNA recognition motif (RRM). AtGRDP2 transcript is mainly expressed in Arabidopsis floral organs, and its deregulation in Arabidopsis Atgrdp2 mutants and 35S::AtGRDP2 over-expression lines produces alterations in development. The 35S::AtGRDP2 over-expression lines grow faster than the WT, while the Atgrdp2 mutants have a delay in growth and development. The over-expression lines accumulate higher levels of indole-3-acetic acid and, have alterations in the expression pattern of ARF6, ARF8, and miR167 regulators of floral development and auxin signaling. Under salt stress conditions, 35S::AtGRDP2 over-expression lines displayed higher tolerance and increased expression of stress marker genes. Likewise, transgenic lettuce plants over-expressing the AtGRDP2 gene manifest increased growth rate and early flowering time. Our data reveal an important role for AtGRDP2 in Arabidopsis development and stress response, and suggest a connection between AtGRDP2 and auxin signaling. PMID:25653657

  19. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  20. Early patterning and blastodermal fate map of the head in the milkweed bug Oncopeltus fasciatus.

    PubMed

    Birkan, Michael; Schaeper, Nina D; Chipman, Ariel D

    2011-01-01

    The process of head development in insects utilizes a set of widely conserved genes, but this process and its evolution are not well understood. Recent data from Tribolium castaneum have provided a baseline for an understanding of insect head development. However, work on a wider range of insect species, including members of the hemimetabolous orders, is needed in order to draw general conclusions about the evolution of head differentiation and regionalization. We have cloned and studied the expression and function of a number of candidate genes for head development in the hemipteran Oncopeltus fasciatus. These include orthodenticle, empty spiracles, collier, cap 'n' collar, and crocodile. The expression patterns of these genes show a broad conservation relative to Tribolium, as well as differences from Drosophila indicating that Tribolium + Oncopeltus represent a more ancestral pattern. In addition, our data provide a blastodermal fate map for different head regions in later developmental stages and supply us with a "roadmap" for future studies on head development in this species. © 2011 Wiley Periodicals, Inc.

  1. Regulation of Facial Morphogenesis by Endothelin Signaling: Insights from Mice and Fish

    PubMed Central

    Clouthier, David E.; Garcia, Elvin; Schilling, Thomas F.

    2010-01-01

    Craniofacial morphogenesis is accomplished through a complex set of developmental events, most of which are initiated in neural crest cells within the pharyngeal arches. Local patterning cues from the surrounding environment induce gene expression within neural crest cells, leading to formation of a diverse set of skeletal elements. Endothelin-1 (Edn1) is one of the primary signals that establish the identities of neural crest cells within the mandibular portion of the first pharyngeal arch. Signaling through its cognate receptor, the endothelin-A receptor, is critical for patterning the ventral/distal portion of the arch (lower jaw) and also participates with Hox genes in patterning more posterior arches. Edn1/Ednra signaling is highly conserved between mouse and zebrafish, and genetic analyses in these two species have provided complementary insights into the patterning cues responsible for establishing the craniofacial complex as well as the genetic basis of facial birth defect syndromes. PMID:20684004

  2. Uncoupling neurogenic gene networks in the Drosophila embryo.

    PubMed

    Rogers, William A; Goyal, Yogesh; Yamaya, Kei; Shvartsman, Stanislav Y; Levine, Michael S

    2017-04-01

    The EGF signaling pathway specifies neuronal identities in the Drosophila embryo by regulating developmental patterning genes such as intermediate neuroblasts defective ( ind ). EGFR is activated in the ventral midline and neurogenic ectoderm by the Spitz ligand, which is processed by the Rhomboid protease. CRISPR/Cas9 was used to delete defined rhomboid enhancers mediating expression at each site of Spitz processing. Surprisingly, the neurogenic ectoderm, not the ventral midline, was found to be the dominant source of EGF patterning activity. We suggest that Drosophila is undergoing an evolutionary transition in central nervous system (CNS)-organizing activity from the ventral midline to the neurogenic ectoderm. © 2017 Rogers et al.; Published by Cold Spring Harbor Laboratory Press.

  3. The Genetics and Epigenetics of Kidney Development

    PubMed Central

    Patel, Sanjeevkumar R.; Dressler, Gregory R.

    2013-01-01

    The development of the mammalian kidney has been studied at the genetic, biochemical, and cell biological level for more than 40 years. As such, detailed mechanisms governing early patterning, cell lineages, and inductive interactions are well described. How genes interact to specify the renal epithelial cells of the nephrons and how this specification is relevant to maintaining normal renal function is discussed. Implicit in the development of the kidney are epigenetic mechanisms that mark renal cell types and connect certain developmental regulatory factors to chromatin modifications that control gene expression patterns and cellular physiology. In adults, such regulatory factors and their epigenetic pathways may function in regeneration and may be disturbed in disease processes. PMID:24011574

  4. Sequential establishment of stripe patterns in an expanding cell population.

    PubMed

    Liu, Chenli; Fu, Xiongfei; Liu, Lizhong; Ren, Xiaojing; Chau, Carlos K L; Li, Sihong; Xiang, Lu; Zeng, Hualing; Chen, Guanhua; Tang, Lei-Han; Lenz, Peter; Cui, Xiaodong; Huang, Wei; Hwa, Terence; Huang, Jian-Dong

    2011-10-14

    Periodic stripe patterns are ubiquitous in living organisms, yet the underlying developmental processes are complex and difficult to disentangle. We describe a synthetic genetic circuit that couples cell density and motility. This system enabled programmed Escherichia coli cells to form periodic stripes of high and low cell densities sequentially and autonomously. Theoretical and experimental analyses reveal that the spatial structure arises from a recurrent aggregation process at the front of the continuously expanding cell population. The number of stripes formed could be tuned by modulating the basal expression of a single gene. The results establish motility control as a simple route to establishing recurrent structures without requiring an extrinsic pacemaker.

  5. Temperature-Related Divergence in Experimental Populations of DROSOPHILA MELANOGASTER. I. Genetic and Developmental Basis of Wing Size and Shape Variation

    PubMed Central

    Cavicchi, Sandro; Guerra, Daniela; Giorgi, Gianfranco; Pezzoli, Cristina

    1985-01-01

    The effects of environmental temperature on wing size and shape of Drosophila melanogaster were analyzed in populations derived from an Oregon laboratory strain kept at three temperatures (18°, 25°, 28°) for 4 yr. Temperature-directed selection was identified for both wing size and shape. The length of the four longitudinal veins, used as a test for wing size variations in the different populations, appears to be affected by both genetic and maternal influences. Vein expression appears to be dependent upon developmental pattern of the wing: veins belonging to the same compartment are coordinated in their expression and relative position, whereas veins belonging to different compartments are not. Both wing and cell areas show genetic divergence, particularly in the posterior compartment. Cell number seems to compensate for cell size variations. Such compensation is carried out both at the level of single organisms and at the level of population as a whole. The two compartments behave as individual units of selection. PMID:17246257

  6. A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

    DOE PAGES

    Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.; ...

    2017-04-26

    Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

  7. Quantitative system drift compensates for altered maternal inputs to the gap gene network of the scuttle fly Megaselia abdita

    PubMed Central

    Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Janssens, Hilde; Alcaine-Colet, Anna; Lemke, Steffen; Schmidt-Ott, Urs; Jaeger, Johannes

    2015-01-01

    The segmentation gene network in insects can produce equivalent phenotypic outputs despite differences in upstream regulatory inputs between species. We investigate the mechanistic basis of this phenomenon through a systems-level analysis of the gap gene network in the scuttle fly Megaselia abdita (Phoridae). It combines quantification of gene expression at high spatio-temporal resolution with systematic knock-downs by RNA interference (RNAi). Initiation and dynamics of gap gene expression differ markedly between M. abdita and Drosophila melanogaster, while the output of the system converges to equivalent patterns at the end of the blastoderm stage. Although the qualitative structure of the gap gene network is conserved, there are differences in the strength of regulatory interactions between species. We term such network rewiring ‘quantitative system drift’. It provides a mechanistic explanation for the developmental hourglass model in the dipteran lineage. Quantitative system drift is likely to be a widespread mechanism for developmental evolution. DOI: http://dx.doi.org/10.7554/eLife.04785.001 PMID:25560971

  8. A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.

    Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

  9. Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

    PubMed Central

    Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

    2010-01-01

    Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

  10. Survey of O-GlcNAc level variations in Xenopus laevis from oogenesis to early development.

    PubMed

    Dehennaut, Vanessa; Lefebvre, Tony; Leroy, Yves; Vilain, Jean-Pierre; Michalski, Jean-Claude; Bodart, Jean-François

    2009-04-01

    Little is known about the impact of O-linked-N-acetylglucosaminylation (O-GlcNAc) in gametes production and developmental processes. Here we investigated changes in O-GlcNAc, UDP-GlcNAc and O-GlcNAc transferase (OGT) levels in Xenopus laevis from oogenesis to embryo hatching. We showed that in comparison to stage VI, stages I-V oocytes expressed higher levels of O-GlcNAc correlating changes in OGT expression, but not in UDP-GlcNAc pools. Upon progesterone stimulation, an O-GlcNAc level burst occurred during meiotic resumption long before MPF and Mos-Erk2 pathways activations. Finally, we observed high levels of O-GlcNAc, UDP-GlcNAc and OGT during segmentation that decreased concomitantly at the onset of gastrulation. Nevertheless, no correlation between the glycosylation, the nucleotide-sugar and the glycosyltransferase was observed after neurulation. Our results show that O-GlcNAc is regulated throughout oogenesis and development within a complex pattern and suggest that dysfunctions in the dynamics of this glycosylation could lead to developmental abnormalities.

  11. Molecular cloning, developmental expression, and cellular localization of the 70-kDa RPA-1 subunit of Drosophila melanogaster.

    PubMed

    Perdigão, J; Logarinho, E; Avides, M C; Sunkel, C E

    1999-12-01

    Replication protein A (RPA) is a highly conserved multifunctional heterotrimeric complex, involved in DNA replication, repair, recombination, and possibly transcription. Here, we report the cloning of the gene that codes for the largest subunit of the Drosophila melanogaster RPA homolog, dmRPA70. In situ hybridization showed that dmRPA70 RNA is present in developing embryos during the first 16 cycles. After this point, dm-RPA70 expression is downregulated in cells that enter a G1 phase and exit the mitotic cycle, becoming restricted to brief bursts of accumulation from late G1 to S phase. This pattern of regulated expression is also observed in the developing eye imaginal disc. In addition, we have shown that the presence of cyclin E is necessary and sufficient to drive the expression of dmRPA70 in embryonic cells arrested in G1 but is not required in tissues undergoing endoreduplication. Immunolocalization showed that in early developing embryos, the dmRPA70 protein associates with chromatin from the end of mitosis until the beginning of the next prophase in a dynamic speckled pattern that is strongly suggestive of its association with replication foci.

  12. Molecular characterization of cDNAs encoding G protein alpha and beta subunits and study of their temporal and spatial expression patterns in Nicotiana plumbaginifolia Viv.

    PubMed

    Kaydamov, C; Tewes, A; Adler, K; Manteuffel, R

    2000-04-25

    We have isolated cDNA sequences encoding alpha and beta subunits of potential G proteins from a cDNA library prepared from somatic embryos of Nicotiana plumbaginifolia Viv. at early developmental stages. The predicted NPGPA1 and NPGPB1 gene products are 75-98% identical to the known respective plant alpha and beta subunits. Southern hybridizations indicate that NPGPA1 is probably a single-copy gene, whereas at least two copies of NPGPB1 exist in the N. plumbaginifolia genome. Northern analyses reveal that both NPGPA1 and NPGPB1 mRNA are expressed in all embryogenic stages and plant tissues examined and their expression is obviously regulated by the plant hormone auxin. Immunohistological localization of NPGPalpha1 and NPGPbeta1 preferentially on plasma and endoplasmic reticulum membranes and their immunochemical detection exclusively in microsomal cell fractions implicate membrane association of both proteins. The temporal and spatial expression patterns of NPGPA1 and NPGPB1 show conformity as well as differences. This could account for not only cooperative, but also individual activities of both subunits during embryogenesis and plant development.

  13. Developmental patterns of expressive language hemispheric lateralization in children, adolescents and adults using functional near-infrared spectroscopy.

    PubMed

    Paquette, Natacha; Lassonde, Maryse; Vannasing, Phetsamone; Tremblay, Julie; González-Frankenberger, Berta; Florea, Olivia; Béland, Renée; Lepore, Franco; Gallagher, Anne

    2015-02-01

    The development of language hemispheric specialization is not well understood in young children, especially regarding expressive language functions. In this study, we investigated age-related changes in expressive language lateralization patterns in a population of children (3-6 and 7-10 years old), adolescents (11-16 years old), and young adults (19-30 years old). During functional near-infrared spectroscopy recordings, all participants performed a verbal fluency task, which consisted in naming as many words as possible belonging to a given semantic category. Hemoglobin concentration changes were measured in bilateral frontal and temporal cortical areas. During the language task, results showed a strong left hemisphere response along with weaker right hemisphere activation in all groups. Age-related increases in hemodynamic responses were found bilaterally, with younger children showing smaller hemodynamic responses than adolescents and adults in both hemispheres. Overall, these findings confirm that a left hemisphere specialization is already established in young children and persists through adulthood. Early left hemisphere specialization for expressive language suggests that language development hinges on structural and functional properties of the human brain with little reorganization occurring with development. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. OCTOPUS-LIKE 2, a novel player in Arabidopsis root and vascular development, reveals a key role for OCTOPUS family genes in root metaphloem sieve tube differentiation.

    PubMed

    Ruiz Sola, M Aguila; Coiro, Mario; Crivelli, Simona; Zeeman, Samuel C; Schmidt Kjølner Hansen, Signe; Truernit, Elisabeth

    2017-12-01

    Protophloem and metaphloem sieve tubes are essential for transporting carbohydrates and signalling molecules towards sink tissues. OCTOPUS (OPS) was previously identified as an important regulator of protophloem differentiation in Arabidopsis roots. Here, we investigated the role of OCTOPUS-LIKE 2 (OPL2), a gene homologous to OPS. OPL2 expression patterns were analysed, and functional equivalence of OPS and OPL2 was tested. Mutant and double mutant phenotypes were investigated. OPS and OPL2 displayed overlapping expression patterns and a high degree of functional overlap. A mutation in OPL2 revealed redundant functions of OPS and OPL2 in developmental processes in which OPS was known to play a role, notably cotyledon vascular patterning and protophloem development. Moreover, we also uncovered redundant roles for OPS and OPL2 in leaf vascular patterning and, most interestingly, metaphloem sieve tube differentiation. Our results reveal a novel OPS-like protein that, together with OPS, is an important regulator of vascular patterning, root growth and phloem development. OPS and OPL2 are the first genes identified that play a role in metaphloem sieve tube differentiation. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  15. Genome-wide characterization of the β-1,3-glucanase gene family in Gossypium by comparative analysis

    PubMed Central

    Xu, Xiaoyang; Feng, Yue; Fang, Shuai; Xu, Jun; Wang, Xinyu; Guo, Wangzhen

    2016-01-01

    The β-1,3-glucanase gene family is involved in a wide range of plant developmental processes as well as pathogen defense mechanisms. Comprehensive analyses of β-1,3-glucanase genes (GLUs) have not been reported in cotton. Here, we identified 67, 68, 130 and 158 GLUs in four sequenced cotton species, G. raimondii (D5), G. arboreum (A2), G. hirsutum acc. TM-1 (AD1), and G. barbadense acc. 3–79 (AD2), respectively. Cotton GLUs can be classified into the eight subfamilies (A–H), and their protein domain architecture and intron/exon structure are relatively conserved within each subfamily. Sixty-seven GLUs in G. raimondii were anchored onto 13 chromosomes, with 27 genes involved in segmental duplications, and 13 in tandem duplications. Expression patterns showed highly developmental and spatial regulation of GLUs in TM-1. In particular, the expression of individual member of GLUs in subfamily E was limited to roots, leaves, floral organs or fibers. Members of subfamily E also showed more protein evolution and subgenome expression bias compared with members of other subfamilies. We clarified that GLU42 and GLU43 in subfamily E were preferentially expressed in root and leaf tissues and significantly upregulated after Verticillium dahliae inoculation. Silencing of GLU42 and GLU43 significantly increased the susceptibility of cotton to V. dahliae. PMID:27353015

  16. Developmental patterns of emission of scent compounds and related gene expression in roses of the cultivar Rosa x hybrida cv. 'Yves Piaget'.

    PubMed

    Chen, Xiaomin; Baldermann, Susanne; Cao, Shuyan; Lu, Yao; Liu, Caixia; Hirata, Hiroshi; Watanabe, Naoharu

    2015-02-01

    2-Phenylethanol (2PE) and 3,5-dimethoxytoluene (DMT) are characteristic scent compounds in specific roses such as Rosa x hybrida cv. 'Yves Piaget'. We analyzed the endogenous concentrations and emission of 2PE and DMT during the unfurling process in different floral organs, as well as changes in transcript levels of the two key genes, PAR and OOMT2. The emission of both 2PE and DMT increased during floral development to reach peaks at the fully unfurled stage. The relative transcripts of PAR and OOMT2 also increased during floral development. Whereas the maximum for OOMT2 was found at the fully unfurled stage (stage 4), similar expression levels of PAR were detected at stage 4 and the senescence stage (stage 6). The results demonstrate a positive correlation between the expression levels of PAR and OOMT2 and the emission of 2PE and DMT. In addition, endogenous volatiles and relative transcripts showed tissue- and development-specific patterns. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  17. Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

    PubMed Central

    2012-01-01

    Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa) formed ten clusters of orthologous groups (COG) with genes from the monocot sorghum (Sorghum bicolor) and dicot Arabidopsis (Arabidopsis thaliana). The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS) classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic) or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in conjunction with lineage-specific or species-specific regulatory fine-tuners. This synergy may be critical for finer-scale spatio-temporal regulation, hence unique expression profiles of homologous transcription factors from different species with distinct zones of ecological adaptation such as rice, sorghum and Arabidopsis. The patterns revealed from these comparisons set the stage for further empirical validation by functional genomics. PMID:22992304

  18. Arabidopsis Gene Family Profiler (aGFP)--user-oriented transcriptomic database with easy-to-use graphic interface.

    PubMed

    Dupl'áková, Nikoleta; Renák, David; Hovanec, Patrik; Honysová, Barbora; Twell, David; Honys, David

    2007-07-23

    Microarray technologies now belong to the standard functional genomics toolbox and have undergone massive development leading to increased genome coverage, accuracy and reliability. The number of experiments exploiting microarray technology has markedly increased in recent years. In parallel with the rapid accumulation of transcriptomic data, on-line analysis tools are being introduced to simplify their use. Global statistical data analysis methods contribute to the development of overall concepts about gene expression patterns and to query and compose working hypotheses. More recently, these applications are being supplemented with more specialized products offering visualization and specific data mining tools. We present a curated gene family-oriented gene expression database, Arabidopsis Gene Family Profiler (aGFP; http://agfp.ueb.cas.cz), which gives the user access to a large collection of normalised Affymetrix ATH1 microarray datasets. The database currently contains NASC Array and AtGenExpress transcriptomic datasets for various tissues at different developmental stages of wild type plants gathered from nearly 350 gene chips. The Arabidopsis GFP database has been designed as an easy-to-use tool for users needing an easily accessible resource for expression data of single genes, pre-defined gene families or custom gene sets, with the further possibility of keyword search. Arabidopsis Gene Family Profiler presents a user-friendly web interface using both graphic and text output. Data are stored at the MySQL server and individual queries are created in PHP script. The most distinguishable features of Arabidopsis Gene Family Profiler database are: 1) the presentation of normalized datasets (Affymetrix MAS algorithm and calculation of model-based gene-expression values based on the Perfect Match-only model); 2) the choice between two different normalization algorithms (Affymetrix MAS4 or MAS5 algorithms); 3) an intuitive interface; 4) an interactive "virtual plant" visualizing the spatial and developmental expression profiles of both gene families and individual genes. Arabidopsis GFP gives users the possibility to analyze current Arabidopsis developmental transcriptomic data starting with simple global queries that can be expanded and further refined to visualize comparative and highly selective gene expression profiles.

  19. Neurogenesis and ontogeny of specific cell phenotypes within the hamster suprachiasmatic nucleus.

    PubMed

    Antle, Michael C; LeSauter, Joseph; Silver, Rae

    2005-06-09

    The hamster suprachiasmatic nucleus (SCN) is anatomically and functionally heterogeneous. A group of cells in the SCN shell, delineated by vasopressin-ergic neurons, are rhythmic with respect to Period gene expression and electrical activity but do not receive direct retinal input. In contrast, some cells in the SCN core, marked by neurons containing calbindin-D28k, gastrin-releasing peptide (GRP), substance P (SP), and vasoactive intestinal polypeptide (VIP), are not rhythmic with respect to Period gene expression and electrical activity but do receive direct retinal input. Examination of the timing of neurogenesis using bromodeoxyuridine indicates that SCN cells are born between embryonic day 9.5 and 12.5. Calbindin, GRP, substance P, and VIP cells are born only during early SCN neurogenesis, between embryonic days 9.5-11.0. Vasopressin cells are born over the whole period of SCN neurogenesis, appearing as late as embryonic day 12.5. Examination of the ontogeny of peptide expression in these cell types reveals transient expression of calbindin in a cluster of dorsolateral SCN cells on postnatal days 1-2. The adult pattern of calbindin expression is detected in a different ventrolateral cell cluster starting on postnatal day 2. GRP and SP expression appear on postnatal day 8 and 10, respectively, after the retinohypothalamic tract has innervated the SCN. In summary, the present study describes the ontogeny-specific peptidergic phenotypes in the SCN and compares these developmental patterns to previously identified patterns in the appearance of circadian functions. These comparisons suggest the possibility that these coincident appearances may be causally related, with the direction of causation to be determined.

  20. Sequencing of mRNA identifies re-expression of fetal splice variants in cardiac hypertrophy

    PubMed Central

    Ames, EG; Lawson, MJ; Mackey, AJ; Holmes, JW

    2013-01-01

    Cardiac hypertrophy has been well-characterized at the level of transcription. During cardiac hypertrophy, genes normally expressed primarily during fetal heart development are reexpressed, and this fetal gene program is believed to be a critical component of the hypertrophic process. Recently, alternative splicing of mRNA transcripts has been shown to be temporally regulated during heart development, leading us to consider whether fetal patterns of splicing also reappear during hypertrophy. We hypothesized that patterns of alternative splicing occurring during heart development are recapitulated during cardiac hypertrophy. Here we present a study of isoform expression during pressure-overload cardiac hypertrophy induced by 10 days of transverse aortic constriction (TAC) in rats and in developing fetal rat hearts compared to sham-operated adult rat hearts, using high-throughput sequencing of poly(A) tail mRNA. We find a striking degree of overlap between the isoforms expressed differentially in fetal and pressure-overloaded hearts compared to control: forty-four percent of the isoforms with significantly altered expression in TAC hearts are also expressed at significantly different levels in fetal hearts compared to control (P < 0.001). The isoforms that are shared between hypertrophy and fetal heart development are significantly enriched for genes involved in cytoskeletal organization, RNA processing, developmental processes, and metabolic enzymes. Our data strongly support the concept that mRNA splicing patterns normally associated with heart development recur as part of the hypertrophic response to pressure overload. These findings suggest that cardiac hypertrophy shares post-transcriptional as well as transcriptional regulatory mechanisms with fetal heart development. PMID:23688780

  1. Neuroimmune mechanisms of stress: sex differences, developmental plasticity, and implications for pharmacotherapy of stress-related disease

    PubMed Central

    Deak, Terrence; Quinn, Matt; Cidlowski, John A.; Victoria, Nicole C.; Murphy, Anne Z.; Sheridan, John F.

    2016-01-01

    The last decade has witnessed profound growth in studies examining the role of fundamental neuroimmune processes as key mechanisms that might form a natural bridge between normal physiology and pathological outcomes. Rooted in core concepts from psychoneuroimmunology, this review utilizes a succinct, exemplar-driven approach of several model systems that contribute significantly to our knowledge of the mechanisms by which neuroimmune processes interact with stress physiology. Specifically, we review recent evidence showing that (i) stress challenges produce time-dependent and stressor-specific patterns of cytokine/chemokine expression in the CNS; (ii) inflammation-related genes exhibit unique expression profiles in males and females depending upon individual, cooperative, or antagonistic interactions between steroid hormone receptors (Estrogen and Glucocorticoid receptors); (iii) adverse social experiences incurred through repeated social defeat engage a dynamic process of immune cell migration from the bone marrow to brain and prime neuroimmune function; and (iv) early developmental exposure to an inflammatory stimulus (carageenin injection into the hindpaw) has a lasting influence on stress reactivity across the lifespan. As such, the present review provides a theoretical framework for understanding the role that neuroimmune mechanisms might play in stress plasticity and pathological outcomes, while at the same time pointing toward features of the individual (sex, developmental experience, stress history) that might ultimately be used for the development of personalized strategies for therapeutic intervention in stress-related pathologies. PMID:26176590

  2. Lack of genetic interaction between Tbx20 and Tbx3 in early mouse heart development.

    PubMed

    Gavrilov, Svetlana; Harvey, Richard P; Papaioannou, Virginia E

    2013-01-01

    Members of the T-box family of transcription factors are important regulators orchestrating the complex regionalization of the developing mammalian heart. Individual mutations in Tbx20 and Tbx3 cause distinct congenital heart abnormalities in the mouse: Tbx20 mutations result in failure of heart looping, developmental arrest and lack of chamber differentiation, while hearts of Tbx3 mutants progress further, loop normally but show atrioventricular convergence and outflow tract defects. The two genes have overlapping areas of expression in the atrioventricular canal and outflow tract of the heart but their potential genetic interaction has not been previously investigated. In this study we produced compound mutants to investigate potential genetic interactions at the earliest stages of heart development. We find that Tbx20; Tbx3 double heterozygous mice are viable and fertile with no apparent abnormalities, while double homozygous mutants are embryonic lethal by midgestation. Double homozygous mutant embryos display abnormal cardiac morphogenesis, lack of heart looping, expression patterns of cardiac genes and time of death that are indistinguishable from Tbx20 homozygous mutants. Prior to death, the double homozygotes show an overall developmental delay similar to Tbx3 homozygous mutants. Thus the effects of Tbx20 are epistatic to Tbx3 in the heart but Tbx3 is epistatic to Tbx20 with respect to developmental delay.

  3. Neuroimmune mechanisms of stress: sex differences, developmental plasticity, and implications for pharmacotherapy of stress-related disease.

    PubMed

    Deak, Terrence; Quinn, Matt; Cidlowski, John A; Victoria, Nicole C; Murphy, Anne Z; Sheridan, John F

    2015-01-01

    The last decade has witnessed profound growth in studies examining the role of fundamental neuroimmune processes as key mechanisms that might form a natural bridge between normal physiology and pathological outcomes. Rooted in core concepts from psychoneuroimmunology, this review utilizes a succinct, exemplar-driven approach of several model systems that contribute significantly to our knowledge of the mechanisms by which neuroimmune processes interact with stress physiology. Specifically, we review recent evidence showing that (i) stress challenges produce time-dependent and stressor-specific patterns of cytokine/chemokine expression in the CNS; (ii) inflammation-related genes exhibit unique expression profiles in males and females depending upon individual, cooperative or antagonistic interactions between steroid hormone receptors (estrogen and glucocorticoid receptors); (iii) adverse social experiences incurred through repeated social defeat engage a dynamic process of immune cell migration from the bone marrow to brain and prime neuroimmune function and (iv) early developmental exposure to an inflammatory stimulus (carageenin injection into the hindpaw) has a lasting influence on stress reactivity across the lifespan. As such, the present review provides a theoretical framework for understanding the role that neuroimmune mechanisms might play in stress plasticity and pathological outcomes, while at the same time pointing toward features of the individual (sex, developmental experience, stress history) that might ultimately be used for the development of personalized strategies for therapeutic intervention in stress-related pathologies.

  4. Transcriptome Dynamics during Maize Endosperm Development

    PubMed Central

    Feng, Jiaojiao; Xu, Shutu; Wang, Lei; Li, Feifei; Li, Yibo; Zhang, Renhe; Zhang, Xinghua; Xue, Jiquan; Guo, Dongwei

    2016-01-01

    The endosperm is a major organ of the seed that plays vital roles in determining seed weight and quality. However, genome-wide transcriptome patterns throughout maize endosperm development have not been comprehensively investigated to date. Accordingly, we performed a high-throughput RNA sequencing (RNA-seq) analysis of the maize endosperm transcriptome at 5, 10, 15 and 20 days after pollination (DAP). We found that more than 11,000 protein-coding genes underwent alternative splicing (AS) events during the four developmental stages studied. These genes were mainly involved in intracellular protein transport, signal transmission, cellular carbohydrate metabolism, cellular lipid metabolism, lipid biosynthesis, protein modification, histone modification, cellular amino acid metabolism, and DNA repair. Additionally, 7,633 genes, including 473 transcription factors (TFs), were differentially expressed among the four developmental stages. The differentially expressed TFs were from 50 families, including the bZIP, WRKY, GeBP and ARF families. Further analysis of the stage-specific TFs showed that binding, nucleus and ligand-dependent nuclear receptor activities might be important at 5 DAP, that immune responses, signalling, binding and lumen development are involved at 10 DAP, that protein metabolic processes and the cytoplasm might be important at 15 DAP, and that the responses to various stimuli are different at 20 DAP compared with the other developmental stages. This RNA-seq analysis provides novel, comprehensive insights into the transcriptome dynamics during early endosperm development in maize. PMID:27695101

  5. Sox2: A multitasking networker

    PubMed Central

    Reiprich, Simone; Wegner, Michael

    2014-01-01

    The transcription factor Sox2 is best known as a pluripotency factor in stem and precursor cells and its expression generally correlates with an undifferentiated state. Proposed modes of action include those as classical transcription factor and pre-patterning factor with influence on histone modifications and chromatin structure. Recently, we provided the first detailed analysis of Sox2 expression and function during development of oligodendrocytes, the myelin-forming cells of the CNS. Surprisingly, we found evidence for a role of Sox2 as differentiation factor and found it to act through modulation of microRNA levels. Thus, we add new facets to the functional repertoire of Sox2 and throw light on the networking activity of this multitasking developmental regulator. PMID:27502481

  6. Preprotachykinin A mRNA expression in the rat brain during development.

    PubMed

    Brené, S; Lindefors, N; Friedman, W J; Persson, H

    1990-12-15

    Expression of preprotachykinin A (PPT-A) mRNA was analyzed by northern blots using mRNA prepared from rat brain at 12 different developmental stages ranging from embryonic day 15 (E15) to adult. A single PPT-A mRNA of 1.3 kb was detected throughout development. PPT-A mRNA was detected as early as E15 and an approximately 3-fold increase occurred at birth. This amount remained until 3 weeks of age when the level increased, reaching a peak at 5 weeks of age. Adult amounts were approximately 3-fold higher than the levels at birth. The distribution of PPT-A mRNA-expressing cells in rat brain was studied by in situ hybridization on sections from embryonic day 20, postnatal days 4 and 7 as well as adult. Cells expressing PPT-A mRNA were detected in the forebrain at all 4 ages analyzed. However, the hybridization pattern and the labeling intensity varied in different brain regions during development. In cingulate cortex, intense labeling was seen in numerous cells at embryonic day 20 and postnatal days 4 and 7, whereas in the adult cingulate cortex only a few scattered labeled cells were observed. In frontoparietal cortex labeled cells were found from postnatal day 4 to adult, with the highest density of labeled cells at P7. Developmental differences in both the distribution of PPT-A mRNA-expressing cells and the level of PPT-A mRNA expression were also found in caudate-putamen, lateral hypothalamus and amygdala. Thus, our results show several changes in PPT-A mRNA expression during ontogeny, indicating a region and time-specific regulation of PPT-A mRNA expression during brain maturation.

  7. Expression of the Hsp23 chaperone during Drosophila embryogenesis: association to distinct neural and glial lineages

    PubMed Central

    Michaud, Sébastien; Tanguay, Robert M

    2003-01-01

    Background In addition to their strong induction following stress, small heat shock proteins (Hsp) are also expressed during development in a wide variety of organisms. However, the precise identity of cell(s) expressing these proteins and the functional contribution of small heat shock proteins in such developmental context remain to be determined. The present study provides a detailed description of the Drosophila small heat shock protein Hsp23 expression pattern during embryogenesis and evaluates its functional contribution to central nervous system development. Results Throughout embryogenesis, Hsp23 is expressed in a stage-specific manner by a restricted number of neuronal and glial lineages of the central nervous system. Hsp23 is also detected in the amnioserosa and within a single lateral chordotonal organ. Its expression within the MP2 lineage does not require the presence of a functional midline nor the activity of the Notch signaling pathway. Transactivation assays demonstrate that transcription factors implicated in the differentiation of the midline also regulate hsp23 promoter activity. Phenotypic analysis of a transgenic line exhibiting loss of Hsp23 expression in the central nervous system suggests that Hsp23 is not required for development and function of this tissue. Likewise, its overexpression does not cause deleterious effects, as development remains unaffected. Conclusions Based on the presented data, we suggest that the tightly regulated developmental expression of Hsp23 is not actively involved in cell differentiation and central nervous system development per se but rather reflects a putative role in preventive "pre-stress" neuroprotection or in non-vital process(es) common to the identified cell lineages. PMID:14617383

  8. Stage-specific expression of DDX4 and c-kit at different developmental stages of the porcine testis.

    PubMed

    Lee, Ran; Lee, Won-Young; Park, Hyun-Jung; Ha, Woo-Tae; Woo, Jae-Seok; Chung, Hak-Jae; Lee, Ji-Heon; Hong, Kwonho; Song, Hyuk

    2018-03-01

    Spermatogenesis begins with spermatogonial stem cells (SSCs), which are located in the basement membrane of the adult testes. Previous studies have described specific biomarkers for undifferentiated porcine spermatogonia or SSCs; however, these markers are not sufficient to understand spermatogenesis at different developmental stages. The objective of this study was characterize the expression of DEAD-Box polypeptide 4 (DDX4, also known as VASA) and tyrosine-protein kinase kit (c-kit), as potential markers of male germ cells in the porcine testis. In porcine testis tissue at prepubertal stages (5, 30, and 60 days), DDX4 and c-kit protein expression was detected in the most undifferentiated spermatogonia, which also express protein gene product 9.5 (PGP9.5). However, in porcine testis tissues from pubertal and postpubertal stages (90, 120, and 150 days), DDX4 and c-kit were not detected in PGP9.5-positive undifferentiated spermatogonia. The DDX4 expression pattern was similar to that of c-kit in the porcine testis. In adult porcine testes, DDX4-expressing cells were located on the lumenal side, compared to synaptonemal complex protein 3-positive primary spermatocytes, but DDX-4 was not co-expressed with acrosin, a known acrosome marker. In addition, DDX4 was detected in PGP9.5-expressing porcine SSCs in culture. Based on our results, we suggest that DDX4 and c-kit are putative markers of undifferentiated spermatogonia in the prepubertal porcine testis. While in the postpubertal porcine testis, they are markers of differentiated spermatocytes. These findings may facilitate future studies of porcine spermatogenesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    PubMed

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. The movement patterns used to rise from a supine position by children with developmental delay and age-related differences in these.

    PubMed

    Hsue, Bih-Jen; Wang, Yun-Er; Chen, Yung-Jung

    2014-09-01

    The purposes of this study were to determine (1) movement patterns and strategies of children with mild to moderate developmental delay (DD) used to rise up and how they differ from those used by age-matched children with typical development (TD), (2) whether the movement patterns differ with age in children with DD, and (3) to determine the developmental sequences for the UE, AX and LE in children with DD and whether they are different from those used by children with TD. Sixty six children with TD and 31 children with DD aged two to six years were recruited. Peabody Developmental Motor Scale II (PDMS-2) was used to determine the motor performance level. The participants were recorded during rising for at least five repetitions. Two trained pediatric physical therapists viewed each video recording and classified the movement patterns of the upper extremities (UE), trunk/axial (AX) and lower extremities (LE) regions using descriptive categories developed by previous researchers. The DD and TD groups were further divided into four subgroups each using a one-year interval. The percentage of occurrence of the each UE, AX and LE movement was determined and compared across subgroups, and between each age-matched pair of TD and DD groups. The results demonstrated that the participants in the TD group clearly followed the proposed developmental sequence and the children with DD followed the developmental sequences but with different maturation speeds and greater variability, especially at the age of three to five years. The most common movement patterns used by the children in each of the DD subgroups were at least one developmental categorical pattern behind those used by the age-matched children with TD before five years old, except for the LE region. In the DD group, the movement patterns had moderate to high correlation with the child's motor performance level, indicating that the children with better motor performances used more developmentally advanced patterns in comparison with those with lower scores. However, besides motor maturity, numerous other intrinsic/extrinsic factors may affect the child's performance of this task. The information obtained in this study would assist therapists when working with the children with DD, so that they can provide individualized treatment rather than guiding all such children toward a single, mature pattern. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions.

    PubMed

    Guo, Guangyu; Xu, Kun; Zhang, Xiaomei; Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

    2015-01-01

    The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth.

  12. Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions

    PubMed Central

    Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

    2015-01-01

    The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth. PMID:26371882

  13. Alternative life histories shape brain gene expression profiles in males of the same population

    USGS Publications Warehouse

    Aubin-Horth, N.; Landry, C.R.; Letcher, B.H.; Hofmann, H.A.

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker. ?? 2005 The Royal Society.

  14. Alternative life histories shape brain gene expression profiles in males of the same population

    PubMed Central

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative ‘sneaker’ tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the ‘default’ life cycle, may actually result from an active inhibition of development into a sneaker. PMID:16087419

  15. Alternative life histories shape brain gene expression profiles in males of the same population.

    PubMed

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-08-22

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker.

  16. An ancient dental gene set governs development and continuous regeneration of teeth in sharks.

    PubMed

    Rasch, Liam J; Martin, Kyle J; Cooper, Rory L; Metscher, Brian D; Underwood, Charlie J; Fraser, Gareth J

    2016-07-15

    The evolution of oral teeth is considered a major contributor to the overall success of jawed vertebrates. This is especially apparent in cartilaginous fishes including sharks and rays, which develop elaborate arrays of highly specialized teeth, organized in rows and retain the capacity for life-long regeneration. Perpetual regeneration of oral teeth has been either lost or highly reduced in many other lineages including important developmental model species, so cartilaginous fishes are uniquely suited for deep comparative analyses of tooth development and regeneration. Additionally, sharks and rays can offer crucial insights into the characters of the dentition in the ancestor of all jawed vertebrates. Despite this, tooth development and regeneration in chondrichthyans is poorly understood and remains virtually uncharacterized from a developmental genetic standpoint. Using the emerging chondrichthyan model, the catshark (Scyliorhinus spp.), we characterized the expression of genes homologous to those known to be expressed during stages of early dental competence, tooth initiation, morphogenesis, and regeneration in bony vertebrates. We have found that expression patterns of several genes from Hh, Wnt/β-catenin, Bmp and Fgf signalling pathways indicate deep conservation over ~450 million years of tooth development and regeneration. We describe how these genes participate in the initial emergence of the shark dentition and how they are redeployed during regeneration of successive tooth generations. We suggest that at the dawn of the vertebrate lineage, teeth (i) were most likely continuously regenerative structures, and (ii) utilised a core set of genes from members of key developmental signalling pathways that were instrumental in creating a dental legacy redeployed throughout vertebrate evolution. These data lay the foundation for further experimental investigations utilizing the unique regenerative capacity of chondrichthyan models to answer evolutionary, developmental, and regenerative biological questions that are impossible to explore in classical models. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Laminin promotes vascular network formation in 3D in vitro collagen scaffolds by regulating VEGF uptake.

    PubMed

    Stamati, Katerina; Priestley, John V; Mudera, Vivek; Cheema, Umber

    2014-09-10

    Angiogenesis is an essential neovascularisation process, which if recapitulated in 3D in vitro, will provide better understanding of endothelial cell (EC) behaviour. Various cell types and growth factors are involved, with vascular endothelial growth factor (VEGF) and its receptors VEGFR1 and VEGFR2 key components. We were able to control the aggregation pattern of ECs in 3D collagen hydrogels, by varying the matrix composition and/or having a source of cells signalling angiogenic proteins. These aggregation patterns reflect the different developmental pathways that ECs take to form different sized tubular structures. Cultures with added laminin and thus increased expression of α6 integrin showed a significant increase (p<0.05) in VEGFR2 positive ECs and increased VEGF uptake. This resulted in the end-to-end network aggregation of ECs. In cultures without laminin and therefore low α6 integrin expression, VEGFR2 levels and VEGF uptake were significantly lower (p<0.05). These ECs formed contiguous sheets, analogous to the 'wrapping' pathway in development. We have identified a key linkage between integrin expression on ECs and their uptake of VEGF, regulated by VEGFR2, resulting in different aggregation patterns in 3D. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Spatially Restricted and Developmentally Dynamic Expression of Engrailed Genes in Multiple Cerebellar Cell Types

    PubMed Central

    Wilson, Sandra L.; Kalinovsky, Anna; Orvis, Grant D.

    2011-01-01

    The cerebellum is a highly organized structure partitioned into lobules along the anterior–posterior (A-P) axis and into striped molecular domains along the medial–lateral (M-L) axis. The Engrailed (En) homeobox genes are required for patterning the morphological and molecular domains along both axes, as well as for the establishment of the normal afferent topography required to generate a fully functional cerebellum. As a means to understand how the En genes regulate multiple levels of cerebellum construction, we characterized En1 and En2 expression around birth and at postnatal day (P)21 during the period when the cerebellum undergoes a remarkable transformation from a smooth ovoid structure to a highly foliated structure. We show that both En1 and En2 are expressed in many neuronal cell types in the cerebellum, and expression persists until at least P21. En1 and En2 expression, however, undergoes profound changes in their cellular and spatial distributions between embryonic stages and P21, and their expression domains become largely distinct. Comparison of the distribution of En-expressing Purkinje cells relative to early- and late-onset Purkinje cell M-L stripe proteins revealed that although En1- and En2-expressing Purkinje cell domains do not strictly align with those of ZEBRINII at P21, a clear pattern exists that is most evident at E17.5 by an inverse correlation between the level of En2 expression and PLCβ4 and EPHA4. PMID:21431469

  19. Development of the central nervous system in the larvacean Oikopleura dioica and the evolution of the chordate brain.

    PubMed

    Cañestro, Cristian; Bassham, Susan; Postlethwait, John

    2005-09-15

    In non-vertebrate chordates, central nervous system (CNS) development has been studied in only two taxa, the Cephalochordata and a single Class (Ascidiacea) of the morphologically diverse Urochordata. To understand development and molecular regionalization of the brain in a different deeply diverging chordate clade, we isolated and determined the expression patterns of orthologs of vertebrate CNS markers (otxa, otxb, otxc, pax6, pax2/5/8a, pax2/5/8b, engrailed, and hox1) in Oikopleura dioica (Subphylum Urochordata, Class Larvacea). The three Oikopleura otx genes are expressed similarly to vertebrate Otx paralogs, demonstrating that trans-homologs converged on similar evolutionary outcomes by independent neo- or subfunctionalization processes during the evolution of the two taxa. This work revealed that the Oikopleura CNS possesses homologs of the vertebrate forebrain, hindbrain, and spinal cord, but not the midbrain. Comparing larvacean gene expression patterns to published results in ascidians disclosed important developmental differences and similarities that suggest mechanisms of development likely present in their last common ancestor. In contrast to ascidians, the lack of a radical reorganization of the CNS as larvaceans become adults allows us to relate embryonic gene expression patterns to three subdivisions of the adult anterior brain. Our study of the Oikopleura brain provides new insights into chordate CNS evolution: first, the absence of midbrain is a urochordate synapomorphy and not a peculiarity of ascidians, perhaps resulting from their drastic CNS metamorphosis; second, there is no convincing evidence for a homolog of a midbrain-hindbrain boundary (MHB) organizer in urochordates; and third, the expression pattern of "MHB-genes" in the urochordate hindbrain suggests that they function in the development of specific neurons rather than in an MHB organizer.

  20. Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

    PubMed

    Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

    2011-01-01

    The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

  1. Developmental pattern of diacylglycerol lipase-α (DAGLα) immunoreactivity in brain regions important for song learning and control in the zebra finch (Taeniopygia guttata).

    PubMed

    Soderstrom, Ken; Wilson, Ashley R

    2013-11-01

    Zebra finch song is a learned behavior dependent upon successful progress through a sensitive period of late-postnatal development. This learning is associated with maturation of distinct brain nuclei and the fiber tract interconnections between them. We have previously found remarkably distinct and dense CB1 cannabinoid receptor expression within many of these song control brain regions, implying a normal role for endocannabinoid signaling in vocal learning. Activation of CB1 receptors via daily treatments with exogenous agonist during sensorimotor stages of song learning (but not in adulthood) results in persistent alteration of song patterns. Now we are working to understand physiological changes responsible for this cannabinoid-altered vocal learning. We have found that song-altering developmental treatments are associated with changes in expression of endocannabinoid signaling elements, including CB1 receptors and the principal CNS endogenous agonist, 2-AG. Within CNS, 2-AG is produced largely through activity of the α isoform of the enzyme diacylglycerol lipase (DAGLα). To better appreciate the role of 2-AG production in normal vocal development we have determined the spatial distribution of DAGLα expression within zebra finch CNS during vocal development. Early during vocal development at 25 days, DAGLα staining is typically light and of fibroid processes. Staining peaks late in the sensorimotor stage of song learning at 75 days and is characterized by fiber, neuropil and some staining of both small and large cell somata. Results provide insight to the normal role for endocannabinoid signaling in the maturation of brain regions responsible for song learning and vocal-motor output, and suggest mechanisms by which exogenous cannabinoid exposure alters acquisition of this form of vocal communication. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Developmental variation, homology, and the pharyngula stage.

    PubMed

    Collazo, A

    2000-03-01

    Understanding how development varies both inter- and intraspecifically can be important for systematic and evolutionary studies. This review will explore three different ways such understanding can be applied to evolutionary analyses. First, developmental data can be useful for homology determination. Interspecific variation in development has been thought to make developmental data poor candidates for determining homology. However, an updated developmental criterion that is more broadly comparative and mechanistic augments the available criteria used in homology determination. Second, modern cell and molecular biology are providing a better understanding of the many developmental processes involved in a structure's formation and will augment the number of characters available for phylogenetic analyses. Recent work has revealed that what had been thought to be a highly conserved developmental stage, the pharyngula (the phylotypic and zootypic stage of craniates) is highly variable. This variation can be seen in the development of such tissues as neural crest and placodes. These tissues are particularly interesting from a phylogenetic standpoint because they and the structures they form contribute to key synapomorphies of craniates. Finally, understanding developmental processes and how they form the variety of morphologies seen in nature will help in constructing the transformations that occurred during evolution. One such example involves descriptions of how lateral line development is affected in different mutant lines of zebrafish. The many species of teleost fishes express great variation in the patterns of their lateral lines, and this is often an important systematic character. Understanding the genetic basis of lateral line development would help not only in hypothesizing possible transformational series but also in determining how many genes may have been required for these transformations.

  3. Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

    PubMed

    Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

    2012-06-01

    In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

  4. The ANISEED database: digital representation, formalization, and elucidation of a chordate developmental program.

    PubMed

    Tassy, Olivier; Dauga, Delphine; Daian, Fabrice; Sobral, Daniel; Robin, François; Khoueiry, Pierre; Salgado, David; Fox, Vanessa; Caillol, Danièle; Schiappa, Renaud; Laporte, Baptiste; Rios, Anne; Luxardi, Guillaume; Kusakabe, Takehiro; Joly, Jean-Stéphane; Darras, Sébastien; Christiaen, Lionel; Contensin, Magali; Auger, Hélène; Lamy, Clément; Hudson, Clare; Rothbächer, Ute; Gilchrist, Michael J; Makabe, Kazuhiro W; Hotta, Kohji; Fujiwara, Shigeki; Satoh, Nori; Satou, Yutaka; Lemaire, Patrick

    2010-10-01

    Developmental biology aims to understand how the dynamics of embryonic shapes and organ functions are encoded in linear DNA molecules. Thanks to recent progress in genomics and imaging technologies, systemic approaches are now used in parallel with small-scale studies to establish links between genomic information and phenotypes, often described at the subcellular level. Current model organism databases, however, do not integrate heterogeneous data sets at different scales into a global view of the developmental program. Here, we present a novel, generic digital system, NISEED, and its implementation, ANISEED, to ascidians, which are invertebrate chordates suitable for developmental systems biology approaches. ANISEED hosts an unprecedented combination of anatomical and molecular data on ascidian development. This includes the first detailed anatomical ontologies for these embryos, and quantitative geometrical descriptions of developing cells obtained from reconstructed three-dimensional (3D) embryos up to the gastrula stages. Fully annotated gene model sets are linked to 30,000 high-resolution spatial gene expression patterns in wild-type and experimentally manipulated conditions and to 528 experimentally validated cis-regulatory regions imported from specialized databases or extracted from 160 literature articles. This highly structured data set can be explored via a Developmental Browser, a Genome Browser, and a 3D Virtual Embryo module. We show how integration of heterogeneous data in ANISEED can provide a system-level understanding of the developmental program through the automatic inference of gene regulatory interactions, the identification of inducing signals, and the discovery and explanation of novel asymmetric divisions.

  5. Parental effects in ecology and evolution: mechanisms, processes and implications

    PubMed Central

    Badyaev, Alexander V.; Uller, Tobias

    2009-01-01

    As is the case with any metaphor, parental effects mean different things to different biologists—from developmental induction of novel phenotypic variation to an evolved adaptation, and from epigenetic transference of essential developmental resources to a stage of inheritance and ecological succession. Such a diversity of perspectives illustrates the composite nature of parental effects that, depending on the stage of their expression and whether they are considered a pattern or a process, combine the elements of developmental induction, homeostasis, natural selection, epigenetic inheritance and historical persistence. Here, we suggest that by emphasizing the complexity of causes and influences in developmental systems and by making explicit the links between development, natural selection and inheritance, the study of parental effects enables deeper understanding of developmental dynamics of life cycles and provides a unique opportunity to explicitly integrate development and evolution. We highlight these perspectives by placing parental effects in a wider evolutionary framework and suggest that far from being only an evolved static outcome of natural selection, a distinct channel of transmission between parents and offspring, or a statistical abstraction, parental effects on development enable evolution by natural selection by reliably transferring developmental resources needed to reconstruct, maintain and modify genetically inherited components of the phenotype. The view of parental effects as an essential and dynamic part of an evolutionary continuum unifies mechanisms behind the origination, modification and historical persistence of organismal form and function, and thus brings us closer to a more realistic understanding of life's complexity and diversity. PMID:19324619

  6. The ANISEED database: Digital representation, formalization, and elucidation of a chordate developmental program

    PubMed Central

    Tassy, Olivier; Dauga, Delphine; Daian, Fabrice; Sobral, Daniel; Robin, François; Khoueiry, Pierre; Salgado, David; Fox, Vanessa; Caillol, Danièle; Schiappa, Renaud; Laporte, Baptiste; Rios, Anne; Luxardi, Guillaume; Kusakabe, Takehiro; Joly, Jean-Stéphane; Darras, Sébastien; Christiaen, Lionel; Contensin, Magali; Auger, Hélène; Lamy, Clément; Hudson, Clare; Rothbächer, Ute; Gilchrist, Michael J.; Makabe, Kazuhiro W.; Hotta, Kohji; Fujiwara, Shigeki; Satoh, Nori; Satou, Yutaka; Lemaire, Patrick

    2010-01-01

    Developmental biology aims to understand how the dynamics of embryonic shapes and organ functions are encoded in linear DNA molecules. Thanks to recent progress in genomics and imaging technologies, systemic approaches are now used in parallel with small-scale studies to establish links between genomic information and phenotypes, often described at the subcellular level. Current model organism databases, however, do not integrate heterogeneous data sets at different scales into a global view of the developmental program. Here, we present a novel, generic digital system, NISEED, and its implementation, ANISEED, to ascidians, which are invertebrate chordates suitable for developmental systems biology approaches. ANISEED hosts an unprecedented combination of anatomical and molecular data on ascidian development. This includes the first detailed anatomical ontologies for these embryos, and quantitative geometrical descriptions of developing cells obtained from reconstructed three-dimensional (3D) embryos up to the gastrula stages. Fully annotated gene model sets are linked to 30,000 high-resolution spatial gene expression patterns in wild-type and experimentally manipulated conditions and to 528 experimentally validated cis-regulatory regions imported from specialized databases or extracted from 160 literature articles. This highly structured data set can be explored via a Developmental Browser, a Genome Browser, and a 3D Virtual Embryo module. We show how integration of heterogeneous data in ANISEED can provide a system-level understanding of the developmental program through the automatic inference of gene regulatory interactions, the identification of inducing signals, and the discovery and explanation of novel asymmetric divisions. PMID:20647237

  7. The expression of the cerato-platanin gene is related to hyphal growth and chlamydospores formation in Ceratocystis platani.

    PubMed

    Baccelli, Ivan; Comparini, Cecilia; Bettini, Priscilla P; Martellini, Federica; Ruocco, Michelina; Pazzagli, Luigia; Bernardi, Rodolfo; Scala, Aniello

    2012-02-01

    Cerato-platanin (CP) is a protein produced by Ceratocystis platani, the causal agent of canker stain disease of plane trees. CP is the first member of the 'cerato-platanin family', and its role as a pathogen-associated molecular pattern (PAMP), inducing defence responses both in host and nonhost plants, is established. However, the primary role of CP and its homologues in the fungal life remains unknown. In the present work, we investigated the regulation of the cp gene during the in vitro growth of C. platani in different conditions and under the effect of potential stress factors. Fungal growth and conidiogenesis were also analysed. Results showed that cp is a single-copy gene whose expression level is strictly associated with hyphal growth and with chlamydospores formation. The analysis of a 1368 bp 5'-flanking region revealed putative motifs that could be involved in the regulation of gene expression in response to stress and developmental cues. Taking into account the localization of CP in the fungal cell wall and the recently published 3D structure of the protein, our results support a role for CP in growth and developmental processes of C. platani. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

    PubMed

    Traeger, Stefanie; Nowrousian, Minou

    2015-04-14

    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

  9. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

    PubMed Central

    Traeger, Stefanie; Nowrousian, Minou

    2015-01-01

    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

  10. Differential Expression of Histone H3.3 Genes and Their Role in Modulating Temperature Stress Response in Caenorhabditis elegans.

    PubMed

    Delaney, Kamila; Mailler, Jonathan; Wenda, Joanna M; Gabus, Caroline; Steiner, Florian A

    2018-04-10

    Replication-independent variant histones replace canonical histones in nucleosomes and act as important regulators of chromatin function. H3.3 is a major variant of histone H3 that is remarkably conserved across all taxa and is distinguished from canonical H3 by just four key amino acids. Most genomes contain two or more genes expressing H3.3, and complete loss of the protein usually causes sterility or embryonic lethality. Here we investigated the developmental expression pattern of the five Caenorhabditis elegans H3.3 homologues and identified two previously uncharacterized homologues to be restricted to the germ line. We demonstrate an essential role for the conserved histone chaperone HIRA in the nucleosomal loading of all H3.3 variants. This requirement can be bypassed by mutation of the H3.3-specific residues to those found in H3. Analysis of H3.3 knockout mutants revealed a surprising absence of developmental phenotypes. While removal of all H3.3 homologues did not result in lethality, it led to reduced fertility and viability in response to high temperature stress. Our results thus show that H3.3 is non-essential in C. elegans , but is critical for ensuring adequate response to stress. Copyright © 2018, Genetics.

  11. Neurocranium versus Face: A Morphometric Approach with Classical Anthropometric Variables for Characterizing Patterns of Cranial Integration in Extant Hominoids and Extinct Hominins

    PubMed Central

    Pérez-Claros, Juan Antonio; Jiménez-Arenas, Juan Manuel; Palmqvist, Paul

    2015-01-01

    The relative importance of the two main cranial complexes, the neurocranium and the splanchnocranium, has been examined in the five species of extant hominoids and in a huge sample of extinct hominins using six standard craniometric variables that measure the length, width and height of each cranial module. Factor analysis and two-block partial least squares were used for establishing the major patterns of developmental and evolutionary integration between both cranial modules. The results obtained show that all extant hominoids (including the anatomically modern humans) share a conserved pattern of developmental integration, a result that agrees with previous studies. The pattern of evolutionary integration between both cranial modules in australopiths runs in parallel to developmental integration. In contrast, the pattern of evolutionary and developmental integration of the species of the genus Homo is the opposite, which is probably the consequence of distinctive selective regimes for both hominin groups. PMID:26177535

  12. Neurocranium versus Face: A Morphometric Approach with Classical Anthropometric Variables for Characterizing Patterns of Cranial Integration in Extant Hominoids and Extinct Hominins.

    PubMed

    Pérez-Claros, Juan Antonio; Jiménez-Arenas, Juan Manuel; Palmqvist, Paul

    2015-01-01

    The relative importance of the two main cranial complexes, the neurocranium and the splanchnocranium, has been examined in the five species of extant hominoids and in a huge sample of extinct hominins using six standard craniometric variables that measure the length, width and height of each cranial module. Factor analysis and two-block partial least squares were used for establishing the major patterns of developmental and evolutionary integration between both cranial modules. The results obtained show that all extant hominoids (including the anatomically modern humans) share a conserved pattern of developmental integration, a result that agrees with previous studies. The pattern of evolutionary integration between both cranial modules in australopiths runs in parallel to developmental integration. In contrast, the pattern of evolutionary and developmental integration of the species of the genus Homo is the opposite, which is probably the consequence of distinctive selective regimes for both hominin groups.

  13. Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes

    PubMed Central

    2010-01-01

    Background Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Results Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. Conclusions This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research. PMID:20416061

  14. Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes.

    PubMed

    Tarver, Matthew R; Zhou, Xuguo; Scharf, Michael E

    2010-04-23

    Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research.

  15. Histone deacetylase expression patterns in developing murine optic nerve

    PubMed Central

    2014-01-01

    Background Histone deacetylases (HDACs) play important roles in glial cell development and in disease states within multiple regions of the central nervous system. However, little is known about HDAC expression or function within the optic nerve. As a first step in understanding the role of HDACs in optic nerve, this study examines the spatio-temporal expression patterns of methylated histone 3 (K9), acetylated histone 3 (K18), and HDACs 1–6 and 8–11 in the developing murine optic nerve head. Results Using RT-qPCR, western blot and immunofluorescence, three stages were analyzed: embryonic day 16 (E16), when astrocyte precursors are found in the optic stalk, postnatal day 5 (P5), when immature astrocytes and oligodendrocytes are found throughout the optic nerve, and P30, when optic nerve astrocytes and oligodendrocytes are mature. Acetylated and methylated histone H3 immunoreactivity was co-localized in the nuclei of most SOX2 positive glia within the optic nerve head and adjacent optic nerve at all developmental stages. HDACs 1–11 were expressed in the optic nerve glial cells at all three stages of optic nerve development in the mouse, but showed temporal differences in overall levels and subcellular localization. HDACs 1 and 2 were predominantly nuclear throughout optic nerve development and glial cell maturation. HDACs 3, 5, 6, 8, and 11 were predominantly cytoplasmic, but showed nuclear localization in at least one stage of optic nerve development. HDACs 4, 9 and10 were predominantly cytoplasmic, with little to no nuclear expression at any time during the developmental stages examined. Conclusions Our results showing that HDACs 1, 2, 3, 5, 6, 8, and 11 were each localized to the nuclei of SOX2 positive glia at some stages of optic nerve development and maturation and extend previous reports of HDAC expression in the aging optic nerve. These HDACs are candidates for further research to understand how chromatin remodeling through acetylation, deacetylation and methylation contributes to glial development as well as their injury response. PMID:25011550

  16. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

    PubMed Central

    Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

    2013-01-01

    Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

  17. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

    PubMed

    Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

    2013-11-01

    LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

  18. Patterns and Trends in Services to Persons on the Caseload of the Division of Developmental Disabilities: A 5-Year Analysis (July 1989-August 1994).

    ERIC Educational Resources Information Center

    Weber, Lisa A.; And Others

    This report presents patterns and trends in services provided to persons with developmental disabilities through the Washington State Division of Developmental Disabilities (DDD) and related agencies from 1989 through 1994. Following an executive summary, individual chapters provide extensive detail on: (1) the Division and this project; (2) types…

  19. Hypoxia regulates microRNA expression in the human carotid body

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mkrtchian, Souren, E-mail: souren.mkrtchian@ki.se; Lee, Kian Leong, E-mail: csilkl@nus.edu.sg; Kåhlin, Jessica

    The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentiallymore » regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.« less

  20. The relative expression levels of insulin-like growth factor 1 and myostatin mRNA in the asynchronous development of skeletal muscle in ducks during early development.

    PubMed

    Hu, Yan; Liu, Hongxiang; Shan, Yanju; Ji, Gaige; Xu, Wenjuan; Shu, Jingting; Li, Huifang

    2015-08-10

    Genetic selection is a powerful tool for modifying poultry muscle yield. Insulin-like growth factor I (IGF-I) and myostatin (MSTN) are important regulators of muscle growth, especially in the myogenesis stage. This study compared the developmental pattern of the pectoralis major (PM) and lateral gastrocnemius (LM) muscles, mRNA expression characterization of IGF-I and MSTN-A and their correlation between 14 days in ovo and 1 week post-hatch in two Chinese local duck breeds. During early development, the growth of duck PM and LM followed an asynchronous pattern. Variations in PM growth rate observed with development followed the relative variations of MSTN and IGF-I expression; however, the same behavior was not observed in LM. Moreover, the profile of IGF-I expression in duck skeletal muscles indicated that genetic selection for high meat-yield poultry has altered the temporal expression of IGF-I and affected cellular characteristics and mass by hatch in a PM-specific manner. The MSTN-A expression profile showed synchronization with the growth of skeletal muscle and peaks of myofiber proliferation. The expression patterns of IGF-I and MSTN suggest that duck pectoralis fibers are prioritized for proliferation in embryogenesis. The IGF-1/MSTN-A mRNA ratios in PM and LM presented very similar trends in the changes of myofiber characteristics, and differences in the IGF-1/MSTN-A mRNA ratio in PM between the two breeds corresponded to the timing of differences in PM mass between the varieties. Our results support the hypothesis that relative levels of IGF-I and MSTN mRNA may participate in ordering muscle growth rates with selected development. Copyright © 2015 Elsevier B.V. All rights reserved.

Top