Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

PubMed

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

Gene expression profiling of the hippocampal dentate gyrus in an adult toxicity study captures a variety of neurodevelopmental dysfunctions in rat models of hypothyroidism.

PubMed

Shiraki, Ayako; Saito, Fumiyo; Akane, Hirotoshi; Akahori, Yumi; Imatanaka, Nobuya; Itahashi, Megu; Yoshida, Toshinori; Shibutani, Makoto

2016-01-01

We previously found that developmental hypothyroidism changed the expression of genes in the rat hippocampal dentate gyrus, a brain region where adult neurogenesis is known to occur. In the present study, we performed brain region-specific global gene expression profiling in an adult rat hypothyroidism model to see if it reflected the developmental neurotoxicity we saw in the developmental hypothyroidism model. Starting when male rats were 5 weeks old, we administered 6-propyl-2-thiouracil at a doses of 0, 0.1 and 10 mg kg(-1) body weight by gavage for 28 days. We selected four brain regions to represent both cerebral and cerebellar tissues: hippocampal dentate gyrus, cerebral cortex, corpus callosum and cerebellar vermis. We observed significant alterations in the expression of genes related to neural development (Eph family genes and Robo3) in the cerebral cortex and hippocampal dentate gyrus and in the expression of genes related to myelination (Plp1 and Mbp) in the hippocampal dentate gyrus. We observed only minor changes in the expression of these genes in the corpus callosum and cerebellar vermis. We used real-time reverse-transcription polymerase chain reaction to confirm Chrdl1, Hes5, Mbp, Plp1, Slit1, Robo3 and the Eph family transcript expression changes. The most significant changes in gene expression were found in the dentate gyrus. Considering that the gene expression profile of the adult dentate gyrus closely related to neurogenesis, 28-day toxicity studies looking at gene expression changes in adult hippocampal dentate gyrus may also detect possible developmental neurotoxic effects. Copyright © 2015 John Wiley & Sons, Ltd.

Dynamic CRM occupancy reflects a temporal map of developmental progression.

PubMed

Wilczyński, Bartek; Furlong, Eileen E M

2010-06-22

Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

Commonly dysregulated genes in murine APL cells

PubMed Central

Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

2007-01-01

To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhancer modularity and the evolution of new traits.

PubMed

Koshikawa, Shigeyuki

2015-01-01

Animals have modular cis-regulatory regions in their genomes, and expression of a single gene is often regulated by multiple enhancers residing in such a region. In the laboratory, and also in natural populations, loss of an enhancer can result in a loss of gene expression. Although only a few examples have been well characterized to date, some studies have suggested that an evolutionary gain of a new enhancer function can establish a new gene expression domain. Our recent study showed that Drosophila guttifera has more enhancers and additional expression domains of the wingless gene during the pupal stage, compared to D. melanogaster, and that these new features appear to have evolved in the ancestral lineage leading to D. guttifera. (1) Gain of a new expression domain of a developmental regulatory gene (toolkit gene), such as wingless, can cause co-option of the expression of its downstream genes to the new domain, resulting in duplication of a preexisting structure at this new body position. Recently, with the advancement of evo-devo studies, we have learned that the developmental regulatory systems are strikingly similar across various animal taxa, in spite of the great diversity of the animals' morphology. Even behind "new" traits, co-options of essential developmental genes from known systems are very common. We previously provided concrete evidence of gains of enhancer activities of a developmental regulatory gene underlying gains of new traits. (1) Broad occurrence of this scenario is testable and should be validated in the future.

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

Function and Evolution of DNA Methylation in Nasonia vitripennis

PubMed Central

Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

2013-01-01

The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

PubMed

Baskar, Venkidasamy; Park, Se Won

2015-07-01

Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

DNA methylation at differentially methylated regions of imprinted genes is resistant to developmental programming by maternal nutrition

PubMed Central

Ivanova, Elena; Chen, Jian-Hua; Segonds-Pichon, Anne; Ozanne, Susan E.; Kelsey, Gavin

2012-01-01

The nutritional environment in which the mammalian fetus or infant develop is recognized as influencing the risk of chronic diseases, such as type 2 diabetes and hypertension, in a phenomenon that has become known as developmental programming. The late onset of such diseases in response to earlier transient experiences has led to the suggestion that developmental programming may have an epigenetic component, because epigenetic marks such as DNA methylation or histone tail modifications could provide a persistent memory of earlier nutritional states. One class of genes that has been considered a potential target or mediator of programming events is imprinted genes, because these genes critically depend upon epigenetic modifications for correct expression and because many imprinted genes have roles in controlling fetal growth as well as neonatal and adult metabolism. In this study, we have used an established model of developmental programming—isocaloric protein restriction to female mice during gestation or lactation—to examine whether there are effects on expression and DNA methylation of imprinted genes in the offspring. We find that although expression of some imprinted genes in liver of offspring is robustly and sustainably changed, methylation of the differentially methylated regions (DMRs) that control their monoallelic expression remains largely unaltered. We conclude that deregulation of imprinting through a general effect on DMR methylation is unlikely to be a common factor in developmental programming. PMID:22968513

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Predictive computation of genomic logic processing functions in embryonic development

PubMed Central

Peter, Isabelle S.; Faure, Emmanuel; Davidson, Eric H.

2012-01-01

Gene regulatory networks (GRNs) control the dynamic spatial patterns of regulatory gene expression in development. Thus, in principle, GRN models may provide system-level, causal explanations of developmental process. To test this assertion, we have transformed a relatively well-established GRN model into a predictive, dynamic Boolean computational model. This Boolean model computes spatial and temporal gene expression according to the regulatory logic and gene interactions specified in a GRN model for embryonic development in the sea urchin. Additional information input into the model included the progressive embryonic geometry and gene expression kinetics. The resulting model predicted gene expression patterns for a large number of individual regulatory genes each hour up to gastrulation (30 h) in four different spatial domains of the embryo. Direct comparison with experimental observations showed that the model predictively computed these patterns with remarkable spatial and temporal accuracy. In addition, we used this model to carry out in silico perturbations of regulatory functions and of embryonic spatial organization. The model computationally reproduced the altered developmental functions observed experimentally. Two major conclusions are that the starting GRN model contains sufficiently complete regulatory information to permit explanation of a complex developmental process of gene expression solely in terms of genomic regulatory code, and that the Boolean model provides a tool with which to test in silico regulatory circuitry and developmental perturbations. PMID:22927416

Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

PubMed

Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

2014-11-27

Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

PubMed Central

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

PubMed

Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

2012-01-01

Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

l-Ergothioneine improves the developmental potential of in vitro sheep embryos without influencing OCTN1-mediated cross-membrane transcript expression.

PubMed

Mishra, A; Reddy, I J; Dhali, A; Javvaji, P K

2018-04-02

SummaryThe objective of the study was to investigate the effect of l-ergothioneine (l-erg) (5 mM or 10 mM) supplementation in maturation medium on the developmental potential and OCTN1-dependant l-erg-mediated (10 mM) change in mRNA abundance of apoptotic (Bcl2, Bax, Casp3 and PCNA) and antioxidant (GPx, SOD1, SOD2 and CAT) genes in sheep oocytes and developmental stages of embryos produced in vitro. Oocytes matured with l-erg (10 mM) reduced their embryo toxicity by decreasing intracellular ROS and increasing intracellular GSH in matured oocytes that in turn improved developmental potential, resulting in significantly (P < 0.05) higher percentages of cleavage (53.72% vs 38.86, 46.56%), morulae (34.36% vs 20.62, 25.84%) and blastocysts (14.83% vs 6.98, 9.26%) compared with other lower concentrations (0 mM and 5 mM) of l-erg without change in maturation rate. l-Erg (10 mM) treatment did not influence the mRNA abundance of the majority of apoptotic and antioxidant genes studied in the matured oocytes and developmental stages of embryo. A gene expression study found that the SLC22A4 gene that encodes OCTN1, an integral membrane protein and specific transporter of l-erg was not expressed in oocytes and developmental stages of embryos. Therefore it was concluded from the study that although there was improvement in the developmental potential of sheep embryos by l-erg supplementation in maturation medium, there was no change in the expression of the majority of the genes studied due to the absence of the SLC22A4 gene in oocytes and embryos that encode OCTN1, which is responsible for transportation of l-erg across the membrane to alter gene expression.

Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

PubMed

Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

2010-10-01

To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

Biomarkers of adult and developmental neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slikker, William; Bowyer, John F.

2005-08-07

Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessarymore » for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations.« less

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation

PubMed Central

Pazhamala, Lekha T.; Purohit, Shilp; Saxena, Rachit K.; Garg, Vanika; Krishnamurthy, L.; Verdier, Jerome

2017-01-01

Abstract Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose–proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. PMID:28338822

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

PubMed

Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

2017-07-30

The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

NASA Astrophysics Data System (ADS)

Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

2015-06-01

Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs.

Characterization of Adelphocoris suturalis (Hemiptera: Miridae) Transcriptome from Different Developmental Stages

PubMed Central

Tian, Caihong; Tek Tay, Wee; Feng, Hongqiang; Wang, Ying; Hu, Yongmin; Li, Guoping

2015-01-01

Adelphocoris suturalis is one of the most serious pest insects of Bt cotton in China, however its molecular genetics, biochemistry and physiology are poorly understood. We used high throughput sequencing platform to perform de novo transcriptome assembly and gene expression analyses across different developmental stages (eggs, 2nd and 5th instar nymphs, female and male adults). We obtained 20 GB of clean data and revealed 88,614 unigenes, including 23,830 clusters and 64,784 singletons. These unigene sequences were annotated and classified by Gene Ontology, Clusters of Orthologous Groups, and Kyoto Encyclopedia of Genes and Genomes databases. A large number of differentially expressed genes were discovered through pairwise comparisons between these developmental stages. Gene expression profiles were dramatically different between life stage transitions, with some of these most differentially expressed genes being associated with sex difference, metabolism and development. Quantitative real-time PCR results confirm deep-sequencing findings based on relative expression levels of nine randomly selected genes. Furthermore, over 791,390 single nucleotide polymorphisms and 2,682 potential simple sequence repeats were identified. Our study provided comprehensive transcriptional gene expression information for A. suturalis that will form the basis to better understanding of development pathways, hormone biosynthesis, sex differences and wing formation in mirid bugs. PMID:26047353

Identification of appropriate reference genes for normalizing transcript expression by quantitative real-time PCR in Litsea cubeba.

PubMed

Lin, Liyuan; Han, Xiaojiao; Chen, Yicun; Wu, Qingke; Wang, Yangdong

2013-12-01

Quantitative real-time PCR has emerged as a highly sensitive and widely used method for detection of gene expression profiles, via which accurate detection depends on reliable normalization. Since no single control is appropriate for all experimental treatments, it is generally advocated to select suitable internal controls prior to use for normalization. This study reported the evaluation of the expression stability of twelve potential reference genes in different tissue/organs and six fruit developmental stages of Litsea cubeba in order to screen the superior internal reference genes for data normalization. Two softwares-geNorm, and NormFinder-were used to identify stability of these candidate genes. The cycle threshold difference and coefficient of variance were also calculated to evaluate the expression stability of candidate genes. F-BOX, EF1α, UBC, and TUA were selected as the most stable reference genes across 11 sample pools. F-BOX, EF1α, and EIF4α exhibited the highest expression stability in different tissue/organs and different fruit developmental stages. Besides, a combination of two stable reference genes would be sufficient for gene expression normalization in different fruit developmental stages. In addition, the relative expression profiles of DXS and DXR were evaluated by EF1α, UBC, and SAMDC. The results further validated the reliability of stable reference genes and also highlighted the importance of selecting suitable internal controls for L. cubeba. These reference genes will be of great importance for transcript normalization in future gene expression studies on L. cubeba.

Effect of timing of development on total cell number and expression profile of HSP-70.1 and GLUT-1 in buffalo (Bubalus bubalis) oocytes and preimplantation embryos produced in vitro.

PubMed

Rajhans, Rajib; Kumar, G Sai; Dubey, Pawan K; Sharma, G Taru

2010-03-29

The present study was designed to compare the expression profile of two developmentally important genes (HSP-70.1 and GLUT-1) and TCN (total cell number) count in fast (group A) and slow (group B) cleaved buffalo embryos to access their in vitro developmental competence. Buffalo COCs (cumulus oocyte complexes) were collected from local abattoir ovaries and subjected to in vitro maturation in: TCM-199 supplemented with 10% FBS (fetal bovine serum), BSA (3 mg/ml), sodium pyruvate (0.25 mM) and 20 ng/ml EGF (epidermal growth factor) at 38.5 degrees C under 5% CO2. In vitro derived embryos were collected at 4-8, 8-16 cell, morula and blastocyst stages at specific time points for gene expression analysis and total cell count. A semiquantitative RT-PCR (reverse transcriptase-PCR) assay was used to determine the HSP-70.1 and GLUT-1 transcripts. Results showed that developmental competence and TCN count in fast (group A)-cleaving embryos was significantly (P<0.05) higher than in the slow group (group B). The gene transcript of HSP-70.1 and GLUT-1 was expressed in oocytes (immature and mature) and throughout the embryonic developmental stages in the fast group (group A), while in the slow (group B) cleaving embryos, the expression of HSP-70.1 was absent in all the embryonic developmental stages, and expression of GLUT-1 was absent after 8-16 cell stage. In conclusion, TCN count and expression profile of HSP-70.1 and GLUT-1 genes in buffalo embryos are different taking into account the cleavage rate. Quality of such embryos for research purposes, TCN and expression profiling of developmentally important genes should be employed to optimize the in vitro culture system to produce superior quality of embryos.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Monoallelic expression of the human FOXP2 speech gene

PubMed Central

Adegbola, Abidemi A.; Cox, Gerald F.; Bradshaw, Elizabeth M.; Hafler, David A.; Gimelbrant, Alexander; Chess, Andrew

2015-01-01

The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations. PMID:25422445

Monoallelic expression of the human FOXP2 speech gene.

PubMed

Adegbola, Abidemi A; Cox, Gerald F; Bradshaw, Elizabeth M; Hafler, David A; Gimelbrant, Alexander; Chess, Andrew

2015-06-02

The recent descriptions of widespread random monoallelic expression (RMAE) of genes distributed throughout the autosomal genome indicate that there are more genes subject to RMAE on autosomes than the number of genes on the X chromosome where X-inactivation dictates RMAE of X-linked genes. Several of the autosomal genes that undergo RMAE have independently been implicated in human Mendelian disorders. Thus, parsing the relationship between allele-specific expression of these genes and disease is of interest. Mutations in the human forkhead box P2 gene, FOXP2, cause developmental verbal dyspraxia with profound speech and language deficits. Here, we show that the human FOXP2 gene undergoes RMAE. Studying an individual with developmental verbal dyspraxia, we identify a deletion 3 Mb away from the FOXP2 gene, which impacts FOXP2 gene expression in cis. Together these data suggest the intriguing possibility that RMAE impacts the haploinsufficiency phenotypes observed for FOXP2 mutations.

Large-scale gene expression profiling data for the model moss Physcomitrella patens aid understanding of developmental progression, culture and stress conditions.

PubMed

Hiss, Manuel; Laule, Oliver; Meskauskiene, Rasa M; Arif, Muhammad A; Decker, Eva L; Erxleben, Anika; Frank, Wolfgang; Hanke, Sebastian T; Lang, Daniel; Martin, Anja; Neu, Christina; Reski, Ralf; Richardt, Sandra; Schallenberg-Rüdinger, Mareike; Szövényi, Peter; Tiko, Theodhor; Wiedemann, Gertrud; Wolf, Luise; Zimmermann, Philip; Rensing, Stefan A

2014-08-01

The moss Physcomitrella patens is an important model organism for studying plant evolution, development, physiology and biotechnology. Here we have generated microarray gene expression data covering the principal developmental stages, culture forms and some environmental/stress conditions. Example analyses of developmental stages and growth conditions as well as abiotic stress treatments demonstrate that (i) growth stage is dominant over culture conditions, (ii) liquid culture is not stressful for the plant, (iii) low pH might aid protoplastation by reduced expression of cell wall structure genes, (iv) largely the same gene pool mediates response to dehydration and rehydration, and (v) AP2/EREBP transcription factors play important roles in stress response reactions. With regard to the AP2 gene family, phylogenetic analysis and comparison with Arabidopsis thaliana shows commonalities as well as uniquely expressed family members under drought, light perturbations and protoplastation. Gene expression profiles for P. patens are available for the scientific community via the easy-to-use tool at https://www.genevestigator.com. By providing large-scale expression profiles, the usability of this model organism is further enhanced, for example by enabling selection of control genes for quantitative real-time PCR. Now, gene expression levels across a broad range of conditions can be accessed online for P. patens. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

A 3-dimensional human embryonic stem cell (hESC)-derived model to detect developmental neurotoxicity of nanoparticles.

PubMed

Hoelting, Lisa; Scheinhardt, Benjamin; Bondarenko, Olesja; Schildknecht, Stefan; Kapitza, Marion; Tanavde, Vivek; Tan, Betty; Lee, Qian Yi; Mecking, Stefan; Leist, Marcel; Kadereit, Suzanne

2013-04-01

Nanoparticles (NPs) have been shown to accumulate in organs, cross the blood-brain barrier and placenta, and have the potential to elicit developmental neurotoxicity (DNT). Here, we developed a human embryonic stem cell (hESC)-derived 3-dimensional (3-D) in vitro model that allows for testing of potential developmental neurotoxicants. Early central nervous system PAX6(+) precursor cells were generated from hESCs and differentiated further within 3-D structures. The 3-D model was characterized for neural marker expression revealing robust differentiation toward neuronal precursor cells, and gene expression profiling suggested a predominantly forebrain-like development. Altered neural gene expression due to exposure to non-cytotoxic concentrations of the known developmental neurotoxicant, methylmercury, indicated that the 3-D model could detect DNT. To test for specific toxicity of NPs, chemically inert polyethylene NPs (PE-NPs) were chosen. They penetrated deep into the 3-D structures and impacted gene expression at non-cytotoxic concentrations. NOTCH pathway genes such as HES5 and NOTCH1 were reduced in expression, as well as downstream neuronal precursor genes such as NEUROD1 and ASCL1. FOXG1, a patterning marker, was also reduced. As loss of function of these genes results in severe nervous system impairments in mice, our data suggest that the 3-D hESC-derived model could be used to test for Nano-DNT.

Analysis of global gene expression profiles to identify differentially expressed genes critical for embryo development in Brassica rapa.

PubMed

Zhang, Yu; Peng, Lifang; Wu, Ya; Shen, Yanyue; Wu, Xiaoming; Wang, Jianbo

2014-11-01

Embryo development represents a crucial developmental period in the life cycle of flowering plants. To gain insights into the genetic programs that control embryo development in Brassica rapa L., RNA sequencing technology was used to perform transcriptome profiling analysis of B. rapa developing embryos. The results generated 42,906,229 sequence reads aligned with 32,941 genes. In total, 27,760, 28,871, 28,384, and 25,653 genes were identified from embryos at globular, heart, early cotyledon, and mature developmental stages, respectively, and analysis between stages revealed a subset of stage-specific genes. We next investigated 9,884 differentially expressed genes with more than fivefold changes in expression and false discovery rate ≤ 0.001 from three adjacent-stage comparisons; 1,514, 3,831, and 6,633 genes were detected between globular and heart stage embryo libraries, heart stage and early cotyledon stage, and early cotyledon and mature stage, respectively. Large numbers of genes related to cellular process, metabolism process, response to stimulus, and biological process were expressed during the early and middle stages of embryo development. Fatty acid biosynthesis, biosynthesis of secondary metabolites, and photosynthesis-related genes were expressed predominantly in embryos at the middle stage. Genes for lipid metabolism and storage proteins were highly expressed in the middle and late stages of embryo development. We also identified 911 transcription factor genes that show differential expression across embryo developmental stages. These results increase our understanding of the complex molecular and cellular events during embryo development in B. rapa and provide a foundation for future studies on other oilseed crops.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Developmental constraints shape the evolution of the nematode mid-developmental transition.

PubMed

Zalts, Harel; Yanai, Itai

2017-03-27

Evolutionary theory assumes that genetic variation is uniform and gradual in nature, yet morphological and gene expression studies have revealed that different life-stages exhibit distinct levels of cross-species conservation. In particular, a stage in mid-embryogenesis is highly conserved across species of the same phylum, suggesting that this stage is subject to developmental constraints, either by increased purifying selection or by a strong mutational bias. An alternative explanation, however, holds that the same 'hourglass' pattern of variation may result from increased positive selection at the earlier and later stages of development. To distinguish between these scenarios, we examined gene expression variation in a population of the nematode Caenorhabditis elegans using an experimental design that eliminated the influence of positive selection. By measuring gene expression for all genes throughout development in 20 strains, we found that variations were highly uneven throughout development, with a significant depletion during mid-embryogenesis. In particular, the family of homeodomain transcription factors, whose expression generally coincides with mid-embryogenesis, evolved under high constraint. Our data further show that genes responsible for the integration of germ layers during morphogenesis are the most constrained class of genes. Together, these results provide strong evidence for developmental constraints as the mechanism underlying the hourglass model of animal evolution. Understanding the pattern and mechanism of developmental constraints provides a framework to understand how evolutionary processes have interacted with embryogenesis and led to the diversity of animal life on Earth.

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

Loss of RNA expression and allele-specific expression associated with congenital heart disease

PubMed Central

McKean, David M.; Homsy, Jason; Wakimoto, Hiroko; Patel, Neil; Gorham, Joshua; DePalma, Steven R.; Ware, James S.; Zaidi, Samir; Ma, Wenji; Patel, Nihir; Lifton, Richard P.; Chung, Wendy K.; Kim, Richard; Shen, Yufeng; Brueckner, Martina; Goldmuntz, Elizabeth; Sharp, Andrew J.; Seidman, Christine E.; Gelb, Bruce D.; Seidman, J. G.

2016-01-01

Congenital heart disease (CHD), a prevalent birth defect occurring in 1% of newborns, likely results from aberrant expression of cardiac developmental genes. Mutations in a variety of cardiac transcription factors, developmental signalling molecules and molecules that modify chromatin cause at least 20% of disease, but most CHD remains unexplained. We employ RNAseq analyses to assess allele-specific expression (ASE) and biallelic loss-of-expression (LOE) in 172 tissue samples from 144 surgically repaired CHD subjects. Here we show that only 5% of known imprinted genes with paternal allele silencing are monoallelic versus 56% with paternal allele expression—this cardiac-specific phenomenon seems unrelated to CHD. Further, compared with control subjects, CHD subjects have a significant burden of both LOE genes and ASE events associated with altered gene expression. These studies identify FGFBP2, LBH, RBFOX2, SGSM1 and ZBTB16 as candidate CHD genes because of significantly altered transcriptional expression. PMID:27670201

Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

PubMed

Metzger, David C H; Schulte, Patricia M

2018-04-14

Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

Gene expression atlas of pigeonpea and its application to gain insights into genes associated with pollen fertility implicated in seed formation.

PubMed

Pazhamala, Lekha T; Purohit, Shilp; Saxena, Rachit K; Garg, Vanika; Krishnamurthy, L; Verdier, Jerome; Varshney, Rajeev K

2017-04-01

Pigeonpea (Cajanus cajan) is an important grain legume of the semi-arid tropics, mainly used for its protein rich seeds. To link the genome sequence information with agronomic traits resulting from specific developmental processes, a Cajanus cajan gene expression atlas (CcGEA) was developed using the Asha genotype. Thirty tissues/organs representing developmental stages from germination to senescence were used to generate 590.84 million paired-end RNA-Seq data. The CcGEA revealed a compendium of 28 793 genes with differential, specific, spatio-temporal and constitutive expression during various stages of development in different tissues. As an example to demonstrate the application of the CcGEA, a network of 28 flower-related genes analysed for cis-regulatory elements and splicing variants has been identified. In addition, expression analysis of these candidate genes in male sterile and male fertile genotypes suggested their critical role in normal pollen development leading to seed formation. Gene network analysis also identified two regulatory genes, a pollen-specific SF3 and a sucrose-proton symporter, that could have implications for improvement of agronomic traits such as seed production and yield. In conclusion, the CcGEA provides a valuable resource for pigeonpea to identify candidate genes involved in specific developmental processes and to understand the well-orchestrated growth and developmental process in this resilient crop. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

PubMed

Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

2016-11-01

We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics

PubMed Central

Gildor, Tsvia; Ben-Tabou de-Leon, Smadar

2015-01-01

Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl). The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp). These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions. PMID:26230518

The RNA-Seq-based high resolution gene expression atlas of chickpea (Cicer arietinum L.) reveals dynamic spatio-temporal changes associated with growth and development.

PubMed

Kudapa, Himabindu; Garg, Vanika; Chitikineni, Annapurna; Varshney, Rajeev K

2018-04-10

Chickpea is one of the world's largest cultivated food legumes and is an excellent source of high-quality protein to the human diet. Plant growth and development are controlled by programmed expression of a suite of genes at the given time, stage, and tissue. Understanding how the underlying genome sequence translates into specific plant phenotypes at key developmental stages, information on gene expression patterns is crucial. Here, we present a comprehensive Cicer arietinum Gene Expression Atlas (CaGEA) across different plant developmental stages and organs covering the entire life cycle of chickpea. One of the widely used drought tolerant cultivars, ICC 4958 has been used to generate RNA-Seq data from 27 samples at 5 major developmental stages of the plant. A total of 816 million raw reads were generated and of these, 794 million filtered reads after quality control (QC) were subjected to downstream analysis. A total of 15,947 unique number of differentially expressed genes across different pairwise tissue combinations were identified. Significant differences in gene expression patterns contributing in the process of flowering, nodulation, and seed and root development were inferred in this study. Furthermore, differentially expressed candidate genes from "QTL-hotspot" region associated with drought stress response in chickpea were validated. © 2018 The Authors. Plant, Cell & Environment Published by John Wiley & Sons Ltd.

Remodeling a tissue: subtraction adds insight.

PubMed

Axelrod, Jeffrey D

2012-11-27

Sculpting a body plan requires both patterning of gene expression and translating that pattern into morphogenesis. Developmental biologists have made remarkable strides in understanding gene expression patterning, but despite a long history of fascination with the mechanics of morphogenesis, knowledge of how patterned gene expression drives the emergence of even simple shapes and forms has grown at a slower pace. The successful merging of approaches from cell biology, developmental biology, imaging, engineering, and mathematical and computational sciences is now accelerating progress toward a fuller and better integrated understanding of the forces shaping morphogenesis.

Developmental Exposure to Diethylstilbestrol Alters Uterine Gene Expression That May Be Associated With Uterine Neoplasia Later in Life

PubMed Central

Newbold, Retha R.; Jefferson, Wendy N.; Grissom, Sherry F.; Padilla-Banks, Elizabeth; Snyder, Ryan J.; Lobenhofer, Edward K.

2008-01-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 μg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 μg/kg/d) on days 1–5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose–responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17β estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. PMID:17394237

Developmental exposure to diethylstilbestrol alters uterine gene expression that may be associated with uterine neoplasia later in life.

PubMed

Newbold, Retha R; Jefferson, Wendy N; Grissom, Sherry F; Padilla-Banks, Elizabeth; Snyder, Ryan J; Lobenhofer, Edward K

2007-09-01

Previously, we described a mouse model where the well-known reproductive carcinogen with estrogenic activity, diethylstilbestrol (DES), caused uterine adenocarcinoma following neonatal treatment. Tumor incidence was dose-dependent reaching >90% by 18 mo following neonatal treatment with 1000 microg/kg/d of DES. These tumors followed the initiation/promotion model of hormonal carcinogenesis with developmental exposure as initiator, and exposure to ovarian hormones at puberty as the promoter. To identify molecular pathways involved in DES-initiation events, uterine gene expression profiles were examined in prepubertal mice exposed to DES (1, 10, or 1000 microg/kg/d) on days 1-5 and compared to controls. Of more than 20 000 transcripts, approximately 3% were differentially expressed in at least one DES treatment group compared to controls; some transcripts demonstrated dose-responsiveness. Assessment of gene ontology annotation revealed alterations in genes associated with cell growth, differentiation, and adhesion. When expression profiles were compared to published studies of uteri from 5-d-old DES-treated mice, or adult mice treated with 17beta estradiol, similarities were seen suggesting persistent differential expression of estrogen responsive genes following developmental DES exposure. Moreover, several altered genes were identified in human uterine adenocarcinomas. Four altered genes [lactotransferrin (Ltf), transforming growth factor beta inducible (Tgfb1), cyclin D1 (Ccnd1), and secreted frizzled-related protein 4 (Sfrp4)], selected for real-time RT-PCR analysis, correlated well with the directionality of the microarray data. These data suggested altered gene expression profiles observed 2 wk after treatment ceased, were established at the time of developmental exposure and maybe related to the initiation events resulting in carcinogenesis. (c) 2007 Wiley-Liss, Inc.

The gene expression database for mouse development (GXD): putting developmental expression information at your fingertips.

PubMed

Smith, Constance M; Finger, Jacqueline H; Kadin, James A; Richardson, Joel E; Ringwald, Martin

2014-10-01

Because molecular mechanisms of development are extraordinarily complex, the understanding of these processes requires the integration of pertinent research data. Using the Gene Expression Database for Mouse Development (GXD) as an example, we illustrate the progress made toward this goal, and discuss relevant issues that apply to developmental databases and developmental research in general. Since its first release in 1998, GXD has served the scientific community by integrating multiple types of expression data from publications and electronic submissions and by making these data freely and widely available. Focusing on endogenous gene expression in wild-type and mutant mice and covering data from RNA in situ hybridization, in situ reporter (knock-in), immunohistochemistry, reverse transcriptase-polymerase chain reaction, Northern blot, and Western blot experiments, the database has grown tremendously over the years in terms of data content and search utilities. Currently, GXD includes over 1.4 million annotated expression results and over 260,000 images. All these data and images are readily accessible to many types of database searches. Here we describe the data and search tools of GXD; explain how to use the database most effectively; discuss how we acquire, curate, and integrate developmental expression information; and describe how the research community can help in this process. Copyright © 2014 The Authors Developmental Dynamics published by Wiley Periodicals, Inc. on behalf of American Association of Anatomists.

A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

PubMed Central

Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

PubMed

Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

Discovering sparse transcription factor codes for cell states and state transitions during development

PubMed Central

Furchtgott, Leon A; Melton, Samuel; Menon, Vilas; Ramanathan, Sharad

2017-01-01

Computational analysis of gene expression to determine both the sequence of lineage choices made by multipotent cells and to identify the genes influencing these decisions is challenging. Here we discover a pattern in the expression levels of a sparse subset of genes among cell types in B- and T-cell developmental lineages that correlates with developmental topologies. We develop a statistical framework using this pattern to simultaneously infer lineage transitions and the genes that determine these relationships. We use this technique to reconstruct the early hematopoietic and intestinal developmental trees. We extend this framework to analyze single-cell RNA-seq data from early human cortical development, inferring a neocortical-hindbrain split in early progenitor cells and the key genes that could control this lineage decision. Our work allows us to simultaneously infer both the identity and lineage of cell types as well as a small set of key genes whose expression patterns reflect these relationships. DOI: http://dx.doi.org/10.7554/eLife.20488.001 PMID:28296636

Genome-wide identification of suitable zebrafish Danio rerio reference genes for normalization of gene expression data by RT-qPCR.

PubMed

Xu, H; Li, C; Zeng, Q; Agrawal, I; Zhu, X; Gong, Z

2016-06-01

In this study, to systematically identify the most stably expressed genes for internal reference in zebrafish Danio rerio investigations, 37 D. rerio transcriptomic datasets (both RNA sequencing and microarray data) were collected from gene expression omnibus (GEO) database and unpublished data, and gene expression variations were analysed under three experimental conditions: tissue types, developmental stages and chemical treatments. Forty-four putative candidate genes were identified with the c.v. <0·2 from all datasets. Following clustering into different functional groups, 21 genes, in addition to four conventional housekeeping genes (eef1a1l1, b2m, hrpt1l and actb1), were selected from different functional groups for further quantitative real-time (qrt-)PCR validation using 25 RNA samples from different adult tissues, developmental stages and chemical treatments. The qrt-PCR data were then analysed using the statistical algorithm refFinder for gene expression stability. Several new candidate genes showed better expression stability than the conventional housekeeping genes in all three categories. It was found that sep15 and metap1 were the top two stable genes for tissue types, ube2a and tmem50a the top two for different developmental stages, and rpl13a and rp1p0 the top two for chemical treatments. Thus, based on the extensive transcriptomic analyses and qrt-PCR validation, these new reference genes are recommended for normalization of D. rerio qrt-PCR data respectively for the three different experimental conditions. © 2016 The Fisheries Society of the British Isles.

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Developmental transcriptional profiling reveals key insights into Triticeae reproductive development.

PubMed

Tran, Frances; Penniket, Carolyn; Patel, Rohan V; Provart, Nicholas J; Laroche, André; Rowland, Owen; Robert, Laurian S

2013-06-01

Despite their importance, there remains a paucity of large-scale gene expression-based studies of reproductive development in species belonging to the Triticeae. As a first step to address this deficiency, a gene expression atlas of triticale reproductive development was generated using the 55K Affymetrix GeneChip(®) wheat genome array. The global transcriptional profiles of the anther/pollen, ovary and stigma were analyzed at concurrent developmental stages, and co-expressed as well as preferentially expressed genes were identified. Data analysis revealed both novel and conserved regulatory factors underlying Triticeae floral development and function. This comprehensive resource rests upon detailed gene annotations, and the expression profiles are readily accessible via a web browser. © 2013 Her Majesty the Queen in Right of Canada as represented by the Minister of Agriculture and Agri-Food Canada.

Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

PubMed Central

2008-01-01

Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus

NASA Astrophysics Data System (ADS)

Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng

2018-06-01

The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.

Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

PubMed

Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

2016-02-01

Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

PubMed

Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

2014-02-01

The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

PubMed Central

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Patterns of expression of position-dependent integrated transgenes in mouse embryo.

PubMed Central

Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

1990-01-01

The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

Serial analysis of gene expression in the silkworm, Bombyx mori.

PubMed

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

Understanding development and stem cells using single cell-based analyses of gene expression

PubMed Central

Kumar, Pavithra; Tan, Yuqi

2017-01-01

In recent years, genome-wide profiling approaches have begun to uncover the molecular programs that drive developmental processes. In particular, technical advances that enable genome-wide profiling of thousands of individual cells have provided the tantalizing prospect of cataloging cell type diversity and developmental dynamics in a quantitative and comprehensive manner. Here, we review how single-cell RNA sequencing has provided key insights into mammalian developmental and stem cell biology, emphasizing the analytical approaches that are specific to studying gene expression in single cells. PMID:28049689

Baicalin increases developmental competence of mouse embryos in vitro by inhibiting cellular apoptosis and modulating HSP70 and DNMT expression

PubMed Central

QI, Xiaonan; LI, Huatao; CONG, Xia; WANG, Xin; JIANG, Zhongling; CAO, Rongfeng; TIAN, Wenru

2016-01-01

Scutellaria baicalensis has been effectively used in Chinese traditional medicine to prevent miscarriages. However, little information is available on its mechanism of action. This study is designed specifically to reveal how baicalin, the main effective ingredient of S. baicalensis, improves developmental competence of embryos in vitro, using the mouse as a model. Mouse pronuclear embryos were cultured in KSOM medium supplemented with (0, 2, 4 and 8 μg/ml) baicalin. The results demonstrated that in vitro culture conditions significantly decreased the blastocyst developmental rate and blastocyst quality, possibly due to increased cellular stress and apoptosis. Baicalin (4 µg/ml) significantly increased 2- and 4-cell cleavage rates, morula developmental rate, and blastocyst developmental rate and cell number of in vitro-cultured mouse embryos. Moreover, baicalin increased the expression of Gja1, Cdh1, Bcl-2, and Dnmt3a genes, decreased the expression of Dnmt1 gene, and decreased cellular stress and apoptosis as it decreased the expression of HSP70, CASP3, and BAX and increased BCL-2 expression in blastocysts cultured in vitro. In conclusion, baicalin improves developmental competence of in vitro-cultured mouse embryos through inhibition of cellular apoptosis and HSP70 expression, and improvement of DNA methylation. PMID:27478062

Gene expression as a sensitive endpoint to evaluate cell differentiation and maturation of the developing central nervous system in primary cultures of rat cerebellar granule cells (CGCs) exposed to pesticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogberg, Helena T.; Department of Physiology, Wenner-Gren Institute, Stockholm University; Kinsner-Ovaskainen, Agnieszka

The major advantage of primary neuronal cultures for developmental neurotoxicity (DNT) testing is their ability to replicate the crucial stages of neurodevelopment. In our studies using primary culture of cerebellar granule cells (CGCs) we have evaluated whether the gene expression relevant to the most critical developmental processes such as neuronal differentiation (NF-68 and NF-200) and functional maturation (NMDA and GABA{sub A} receptors), proliferation and differentiation of astrocytes (GFAP and S100{beta}) as well as the presence of neural precursor cells (nestin and Sox10) could be used as an endpoint for in vitro DNT. The expression of these genes was assessed aftermore » exposure to various pesticides (paraquat parathion, dichlorvos, pentachlorophenol and cycloheximide) that could induce developmental neurotoxicity through different mechanisms. All studied pesticides significantly modified the expression of selected genes, related to the different stages of neuronal and/or glial cell development and maturation. The most significant changes were observed after exposure to paraquat and parathion (i.e. down-regulation of mRNA expression of NF-68 and NF-200, NMDA and GABA{sub A} receptors). Similarly, dichlorvos affected mainly neurons (decreased mRNA expression of NF-68 and GABA{sub A} receptors) whereas cycloheximide had an effect on neurons and astrocytes, as significant decreases in the mRNA expression of both neurofilaments (NF-68 and NF-200) and the astrocyte marker (S100{beta}) were observed. Our results suggest that toxicity induced by pesticides that target multiple pathways of neurodevelopment can be identified by studying expression of genes that are involved in different stages of cell development and maturation, and that gene expression could be used as a sensitive endpoint for initial screening to identify the compounds with the potential to cause developmental neurotoxicity.« less

A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

PubMed

Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

2016-02-29

Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

USDA-ARS?s Scientific Manuscript database

Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

PubMed

You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

2018-05-01

Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

NASA Astrophysics Data System (ADS)

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-01

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

PubMed

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-17

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

PubMed Central

Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

2014-01-01

The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

Australian black field crickets show changes in neural gene expression associated with socially-induced morphological, life-history, and behavioral plasticity.

PubMed

Kasumovic, Michael M; Chen, Zhiliang; Wilkins, Marc R

2016-10-24

Ecological and evolutionary model organisms have provided extensive insight into the ecological triggers, adaptive benefits, and evolution of life-history driven developmental plasticity. Despite this, we still have a poor understanding of the underlying genetic changes that occur during shifts towards different developmental trajectories. The goal of this study is to determine whether we can identify underlying gene expression patterns that can describe the different life-history trajectories individuals follow in response to social cues of competition. To do this, we use the Australian black field cricket (Teleogryllus commodus), a species with sex-specific developmental trajectories moderated by the density and quality of calls heard during immaturity. In this study, we manipulated the social information males and females could hear by rearing individuals in either calling or silent treatments. We next used RNA-Seq to develop a reference transcriptome to study changes in brain gene expression at two points prior to sexual maturation. We show accelerated development in both sexes when exposed to calling; changes were also seen in growth, lifespan, and reproductive effort. Functional relationships between genes and phenotypes were apparent from ontological enrichment analysis. We demonstrate that increased investment towards traits such as growth and reproductive effort were often associated with the expression of a greater number of genes with similar effect, thus providing a suite of candidate genes for future research in this and other invertebrate organisms. Our results provide interesting insight into the genomic underpinnings of developmental plasticity and highlight the potential of a genomic exploration of other evolutionary theories such as condition dependence and sex-specific developmental strategies.

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

Hox genes and chordate evolution.

PubMed

Holland, P W; Garcia-Fernàndez, J

1996-02-01

Hox genes are implicated in the control of axial patterning during embryonic development of many, perhaps all, animals. Here we review recent data on Hox gene diversity, genomic organization, and embryonic expression in chordates (including tunicates, amphioxus, hagfish, lampreys, teleosts) plus their putative sister group, the hemichordates. We consider the potential of comparative Hox gene data to resolve some outstanding controversies in chordate phylogeny. The use of Hox gene expression patterns to identify homologies between body plans both within the vertebrates and between the chordate subphyla is also discussed. Homology between the vertebrate hindbrain and an extensive region of amphioxus neural tube is suggested by comparison of Hox-3 homologues and strengthened by new data on amphioxus Hox-1 gene expression reported here. Finally, we give two examples of how Hox genes are giving glimpses into chordate developmental evolution. The first relates changes in Hox gene expression to transposition of vertebral of vertebral identities; the second describes a correlation between vertebrate origins and Hox gene cluster duplication. We suggest that the simultaneous duplication of many classes of genes, often interacting in gene networks, allowed the elaboration of new developmental control mechanisms at vertebrate origins.

Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

PubMed Central

Xiao, Han; Radovich, Cheryll; Welty, Nicholas; Hsu, Jason; Li, Dongmei; Meulia, Tea; van der Knaap, Esther

2009-01-01

Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7), anthesis-stage flowers (floral landmark 10 and fruit landmark 1), and 5 days post anthesis fruit (fruit landmark 3). To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in the NILs that differ at the sun locus, higher or lower transcript levels for many genes involved in phytohormone biosynthesis or signaling as well as organ identity and patterning of tomato fruit were found between developmental time points. PMID:19422692

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Expression Atlas: gene and protein expression across multiple studies and organisms

PubMed Central

Tang, Y Amy; Bazant, Wojciech; Burke, Melissa; Fuentes, Alfonso Muñoz-Pomer; George, Nancy; Koskinen, Satu; Mohammed, Suhaib; Geniza, Matthew; Preece, Justin; Jarnuczak, Andrew F; Huber, Wolfgang; Stegle, Oliver; Brazma, Alvis; Petryszak, Robert

2018-01-01

Abstract Expression Atlas (http://www.ebi.ac.uk/gxa) is an added value database that provides information about gene and protein expression in different species and contexts, such as tissue, developmental stage, disease or cell type. The available public and controlled access data sets from different sources are curated and re-analysed using standardized, open source pipelines and made available for queries, download and visualization. As of August 2017, Expression Atlas holds data from 3,126 studies across 33 different species, including 731 from plants. Data from large-scale RNA sequencing studies including Blueprint, PCAWG, ENCODE, GTEx and HipSci can be visualized next to each other. In Expression Atlas, users can query genes or gene-sets of interest and explore their expression across or within species, tissues, developmental stages in a constitutive or differential context, representing the effects of diseases, conditions or experimental interventions. All processed data matrices are available for direct download in tab-delimited format or as R-data. In addition to the web interface, data sets can now be searched and downloaded through the Expression Atlas R package. Novel features and visualizations include the on-the-fly analysis of gene set overlaps and the option to view gene co-expression in experiments investigating constitutive gene expression across tissues or other conditions. PMID:29165655

Differential gene expression in notochord and nerve cord fate segregation in the Ciona intestinalis embryo.

PubMed

Kobayashi, Kenji; Yamada, Lixy; Satou, Yutaka; Satoh, Nori

2013-09-01

During early embryogenesis, embryonic cells gradually restrict their developmental potential and are eventually destined to give rise to one type of cells. Molecular mechanisms underlying developmental fate restriction are one of the major research subjects within developmental biology. In this article, this subject was addressed by combining blastomere isolation with microarray analysis. During the 6th cleavage of the Ciona intestinalis embryo, from the 32-cell to the 64-cell stage, four mother cells divide into daughter cells with two distinct fates, one giving rise to notochord precursor cells and the other to nerve cord precursors. Approximately 2,200 each of notochord and nerve cord precursor cells were isolated, and their mRNA expression profiles were compared by microarray. This analysis identified 106 and 68 genes, respectively, that are differentially expressed in notochord and nerve cord precursor cells. These included not only genes for transcription factors and signaling molecules but also those with generalized functions observed in many types of cells. In addition, whole-mount in situ hybridization showed dynamic spatial expression profiles of these genes during segregation of the two fates: partitioning of transcripts present in the mother cells into either type of daughter cells, and initiation of preferential gene expression in either type of cells. Copyright © 2013 Wiley Periodicals, Inc.

Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor.

PubMed

Zhu, Jia-Ying; Ze, Sang-Zi; Stanley, David W; Yang, Bin

2014-09-01

Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor. The cDNAs for ecCuZnSOD, icCuZnSOD, and MnSOD, respectively, encode 24.55, 15.81, and 23.14 kDa polypeptides, which possess structural features typical of other insect SODs. They showed 20-94% identity to other known SOD sequences from Bombyx mori, Musca domestica, Nasonia vitripennis, Pediculus humanus corporis, and Tribolium castaneum. Expression of these genes was analyzed in selected tissues and developmental stages, and following exposure to Escherichia coli and parasitization by Scleroderma guani. We recorded expression of all three SODs in cuticle, fat body, and hemocytes and in the major developmental stages. Relatively higher expressions were detected in late-instar larvae and pupae, compared to other developmental stages. Transcriptional levels were upregulated following bacterial infection. Analysis of pupae parasitized by S. guani revealed that expression of T. molitor SOD genes was significantly induced following parasitization. We infer that these genes act in immune response and in host-parasitoid interactions. © 2014 Wiley Periodicals, Inc.

Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

PubMed Central

Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

2017-01-01

Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

Understanding development and stem cells using single cell-based analyses of gene expression.

PubMed

Kumar, Pavithra; Tan, Yuqi; Cahan, Patrick

2017-01-01

In recent years, genome-wide profiling approaches have begun to uncover the molecular programs that drive developmental processes. In particular, technical advances that enable genome-wide profiling of thousands of individual cells have provided the tantalizing prospect of cataloging cell type diversity and developmental dynamics in a quantitative and comprehensive manner. Here, we review how single-cell RNA sequencing has provided key insights into mammalian developmental and stem cell biology, emphasizing the analytical approaches that are specific to studying gene expression in single cells. © 2017. Published by The Company of Biologists Ltd.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

PubMed Central

Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

2012-01-01

The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.).

PubMed

Huis, Rudy; Hawkins, Simon; Neutelings, Godfrey

2010-04-19

Quantitative real-time PCR (qRT-PCR) is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs). Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L). Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs) and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups.qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59). LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both geNorm-designated- and NormFinder-designated-reference genes. The use of 2 different statistical algorithms results in the identification of different combinations of flax HKGs for expression data normalization. Despite such differences, the use of geNorm-designated- and NormFinder-designated-reference genes enabled us to accurately compare the expression levels of a flax MYB gene in different organs and tissues. Our identification and validation of suitable flax HKGs will facilitate future developmental transcriptomic studies in this economically-important plant.

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance.

PubMed

Rath, Martin F; Rohde, Kristian; Klein, David C; Møller, Morten

2013-06-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell.

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance

PubMed Central

Rath, Martin F.; Rohde, Kristian; Klein, David C.; Møller, Morten

2012-01-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell. PMID:23076630

Do convergent developmental mechanisms underlie convergent phenotypes?

NASA Technical Reports Server (NTRS)

Wray, Gregory A.

2002-01-01

Convergence is a pervasive evolutionary process, affecting many aspects of phenotype and even genotype. Relatively little is known about convergence in developmental processes, however, nor about the degree to which convergence in development underlies convergence in anatomy. A switch in the ecology of sea urchins from feeding to nonfeeding larvae illustrates how convergence in development can be associated with convergence in anatomy. Comparisons to more distantly related taxa, however, suggest that this association may be limited to relatively close phylogenetic comparisons. Similarities in gene expression during development provide another window into the association between convergence in developmental processes and convergence in anatomy. Several well-studied transcription factors exhibit likely cases of convergent gene expression in distantly related animal phyla. Convergence in regulatory gene expression domains is probably more common than generally acknowledged, and can arise for several different reasons. Copyright 2002 S. Karger AG, Basel.

Roles of the sister chromatid cohesion apparatus in gene expression, development, and human syndromes

PubMed Central

Dorsett, Dale

2006-01-01

The sister chromatid cohesion apparatus mediates physical pairing of duplicated chromosomes. This pairing is essential for appropriate distribution of chromosomes into the daughter cells upon cell division. Recent evidence shows that the cohesion apparatus, which is a significant structural component of chromosomes during interphase, also affects gene expression and development. The Cornelia de Lange (CdLS) and Roberts/SC phocomelia (RBS/SC) genetic syndromes in humans are caused by mutations affecting components of the cohesion apparatus. Studies in Drosophila suggest that effects on gene expression are most likely responsible for developmental alterations in CdLS. Effects on chromatid cohesion are apparent in RBS/SC syndrome, but data from yeast and Drosophila point to the likelihood that changes in expression of genes located in heterochromatin could contribute to the developmental deficits. PMID:16819604

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

PubMed Central

Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

2016-01-01

Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Endo-β-mannanase and β-tubulin gene expression during the final phases of coffee seed maturation.

PubMed

Santos, F C; Clemente, A C S; Caixeta, F; Rosa, S D V F

2015-10-02

Coffee seeds begin to develop shortly after fertilization and can take 6 to 8 months to complete their formation, a period during which all the characteristics of the mature seed are determined, directly influencing physiological quality. However, little is known about the molecular mechanisms that act during coffee seed maturation. The objective of the current study was to analyze expression of the β-tubulin (TUB) and endo-β-mannanase (MAN) genes during different phases at the end of development and in different tissues of Coffea arabica seeds. The transcription levels of the TUB and MAN genes were quantified in a relative manner using qRT-PCR in whole seeds, and dissected into embryos and endosperms at different developmental stages. Greater expression of MAN was observed in whole seeds and in endosperms during the green stage, and in the embryo during the over-ripe stage. High TUB gene expression was observed in whole seeds during the green stage and, in the embryos, there were peaks in expression during the over-ripe stage. In endosperms, the peak of expression occurred in both the green stage and in the cherry stage. These results suggest participation of endo-β-mannanase during the initial seed developmental stages, and in the stages of physiological maturity in the embryo tissues. TUB gene expression varied depending on the developmental stage and section of seed analyzed, indicating the participation of β-tubulin during organogenesis and coffee seed maturation.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

PubMed

Katayama, Takahiro; Yasukawa, Hiro

2008-01-01

The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

Validation of reference genes for real-time quantitative PCR normalization in soybean developmental and germinating seeds.

PubMed

Li, Qing; Fan, Cheng-Ming; Zhang, Xiao-Mei; Fu, Yong-Fu

2012-10-01

Most of traditional reference genes chosen for real-time quantitative PCR normalization were assumed to be ubiquitously and constitutively expressed in vegetative tissues. However, seeds show distinct transcriptomes compared with the vegetative tissues. Therefore, there is a need for re-validation of reference genes in samples of seed development and germination, especially for soybean seeds. In this study, we aimed at identifying reference genes suitable for the quantification of gene expression level in soybean seeds. In order to identify the best reference genes for soybean seeds, 18 putative reference genes were tested with various methods in different seed samples. We combined the outputs of both geNorm and NormFinder to assess the expression stability of these genes. The reference genes identified as optimums for seed development were TUA5 and UKN2, whereas for seed germination they were novel reference genes Glyma05g37470 and Glyma08g28550. Furthermore, for total seed samples it was necessary to combine four genes of Glyma05g37470, Glyma08g28550, Glyma18g04130 and UKN2 [corrected] for normalization. Key message We identified several reference genes that stably expressed in soybean seed developmental and germinating processes.

The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

PubMed

Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

2017-06-14

Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

Applications of Gene Targeting Technology to Mental Retardation and Developmental Disability Research

ERIC Educational Resources Information Center

Pimenta, Aurea F.; Levitt, Pat

2005-01-01

The human and mouse genome projects elucidated the sequence and position map of innumerous genes expressed in the central nervous system (CNS), advancing our ability to manipulate these sequences and create models to investigate regulation of gene expression and function. In this article, we reviewed gene targeting methodologies with emphasis on…

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation

USDA-ARS?s Scientific Manuscript database

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing ac...

Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

PubMed

Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

PubMed Central

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana

PubMed Central

Laubinger, Sascha; Zeller, Georg; Henz, Stefan R; Sachsenberg, Timo; Widmer, Christian K; Naouar, Naïra; Vuylsteke, Marnik; Schölkopf, Bernhard; Rätsch, Gunnar; Weigel, Detlef

2008-01-01

Gene expression maps for model organisms, including Arabidopsis thaliana, have typically been created using gene-centric expression arrays. Here, we describe a comprehensive expression atlas, Arabidopsis thaliana Tiling Array Express (At-TAX), which is based on whole-genome tiling arrays. We demonstrate that tiling arrays are accurate tools for gene expression analysis and identified more than 1,000 unannotated transcribed regions. Visualizations of gene expression estimates, transcribed regions, and tiling probe measurements are accessible online at the At-TAX homepage. PMID:18613972

Codon bias and gene ontology in holometabolous and hemimetabolous insects.

PubMed

Carlini, David B; Makowski, Matthew

2015-12-01

The relationship between preferred codon use (PCU), developmental mode, and gene ontology (GO) was investigated in a sample of nine insect species with sequenced genomes. These species were selected to represent two distinct modes of insect development, holometabolism and hemimetabolism, with an aim toward determining whether the differences in developmental timing concomitant with developmental mode would be mirrored by differences in PCU in their developmental genes. We hypothesized that the developmental genes of holometabolous insects should be under greater selective pressure for efficient translation, manifest as increased PCU, than those of hemimetabolous insects because holometabolism requires abundant protein expression over shorter time intervals than hemimetabolism, where proteins are required more uniformly in time. Preferred codon sets were defined for each species, from which the frequency of PCU for each gene was obtained. Although there were substantial differences in the genomic base composition of holometabolous and hemimetabolous insects, both groups exhibited a general preference for GC-ending codons, with the former group having higher PCU averaged across all genes. For each species, the biological process GO term for each gene was assigned that of its Drosophila homolog(s), and PCU was calculated for each GO term category. The top two GO term categories for PCU enrichment in the holometabolous insects were anatomical structure development and cell differentiation. The increased PCU in the developmental genes of holometabolous insects may reflect a general strategy to maximize the protein production of genes expressed in bursts over short time periods, e.g., heat shock proteins. J. Exp. Zool. (Mol. Dev. Evol.) 324B: 686-698, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Genome-wide identification of 52 cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus and their B[α]P-induced expression patterns.

PubMed

Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong

2017-09-01

Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.

Selection of reference genes for gene expression studies related to intramuscular fat deposition in Capra hircus skeletal muscle.

PubMed

Zhu, Wuzheng; Lin, Yaqiu; Liao, Honghai; Wang, Yong

2015-01-01

The identification of suitable reference genes is critical for obtaining reliable results from gene expression studies using quantitative real-time PCR (qPCR) because the expression of reference genes may vary considerably under different experimental conditions. In most cases, however, commonly used reference genes are employed in data normalization without proper validation, which may lead to incorrect data interpretation. Here, we aim to select a set of optimal reference genes for the accurate normalization of gene expression associated with intramuscular fat (IMF) deposition during development. In the present study, eight reference genes (PPIB, HMBS, RPLP0, B2M, YWHAZ, 18S, GAPDH and ACTB) were evaluated by three different algorithms (geNorm, NormFinder and BestKeeper) in two types of muscle tissues (longissimus dorsi muscle and biceps femoris muscle) across different developmental stages. All three algorithms gave similar results. PPIB and HMBS were identified as the most stable reference genes, while the commonly used reference genes 18S and GAPDH were the most variably expressed, with expression varying dramatically across different developmental stages. Furthermore, to reveal the crucial role of appropriate reference genes in obtaining a reliable result, analysis of PPARG expression was performed by normalization to the most and the least stable reference genes. The relative expression levels of PPARG normalized to the most stable reference genes greatly differed from those normalized to the least stable one. Therefore, evaluation of reference genes must be performed for a given experimental condition before the reference genes are used. PPIB and HMBS are the optimal reference genes for analysis of gene expression associated with IMF deposition in skeletal muscle during development.

Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera).

PubMed

Zeng, Yanling; Tan, Xiaofeng; Zhang, Lin; Jiang, Nan; Cao, Heping

2014-01-01

Tea oil tree (Camellia oleifera, Co) provides a fine edible oil source in China. Tea oil from the seeds is very beneficial to human health. Fructose-1,6-bisphosphate aldolase (FBA) hydrolyzes fructose-1,6-bisphosphate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, two critical metabolites for oil biosynthesis. The objectives of this study were to identify FBA genes and investigate the relationship between FBA gene expression and oil content in developing seeds of tea oil tree. In this paper, four developmentally up-regulated CoFBA genes were identified in Camellia oleifera seeds based on the transcriptome from two seed developmental stages corresponding to the initiation and peak stages of lipid biosynthesis. The expression of CoFBA genes, along with three key oil biosynthesis genes CoACP, CoFAD2 and CoSAD were analyzed in seeds from eight developmental stages by real-time quantitative PCR. The oil content and fatty acid composition were also analyzed. The results showed that CoFBA and CoSAD mRNA levels were well-correlated with oil content whereas CoFAD2 gene expression levels were correlated with fatty acid composition in Camellia seeds. We propose that CoFBA and CoSAD are two important factors for determining tea oil yield because CoFBA gene controls the flux of key intermediates for oil biosynthesis and CoSAD gene controls the synthesis of oleic acid, which accounts for 80% of fatty acids in tea oil. These findings suggest that tea oil yield could be improved by enhanced expression of CoFBA and CoSAD genes in transgenic plants.

Temporal and developmental requirements for the Prader–Willi imprinting center

PubMed Central

DuBose, Amanda J.; Smith, Emily Y.; Johnstone, Karen A.; Resnick, James L.

2012-01-01

Imprinted gene expression associated with Prader–Willi syndrome (PWS) and Angelman syndrome (AS) is controlled by two imprinting centers (ICs), the PWS-IC and the AS-IC. The PWS-IC operates in cis to activate transcription of genes that are expressed exclusively from the paternal allele. We have created a conditional allele of the PWS-IC to investigate its developmental activity. Deletion of the paternal PWS-IC in the embryo before implantation abolishes expression of the paternal-only genes in the neonatal brain. Surprisingly, deletion of the PWS-IC in early brain progenitors does not affect the subsequent imprinted status of PWS/AS genes in the newborn brain. These results indicate that the PWS-IC functions to protect the paternal epigenotype at the epiblast stage of development but is dispensable thereafter. PMID:22331910

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

PubMed

Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

2006-09-01

Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.).

PubMed

Taylor, Candy M; Jost, Ricarda; Erskine, William; Nelson, Matthew N

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future.

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.)

PubMed Central

Erskine, William; Nelson, Matthew N.

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future. PMID:26872362

Mobile microRNAs hit the target.

PubMed

Gursanscky, Nial R; Searle, Iain R; Carroll, Bernard J

2011-11-01

MicroRNAs (miRNAs) are negative regulators of gene expression in eukaryotic organisms, whereas small interfering RNAs (siRNAs) guide host-cell defence against viruses, transposons and transgenes. A key issue in plant biology is whether miRNAs act only in cells in which they are formed, or if, like siRNAs, they also function after passive diffusion or active transportation into other cells. Recent reports show that miRNAs are indeed able to move between plant cells to direct developmental programming of gene expression. In both leaf and root development, miRNAs establish intercellular gradients of gene expression that are essential for cell and tissue differentiation. Gradients in gene expression also play crucial roles in animal development, and there is strong evidence for intercellular movement of miRNAs in animals. Thus, intercellular movement of miRNAs may be crucial to animal developmental biology as well as plants. © 2011 John Wiley & Sons A/S.

Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

PubMed

Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana

2014-10-01

Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

Arabidopsis Gene Family Profiler (aGFP)--user-oriented transcriptomic database with easy-to-use graphic interface.

PubMed

Dupl'áková, Nikoleta; Renák, David; Hovanec, Patrik; Honysová, Barbora; Twell, David; Honys, David

2007-07-23

Microarray technologies now belong to the standard functional genomics toolbox and have undergone massive development leading to increased genome coverage, accuracy and reliability. The number of experiments exploiting microarray technology has markedly increased in recent years. In parallel with the rapid accumulation of transcriptomic data, on-line analysis tools are being introduced to simplify their use. Global statistical data analysis methods contribute to the development of overall concepts about gene expression patterns and to query and compose working hypotheses. More recently, these applications are being supplemented with more specialized products offering visualization and specific data mining tools. We present a curated gene family-oriented gene expression database, Arabidopsis Gene Family Profiler (aGFP; http://agfp.ueb.cas.cz), which gives the user access to a large collection of normalised Affymetrix ATH1 microarray datasets. The database currently contains NASC Array and AtGenExpress transcriptomic datasets for various tissues at different developmental stages of wild type plants gathered from nearly 350 gene chips. The Arabidopsis GFP database has been designed as an easy-to-use tool for users needing an easily accessible resource for expression data of single genes, pre-defined gene families or custom gene sets, with the further possibility of keyword search. Arabidopsis Gene Family Profiler presents a user-friendly web interface using both graphic and text output. Data are stored at the MySQL server and individual queries are created in PHP script. The most distinguishable features of Arabidopsis Gene Family Profiler database are: 1) the presentation of normalized datasets (Affymetrix MAS algorithm and calculation of model-based gene-expression values based on the Perfect Match-only model); 2) the choice between two different normalization algorithms (Affymetrix MAS4 or MAS5 algorithms); 3) an intuitive interface; 4) an interactive "virtual plant" visualizing the spatial and developmental expression profiles of both gene families and individual genes. Arabidopsis GFP gives users the possibility to analyze current Arabidopsis developmental transcriptomic data starting with simple global queries that can be expanded and further refined to visualize comparative and highly selective gene expression profiles.

Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

PubMed

Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

2016-09-08

The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

A high resolution atlas of gene expression in the domestic sheep (Ovis aries)

PubMed Central

Farquhar, Iseabail L.; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G.; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C. Bruce; Freeman, Tom C.; Archibald, Alan L.; Hume, David A.

2017-01-01

Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of ‘guilt by association’ was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages. PMID:28915238

A high resolution atlas of gene expression in the domestic sheep (Ovis aries).

PubMed

Clark, Emily L; Bush, Stephen J; McCulloch, Mary E B; Farquhar, Iseabail L; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G; Wu, Chunlei; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C Bruce; Freeman, Tom C; Summers, Kim M; Archibald, Alan L; Hume, David A

2017-09-01

Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of 'guilt by association' was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages.

Methyl donor-deficient diet during development can affect fear and anxiety in adulthood in C57BL/6J mice.

PubMed

Ishii, Daisuke; Matsuzawa, Daisuke; Matsuda, Shingo; Tomizawa, Haruna; Sutoh, Chihiro; Shimizu, Eiji

2014-01-01

DNA methylation is one of the essential factors in the control of gene expression. Folic acid, methionine and choline (methyl donors)--all nutrients related to one-carbon metabolism--are known as important mediators of DNA methylation. A previous study has shown that long-term administration of a diet lacking in methyl donors caused global DNA hypermethylation in the brain (Pogribny et al., 2008). However, no study has investigated the effects of a diet lacking in methyl donors during the developmental period on emotional behaviors such as fear and anxiety-like behavior in association with gene expressions in the brain. In addition, it has not been elucidated whether a diet supplemented with methyl donors later in life can reverse these changes. Therefore, we examined the effects of methyl donor deficiency during the developmental period on fear memory acquisition/extinction and anxiety-like behavior, and the relevant gene expressions in the hippocampus in juvenile (6-wk) and adult (12-wk) mice. We found that juvenile mice fed a methyl-donor-deficient diet had impaired fear memory acquisition along with decreases in the gene expressions of Dnmt3a and Dnmt3b. In addition, reduced anxiety-like behavior with decreased gene expressions of Grin2b and Gabar2 was observed in both the methyl-donor-deficient group and the body-weight-matched food-restriction group. After being fed a diet supplemented with methyl donors ad libitum, adult mice reversed the alteration of gene expression of Dnmt3a, Dnmt3b, Grin2b and Gabar2, but anxiety-like behavior became elevated. In addition, impaired fear-memory formation was observed in the adult mice fed the methyl-donor-deficient diet during the developmental period. Our study suggested that developmental alterations in the one-carbon metabolic pathway in the brain could have effects on emotional behavior and memory formation that last into adulthood.

Methyl Donor-Deficient Diet during Development Can Affect Fear and Anxiety in Adulthood in C57BL/6J Mice

PubMed Central

Ishii, Daisuke; Matsuzawa, Daisuke; Matsuda, Shingo; Tomizawa, Haruna; Sutoh, Chihiro; Shimizu, Eiji

2014-01-01

DNA methylation is one of the essential factors in the control of gene expression. Folic acid, methionine and choline (methyl donors)–all nutrients related to one-carbon metabolism–are known as important mediators of DNA methylation. A previous study has shown that long-term administration of a diet lacking in methyl donors caused global DNA hypermethylation in the brain (Pogribny et al., 2008). However, no study has investigated the effects of a diet lacking in methyl donors during the developmental period on emotional behaviors such as fear and anxiety-like behavior in association with gene expressions in the brain. In addition, it has not been elucidated whether a diet supplemented with methyl donors later in life can reverse these changes. Therefore, we examined the effects of methyl donor deficiency during the developmental period on fear memory acquisition/extinction and anxiety-like behavior, and the relevant gene expressions in the hippocampus in juvenile (6-wk) and adult (12-wk) mice. We found that juvenile mice fed a methyl-donor-deficient diet had impaired fear memory acquisition along with decreases in the gene expressions of Dnmt3a and Dnmt3b. In addition, reduced anxiety-like behavior with decreased gene expressions of Grin2b and Gabar2 was observed in both the methyl-donor-deficient group and the body-weight-matched food-restriction group. After being fed a diet supplemented with methyl donors ad libitum, adult mice reversed the alteration of gene expression of Dnmt3a, Dnmt3b, Grin2b and Gabar2, but anxiety-like behavior became elevated. In addition, impaired fear-memory formation was observed in the adult mice fed the methyl-donor-deficient diet during the developmental period. Our study suggested that developmental alterations in the one-carbon metabolic pathway in the brain could have effects on emotional behavior and memory formation that last into adulthood. PMID:25144567

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

Plastid Transcriptomics and Translatomics of Tomato Fruit Development and Chloroplast-to-Chromoplast Differentiation: Chromoplast Gene Expression Largely Serves the Production of a Single Protein[W][OA

PubMed Central

Kahlau, Sabine; Bock, Ralph

2008-01-01

Plastid genes are expressed at high levels in photosynthetically active chloroplasts but are generally believed to be drastically downregulated in nongreen plastids. The genome-wide changes in the expression patterns of plastid genes during the development of nongreen plastid types as well as the contributions of transcriptional versus translational regulation are largely unknown. We report here a systematic transcriptomics and translatomics analysis of the tomato (Solanum lycopersicum) plastid genome during fruit development and chloroplast-to-chromoplast conversion. At the level of RNA accumulation, most but not all plastid genes are strongly downregulated in fruits compared with leaves. By contrast, chloroplast-to-chromoplast differentiation during fruit ripening is surprisingly not accompanied by large changes in plastid RNA accumulation. However, most plastid genes are translationally downregulated during chromoplast development. Both transcriptional and translational downregulation are more pronounced for photosynthesis-related genes than for genes involved in gene expression, indicating that some low-level plastid gene expression must be sustained in chromoplasts. High-level expression during chromoplast development identifies accD, the only plastid-encoded gene involved in fatty acid biosynthesis, as the target gene for which gene expression activity in chromoplasts is maintained. In addition, we have determined the developmental patterns of plastid RNA polymerase activities, intron splicing, and RNA editing and report specific developmental changes in the splicing and editing patterns of plastid transcripts. PMID:18441214

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Selection of Reference Genes for Expression Studies in Diaphorina citri (Hemiptera: Liviidae).

PubMed

Bassan, Meire Menezes; Angelotti-Mendonc A, Je Ssika; Alves, Gustavo Rodrigues; Yamamoto, Pedro Takao; Moura O Filho, Francisco de Assis Alves

2017-12-05

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is considered the main vector of the bacteria associated with huanglongbing, a very serious disease that has threatened the world citrus industry. The absence of efficient control management protocols, including a lack of resistant cultivars, has led to the development of different approaches to study this pathosystem. The production of resistant genotypes relies on D. citri gene expression analyses by RT-qPCR to assess control of the vector population. High-quality, reliable RT-qPCR analyses depend upon proper reference gene selection and validation. However, adequate D. citri reference genes have not yet been identified. In the present study, we evaluated the genes EF 1-α, ACT, GAPDH, RPL7, RPL17, and TUB as candidate reference genes for this insect. Gene expression stability was evaluated using the mathematical algorithms deltaCt, NormFinder, BestKeeper, and geNorm, at five insect developmental stages, grown on two different plant hosts [Citrus sinensis (L.) Osbeck (Sapindales: Rutaceae) and Murraya paniculata (L.) Jack (Sapindales: Rutaceae)]. The final gene ranking was calculated using RefFinder software, and the V-ATPase-A gene was selected for validation. According to our results, two reference genes are recommended when different plant hosts and developmental stages are considered. Considering gene expression studies in D. citri grown on M. paniculata, regardless of the insect developmental stage, GAPDH and RPL7 have the best fit as reference genes in RT-qPCR analyses, whereas GAPDH and EF 1-α are recommended as reference genes in insect studies using C. sinensis. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans.

PubMed

Sinha, Amit; Sommer, Ralf J; Dieterich, Christoph

2012-06-19

An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution.

Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans

PubMed Central

2012-01-01

Background An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. Results We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Conclusion Our data set provides a catalog for future functional investigations and indicates novel insight into evolutionary mechanisms. We discuss the limited conservation of core developmental and transcriptional programs as a common aspect of animal evolution. PMID:22712530

Systems biology of embryonic development: Prospects for a complete understanding of the Caenorhabditis elegans embryo.

PubMed

Murray, John Isaac

2018-05-01

The convergence of developmental biology and modern genomics tools brings the potential for a comprehensive understanding of developmental systems. This is especially true for the Caenorhabditis elegans embryo because its small size, invariant developmental lineage, and powerful genetic and genomic tools provide the prospect of a cellular resolution understanding of messenger RNA (mRNA) expression and regulation across the organism. We describe here how a systems biology framework might allow large-scale determination of the embryonic regulatory relationships encoded in the C. elegans genome. This framework consists of two broad steps: (a) defining the "parts list"-all genes expressed in all cells at each time during development and (b) iterative steps of computational modeling and refinement of these models by experimental perturbation. Substantial progress has been made towards defining the parts list through imaging methods such as large-scale green fluorescent protein (GFP) reporter analysis. Imaging results are now being augmented by high-resolution transcriptome methods such as single-cell RNA sequencing, and it is likely the complete expression patterns of all genes across the embryo will be known within the next few years. In contrast, the modeling and perturbation experiments performed so far have focused largely on individual cell types or genes, and improved methods will be needed to expand them to the full genome and organism. This emerging comprehensive map of embryonic expression and regulatory function will provide a powerful resource for developmental biologists, and would also allow scientists to ask questions not accessible without a comprehensive picture. This article is categorized under: Invertebrate Organogenesis > Worms Technologies > Analysis of the Transcriptome Gene Expression and Transcriptional Hierarchies > Gene Networks and Genomics. © 2018 Wiley Periodicals, Inc.

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Stability evaluation of reference genes for gene expression analysis by RT-qPCR in soybean under different conditions.

PubMed

Wan, Qiao; Chen, Shuilian; Shan, Zhihui; Yang, Zhonglu; Chen, Limiao; Zhang, Chanjuan; Yuan, Songli; Hao, Qinnan; Zhang, Xiaojuan; Qiu, Dezhen; Chen, Haifeng; Zhou, Xinan

2017-01-01

Real-time quantitative reverse transcription PCR is a sensitive and widely used technique to quantify gene expression. To achieve a reliable result, appropriate reference genes are highly required for normalization of transcripts in different samples. In this study, 9 previously published reference genes (60S, Fbox, ELF1A, ELF1B, ACT11, TUA5, UBC4, G6PD, CYP2) of soybean [Glycine max (L.) Merr.] were selected. The expression stability of the 9 genes was evaluated under conditions of biotic stress caused by infection with soybean mosaic virus, nitrogen stress, across different cultivars and developmental stages. ΔCt and geNorm algorithms were used to evaluate and rank the expression stability of the 9 reference genes. Results obtained from two algorithms showed high consistency. Moreover, results of pairwise variation showed that two reference genes were sufficient to normalize the expression levels of target genes under each experimental setting. For virus infection, ELF1A and ELF1B were the most stable reference genes for accurate normalization. For different developmental stages, Fbox and G6PD had the highest expression stability between two soybean cultivars (Tanlong No. 1 and Tanlong No. 2). ELF1B and ACT11 were identified as the most stably expressed reference genes both under nitrogen stress and among different cultivars. The results showed that none of the candidate reference genes were uniformly expressed at different conditions, and selecting appropriate reference genes was pivotal for gene expression studies with particular condition and tissue. The most stable combination of genes identified in this study will help to achieve more accurate and reliable results in a wide variety of samples in soybean.

Change in Gene Expression in Zebrafish as an Endpoint for Developmental Neurotoxicity Screening

EPA Science Inventory

Chemicals that adversely affect the developing nervous system may have long-term consequences on human health. Little information exists on a large number of environmental chemicals to guide the risk assessments for developmental neurotoxicity (DNT). As traditional developmental ...

The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

PubMed

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

2007-03-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

PubMed Central

Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

2006-01-01

The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

PubMed Central

Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

2011-01-01

PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

PubMed Central

Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

2012-01-01

Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to discover whether there are rules or regularities governing development and evolution of complex multi-cellular organisms. PMID:22807664

Developmental toxicity in flounder embryos exposed to crude oils derived from different geographical regions.

PubMed

Jung, Jee-Hyun; Lee, Eun-Hee; Choi, Kwang-Min; Yim, Un Hyuk; Ha, Sung Yong; An, Joon Geon; Kim, Moonkoo

2017-06-01

Crude oils from distinct geographical regions have distinct chemical compositions, and, as a result, their toxicity may be different. However, developmental toxicity of crude oils derived from different geographical regions has not been extensively characterized. In this study, flounder embryos were separately exposed to effluents contaminated by three crude oils including: Basrah Light (BLO), Pyrenees (PCO), and Sakhalin Vityaz (SVO), in addition to a processed fuel oil (MFO-380), to measure developmental toxicity and for gene expressions. Each oil possessed a distinct chemical composition. Edema defect was highest in embryos exposed to PCO and MFO-380 that both have a greater fraction of three-ring PAHs (33% and 22%, respectively) compared to BLO and SVO. Observed caudal fin defects were higher in embryos exposed to SVO and MFO-380, which are both dominated by naphthalenes (81% and 52%, respectively). CYP1A gene expressions were also highest in embryos exposed to SVO and MFO-380. Higher incidence of cardiotoxicity and lower nkx 2.5 expression were detected in embryos exposed to PCO. Unique gene expression profiles were observed in embryos exposed to crude oils with distinct compositions. This study demonstrates that crude oils of different geographical origins with different compositional characteristics induce developmental toxicity to different degrees. Copyright © 2017 Elsevier Inc. All rights reserved.

20-Hydroxyecdysone (20E) Primary Response Gene E75 Isoforms Mediate Steroidogenesis Autoregulation and Regulate Developmental Timing in Bombyx*

PubMed Central

Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng

2016-01-01

The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399

Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

PubMed

Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

2015-04-13

Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

Superior Cross-Species Reference Genes: A Blueberry Case Study

PubMed Central

Die, Jose V.; Rowland, Lisa J.

2013-01-01

The advent of affordable Next Generation Sequencing technologies has had major impact on studies of many crop species, where access to genomic technologies and genome-scale data sets has been extremely limited until now. The recent development of genomic resources in blueberry will enable the application of high throughput gene expression approaches that should relatively quickly increase our understanding of blueberry physiology. These studies, however, require a highly accurate and robust workflow and make necessary the identification of reference genes with high expression stability for correct target gene normalization. To create a set of superior reference genes for blueberry expression analyses, we mined a publicly available transcriptome data set from blueberry for orthologs to a set of Arabidopsis genes that showed the most stable expression in a developmental series. In total, the expression stability of 13 putative reference genes was evaluated by qPCR and a set of new references with high stability values across a developmental series in fruits and floral buds of blueberry were identified. We also demonstrated the need to use at least two, preferably three, reference genes to avoid inconsistencies in results, even when superior reference genes are used. The new references identified here provide a valuable resource for accurate normalization of gene expression in Vaccinium spp. and may be useful for other members of the Ericaceae family as well. PMID:24058469

Comparative Transcriptomic Characterization of the Early Development in Pacific White Shrimp Litopenaeus vannamei

PubMed Central

Wei, Jiankai; Zhang, Xiaojun; Yu, Yang; Huang, Hao; Li, Fuhua; Xiang, Jianhai

2014-01-01

Penaeid shrimp has a distinctive metamorphosis stage during early development. Although morphological and biochemical studies about this ontogeny have been developed for decades, researches on gene expression level are still scarce. In this study, we have investigated the transcriptomes of five continuous developmental stages in Pacific white shrimp (Litopenaeus vannamei) with high throughput Illumina sequencing technology. The reads were assembled and clustered into 66,815 unigenes, of which 32,398 have putative homologues in nr database, 14,981 have been classified into diverse functional categories by Gene Ontology (GO) annotation and 26,257 have been associated with 255 pathways by KEGG pathway mapping. Meanwhile, the differentially expressed genes (DEGs) between adjacent developmental stages were identified and gene expression patterns were clustered. By GO term enrichment analysis, KEGG pathway enrichment analysis and functional gene profiling, the physiological changes during shrimp metamorphosis could be better understood, especially histogenesis, diet transition, muscle development and exoskeleton reconstruction. In conclusion, this is the first study that characterized the integrated transcriptomic profiles during early development of penaeid shrimp, and these findings will serve as significant references for shrimp developmental biology and aquaculture research. PMID:25197823

Developmental expression patterns of candidate co-factors for vertebrate Six family transcription factors

PubMed Central

Neilson, Karen M.; Pignoni, Francesca; Yan, Bo; Moody, Sally A.

2010-01-01

Six family transcription factors play important roles in craniofacial development. Their transcriptional activity can be modified by co-factor proteins. Two Six genes and one co-factor gene (Eya1) are involved in the human Branchio-otic (BO) and Branchio-otic-renal (BOR) syndromes. However, mutations in Six and Eya genes only account for about half of these patients. To discover potential new causative genes, we searched the Xenopus genome for orthologues of Drosophila co-factor proteins that interact with the fly Six-related factor, SO. We identified 33 Xenopus genes with high sequence identity to 20 of the 25 fly SO-interacting proteins. We provide the developmental expression patterns of the Xenopus orthologues for 11 of the fly genes, and demonstrate that all are expressed in developing craniofacial tissues with at least partial overlap with Six1/Six2. We speculate that these genes may function as Six-interacting partners with important roles in vertebrate craniofacial development and perhaps congenital syndromes. PMID:21089078

Complex expression patterns of lymphocyte-specific genes during the development of cartilaginous fish implicate unique lymphoid tissues in generating an immune repertoire

NASA Technical Reports Server (NTRS)

Miracle, A. L.; Anderson, M. K.; Litman, R. T.; Walsh, C. J.; Luer, C. A.; Rothenberg, E. V.; Litman, G. W.

2001-01-01

Cartilaginous fish express canonical B and T cell recognition genes, but their lymphoid organs and lymphocyte development have been poorly defined. Here, the expression of Ig, TCR, recombination-activating gene (Rag)-1 and terminal deoxynucleosidase (TdT) genes has been used to identify roles of various lymphoid tissues throughout development in the cartilaginous fish, Raja eglanteria (clearnose skate). In embryogenesis, Ig and TCR genes are sharply up-regulated at 8 weeks of development. At this stage TCR and TdT expression is limited to the thymus; later, TCR gene expression appears in peripheral sites in hatchlings and adults, suggesting that the thymus is a source of T cells as in mammals. B cell gene expression indicates more complex roles for the spleen and two special organs of cartilaginous fish-the Leydig and epigonal (gonad-associated) organs. In the adult, the Leydig organ is the site of the highest IgM and IgX expression. However, the spleen is the first site of IgM expression, while IgX is expressed first in gonad, liver, Leydig and even thymus. Distinctive spatiotemporal patterns of Ig light chain gene expression also are seen. A subset of Ig genes is pre-rearranged in the germline of the cartilaginous fish, making expression possible without rearrangement. To assess whether this allows differential developmental regulation, IgM and IgX heavy chain cDNA sequences from specific tissues and developmental stages have been compared with known germline-joined genomic sequences. Both non-productively rearranged genes and germline-joined genes are transcribed in the embryo and hatchling, but not in the adult.

Is Transcriptomic Regulation of Berry Development More Important at Night than During the Day?

PubMed Central

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T.; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far. PMID:24551177

Is transcriptomic regulation of berry development more important at night than during the day?

PubMed

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

PubMed

Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

2015-06-01

Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Normalizing gene expression by quantitative PCR during somatic embryogenesis in two representative conifer species: Pinus pinaster and Picea abies.

PubMed

de Vega-Bartol, José J; Santos, Raquen Raissa; Simões, Marta; Miguel, Célia M

2013-05-01

Suitable internal control genes to normalize qPCR data from different stages of embryo development and germination were identified in two representative conifer species. Clonal propagation by somatic embryogenesis has a great application potentiality in conifers. Quantitative PCR (qPCR) is widely used for gene expression analysis during somatic embryogenesis and embryo germination. No single reference gene is universal, so a systematic characterization of endogenous genes for concrete conditions is fundamental for accuracy. We identified suitable internal control genes to normalize qPCR data obtained at different steps of somatic embryogenesis (embryonal mass proliferation, embryo maturation and germination) in two representative conifer species, Pinus pinaster and Picea abies. Candidate genes included endogenous genes commonly used in conifers, genes previously tested in model plants, and genes with a lower variation of the expression along embryo development according to genome-wide transcript profiling studies. Three different algorithms were used to evaluate expression stability. The geometric average of the expression values of elongation factor-1α, α-tubulin and histone 3 in P. pinaster, and elongation factor-1α, α-tubulin, adenosine kinase and CAC in P. abies were adequate for expression studies throughout somatic embryogenesis. However, improved accuracy was achieved when using other gene combinations in experiments with samples at a single developmental stage. The importance of studies selecting reference genes to use in different tissues or developmental stages within one or close species, and the instability of commonly used reference genes, is highlighted.

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

PubMed

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

PubMed

Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

2015-03-01

Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Global gene expression analysis reveals pathway differences between teratogenic and non-teratogenic exposure concentrations of bisphenol A and 17β-estradiol in embryonic zebrafish

PubMed Central

Saili, Katerine S.; Tilton, Susan C.; Waters, Katrina M.; Tanguay, Robert L.

2013-01-01

Transient developmental exposure to 0.1 μM bisphenol A (BPA) results in larval zebrafish hyperactivity and learning impairments in the adult, while exposure to 80 μM BPA results in teratogenic responses, including craniofacial abnormalities and edema. The mode of action underlying these effects is unclear. We used global gene expression analysis to identify candidate genes and signaling pathways that mediate BPA’s developmental toxicity in zebrafish. Exposure concentrations were selected and anchored to the positive control, 17β-estradiol (E2), based on previously determined behavioral or teratogenic phenotypes. Functional analysis of differentially expressed genes revealed distinct expression profiles at 24 hours post fertilization for 0.1 versus 80 μM BPA and 0.1 versus 15 μM E2 exposure, identification of prothrombin activation as a top canonical pathway impacted by both 0.1 μM BPA and 0.1 μM E2 exposure, and suppressed expression of several genes involved in nervous system development and function following 0.1 μM BPAexposure. PMID:23557687

Comparison of MeHg-induced toxicogenomic responses across in vivo and in vitro models used in developmental toxicology.

PubMed

Robinson, Joshua F; Theunissen, Peter T; van Dartel, Dorien A M; Pennings, Jeroen L; Faustman, Elaine M; Piersma, Aldert H

2011-09-01

Toxicogenomic evaluations may improve toxicity prediction of in vitro-based developmental models, such as whole embryo culture (WEC) and embryonic stem cells (ESC), by providing a robust mechanistic marker which can be linked with responses associated with developmental toxicity in vivo. While promising in theory, toxicogenomic comparisons between in vivo and in vitro models are complex due to inherent differences in model characteristics and experimental design. Determining factors which influence these global comparisons are critical in the identification of reliable mechanistic-based markers of developmental toxicity. In this study, we compared available toxicogenomic data assessing the impact of the known teratogen, methylmercury (MeHg) across a diverse set of in vitro and in vivo models to investigate the impact of experimental variables (i.e. model, dose, time) on our comparative assessments. We evaluated common and unique aspects at both the functional (Gene Ontology) and gene level of MeHg-induced response. At the functional level, we observed stronger similarity in MeHg-response between mouse embryos exposed in utero (2 studies), ESC, and WEC as compared to liver, brain and mouse embryonic fibroblast MeHg studies. These findings were strongly correlated to the presence of a MeHg-induced developmentally related gene signature. In addition, we identified specific MeHg-induced gene expression alterations associated with developmental signaling and heart development across WEC, ESC and in vivo systems. However, the significance of overlap between studies was highly dependent on traditional experimental variables (i.e. dose, time). In summary, we identify promising examples of unique gene expression responses which show in vitro-in vivo similarities supporting the relevance of in vitro developmental models for predicting in vivo developmental toxicity. Copyright © 2011 Elsevier Inc. All rights reserved.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

PubMed Central

Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

2013-01-01

MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

PubMed Central

2011-01-01

Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes involved in extracellular matrix regulation, cell death/apoptosis, and calcium signaling/muscle function, as well as genes with miscellaneous function was confirmed by qPCR. Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of their protein products. PMID:21385442

MOLECULAR AND MORPHOLOGICAL CHANGES IN ZEBRAFISH FOLLOWING TRANSIENT ETHANOL EXPOSURE DURING DEFINED DEVELOPMENTAL STAGES

PubMed Central

Zhang, Chengjin; Frazier, Jared M.; Chen, Hao; Liu, Yao; Lee, Ju-Ahng; Cole, Gregory J.

2014-01-01

Alcohol is a teratogen that has diverse effects on brain and craniofacial development, leading to a constellation of developmental disorders referred to as fetal alcohol spectrum disorder (FASD). The molecular basis of ethanol insult remains poorly understood, as does the relationship between molecular and behavioral changes as a consequence of prenatal ethanol exposure. Zebrafish embryos were exposed to a range of ethanol concentrations (0.5–5.0%) during defined developmental stages, and examined for morphological phenotypes characteristic of FASD. Embryos were also analyzed by in situ hybridization for changes in expression of defined cell markers for neural cell types that are sonic hedgehog-dependent. We show that transient binge-like ethanol exposures during defined developmental stages, such as early gastrulation and early neurulation, result in a range of phenotypes and changes in expression of Shh-dependent genes. The severity of fetal alcohol syndrome (FAS) morphological phenotypes, such as microphthalmia, depends on the embryonic stage and concentration of alcohol exposure, as does diminution of retinal Pax6a or forebrain and hindbrain GAD1 gene expression. We also show that changes in eye and brain morphology correlate with changes in Pax6a and GAD1 gene expression. Our results therefore show that transient binge-like ethanol exposures in zebrafish embryos produce the stereotypical morphological phenotypes of FAS, with the severity of phenotypes depending on the developmental stage and alcohol concentration of exposure. PMID:24929233

Systematic identification of genes involved in divergent skeletal muscle growth rates of broiler and layer chickens.

PubMed

Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai

2009-02-22

The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.

In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

PubMed Central

Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

2014-01-01

Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

PubMed Central

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

2016-01-01

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

PubMed

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

2016-02-09

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

Association of abnormal morphology and altered gene expression in human preimplantation embryos.

PubMed

Wells, Dagan; Bermúdez, Mercedes G; Steuerwald, Nury; Malter, Henry E; Thornhill, Alan R; Cohen, Jacques

2005-08-01

We set out to characterize the expression of nine genes in human preimplantation embryos and determine whether abnormal morphology is associated with altered gene activity. Reverse transcription and real-time polymerase chain reaction were used to quantify the expression of multiple genes in each embryo. The genes studied have various important cellular roles (e.g., cell cycle regulation, DNA repair, and apoptosis). Research laboratory working closely with a clinical IVF practice. Over 50 embryos were donated by infertile patients (various etiologies). Among these, all major stages of preimplantation development and a variety of common morphologic abnormalities were represented. None. Quantification of mRNA transcripts. We detected an association between certain forms of abnormal morphology and disturbances of gene activity. Cellular fragmentation was associated with altered expression of several genes, including TP53, suggesting that fragmenting blastomeres are suffering stress of a type monitored by p53, possibly as a consequence of suboptimal culture conditions. Appropriate gene expression is vital for the regulation of metabolic pathways and key developmental events. Our data indicates a possible causal relationship between changes in gene expression and the formation of clinically relevant abnormal embryo morphologies. We hypothesize that embryos with expression profiles characteristic of good morphology and appropriate for their developmental stage have the greatest potential for implantation. If confirmed, this could lead to a new generation of preimplantation genetic diagnosis (PGD) tests for assessing embryo viability and predicting implantation potential.

Developmental Role and Auxin Responsiveness of Class III Homeodomain Leucine Zipper Gene Family Members in Rice1[C][W][OA

PubMed Central

Itoh, Jun-Ichi; Hibara, Ken-Ichiro; Sato, Yutaka; Nagato, Yasuo

2008-01-01

Members of the Class III homeodomain leucine zipper (Class III HD-Zip) gene family are central regulators of crucial aspects of plant development. To better understand the roles of five Class III HD-Zip genes in rice (Oryza sativa) development, we investigated their expression patterns, ectopic expression phenotypes, and auxin responsiveness. Four genes, OSHB1 to OSHB4, were expressed in a localized domain of the shoot apical meristem (SAM), the adaxial cells of leaf primordia, the leaf margins, and the xylem tissue of vascular bundles. In contrast, expression of OSHB5 was observed only in phloem tissue. Plants ectopically expressing microRNA166-resistant versions of the OSHB3 gene exhibited severe defects, including the ectopic production of leaf margins, shoots, and radialized leaves. The treatment of seedlings with auxin quickly induced ectopic OSHB3 expression in the entire region of the SAM, but not in other tissues. Furthermore, this ectopic expression of OSHB3 was correlated with leaf initiation defects. Our findings suggest that rice Class III HD-Zip genes have conserved functions with their homologs in Arabidopsis (Arabidopsis thaliana), but have also acquired specific developmental roles in grasses or monocots. In addition, some Class III HD-Zip genes may regulate the leaf initiation process in the SAM in an auxin-dependent manner. PMID:18567825

WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

2017-03-01

Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

PubMed Central

Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

2004-01-01

Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

PubMed

Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

2013-10-15

The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Genome-wide dynamics of alternative polyadenylation in rice

PubMed Central

Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

2016-01-01

Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

Interaction of rearing environment and reproductive tactic on gene expression profiles in Atlantic salmon

USGS Publications Warehouse

Aubin-Horth, N.; Letcher, B.H.; Hofmann, H.A.

2005-01-01

Organisms that share the same genotype can develop into divergent phenotypes, depending on environmental conditions. In Atlantic salmon, young males of the same age can be found either as sneakers or immature males that are future anadromous fish. Just as the organism-level phenotype varies between divergent male developmental trajectories, brain gene expression is expected to vary as well. We hypothesized that rearing environment can also have an important effect on gene expression in the brain and possibly interact with the reproductive tactic adopted. We tested this hypothesis by comparing brain gene expression profiles of the two male tactics in fish from the same population that were reared in either a natural stream or under laboratory conditions. We found that expression of certain genes was affected by rearing environment only, while others varied between male reproductive tactics independent of rearing environment. Finally, more than half of all genes that showed variable expression varied between the two male tactics only in one environment. Thus, in these fish, very different molecular pathways can give rise to similar macro-phenotypes depending on rearing environment. This result gives important insights into the molecular underpinnings of developmental plasticity in relationship to the environment. ?? 2005 The American Genetic Association.

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

USGS Publications Warehouse

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

PubMed

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

A high resolution spatiotemporal atlas of gene expression of the developing mouse brain

PubMed Central

Thompson, Carol L.; Ng, Lydia; Menon, Vilas; Martinez, Salvador; Lee, Chang-Kyu; Glattfelder, Katie; Sunkin, Susan M.; Henry, Alex; Lau, Christopher; Dang, Chinh; Garcia-Lopez, Raquel; Martinez-Ferre, Almudena; Pombero, Ana; Rubenstein, John L.R.; Wakeman, Wayne B.; Hohmann, John; Dee, Nick; Sodt, Andrew J.; Young, Rob; Smith, Kimberly; Nguyen, Thuc-Nghi; Kidney, Jolene; Kuan, Leonard; Jeromin, Andreas; Kaykas, Ajamete; Miller, Jeremy; Page, Damon; Orta, Geri; Bernard, Amy; Riley, Zackery; Smith, Simon; Wohnoutka, Paul; Hawrylycz, Mike; Puelles, Luis; Jones, Allan R.

2015-01-01

SUMMARY To provide a temporal framework for the genoarchitecture of brain development, in situ hybridization data were generated for embryonic and postnatal mouse brain at 7 developmental stages for ~2100 genes, processed with an automated informatics pipeline and manually annotated. This resource comprises 434,946 images, 7 reference atlases, an ontogenetic ontology, and tools to explore co-expression of genes across neurodevelopment. Gene sets coinciding with developmental phenomena were identified. A temporal shift in the principles governing the molecular organization of the brain was detected, with transient neuromeric, plate-based organization of the brain present at E11.5 and E13.5. Finally, these data provided a transcription factor code that discriminates brain structures and identifies the developmental age of a tissue, providing a foundation for eventual genetic manipulation or tracking of specific brain structures over development. The resource is available as the Allen Developing Mouse Brain Atlas (developingmouse.brain-map.org). PMID:24952961

Dynamic expression of ancient and novel molluscan shell genes during ecological transitions

PubMed Central

Jackson, Daniel J; Wörheide, Gert; Degnan, Bernard M

2007-01-01

Background The Mollusca constitute one of the most morphologically and ecologically diverse metazoan phyla, occupying a wide range of marine, terrestrial and freshwater habitats. The evolutionary success of the molluscs can in part be attributed to the evolvability of the external shell. Typically, the shell first forms during embryonic and larval development, changing dramatically in shape, colour and mineralogical composition as development and maturation proceeds. Major developmental transitions in shell morphology often correlate with ecological transitions (e.g. from a planktonic to benthic existence at metamorphosis). While the genes involved in molluscan biomineralisation are beginning to be identified, there is little understanding of how these are developmentally regulated, or if the same genes are operational at different stages of the mollusc's life. Results Here we relate the developmental expression of nine genes in the tissue responsible for shell production – the mantle – to ecological transitions that occur during the lifetime of the tropical abalone Haliotis asinina (Vetigastropoda). Four of these genes encode evolutionarily ancient proteins, while four others encode secreted proteins with little or no identity to known proteins. Another gene has been previously described from the mantle of another haliotid vetigastropod. All nine genes display dynamic spatial and temporal expression profiles within the larval shell field and juvenile mantle. Conclusion These expression data reflect the regulatory complexity that underlies molluscan shell construction from larval stages to adulthood, and serves to highlight the different ecological demands placed on each stage. The use of both ancient and novel genes in all stages of shell construction also suggest that a core set of shell-making genes was provided by a shared metazoan ancestor, which has been elaborated upon to produce the range of molluscan shell types we see today. PMID:17845714

Compound-specific effects of diverse neurodevelopmental toxicants on global gene expression in the neural embryonic stem cell test (ESTn)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theunissen, P.T., E-mail: Peter.Theunissen@rivm.nl; Department of Toxicogenomics, Maastricht University, Maastricht; Robinson, J.F.

Alternative assays for developmental toxicity testing are needed to reduce animal use in regulatory toxicology. The in vitro murine neural embryonic stem cell test (ESTn) was designed as an alternative for neurodevelopmental toxicity testing. The integration of toxicogenomic-based approaches may further increase predictivity as well as provide insight into underlying mechanisms of developmental toxicity. In the present study, we investigated concentration-dependent effects of six mechanistically diverse compounds, acetaldehyde (ACE), carbamazepine (CBZ), flusilazole (FLU), monoethylhexyl phthalate (MEHP), penicillin G (PENG) and phenytoin (PHE), on the transcriptome and neural differentiation in the ESTn. All compounds with the exception of PENG altered ESTnmore » morphology (cytotoxicity and neural differentiation) in a concentration-dependent manner. Compound induced gene expression changes and corresponding enriched gene ontology biological processes (GO–BP) were identified after 24 h exposure at equipotent differentiation-inhibiting concentrations of the compounds. Both compound-specific and common gene expression changes were observed between subsets of tested compounds, in terms of significance, magnitude of regulation and functionality. For example, ACE, CBZ and FLU induced robust changes in number of significantly altered genes (≥ 687 genes) as well as a variety of GO–BP, as compared to MEHP, PHE and PENG (≤ 55 genes with no significant changes in GO–BP observed). Genes associated with developmentally related processes (embryonic morphogenesis, neuron differentiation, and Wnt signaling) showed diverse regulation after exposure to ACE, CBZ and FLU. In addition, gene expression and GO–BP enrichment showed concentration dependence, allowing discrimination of non-toxic versus toxic concentrations on the basis of transcriptomics. This information may be used to define adaptive versus toxic responses at the transcriptome level.« less

Gene Expression Profiles in Rice Developing Ovules Provided Evidence for the Role of Sporophytic Tissue in Female Gametophyte Development.

PubMed

Wu, Ya; Yang, Liyu; Cao, Aqin; Wang, Jianbo

2015-01-01

The development of ovule in rice (Oryza sativa) is vital during its life cycle. To gain more understanding of the molecular events associated with the ovule development, we used RNA sequencing approach to perform transcriptome-profiling analysis of the leaf and ovules at four developmental stages. In total, 25,401, 23,343, 23,647 and 23,806 genes were identified from the four developmental stages of the ovule, respectively. We identified a number of differently expressed genes (DEGs) from three adjacent stage comparisons, which may play crucial roles in ovule development. The DEGs were then conducted functional annotations and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses. Genes related to cellular component biogenesis, membrane-bounded organelles and reproductive regulation were identified to be highly expressed during the ovule development. Different expression levels of auxin-related and cytokinin-related genes were also identified at various stages, providing evidence for the role of sporophytic ovule tissue in female gametophyte development from the aspect of gene expression. Generally, an overall transcriptome analysis for rice ovule development has been conducted. These results increased our knowledge of the complex molecular and cellular events that occur during the development of rice ovule and provided foundation for further studies on rice ovule development.

Transcriptional dynamics of the developing sweet cherry (Prunus avium L.) fruit: sequencing, annotation and expression profiling of exocarp-associated genes

PubMed Central

Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz

2014-01-01

The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533

Reactivation of larval keratin gene (krt62.L) in blastema epithelium during Xenopus froglet limb regeneration.

PubMed

Satoh, Akira; Mitogawa, Kazumasa; Saito, Nanami; Suzuki, Miyuki; Suzuki, Ken-Ichi T; Ochi, Haruki; Makanae, Aki

2017-12-15

Limb regeneration is considered a form of limb redevelopment because of the molecular and morphological similarities. Forming a regeneration blastema is, in essence, creating a developing limb bud in an adult body. This reactivation of a developmental process in a mature body is worth studying. Xenopus laevis has a biphasic life cycle that involves distinct larval and adult stages. These distinct developmental stages are useful for investigating the reactivation of developmental processes in post-metamorphic frogs (froglets). In this study, we focused on the re-expression of a larval gene (krt62.L) during Xenopus froglet limb regeneration. Recently renamed krt62.L, this gene was known as the larval keratin (xlk) gene, which is specific to larval-tadpole stages. During limb regeneration in a froglet, krt62.L was re-expressed in a basal layer of blastema epithelium, where adult-specific keratin (Krt12.6.S) expression was also observable. Nerves produce important regulatory factors for amphibian limb regeneration, and also play a role in blastema formation and maintenance. The effect of nerve function on krt62.L expression could be seen in the maintenance of krt62.L expression, but not in its induction. When an epidermis-stripped limb bud was grafted in a froglet blastema, the grafted limb bud could reach the digit-forming stage. This suggests that krt62.L-positive froglet blastema epithelium is able to support the limb development process. These findings imply that the developmental process is locally reactivated in an postmetamorphic body during limb regeneration. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Conserved Gene Expression Programs in Developing Roots from Diverse Plants.

PubMed

Huang, Ling; Schiefelbein, John

2015-08-01

The molecular basis for the origin and diversification of morphological adaptations is a central issue in evolutionary developmental biology. Here, we defined temporal transcript accumulation in developing roots from seven vascular plants, permitting a genome-wide comparative analysis of the molecular programs used by a single organ across diverse species. The resulting gene expression maps uncover significant similarity in the genes employed in roots and their developmental expression profiles. The detailed analysis of a subset of 133 genes known to be associated with root development in Arabidopsis thaliana indicates that most of these are used in all plant species. Strikingly, this was also true for root development in a lycophyte (Selaginella moellendorffii), which forms morphologically different roots and is thought to have evolved roots independently. Thus, despite vast differences in size and anatomy of roots from diverse plants, the basic molecular mechanisms employed during root formation appear to be conserved. This suggests that roots evolved in the two major vascular plant lineages either by parallel recruitment of largely the same developmental program or by elaboration of an existing root program in the common ancestor of vascular plants. © 2015 American Society of Plant Biologists. All rights reserved.

Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

PubMed

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-12-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

PubMed

Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

2007-01-01

Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

Interspecies modulation of bacterial development through iron competition and siderophore piracy

PubMed Central

Traxler, Matthew F.; Seyedsayamdost, Mohammad R.; Clardy, Jon; Kolter, Roberto

2012-01-01

Summary While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key down-stream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were down-regulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. PMID:22931126

Interspecies modulation of bacterial development through iron competition and siderophore piracy.

PubMed

Traxler, Matthew F; Seyedsayamdost, Mohammad R; Clardy, Jon; Kolter, Roberto

2012-11-01

While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key downstream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were downregulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. © 2012 Blackwell Publishing Ltd.

Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

PubMed Central

Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

2011-01-01

Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

Developmental studies of the lamprey and hierarchical evolutionary steps towards the acquisition of the jaw

PubMed Central

Kuratani, Shigeru

2005-01-01

The evolution of animal morphology can be understood as a series of changes in developmental programs. Among vertebrates, some developmental stages are conserved across species, representing particular developmental constraints. One of the most conserved stages is the vertebrate pharyngula, in which similar embryonic morphology is observed and the Hox code is clearly expressed. The oral developmental program also appears to be constrained to some extent, as both its morphology and the the Hox-code-default state of the oropharyngeal region are well conserved between the lamprey and gnathostome embryos. These features do not by themselves explain the evolution of jaws, but should be regarded as a prerequisite for evolutionary diversification of the mandibular arch. By comparing the pharyngula morphology of the lamprey and gnathostomes, it has become clear that the oral pattern is not entirely identical; in particular, the positional differentiation of the rostral ectomesenchyme is shifted between these animals. Therefore, the jaw seems to have arisen as an evolutionary novelty by overriding ancestral constraints, a process in which morphological homologies are partially lost. This change involves the heterotopic shift of tissue interaction, which appears to have been preceded by the transition from monorhiny to diplorhiny, as well as separation of the hypophysis. When gene expression patterns are compared between the lamprey and gnathostomes, cell-autonomously functioning genes tend to be associated with identical cell types or equivalent anatomical domains, whereas growth-factor-encoding genes have changed their expression domains during evolution. Thus, the heterotopic evolution may be based on changes in the regulation of signalling-molecule-encoding genes. PMID:16313390

Expression analysis of genes encoding double B-box zinc finger proteins in maize.

PubMed

Li, Wenlan; Wang, Jingchao; Sun, Qi; Li, Wencai; Yu, Yanli; Zhao, Meng; Meng, Zhaodong

2017-11-01

The B-box proteins play key roles in plant development. The double B-box (DBB) family is one of the subfamily of the B-box family, with two B-box domains and without a CCT domain. In this study, 12 maize double B-box genes (ZmDBBs) were identified through a genome-wide survey. Phylogenetic analysis of DBB proteins from maize, rice, Sorghum bicolor, Arabidopsis, and poplar classified them into five major clades. Gene duplication analysis indicated that segmental duplications made a large contribution to the expansion of ZmDBBs. Furthermore, a large number of cis-acting regulatory elements related to plant development, response to light and phytohormone were identified in the promoter regions of the ZmDBB genes. The expression patterns of the ZmDBB genes in various tissues and different developmental stages demonstrated that ZmDBBs might play essential roles in plant development, and some ZmDBB genes might have unique function in specific developmental stages. In addition, several ZmDBB genes showed diurnal expression pattern. The expression levels of some ZmDBB genes changed significantly under light/dark treatment conditions and phytohormone treatments, implying that they might participate in light signaling pathway and hormone signaling. Our results will provide new information to better understand the complexity of the DBB gene family in maize.

Genomic resources for songbird research and their use in characterizing gene expression during brain development

PubMed Central

Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

2007-01-01

Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

Decoding the Regulatory Network for Blood Development from Single-Cell Gene Expression Measurements

PubMed Central

Haghverdi, Laleh; Lilly, Andrew J.; Tanaka, Yosuke; Wilkinson, Adam C.; Buettner, Florian; Macaulay, Iain C.; Jawaid, Wajid; Diamanti, Evangelia; Nishikawa, Shin-Ichi; Piterman, Nir; Kouskoff, Valerie; Theis, Fabian J.; Fisher, Jasmin; Göttgens, Berthold

2015-01-01

Here we report the use of diffusion maps and network synthesis from state transition graphs to better understand developmental pathways from single cell gene expression profiling. We map the progression of mesoderm towards blood in the mouse by single-cell expression analysis of 3,934 cells, capturing cells with blood-forming potential at four sequential developmental stages. By adapting the diffusion plot methodology for dimensionality reduction to single-cell data, we reconstruct the developmental journey to blood at single-cell resolution. Using transitions between individual cellular states as input, we develop a single-cell network synthesis toolkit to generate a computationally executable transcriptional regulatory network model that recapitulates blood development. Model predictions were validated by showing that Sox7 inhibits primitive erythropoiesis, and that Sox and Hox factors control early expression of Erg. We therefore demonstrate that single-cell analysis of a developing organ coupled with computational approaches can reveal the transcriptional programs that control organogenesis. PMID:25664528

The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

PubMed Central

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

2007-01-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

PubMed

Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

1991-10-01

Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Inference of developmental gene regulatory networks beyond classical model systems: new approaches in the post-genomic era.

PubMed

Fernandez-Valverde, Selene L; Aguilera, Felipe; Ramos-Díaz, René Alexander

2018-06-18

The advent of high-throughput sequencing technologies has revolutionized the way we understand the transformation of genetic information into morphological traits. Elucidating the network of interactions between genes that govern cell differentiation through development is one of the core challenges in genome research. These networks are known as developmental gene regulatory networks (dGRNs) and consist largely of the functional linkage between developmental control genes, cis-regulatory modules and differentiation genes, which generate spatially and temporally refined patterns of gene expression. Over the last 20 years, great advances have been made in determining these gene interactions mainly in classical model systems, including human, mouse, sea urchin, fruit fly, and worm. This has brought about a radical transformation in the fields of developmental biology and evolutionary biology, allowing the generation of high-resolution gene regulatory maps to analyse cell differentiation during animal development. Such maps have enabled the identification of gene regulatory circuits and have led to the development of network inference methods that can recapitulate the differentiation of specific cell-types or developmental stages. In contrast, dGRN research in non-classical model systems has been limited to the identification of developmental control genes via the candidate gene approach and the characterization of their spatiotemporal expression patterns, as well as to the discovery of cis-regulatory modules via patterns of sequence conservation and/or predicted transcription-factor binding sites. However, thanks to the continuous advances in high-throughput sequencing technologies, this scenario is rapidly changing. Here, we give a historical overview on the architecture and elucidation of the dGRNs. Subsequently, we summarize the approaches available to unravel these regulatory networks, highlighting the vast range of possibilities of integrating multiple technical advances and theoretical approaches to expand our understanding on the global of gene regulation during animal development in non-classical model systems. Such new knowledge will not only lead to greater insights into the evolution of molecular mechanisms underlying cell identity and animal body plans, but also into the evolution of morphological key innovations in animals.

Evidence of sex-bias in gene expression in the brain transcriptome of two populations of rainbow trout (Oncorhynchus mykiss) with divergent life histories.

PubMed

Hale, Matthew C; McKinney, Garrett J; Thrower, Frank P; Nichols, Krista M

2018-01-01

Sex-bias in gene expression is a mechanism that can generate phenotypic variance between the sexes, however, relatively little is known about how patterns of sex-bias vary during development, and how variable sex-bias is between different populations. To that end, we measured sex-bias in gene expression in the brain transcriptome of rainbow trout (Oncorhynchus mykiss) during the first two years of development. Our sampling included from the fry stage through to when O. mykiss either migrate to the ocean or remain resident and undergo sexual maturation. Samples came from two F1 lines: One from migratory steelhead trout and one from resident rainbow trout. All samples were reared in a common garden environment and RNA sequencing (RNA-seq) was used to estimate patterns of gene expression. A total of 1,716 (4.6% of total) genes showed evidence of sex-bias in gene expression in at least one time point. The majority (96.7%) of sex-biased genes were differentially expressed during the second year of development, indicating that patterns of sex-bias in expression are tied to key developmental events, such as migration and sexual maturation. Mapping of differentially expressed genes to the O. mykiss genome revealed that the X chromosome is enriched for female upregulated genes, and this may indicate a lack of dosage compensation in rainbow trout. There were many more sex-biased genes in the migratory line than the resident line suggesting differences in patterns of gene expression in the brain between populations subjected to different forces of selection. Overall, our results suggest that there is considerable variation in the extent and identity of genes exhibiting sex-bias during the first two years of life. These differentially expressed genes may be connected to developmental differences between the sexes, and/or between adopting a resident or migratory life history.

Gene expression and molecular phylogenetic analyses of beta-glucosidase in the termite Reticulitermes speratus (Isoptera: Rhinotermitidae).

PubMed

Shimada, Keisuke; Maekawa, Kiyoto

2014-06-01

Beta-glucosidase (BG) is known as a multifunctional enzyme for social maintenance in terms of both cellulose digestion and social communication in termites. However, the expression profiles of each BG gene and their evolutionary history are not well understood. First, we cloned two types of BG homologs (RsBGI and RsBGII) from the termite Reticulitermes speratus (Kolbe). Gene expression analyses showed that RsBGI expression levels of primary queens and kings from 30 to 100 days after colony foundation were high, but those of reproductives dropped after day 400. Extremely low gene expression levels of RsBGI were observed in eggs, whereas workers had significantly higher expression levels than those of soldiers and other colony members. Consequently, RsBGI gene expression levels changed among each developmental stage, and RsBGI was shown to be involved in cellulose digestion. On the other hand, the RsBGII gene was consistently expressed in all castes and developmental stages examined, and notable expression changes were not observed among them, including in eggs. It was indicated that RsBGII is a main component involved in social communication, for example, the egg-recognition pheromone shown in this species previously. Finally, we obtained partial gene homologs from other termite and cockroach species, including the woodroach (genus Cryptocercus), which is the sister group to termites, and performed molecular phylogenetic analyses. The results showed that the origin of the BG gene homologs preceded the divergence of termites and cockroaches, suggesting that the acquisition of multifunctionality of the BG gene also occurred in cockroach lineages. Copyright © 2014 Elsevier Ltd. All rights reserved.

The vertebrate phylotypic stage and an early bilaterian-related stage in mouse embryogenesis defined by genomic information.

PubMed

Irie, Naoki; Sehara-Fujisawa, Atsuko

2007-01-12

Embryos of taxonomically different vertebrates are thought to pass through a stage in which they resemble one another morphologically. This "vertebrate phylotypic stage" may represent the basic vertebrate body plan that was established in the common ancestor of vertebrates. However, much controversy remains about when the phylotypic stage appears, and whether it even exists. To overcome the limitations of studies based on morphological comparison, we explored a comprehensive quantitative method for defining the constrained stage using expressed sequence tag (EST) data, gene ontologies (GO), and available genomes of various animals. If strong developmental constraints occur during the phylotypic stage of vertebrate embryos, then genes conserved among vertebrates would be highly expressed at this stage. We established a novel method for evaluating the ancestral nature of mouse embryonic stages that does not depend on comparative morphology. The numerical "ancestor index" revealed that the mouse indeed has a highly conserved embryonic period at embryonic day 8.0-8.5, the time of appearance of the pharyngeal arch and somites. During this period, the mouse prominently expresses GO-determined developmental genes shared among vertebrates. Similar analyses revealed the existence of a bilaterian-related period, during which GO-determined developmental genes shared among bilaterians are markedly expressed at the cleavage-to-gastrulation period. The genes associated with the phylotypic stage identified by our method are essential in embryogenesis. Our results demonstrate that the mid-embryonic stage of the mouse is indeed highly constrained, supporting the existence of the phylotypic stage. Furthermore, this candidate stage is preceded by a putative bilaterian ancestor-related period. These results not only support the developmental hourglass model, but also highlight the hierarchical aspect of embryogenesis proposed by von Baer. Identification of conserved stages and tissues by this method in various animals would be a powerful tool to examine the phylotypic stage hypothesis, and to understand which kinds of developmental events and gene sets are evolutionarily constrained and how they limit the possible variations of animal basic body plans.

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

PubMed Central

2012-01-01

Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental stages as well as in barley cultivars with different seed size was evidenced for both genes. The two barley Type I MADS-box genes were found to be induced by ABA and JA. DNA methylation differences in different seed developmental stages and after exogenous application of ABA is suggestive of epigenetic regulation of gene expression. The study of barley Type I-like MADS-box genes extends our investigations of gene regulation during endosperm and seed development in a monocot crop like barley. PMID:22985436

The mouse F3/contactin glycoprotein

PubMed Central

Bizzoca, Antonella; Corsi, Patrizia

2009-01-01

F3/Contactin is an immunoglobulin superfamily component expressed in the nervous tissue of several species. Here we focus on the structural and functional properties of its mouse relative, on the mechanisms driving its regulated expression and on its developmental role. F3/Contactin is differentially expressed in distinct populations of central and peripheral neurons and in some non-neuronal cells. Accordingly, the regulatory region of the underlying gene includes promoter elements undergoing differential activation, associated with an intricate splicing profile, indicating that transcriptional and posttranscriptional mechanisms contribute to its expression. Transgenic models allowed to follow F3/Contactin promoter activation in vivo and to modify F3/Contactin gene expression under a heterologous promoter, which resulted in morphological and functional phenotypes. Besides axonal growth and pathfinding, these concerned earlier events, including precursor proliferation and commitment. This wide role in neural ontogenesis is consistent with the recognized interaction of F3/Contactin with developmental control genes belonging to the Notch pathway. PMID:19372728

TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants.

PubMed Central

Leskiw, B K; Lawlor, E J; Fernandez-Abalos, J M; Chater, K F

1991-01-01

In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hyg and aad) containing TTA codons show a medium-dependent reduction in phenotypic expression (hygromycin resistance and spectinomycin resistance, respectively) in bldA mutants. For hyg, evidence is presented that the UUA codon is probably being translated by a tRNA with an imperfectly matched anticodon, giving very low levels of gene product but relatively high resistance to hygromycin. It is proposed that TTA codons may be generally absent from genes expressed during vegetative growth and from the structural genes for differentiation and antibiotic production but present in some regulatory and resistance genes associated with the latter processes. The codon may therefore play a role in developmental regulation. Images PMID:1826053

Transcriptomic Analysis of Differentially Expressed Genes During Larval Development of Rapana venosa by Digital Gene Expression Profiling.

PubMed

Song, Hao; Yu, Zheng-Lin; Sun, Li-Na; Xue, Dong-Xiu; Zhang, Tao; Wang, Hai-Yan

2016-07-07

During the life cycle of shellfish, larval development, especially metamorphosis, has a vital influence on the dynamics, distribution, and recruitment of natural populations, as well as seed breeding. Rapana venosa, a carnivorous gastropod, is an important commercial shellfish in China, and is an ecological invader in the United States, Argentina, and France. However, information about the mechanism of its early development is still limited, because research in this area has long suffered from a lack of genomic resources. In this study, 15 digital gene expression (DGE) libraries from five developmental stages of R. venosa were constructed and sequenced on the IIIumina Hi-Sequation 2500 platform. Bioinformaticsanalysis identified numerous differentially and specifically expressed genes, which revealed that genes associated with growth, nervous system, digestive system, immune system, and apoptosis participate in important developmental processes. The functional analysis of differentially expressed genes was further implemented by gene ontology, and Kyoto encyclopedia of genes and genomes enrichment. DGE profiling provided a general picture of the transcriptomic activities during the early development of R. venosa, which may provide interesting hints for further study. Our data represent the first comparative transcriptomic information available for the early development of R. venosa, which is a prerequisite for a better understanding of the physiological traits controlling development. Copyright © 2016 Song et al.

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

PubMed Central

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

USDA-ARS?s Scientific Manuscript database

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

Predictive Models of Cognitive Outcomes of Developmental Insults

NASA Astrophysics Data System (ADS)

Chan, Yupo; Bouaynaya, Nidhal; Chowdhury, Parimal; Leszczynska, Danuta; Patterson, Tucker A.; Tarasenko, Olga

2010-04-01

Representatives of Arkansas medical, research and educational institutions have gathered over the past four years to discuss the relationship between functional developmental perturbations and their neurological consequences. We wish to track the effect on the nervous system by developmental perturbations over time and across species. Except for perturbations, the sequence of events that occur during neural development was found to be remarkably conserved across mammalian species. The tracking includes consequences on anatomical regions and behavioral changes. The ultimate goal is to develop a predictive model of long-term genotypic and phenotypic outcomes that includes developmental insults. Such a model can subsequently be fostered into an educated intervention for therapeutic purposes. Several datasets were identified to test plausible hypotheses, ranging from evoked potential datasets to sleep-disorder datasets. An initial model may be mathematical and conceptual. However, we expect to see rapid progress as large-scale gene expression studies in the mammalian brain permit genome-wide searches to discover genes that are uniquely expressed in brain circuits and regions. These genes ultimately control behavior. By using a validated model we endeavor to make useful predictions.

microRNAs of parasites: current status and future perspectives

USDA-ARS?s Scientific Manuscript database

MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs regulating gene expression in eukaryotes at the post-transcriptional level. The complex life cycles of parasites may require the ability to respond to environmental and developmental signals through miRNA-mediated gene expression. Ov...

Dynamic changes of genome-wide DNA methylation during soybean seed development

USDA-ARS?s Scientific Manuscript database

Seed development is programmed by expression of many genes in plants. Seed maturation is an important developmental process to soybean seed quality and yield. DNA methylation is a major epigenetic modification regulating gene expression. However, little is known about the dynamic nature of DNA me...

Developmental exposure to lead (Pb) alters the expression of the human tau gene and its products in a transgenic animal model

PubMed Central

Dash, M.; Eid, A.; Subaiea, G.; Chang, J.; Deeb, R.; Masoud, A.; Renehan, W.E.; Adem, A.; Zawia, N.H.

2016-01-01

Tauopathies are a class of neurodegenerative diseases associated with the pathological aggregationof the tau protein in the human brain. The best known of these illnesses is Alzheimer's disease (AD); a disease where the microtubule associated protein tau (MAPT) becomes hyperphosphorylated (lowering its binding affinity to microtubules) and aggregates within neurons in the form of neurofibrillary tangles (NFTs). In this paper we examine whether environmental factors play a significant role in tau pathogenesis. Our studies were conducted in a double mutant mouse model that expressed the human tau gene and lacked the gene for murine tau. The human tau mouse model was tested for the transgene's ability to respond to an environmental toxicant. Pups were developmentally exposed to lead (Pb) from postnatal day (PND) 1-20 with 0.2% Pb acetate. Mice were then sacrificed at PND 20, 30, 40 and 60. Protein and mRNA levels for tau and CDK5 as well as tau phosphorylation at Ser396 were determined. In addition, the potential role of miRNA in tau expression was investigated by measuring levels of miR-34c, a miRNA that targets the mRNA for human tau, at PND20 and 50. The expression of the human tau transgene was altered by developmental exposure to Pb. This exposure also altered the expression of miR-34c. Our findings are the first of their kind to test the responsiveness of the human tau gene to an environmental toxicant and to examine an epigenetic mechanism that may be involved in the regulation of this gene's expression. PMID:27293183

DNA methylation in schizophrenia in different patient-derived cell types.

PubMed

Vitale, Alejandra M; Matigian, Nicholas A; Cristino, Alexandre S; Nones, Katia; Ravishankar, Sugandha; Bellette, Bernadette; Fan, Yongjun; Wood, Stephen A; Wolvetang, Ernst; Mackay-Sim, Alan

2017-01-01

DNA methylation of gene promoter regions represses transcription and is a mechanism via which environmental risk factors could affect cells during development in individuals at risk for schizophrenia. We investigated DNA methylation in patient-derived cells that might shed light on early development in schizophrenia. Induced pluripotent stem cells may reflect a "ground state" upon which developmental and environmental influences would be minimal. Olfactory neurosphere-derived cells are an adult-derived neuro-ectodermal stem cell modified by developmental and environmental influences. Fibroblasts provide a non-neural control for life-long developmental and environmental influences. Genome-wide profiling of DNA methylation and gene expression was done in these three cell types from the same individuals. All cell types had distinct, statistically significant schizophrenia-associated differences in DNA methylation and linked gene expression, with Gene Ontology analysis showing that the differentially affected genes clustered in networks associated with cell growth, proliferation, and movement, functions known to be affected in schizophrenia patient-derived cells. Only five gene loci were differentially methylated in all three cell types. Understanding the role of epigenetics in cell function in the brain in schizophrenia is likely to be complicated by similar cell type differences in intrinsic and environmentally induced epigenetic regulation.

Gene Expression Profiles of Chlamydophila pneumoniae during the Developmental Cycle and Iron Depletion–Mediated Persistence

PubMed Central

Mäurer, André P; Mehlitz, Adrian; Mollenkopf, Hans J; Meyer, Thomas F

2007-01-01

The obligate intracellular, gram-negative bacterium Chlamydophila pneumoniae (Cpn) has impact as a human pathogen. Little is known about changes in the Cpn transcriptome during its biphasic developmental cycle (the acute infection) and persistence. The latter stage has been linked to chronic diseases. To analyze Cpn CWL029 gene expression, we designed a pathogen-specific oligo microarray and optimized the extraction method for pathogen RNA. Throughout the acute infection, ratio expression profiles for each gene were generated using 48 h post infection as a reference. Based on these profiles, significantly expressed genes were separated into 12 expression clusters using self-organizing map clustering and manual sorting into the “early”, “mid”, “late”, and “tardy” cluster classes. The latter two were differentiated because the “tardy” class showed steadily increasing expression at the end of the cycle. The transcriptome of the Cpn elementary body (EB) and published EB proteomics data were compared to the cluster profile of the acute infection. We found an intriguing association between “late” genes and genes coding for EB proteins, whereas “tardy” genes were mainly associated with genes coding for EB mRNA. It has been published that iron depletion leads to Cpn persistence. We compared the gene expression profiles during iron depletion–mediated persistence with the expression clusters of the acute infection. This led to the finding that establishment of iron depletion–mediated persistence is more likely a mid-cycle arrest in development rather than a completely distinct gene expression pattern. Here, we describe the Cpn transcriptome during the acute infection, differentiating “late” genes, which correlate to EB proteins, and “tardy” genes, which lead to EB mRNA. Expression profiles during iron mediated–persistence led us to propose the hypothesis that the transcriptomic “clock” is arrested during acute mid-cycle. PMID:17590080

Temperature induced variation in gene expression of thyroid hormone receptors and deiodinases of European eel (Anguilla anguilla) larvae.

PubMed

Politis, S N; Servili, A; Mazurais, D; Zambonino-Infante, J-L; Miest, J J; Tomkiewicz, J; Butts, I A E

2018-04-01

Thyroid hormones (THs) are key regulators of growth, development, and metabolism in vertebrates and influence early life development of fish. TH is produced in the thyroid gland (or thyroid follicles) mainly as T4 (thyroxine), which is metabolized to T3 (3,5,3'-triiodothyronine) and T2 (3,5-diiodothyronine) by deiodinase (DIO) enzymes in peripheral tissues. The action of these hormones is mostly exerted by binding to a specific nuclear thyroid hormone receptor (THR). In this study, we i) cloned and characterized thr sequences, ii) investigated the expression pattern of the different subtypes of thrs and dios, and iii) studied how temperature affects the expression of those genes in artificially produced early life history stages of European eel (Anguilla anguilla), reared in different thermal regimes (16, 18, 20 and 22 °C) from hatch until first-feeding. We identified 2 subtypes of thr (thrα and thrβ) with 2 isoforms each (thrαA, thrαB, thrβA, thrβB) and 3 subtypes of deiodinases (dio1, dio2, dio3). All thr genes identified showed high similarity to the closely related Japanese eel (Anguilla japonica). We found that all genes investigated in this study were affected by larval age (in real time or at specific developmental stages), temperature, and/or their interaction. More specifically, the warmer the temperature the earlier the expression response of a specific target gene. In real time, the expression profiles appeared very similar and only shifted with temperature. In developmental time, gene expression of all genes differed across selected developmental stages, such as at hatch, during teeth formation or at first-feeding. Thus, we demonstrate that thrs and dios show sensitivity to temperature and are involved in and during early life development of European eel. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental Hypothyroidism Reduces the Expression of ...

EPA Pesticide Factsheets

Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress.

PubMed

Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian

2017-04-21

Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species.

Differential maturation of rhythmic clock gene expression during early development in medaka (Oryzias latipes).

PubMed

Cuesta, Ines H; Lahiri, Kajori; Lopez-Olmeda, Jose Fernando; Loosli, Felix; Foulkes, Nicholas S; Vallone, Daniela

2014-05-01

One key challenge for the field of chronobiology is to identify how circadian clock function emerges during early embryonic development. Teleosts such as the zebrafish are ideal models for studying circadian clock ontogeny since the entire process of development occurs ex utero in an optically transparent chorion. Medaka (Oryzias latipes) represents another powerful fish model for exploring early clock function with, like the zebrafish, many tools available for detailed genetic analysis. However, to date there have been no reports documenting circadian clock gene expression during medaka development. Here we have characterized the expression of key clock genes in various developmental stages and in adult tissues of medaka. As previously reported for other fish, light dark cycles are required for the emergence of clock gene expression rhythms in this species. While rhythmic expression of per and cry genes is detected very early during development and seems to be light driven, rhythmic clock and bmal expression appears much later around hatching time. Furthermore, the maturation of clock function seems to correlate with the appearance of rhythmic expression of these positive elements of the clock feedback loop. By accelerating development through elevated temperatures or by artificially removing the chorion, we show an earlier onset of rhythmicity in clock and bmal expression. Thus, differential maturation of key elements of the medaka clock mechanism depends on the developmental stage and the presence of the chorion.

Expression of Heat Shock Protein Genes in Different Developmental Stages and After Temperature Stress in the Maize Weevil (Coleoptera: Curculionidae).

PubMed

Tungjitwitayakul, Jatuporn; Tatun, Nujira; Vajarasathira, Boongeua; Sakurai, Sho

2015-06-01

The maize weevil, Sitophilus zeamais Motschulsky, is a major pest of rice and other postharvest grain stocks in tropical countries. Heating and cooling treatments have been adopted to control this pest. Because heat shock protein (hsp) genes respond to temperature stress, we examined the association of hsp genes with development and thermal stress in S. zeamais. The temperature response of the insect to heat and cold treatments was assessed at four developmental stages: egg, larva, pupa, and adult. LT50 values at high temperatures were similar among the four developmental stages, while adults were the most tolerant to low temperatures, and eggs, larvae, and pupae exhibited similar LT50 values. Expression levels of three hsps--Szhsp70, Szhsc70, and Szhsp90--fluctuated substantially throughout the four stages at a rearing temperature of 28°C. Heat shock and cold shock increased the expression of all three hsps, and the highest upregulation was observed at 40°C, although the intensity of upregulation varied among the three genes: strongly in Szhsp70, moderately in Szhsp90, and slightly in Szhsc70. Basal expression of the three hsps at 28°C and gene responses to heat and cold shock also varied significantly at the tissue level. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Flower development and sex specification in wild grapevine.

PubMed

Ramos, Miguel Jesus Nunes; Coito, João Lucas; Silva, Helena Gomes; Cunha, Jorge; Costa, Maria Manuela Ribeiro; Rocheta, Margarida

2014-12-12

Wild plants of Vitis closely related to the cultivated grapevine (V. v. vinifera) are believed to have been first domesticated 10,000 years BC around the Caspian Sea. V. v. vinifera is hermaphrodite whereas V. v. sylvestris is a dioecious species. Male flowers show a reduced pistil without style or stigma and female flowers present reflexed stamens with infertile pollen. V. vinifera produce perfect flowers with all functional structures. The mechanism for flower sex determination and specification in grapevine is still unknown. To understand which genes are involved during the establishment of male, female and complete flowers, we analysed and compared the transcription profiles of four developmental stages of the three genders. We showed that sex determination is a late event during flower development and that the expression of genes from the ABCDE model is not directly correlated with the establishment of sexual dimorphism. We propose a temporal comprehensive model in which two mutations in two linked genes could be players in sex determination and indirectly establish the Vitis domestication process. Additionally, we also found clusters of genes differentially expressed between genders and between developmental stages that suggest a role involved in sex differentiation. Also, the detection of differentially transcribed regions that extended existing gene models (intergenic regions) between sexes suggests that they may account for some of the variation between the subspecies. There is no evidence of differences of expression levels in genes from the ABCDE model that could explain the shift from hermaphroditism to dioecy. We propose that sex specification occurs after floral organ identity has been established and therefore, sex determination genes might be having an effect downstream of the ABCDE model genes.For the first time a full transcriptomic analysis was performed in different flower developmental stages in the same individual. Our experimental approach enabled us to create a comprehensive catalogue of transcribed genes across developmental stages and genders that will contribute for future work in sex determination in seed plants.

Chromosome rearrangements induce both variegated and reduced, uniform expression of heterochromatic genes in a development-specific manner.

PubMed Central

Weiler, K S; Wakimoto, B T

1998-01-01

In Drosophila melanogaster, chromosome rearrangements that juxtapose euchromatin and heterochromatin can result in position effect variegation (PEV), the variable expression of heterochromatic and euchromatic genes in the vicinity of the novel breakpoint. We examined PEV of the heterochromatic light (lt) and concertina (cta) genes in order to investigate potential tissue or developmental differences in chromosome structure that might be informative for comparing the mechanisms of PEV of heterochromatic and euchromatic genes. We employed tissue pigmentation and in situ hybridization to RNA to assess expression of lt in individual cells of multiple tissues during development. Variegation of lt was induced in the adult eye, larval salivary glands and larval Malpighian tubules for each of three different chromosome rearrangements. The relative severity of the effect in these tissues was not tissue-specific but rather was characteristic of each rearrangement. Surprisingly, larval imaginal discs did not exhibit variegated lt expression. Instead, a uniform reduction of the lt transcript was observed, which correlated in magnitude with the degree of variegation. The same results were obtained for cta expression. These two distinct effects of rearrangements on heterochromatic gene expression correlated with the developmental stage of the tissue. These results have implications for models of heterochromatin formation and the nuclear organization of chromosomes during development and differentiation. PMID:9649533

Genomic regulatory blocks encompass multiple neighboring genes and maintain conserved synteny in vertebrates

PubMed Central

Kikuta, Hiroshi; Laplante, Mary; Navratilova, Pavla; Komisarczuk, Anna Z.; Engström, Pär G.; Fredman, David; Akalin, Altuna; Caccamo, Mario; Sealy, Ian; Howe, Kerstin; Ghislain, Julien; Pezeron, Guillaume; Mourrain, Philippe; Ellingsen, Staale; Oates, Andrew C.; Thisse, Christine; Thisse, Bernard; Foucher, Isabelle; Adolf, Birgit; Geling, Andrea; Lenhard, Boris; Becker, Thomas S.

2007-01-01

We report evidence for a mechanism for the maintenance of long-range conserved synteny across vertebrate genomes. We found the largest mammal-teleost conserved chromosomal segments to be spanned by highly conserved noncoding elements (HCNEs), their developmental regulatory target genes, and phylogenetically and functionally unrelated “bystander” genes. Bystander genes are not specifically under the control of the regulatory elements that drive the target genes and are expressed in patterns that are different from those of the target genes. Reporter insertions distal to zebrafish developmental regulatory genes pax6.1/2, rx3, id1, and fgf8 and miRNA genes mirn9-1 and mirn9-5 recapitulate the expression patterns of these genes even if located inside or beyond bystander genes, suggesting that the regulatory domain of a developmental regulatory gene can extend into and beyond adjacent transcriptional units. We termed these chromosomal segments genomic regulatory blocks (GRBs). After whole genome duplication in teleosts, GRBs, including HCNEs and target genes, were often maintained in both copies, while bystander genes were typically lost from one GRB, strongly suggesting that evolutionary pressure acts to keep the single-copy GRBs of higher vertebrates intact. We show that loss of bystander genes and other mutational events suffered by duplicated GRBs in teleost genomes permits target gene identification and HCNE/target gene assignment. These findings explain the absence of evolutionary breakpoints from large vertebrate chromosomal segments and will aid in the recognition of position effect mutations within human GRBs. PMID:17387144

The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

PubMed

Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

2016-05-19

Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs

PubMed Central

Gálvez, José Héctor; Tai, Helen H.; Lagüe, Martin; Zebarth, Bernie J.; Strömvik, Martina V.

2016-01-01

Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha−1 was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency. PMID:27193058

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

Highly conserved proximal promoter element harbouring paired Sox9-binding sites contributes to the tissue- and developmental stage-specific activity of the matrilin-1 gene.

PubMed

Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya

2005-08-01

The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.

Genetic Diversity Influences the Response of the Brain to Developmental Lead Exposure

PubMed Central

Schneider, Jay S.; Talsania, Keyur; Mettil, William; Anderson, David W.

2014-01-01

Although extrinsic factors, such as nutritional status, and some intrinsic genetic factors may modify susceptibility to developmental lead (Pb) poisoning, no studies have specifically examined the influence of genetic background on outcomes from Pb exposure. In this study, we used gene microarray profiling to identify Pb-responsive genes in rats of different genetic backgrounds, including inbred (Fischer 344 (F344)) and outbred (Long Evans (LE), Sprague Dawley (SD)) strains, to investigate the role that genetic variation may play in influencing outcomes from developmental Pb exposure. Male and female animals received either perinatal (gestation through lactation) or postnatal (birth through weaning) exposure to Pb in food (0, 250, or 750 ppm). RNA was extracted from the hippocampus at day 55 and hybridized to Affymetrix Rat Gene 1.0 ST Arrays. There were significant strain-specific effects of Pb on the hippocampal transcriptome with 978 transcripts differentially expressed in LE rats across all experimental groups, 269 transcripts differentially expressed in F344 rats, and only 179 transcripts differentially expressed in SD rats. These results were not due to strain-related differences in brain accumulation of Pb. Further, no genes were consistently differentially regulated in all experimental conditions. There was no set of “Pb toxicity” genes that are a molecular signature for Pb neurotoxicity that transcended sex, exposure condition, and strain. These results demonstrate the influence that strain and genetic background play in modifying the brain's response to developmental Pb exposure and may have relevance for better understanding the molecular underpinnings of the lack of a neurobehavioral signature in childhood Pb poisoning. PMID:24913800

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiugong, E-mail: xiugong.gao@fda.hhs.gov; Sprando, Robert L.; Yourick, Jeffrey J.

Developmental toxicity testing has traditionally relied on animal models which are costly, time consuming, and require the sacrifice of large numbers of animals. In addition, there are significant disparities between human beings and animals in their responses to chemicals. Thalidomide is a species-specific developmental toxicant that causes severe limb malformations in humans but not in mice. Here, we used microarrays to study transcriptomic changes induced by thalidomide in an in vitro model based on differentiation of mouse embryonic stem cells (mESCs). C57BL/6 mESCs were allowed to differentiate spontaneously and RNA was collected at 24, 48, and 72 h after exposuremore » to 0.25 mM thalidomide. Global gene expression analysis using microarrays revealed hundreds of differentially expressed genes upon thalidomide exposure that were enriched in gene ontology (GO) terms and canonical pathways associated with embryonic development and differentiation. In addition, many genes were found to be involved in small GTPases-mediated signal transduction, heart development, and inflammatory responses, which coincide with clinical evidences and may represent critical embryotoxicities of thalidomide. These results demonstrate that transcriptomics in combination with mouse embryonic stem cell differentiation is a promising alternative model for developmental toxicity assessment. - Highlights: • Studied genomic changes in mouse embryonic stem cells upon thalidomide exposure • Identified gene expression changes that may represent thalidomide embryotoxicity • The toxicogenomic changes coincide well with known thalidomide clinical outcomes. • The mouse embryonic stem cell model is suitable for developmental toxicity testing. • The model has the potential for high-throughput screening of a multitude of compounds.« less

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research

PubMed Central

Kockel, Lutz; Huq, Lutfi M.; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E. S.; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M.; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E.; Chisholm, Townley W.; Kim, Seung K.

2016-01-01

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila. However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. PMID:27527793

A Drosophila LexA Enhancer-Trap Resource for Developmental Biology and Neuroendocrine Research.

PubMed

Kockel, Lutz; Huq, Lutfi M; Ayyar, Anika; Herold, Emma; MacAlpine, Elle; Logan, Madeline; Savvides, Christina; Kim, Grace E S; Chen, Jiapei; Clark, Theresa; Duong, Trang; Fazel-Rezai, Vahid; Havey, Deanna; Han, Samuel; Jagadeesan, Ravi; Kim, Eun Soo Jackie; Lee, Diane; Lombardo, Kaelina; Piyale, Ida; Shi, Hansen; Stahr, Lydia; Tung, Dana; Tayvah, Uriel; Wang, Flora; Wang, Ja-Hon; Xiao, Sarah; Topper, Sydni M; Park, Sangbin; Rotondo, Cheryl; Rankin, Anne E; Chisholm, Townley W; Kim, Seung K

2016-10-13

Novel binary gene expression tools like the LexA-LexAop system could powerfully enhance studies of metabolism, development, and neurobiology in Drosophila However, specific LexA drivers for neuroendocrine cells and many other developmentally relevant systems remain limited. In a unique high school biology course, we generated a LexA-based enhancer trap collection by transposon mobilization. The initial collection provides a source of novel LexA-based elements that permit targeted gene expression in the corpora cardiaca, cells central for metabolic homeostasis, and other neuroendocrine cell types. The collection further contains specific LexA drivers for stem cells and other enteric cells in the gut, and other developmentally relevant tissue types. We provide detailed analysis of nearly 100 new LexA lines, including molecular mapping of insertions, description of enhancer-driven reporter expression in larval tissues, and adult neuroendocrine cells, comparison with established enhancer trap collections and tissue specific RNAseq. Generation of this open-resource LexA collection facilitates neuroendocrine and developmental biology investigations, and shows how empowering secondary school science can achieve research and educational goals. Copyright © 2016 Kockel et al.

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

Extensive transcriptional response associated with seasonal plasticity of butterfly wing patterns.

PubMed

Daniels, Emily V; Murad, Rabi; Mortazavi, Ali; Reed, Robert D

2014-12-01

In the eastern United States, the buckeye butterfly, Junonia coenia, shows seasonal wing colour plasticity where adults emerging in the spring are tan, while those emerging in the autumn are dark red. This variation can be artificially induced in laboratory colonies, thus making J. coenia a useful model system to examine the mechanistic basis of plasticity. To better understand the developmental basis of seasonal plasticity, we used RNA-seq to quantify transcription profiles associated with development of alternative seasonal wing morphs. Depending on the developmental stage, between 547 and 1420 transfrags were significantly differentially expressed between morphs. These extensive differences in gene expression stand in contrast to the much smaller numbers of differentially expressed transcripts identified in previous studies of genetic wing pattern variation in other species and suggest that environmentally induced phenotypic shifts arise from very broad systemic processes. Analyses of candidate endocrine and pigmentation transcripts revealed notable genes upregulated in the red morph, including several ecdysone-associated genes, and cinnabar, an ommochrome pigmentation gene implicated in colour pattern variation in other butterflies. We also found multiple melanin-related transcripts strongly upregulated in the red morph, including tan and yellow-family genes, leading us to speculate that dark red pigmentation in autumn J. coenia may involve nonommochrome pigments. While we identified several endocrine and pigmentation genes as obvious candidates for seasonal colour morph differentiation, we speculate that the majority of observed expression differences were due to thermal stress response. The buckeye transcriptome provides a basis for further developmental studies of phenotypic plasticity. © 2014 John Wiley & Sons Ltd.

Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis.

PubMed

Strakovsky, Rita S; Wang, Huan; Engeseth, Nicki J; Flaws, Jodi A; Helferich, William G; Pan, Yuan-Xiang; Lezmi, Stéphane

2015-04-15

Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague-Dawley rats were dosed with vehicle (oil) or BPA (100μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. Copyright © 2015 Elsevier Inc. All rights reserved.

Differential Expression of Anthocyanin Biosynthetic Genes and Transcription Factor PcMYB10 in Pears (Pyrus communis L.)

PubMed Central

Li, Xi-Hong; Wu, Mao-Yu; Wang, Ai-Li; Jiang, Yu-Qian; Jiang, Yun-Hong

2012-01-01

Anthocyanin biosynthesis in various plants is affected by environmental conditions and controlled by the transcription level of the corresponding genes. In pears (Pyrus communis cv. ‘Wujiuxiang’), anthocyanin biosynthesis is significantly induced during low temperature storage compared with that at room temperature. We further examined the transcriptional levels of anthocyanin biosynthetic genes in ‘Wujiuxiang’ pears during developmental ripening and temperature-induced storage. The expression of genes that encode flavanone 3-hydroxylase, dihydroflavonol 4-reductase, anthocyanidin synthase, UDP-glucose: flavonoid 3-O-glucosyltransferase, and R2R3 MYB transcription factor (PcMYB10) was strongly positively correlated with anthocyanin accumulation in ‘Wujiuxiang’ pears in response to both developmental and cold-temperature induction. Hierarchical clustering analysis revealed the expression patterns of the set of target genes, of which PcMYB10 and most anthocyanin biosynthetic genes were related to the same cluster. The present work may help explore the molecular mechanism that regulates anthocyanin biosynthesis and its response to abiotic stress at the transcriptional level in plants. PMID:23029391

Protective effects of puerarin against tetrabromobisphenol a-induced apoptosis and cardiac developmental toxicity in zebrafish embryo-larvae.

PubMed

Yang, Suwen; Wang, Shengrui; Sun, Fengchao; Zhang, Mengmeng; Wu, Fengchang; Xu, Fanfan; Ding, Zhishan

2015-09-01

Tetrabromobisphenol A (TBBPA), a brominated flame retardant, is detected commonly in aquatic environments, where it is thought to be highly toxic to the development of aquatic life. In this study, zebrafish embryos and larvae were used to investigate the protective effects of puerarin after exposure to TBBPA. Malformation, blood flow disorders, pericardial edema, and spawn coagulation rates increased, whereas survival decreased significantly after exposure to 0.5 and 1.0 mg L(-1) TBBPA. The measured indices of morphological toxicity improved after treatment with puerarin. TBBPA also induced reactive oxygen species (ROS) production in a dose-dependent manner. Acridine orange staining results revealed that TBBPA exposure caused cardiomyocyte apoptosis and induced the expression of three proapoptotic genes: P53, Bax, and Caspase9. In contrast, the expression of the antiapoptotic gene Bcl2 was down-regulated. When genes related to cardiac development were assessed, the expression of Tbx1, Raldh2, and Bmp2b changed after exposure to the combination of TBBPA and puerarin. These results suggest that TBBPA induces cardiomyocyte apoptosis and ROS production, resulting in cardiac developmental toxicity in zebrafish embryos or larvae. Therefore, puerarin regulates the expression of cardiac developmental genes, such as Tbx1, Bmp2b, and Raldh2 by inhibiting ROS production, and subsequently modulates cardiac development after the exposure of zebrafish larvae to TBBPA. © 2014 Wiley Periodicals, Inc.

Spatial fluctuations in expression of the heterocyst differentiation regulatory gene hetR in Anabaena filaments.

PubMed

Corrales-Guerrero, Laura; Tal, Asaf; Arbel-Goren, Rinat; Mariscal, Vicente; Flores, Enrique; Herrero, Antonia; Stavans, Joel

2015-04-01

Under nitrogen deprivation, filaments of the cyanobacterium Anabaena undergo a process of development, resulting in a one-dimensional pattern of nitrogen-fixing heterocysts separated by about ten photosynthetic vegetative cells. Many aspects of gene expression before nitrogen deprivation and during the developmental process remain to be elucidated. Furthermore, the coupling of gene expression fluctuations between cells along a multicellular filament is unknown. We studied the statistics of fluctuations of gene expression of HetR, a transcription factor essential for heterocyst differentiation, both under steady-state growth in nitrogen-rich conditions and at different times following nitrogen deprivation, using a chromosomally-encoded translational hetR-gfp fusion. Statistical analysis of fluorescence at the individual cell level in wild-type and mutant filaments demonstrates that expression fluctuations of hetR in nearby cells are coupled, with a characteristic spatial range of circa two to three cells, setting the scale for cellular interactions along a filament. Correlations between cells predominantly arise from intercellular molecular transfer and less from cell division. Fluctuations after nitrogen step-down can build up on those under nitrogen-replete conditions. We found that under nitrogen-rich conditions, basal, steady-state expression of the HetR inhibitor PatS, cell-cell communication influenced by the septal protein SepJ and positive HetR auto-regulation are essential determinants of fluctuations in hetR expression and its distribution along filaments. A comparison between the expression of hetR-gfp under nitrogen-rich and nitrogen-poor conditions highlights the differences between the two HetR inhibitors PatS and HetN, as well as the differences in specificity between the septal proteins SepJ and FraC/FraD. Activation, inhibition and cell-cell communication lie at the heart of developmental processes. Our results show that proteins involved in these basic ingredients combine together in the presence of inevitable stochasticity in gene expression, to control the coupled fluctuations of gene expression that give rise to a one-dimensional developmental pattern in this organism.

Genetic element from human surfactant protein SP-C gene confers bronchiolar-alveolar cell specificity in transgenic mice.

PubMed

Glasser, S W; Korfhagen, T R; Wert, S E; Bruno, M D; McWilliams, K M; Vorbroker, D K; Whitsett, J A

1991-10-01

Transgenic mice bearing chimeric genes consisting of 5'-sequences derived from the human surfactant protein C (SP-C) gene and the bacterial chloramphenicol acetyltransferase (CAT) gene were generated. Analysis of CAT activity was utilized to demonstrate tissue-specific and developmental expression of chimeric genes containing 3.7 kb of sequences from the human SP-C gene. Lung-specific expression of the 3.7 SP-C-CAT transgene was observed in eight distinct transgenic mouse lines. Expression of the 3.7 SP-C-CAT transgene was first detected in fetal lung on day 11 of gestation and increased dramatically with advancing gestational age, reaching adult levels of activity before birth. In situ hybridization demonstrated that expression of 3.7 SP-C-CAT mRNA was confined to the distal respiratory epithelium. Antisense CAT hybridization was detected in bronchiolar and type II epithelial cells in the adult lung of the 3.7 SP-C-CAT transgenic mice. In situ hybridization of four distinct 3.7 SP-C-CAT transgenic mouse lines demonstrated bronchiolar-alveolar expression of the chimeric CAT gene, although the relative intensity of expression at each site varied within the lines studied. Glucocorticoids increased murine SP-C mRNA in fetal lung organ culture. Likewise, expression of 3.7 SP-C-CAT transgene increased during fetal lung organ or explant culture and was further enhanced by glucocorticoid in vitro. The 5'-regions of human SP-C conferred developmental, lung epithelial, and glucocorticoid-enhanced expression of bacterial CAT in transgenic mice. The increased expression of SP-C accompanying prenatal lung development and exposure to glucocorticoid is mediated, at least in part, at the transcriptional level, being influenced by cis-active elements contained within the 5'-flanking region of the human SP-C gene.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cui Xiangshun; Li Xingyu; Kim, Nam-Hyung

To gain insights into the roles the paternal genome and chromosome number play in pre-implantation development, we cultured fertilized embryos and diploid and haploid parthenotes (DPs and HPs, respectively), and compared their development and gene expression patterns. The DPs and fertilized embryos did not differ in developmental ability but HPs development was slower and characterized by impaired compaction and blastocoel formation. Microarray analysis revealed that fertilized blastocysts expressed several genes at higher levels than DP blastocysts; these included the Y-chromosome-specific gene eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked (Eif2s3y) and the imprinting gene U2 small nuclear ribonucleoproteinmore » auxiliary factor 1, related sequence 1 (U2af1-rs1). We also found that when DPs and HPs were both harvested at 44 and 58 h of culture, they differed in the expression of 38 and 665 genes, respectively. However, when DPs and HPs were harvested at the midpoints of 4-cell stage (44 and 49 h, respectively), no differences in expression was observed. Similarly, when the DPs and HPs were harvested when they became blastocysts (102 and 138 h, respectively), only 15 genes showed disparate expression. These results suggest that while transcripts needed for early development are delayed in HPs, it does progress sufficiently for the generation of the various developmental stages despite the lack of genetic components.« less

Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer

PubMed Central

An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

2015-01-01

Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan–Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients. PMID:26691761

Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer.

PubMed

An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

2015-12-22

Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan-Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients.

CELLULAR, BIOCHEMICAL, AND MOLECULAR TECHNIQUES IN DEVELOPMENTAL TOXICOLOGY

EPA Science Inventory

Cellular, molecular and biochemical approaches vastly expand the possibilities for revealing the underlying mechanisms of developmental toxicity. The increasing interest in embryonic development as a model system for the study of gene expression has resulted in a cornucopia of i...

Genetic mechanisms involved in the evolution of the cephalopod camera eye revealed by transcriptomic and developmental studies

PubMed Central

2011-01-01

Background Coleoid cephalopods (squids and octopuses) have evolved a camera eye, the structure of which is very similar to that found in vertebrates and which is considered a classic example of convergent evolution. Other molluscs, however, possess mirror, pin-hole, or compound eyes, all of which differ from the camera eye in the degree of complexity of the eye structures and neurons participating in the visual circuit. Therefore, genes expressed in the cephalopod eye after divergence from the common molluscan ancestor could be involved in eye evolution through association with the acquisition of new structural components. To clarify the genetic mechanisms that contributed to the evolution of the cephalopod camera eye, we applied comprehensive transcriptomic analysis and conducted developmental validation of candidate genes involved in coleoid cephalopod eye evolution. Results We compared gene expression in the eyes of 6 molluscan (3 cephalopod and 3 non-cephalopod) species and selected 5,707 genes as cephalopod camera eye-specific candidate genes on the basis of homology searches against 3 molluscan species without camera eyes. First, we confirmed the expression of these 5,707 genes in the cephalopod camera eye formation processes by developmental array analysis. Second, using molecular evolutionary (dN/dS) analysis to detect positive selection in the cephalopod lineage, we identified 156 of these genes in which functions appeared to have changed after the divergence of cephalopods from the molluscan ancestor and which contributed to structural and functional diversification. Third, we selected 1,571 genes, expressed in the camera eyes of both cephalopods and vertebrates, which could have independently acquired a function related to eye development at the expression level. Finally, as experimental validation, we identified three functionally novel cephalopod camera eye genes related to optic lobe formation in cephalopods by in situ hybridization analysis of embryonic pygmy squid. Conclusion We identified 156 genes positively selected in the cephalopod lineage and 1,571 genes commonly found in the cephalopod and vertebrate camera eyes from the analysis of cephalopod camera eye specificity at the expression level. Experimental validation showed that the cephalopod camera eye-specific candidate genes include those expressed in the outer part of the optic lobes, which unique to coleoid cephalopods. The results of this study suggest that changes in gene expression and in the primary structure of proteins (through positive selection) from those in the common molluscan ancestor could have contributed, at least in part, to cephalopod camera eye acquisition. PMID:21702923

mirEX: a platform for comparative exploration of plant pri-miRNA expression data.

PubMed

Bielewicz, Dawid; Dolata, Jakub; Zielezinski, Andrzej; Alaba, Sylwia; Szarzynska, Bogna; Szczesniak, Michal W; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia; Karlowski, Wojciech M

2012-01-01

mirEX is a comprehensive platform for comparative analysis of primary microRNA expression data. RT-qPCR-based gene expression profiles are stored in a universal and expandable database scheme and wrapped by an intuitive user-friendly interface. A new way of accessing gene expression data in mirEX includes a simple mouse operated querying system and dynamic graphs for data mining analyses. In contrast to other publicly available databases, the mirEX interface allows a simultaneous comparison of expression levels between various microRNA genes in diverse organs and developmental stages. Currently, mirEX integrates information about the expression profile of 190 Arabidopsis thaliana pri-miRNAs in seven different developmental stages: seeds, seedlings and various organs of mature plants. Additionally, by providing RNA structural models, publicly available deep sequencing results, experimental procedure details and careful selection of auxiliary data in the form of web links, mirEX can function as a one-stop solution for Arabidopsis microRNA information. A web-based mirEX interface can be accessed at http://bioinfo.amu.edu.pl/mirex.

Gene Expression Data from the Moon Jelly, Aurelia, Provide Insights into the Evolution of the Combinatorial Code Controlling Animal Sense Organ Development.

PubMed

Nakanishi, Nagayasu; Camara, Anthony C; Yuan, David C; Gold, David A; Jacobs, David K

2015-01-01

In Bilateria, Pax6, Six, Eya and Dach families of transcription factors underlie the development and evolution of morphologically and phyletically distinct eyes, including the compound eyes in Drosophila and the camera-type eyes in vertebrates, indicating that bilaterian eyes evolved under the strong influence of ancestral developmental gene regulation. However the conservation in eye developmental genetics deeper in the Eumetazoa, and the origin of the conserved gene regulatory apparatus controlling eye development remain unclear due to limited comparative developmental data from Cnidaria. Here we show in the eye-bearing scyphozoan cnidarian Aurelia that the ectodermal photosensory domain of the developing medusa sensory structure known as the rhopalium expresses sine oculis (so)/six1/2 and eyes absent/eya, but not optix/six3/6 or pax (A&B). In addition, the so and eya co-expression domain encompasses the region of active cell proliferation, neurogenesis, and mechanoreceptor development in rhopalia. Consistent with the role of so and eya in rhopalial development, developmental transcriptome data across Aurelia life cycle stages show upregulation of so and eya, but not optix or pax (A&B), during medusa formation. Moreover, pax6 and dach are absent in the Aurelia genome, and thus are not required for eye development in Aurelia. Our data are consistent with so and eya, but not optix, pax or dach, having conserved functions in sensory structure specification across Eumetazoa. The lability of developmental components including Pax genes relative to so-eya is consistent with a model of sense organ development and evolution that involved the lineage specific modification of a combinatorial code that specifies animal sense organs.

Developmental and Environmental Regulation of Aquaporin Gene Expression across Populus Species: Divergence or Redundancy?

PubMed Central

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected. PMID:23393587

Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

PubMed

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected.

Selection of housekeeping genes as internal controls for quantitative RT-PCR analysis of the veined rapa whelk (Rapana venosa).

PubMed

Song, Hao; Dang, Xin; He, Yuan-Qiu; Zhang, Tao; Wang, Hai-Yan

2017-01-01

The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa . For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1 α ( EF-1α ), α -actin ( ACT ), cytochrome c oxidase subunit 1 ( COX1 ), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1 α subcomplex subunit 7 ( NDUFA7 ), 60S ribosomal protein L5 ( RL5 ), 60S ribosomal protein L28 ( RL28 ), glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ), β -tubulin ( TUBB ), 40S ribosomal protein S25 ( RS25 ), 40S ribosomal protein S8 ( RS8 ), ubiquitin-conjugating enzyme E2 ( UBE2 ), histone H3 ( HH3 ), and peptidyl-prolyl cis-trans isomerase A ( PPIA ). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α , RL5 , and NDUFA7 for liver , GAPDH , PPIA , and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene in all developmental stages measured, and COX1 and RL5 were appropriate secondary choices. For the specific developmental stage, we recommended the following combination for normalization, PPIA , RS25 , and RL28 for stage 1, RL5 and RL28 for stage 2 and 5, RL28 and NDUFA7 for stage 3, and PPIA and TUBB for stage 4. Our results are instrumental for the selection of appropriately validated housekeeping genes for use as internal controls for gene expression studies in adult tissues or larval development of R. venosa in the future.

Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

PubMed Central

Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

2014-01-01

Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.

Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C,more » and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a DNA methylation, histones, and transcription factors.« less

Comparative methods for the analysis of gene-expression evolution: an example using yeast functional genomic data.

PubMed

Oakley, Todd H; Gu, Zhenglong; Abouheif, Ehab; Patel, Nipam H; Li, Wen-Hsiung

2005-01-01

Understanding the evolution of gene function is a primary challenge of modern evolutionary biology. Despite an expanding database from genomic and developmental studies, we are lacking quantitative methods for analyzing the evolution of some important measures of gene function, such as gene-expression patterns. Here, we introduce phylogenetic comparative methods to compare different models of gene-expression evolution in a maximum-likelihood framework. We find that expression of duplicated genes has evolved according to a nonphylogenetic model, where closely related genes are no more likely than more distantly related genes to share common expression patterns. These results are consistent with previous studies that found rapid evolution of gene expression during the history of yeast. The comparative methods presented here are general enough to test a wide range of evolutionary hypotheses using genomic-scale data from any organism.

Developmental transcriptome analysis and identification of genes involved in formation of intestinal air-breathing function of Dojo loach, Misgurnus anguillicaudatus

PubMed Central

Luo, Weiwei; Cao, Xiaojuan; Xu, Xiuwen; Huang, Songqian; Liu, Chuanshu; Tomljanovic, Tea

2016-01-01

Dojo loach, Misgurnus anguillicaudatus is a freshwater fish species of the loach family Cobitidae, using its posterior intestine as an accessory air-breathing organ. Little is known about the molecular regulatory mechanisms in the formation of intestinal air-breathing function of M. anguillicaudatus. Here high-throughput sequencing of mRNAs was performed from six developmental stages of posterior intestine of M. anguillicaudatus: 4-Dph (days post hatch) group, 8-Dph group, 12-Dph group, 20-Dph group, 40-Dph group and Oyd (one-year-old) group. These six libraries were assembled into 81300 unigenes. Totally 40757 unigenes were annotated. Subsequently, 35291 differentially expressed genes (DEGs) were scanned among different developmental stages and clustered into 20 gene expression profiles. Finally, 15 key pathways and 25 key genes were mined, providing potential targets for candidate gene selection involved in formation of intestinal air-breathing function in M. anguillicaudatus. This is the first report of developmental transcriptome of posterior intestine in M. anguillicaudatus, offering a substantial contribution to the sequence resources for this species and providing a deep insight into the formation mechanism of its intestinal air-breathing function. This report demonstrates that M. anguillicaudatus is a good model for studies to identify and characterize the molecular basis of accessory air-breathing organ development in fish. PMID:27545457

Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni.

PubMed

Neumann, S; Ziv, E; Lantner, F; Schechter, I

1993-03-01

Analyses of RNA from different developmental stages of Schistosoma mansoni showed stage-specific expression of heat-shock protein 70 (hsp70), which is regulated by a developmental program and by stress. The developmental program, common to hsp70 and other genes (e.g. paramyosin), refers to constitutive expression in miracidia sporocyst and adult worm but not in cercariae, and to the termination of hsp70 gene transcription during sporocyst/cercaria transformation. Stress induction, specific to hsp70, refers to transient accumulation of high levels of hsp70 mRNA during cercariae/schistosomula transformation and in adult worms after heat shock (42 degrees C). Cercariae/schistosomula transformation can be visualized as a physiological stress involving shifts in temperature (23-37 degrees C) and in salt concentration (from water to isotonic medium), as well as removal of tails from cercariae to yield isolated bodies that transform into schistosomula. It was found that temperature is an important factor, but not sufficient for strong induction of the hsp70 genes of schistosomula. Tail removal is an obligatory step for full induction of the hsp70 genes of schistosomula, in response to a temperature shift from 23-37 degrees C. The hsp70 genes in cercariae and isolated tails do not respond to stimuli (salt and temperature increases) that strongly activate the genes in isolated bodies (i.e., schistosomula). We speculate that the hsp70 genes in intact cercariae are not inducible because the tails can produce inhibitory signals that diffuse to the bodies and suppress their hsp70 genes. This hypothesis is useful to explain the termination of hsp70 gene transcription during sporocyst/cercaria transformation by the inhibitory effect of the growing tail.

Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.

PubMed

Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D

2014-07-21

Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric development may involve re-programming of the transcriptome through small modifications of the developmental genetic network, which may also indicate that response to social interaction involves many genes with individually small transcriptional effect.

Selection of reliable reference genes for normalization of quantitative RT-PCR from different developmental stages and tissues in amphioxus

PubMed Central

Zhang, Qi-Lin; Zhu, Qian-Hua; Liao, Xin; Wang, Xiu-Qiang; Chen, Tao; Xu, Han-Ting; Wang, Juan; Yuan, Ming-Long; Chen, Jun-Yuan

2016-01-01

Amphioxus is a closest living proxy to the ancestor of cephalochordates with vertebrates, and key animal for novel understanding in the evolutionary origin of vertebrate body plan, genome, tissues and immune system. Reliable analyses using quantitative real-time PCR (qRT-PCR) for answering these scientific questions is heavily dependent on reliable reference genes (RGs). In this study, we evaluated stability of thirteen candidate RGs in qRT-PCR for different developmental stages and tissues of amphioxus by four independent (geNorm, NormFinder, BestKeeper and deltaCt) and one comparative algorithms (RefFinder). The results showed that the top two stable RGs were the following: (1) S20 and 18 S in thirteen developmental stages, (2) EF1A and ACT in seven normal tissues, (3) S20 and L13 in both intestine and hepatic caecum challenged with lipopolysaccharide (LPS), and (4) S20 and EF1A in gill challenged with LPS. The expression profiles of two target genes (EYA and HHEX) in thirteen developmental stages were used to confirm the reliability of chosen RGs. This study identified optimal RGs that can be used to accurately measure gene expression under these conditions, which will benefit evolutionary and functional genomics studies in amphioxus. PMID:27869224

A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

PubMed

Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

2016-02-01

Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Integrating Membrane Transport with Male Gametophyte Development and Function through Transcriptomics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bock KW; D Honys; JM. Ward

Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. About 1269 genes encoding classified transporters were collected from themore » Arabidopsis thaliana genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3 and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9); while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, were developmentally-regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::GUS analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.« less

Integrating membrane transport with male gametophyte development and function through transcriptomics.

PubMed

Bock, Kevin W; Honys, David; Ward, John M; Padmanaban, Senthilkumar; Nawrocki, Eric P; Hirschi, Kendal D; Twell, David; Sze, Heven

2006-04-01

Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth, and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. Approximately 1,269 genes encoding classified transporters were collected from the Arabidopsis (Arabidopsis thaliana) genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3, and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9), while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, was developmentally regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::beta-glucuronidase analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.

Cerebellum: links between development, developmental disorders and motor learning

PubMed Central

Manto, Mario U.; Jissendi, Patrice

2012-01-01

The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodeling are being unraveled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signaling between granule cells and Purkinje neurons. The expression profile of sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired developments and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders. PMID:22291620

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Molecular processes of transgenerational acclimation to a warming ocean

NASA Astrophysics Data System (ADS)

Veilleux, Heather D.; Ryu, Taewoo; Donelson, Jennifer M.; van Herwerden, Lynne; Seridi, Loqmane; Ghosheh, Yanal; Berumen, Michael L.; Leggat, William; Ravasi, Timothy; Munday, Philip L.

2015-12-01

Some animals have the remarkable capacity to acclimate across generations to projected future climate change; however, the underlying molecular processes are unknown. We sequenced and assembled de novo transcriptomes of adult tropical reef fish exposed developmentally or transgenerationally to projected future ocean temperatures and correlated the resulting expression profiles with acclimated metabolic traits from the same fish. We identified 69 contigs representing 53 key genes involved in thermal acclimation of aerobic capacity. Metabolic genes were among the most upregulated transgenerationally, suggesting shifts in energy production for maintaining performance at elevated temperatures. Furthermore, immune- and stress-responsive genes were upregulated transgenerationally, indicating a new complement of genes allowing the second generation of fish to better cope with elevated temperatures. Other differentially expressed genes were involved with tissue development and transcriptional regulation. Overall, we found a similar suite of differentially expressed genes among developmental and transgenerational treatments. Heat-shock protein genes were surprisingly unresponsive, indicating that short-term heat-stress responses may not be a good indicator of long-term acclimation capacity. Our results are the first to reveal the molecular processes that may enable marine fishes to adjust to a future warmer environment over multiple generations.

Enriched expression of the ciliopathy gene Ick in cell proliferating regions of adult mice.

PubMed

Tsutsumi, Ryotaro; Chaya, Taro; Furukawa, Takahisa

2018-04-07

Cilia are essential for sensory and motile functions across species. In humans, ciliary dysfunction causes "ciliopathies", which show severe developmental abnormalities in various tissues. Several missense mutations in intestinal cell kinase (ICK) gene lead to endocrine-cerebro-osteodysplasia syndrome or short rib-polydactyly syndrome, lethal recessive developmental ciliopathies. We and others previously reported that Ick-deficient mice exhibit neonatal lethality with developmental defects. Mechanistically, Ick regulates intraflagellar transport and cilia length at ciliary tips. Although Ick plays important roles during mammalian development, roles of Ick at the adult stage are poorly understood. In the current study, we investigated the Ick gene expression in adult mouse tissues. RT-PCR analysis showed that Ick is ubiquitously expressed, with enrichment in the retina, brain, lung, intestine, and reproductive system. In the adult brain, we found that Ick expression is enriched in the walls of the lateral ventricle, in the rostral migratory stream of the olfactory bulb, and in the subgranular zone of the hippocampal dentate gyrus by in situ hybridization analysis. We also observed that Ick staining pattern is similar to pachytene spermatocyte to spermatid markers in the mature testis and to an intestinal stem cell marker in the adult small intestine. These results suggest that Ick is expressed in proliferating regions in the adult mouse brain, testis, and intestine. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparison of Gene Expression in Human Embryonic Stem Cells, hESC-Derived Mesenchymal Stem Cells and Human Mesenchymal Stem Cells.

PubMed

Barbet, Romain; Peiffer, Isabelle; Hatzfeld, Antoinette; Charbord, Pierre; Hatzfeld, Jacques A

2011-01-01

We present a strategy to identify developmental/differentiation and plasma membrane marker genes of the most primitive human Mesenchymal Stem Cells (hMSCs). Using sensitive and quantitative TaqMan Low Density Arrays (TLDA) methodology, we compared the expression of 381 genes in human Embryonic Stem Cells (hESCs), hESC-derived MSCs (hES-MSCs), and hMSCs. Analysis of differentiation genes indicated that hES-MSCs express the sarcomeric muscle lineage in addition to the classical mesenchymal lineages, suggesting they are more primitive than hMSCs. Transcript analysis of membrane antigens suggests that IL1R1(low), BMPR1B(low), FLT4(low), LRRC32(low), and CD34 may be good candidates for the detection and isolation of the most primitive hMSCs. The expression in hMSCs of cytokine genes, such as IL6, IL8, or FLT3LG, without expression of the corresponding receptor, suggests a role for these cytokines in the paracrine control of stem cell niches. Our database may be shared with other laboratories in order to explore the considerable clinical potential of hES-MSCs, which appear to represent an intermediate developmental stage between hESCs and hMSCs.

Spatial and temporal expression of the Grainyhead-like transcription factor family during murine development.

PubMed

Auden, Alana; Caddy, Jacinta; Wilanowski, Tomasz; Ting, Stephen B; Cunningham, John M; Jane, Stephen M

2006-10-01

The Drosophila transcription factor Grainyhead (grh) is expressed in ectoderm-derived tissues where it regulates several key developmental events including cuticle formation, tracheal elongation and dorsal closure. Our laboratory has recently identified three novel mammalian homologues of the grh gene, Grainyhead-like 1, -2 and -3 (Grhl1-3) that rewrite the phylogeny of this family. Using gene targeting in mice, we have shown that Grhl3 is essential for neural tube closure, skin barrier formation and wound healing. Despite their extensive sequence homology, Grhl1 and Grhl2 are unable to compensate for loss of Grhl3 in these developmental processes. To explore this lack of redundancy, and to gain further insights into the functions of this gene family in mammalian development we have performed an extensive in situ hybridisation analysis. We demonstrate that, although all three Grhl genes are highly expressed in the developing epidermis, they display subtle differences in the timing and level of expression. Surprisingly, we also demonstrate differential expression patterns in non-ectoderm-derived tissues, including the heart, the lung, and the metanephric kidney. These findings expand our understanding of the unique role of Grhl3 in neurulation and epidermal morphogenesis, and provide a focus for further functional analysis of the Grhl genes during mouse embryogenesis.

Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae)

PubMed Central

Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

2015-01-01

The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture. PMID:26352931

Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae).

PubMed

Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

2015-01-01

The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture.

Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

PubMed Central

Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A

2008-01-01

Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC), SGN-U321250 (TIP41), SGN-U346908 ("Expressed") and SGN-U316474 (SAND) genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time RT-PCR studies of gene expression during tomato development process. From our study a tool-kit of control genes emerges that outperform the traditional genes in terms of expression stability. PMID:19102748

Systems Approaches to Predict the Functions of Glycoside Hydrolases during the Life Cycle of Aspergillus niger Using Developmental Mutants ∆brlA and ∆flbA

PubMed Central

van Munster, Jolanda M.; Nitsche, Benjamin M.; Akeroyd, Michiel; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.; Ram, Arthur F. J.

2015-01-01

Background The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis. Results In this study, we used developmental mutants (ΔflbA and ΔbrlA) which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced. Conclusion The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall modification, which contributes to understanding cell wall remodeling mechanisms during development. PMID:25629352

Microarray Analysis of microRNA Expression during Axolotl Limb Regeneration

PubMed Central

Holman, Edna C.; Campbell, Leah J.; Hines, John; Crews, Craig M.

2012-01-01

Among vertebrates, salamanders stand out for their remarkable capacity to quickly regrow a myriad of tissues and organs after injury or amputation. The limb regeneration process in axolotls (Ambystoma mexicanum) has been well studied for decades at the cell-tissue level. While several developmental genes are known to be reactivated during this epimorphic process, less is known about the role of microRNAs in urodele amphibian limb regeneration. Given the compelling evidence that many microRNAs tightly regulate cell fate and morphogenetic processes through development and adulthood by modulating the expression (or re-expression) of developmental genes, we investigated the possibility that microRNA levels change during limb regeneration. Using two different microarray platforms to compare the axolotl microRNA expression between mid-bud limb regenerating blastemas and non-regenerating stump tissues, we found that miR-21 was overexpressed in mid-bud blastemas compared to stump tissue. Mature A. mexicanum (“Amex”) miR-21 was detected in axolotl RNA by Northern blot and differential expression of Amex-miR-21 in blastema versus stump was confirmed by quantitative RT-PCR. We identified the Amex Jagged1 as a putative target gene for miR-21 during salamander limb regeneration. We cloned the full length 3′UTR of Amex-Jag1, and our in vitro assays demonstrated that its single miR-21 target recognition site is functional and essential for the response of the Jagged1 gene to miR-21 levels. Our findings pave the road for advanced in vivo functional assays aimed to clarify how microRNAs such as miR-21, often linked to pathogenic cell growth, might be modulating the redeployment of developmental genes such as Jagged1 during regenerative processes. PMID:23028429

Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them

PubMed Central

Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

2015-01-01

Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF. PMID:26053554

Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

PubMed

Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

2015-01-01

Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

Transcriptome analysis of starch and sucrose metabolism across bulb development in Sagittaria sagittifolia.

PubMed

Gao, Meiping; Zhang, Shangwen; Luo, Cong; He, Xinhua; Wei, Shaolong; Jiang, Wen; He, Fanglian; Lin, Zhicheng; Yan, Meixin; Dong, Weiqong

2018-04-05

Sagittaria sagittifolia L is an important bulb vegetable that has high nutritional and medical value. Bulb formation and development are crucial to Sagittaria sagittifolia; however, its sucrose metabolism is poorly understood and there are a lack of sufficient transcriptomic and genomic data available to fully understand the molecular mechanisms underlying bulb formation and development as well as the bulb transcriptome. Five cDNA libraries were constructed at different developmental stages and sequenced using high-throughput Illumina RNA sequencing. From approximately 63.53 Gb clean reads, a total of 60,884 unigenes, with an average length of 897.34 bp and N50 of 1.368 kb, were obtained. A total of 36,590 unigenes were successfully annotated using five public databases. Across different developmental stages, 4195, 827, 832, 851, and 1494 were differentially expressed in T02, T03, T04, T05, and T06 libraries, respectively. Gene ontology (GO) analysis revealed several differentially-expressed genes (DEGs) associated with catalytic activity, binding, and transporter activity. The Kyoto encyclopedia of genes and genomes (KEGG) revealed that these DEGs are involved in physiological and biochemical processes. RT-qPCR was used to profile the expression of these unigenes and revealed that the expression patterns of the DEGs were consistent with the transcriptome data. In this study, we conducted a comparative gene expression analysis at the transcriptional level using RNA-seq across the different developmental stages of Sagittaria sagittifolia. We identified a set of genes that might contribute to starch and sucrose metabolism, and the genetic mechanisms related to bulblet development were also explored. This study provides important data for future studies of the genetic and molecular mechanisms underlying bulb formation and development in Sagittaria sagittifolia. Copyright © 2018. Published by Elsevier B.V.

Identifying candidate genes affecting developmental time in Drosophila melanogaster: pervasive pleiotropy and gene-by-environment interaction

PubMed Central

Mensch, Julián; Lavagnino, Nicolás; Carreira, Valeria Paula; Massaldi, Ana; Hasson, Esteban; Fanara, Juan José

2008-01-01

Background Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait. Results We analyzed 179 co-isogenic single P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25°C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17°C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes. Conclusion We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during development. Taken together, our results stress the need to take into account the effect of environmental variation and the dynamics of gene interactions on the genetic architecture of this complex life-history trait. PMID:18687152

A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina.

PubMed

Blixt, Maria K E; Hallböök, Finn

2016-01-01

Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression-specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac "donor" vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor.

Extracellular matrix influence in Streptococcus mutans gene expression in a cariogenic biofilm.

PubMed

Florez Salamanca, E J; Klein, M I

2018-04-01

Caries etiology is biofilm-diet-dependent. Biofilms are highly dynamic and structured microbial communities enmeshed in a three-dimensional extracellular matrix. The study evaluated the expression dynamics of Streptococcus mutans genes associated with exopolysaccharides (EPS) (gtfBCD, gbpB, dexA), lipoteichoic acids (LTA) (dltABCD, SMU_775c) and extracellular DNA (eDNA) (lytST, lrgAB, ccpA) during matrix development within a mixed-species biofilm of S. mutans, Actinomyces naeslundii and Streptococcus gordonii. Mixed-species biofilms using S. mutans strains UA159 or ΔgtfB formed on saliva-coated hydroxyapatite discs were submitted to a nutritional challenge (providing an abundance of sucrose and starch). Biofilms were removed at eight developmental stages for gene expression analysis by quantitative polymerase chain reaction. The pH of spent culture media remained acidic throughout the experimental periods, being lower after sucrose and starch exposure. All genes were expressed at all biofilm developmental phases. EPS- and LTA-associated genes had a similar expression profile for both biofilms, presenting lower levels of expression at 67, 91 and 115 hours and a peak of expression at 55 hours, but having distinct expression magnitudes, with lower values for ΔgtfB (eg, fold-difference of ~382 for gtfC and ~16 for dltB at 43 hours). The eDNA-associated genes presented different dynamics of expression between both strains. In UA159 biofilms lrgA and lrgB genes were highly expressed at 29 hours (which were ~13 and ~5.4 times vs ΔgtfB, respectively), whereas in ΔgtfB biofilms an inverse relationship between lytS and lrgA and lrgB expression was detected. Therefore, the deletion of gtfB influences dynamics and magnitude of expression of genes associated with matrix main components. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes

PubMed Central

2010-01-01

Background Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Results Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. Conclusions This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research. PMID:20416061

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes.

PubMed

Tarver, Matthew R; Zhou, Xuguo; Scharf, Michael E

2010-04-23

Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research.

Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

PubMed

Abete-Luzi, Patricia; Eisenmann, David M

2018-05-01

The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

Identification and resolution of artifacts in the interpretation of imprinted gene expression.

PubMed

Proudhon, Charlotte; Bourc'his, Déborah

2010-12-01

Genomic imprinting refers to genes that are epigenetically programmed in the germline to express exclusively or preferentially one allele in a parent-of-origin manner. Expression-based genome-wide screening for the identification of imprinted genes has failed to uncover a significant number of new imprinted genes, probably because of the high tissue- and developmental-stage specificity of imprinted gene expression. A very large number of technical and biological artifacts can also lead to the erroneous evidence of imprinted gene expression. In this article, we focus on three common sources of potential confounding effects: (i) random monoallelic expression in monoclonal cell populations, (ii) genetically determined monoallelic expression and (iii) contamination or infiltration of embryonic tissues with maternal material. This last situation specifically applies to genes that occur as maternally expressed in the placenta. Beside the use of reciprocal crosses that are instrumental to confirm the parental specificity of expression, we provide additional methods for the detection and elimination of these situations that can be misinterpreted as cases of imprinted expression.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress

PubMed Central

Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian

2017-01-01

Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species. PMID:28429727

Evolution of developmental roles of Pax2/5/8 paralogs after independent duplication in urochordate and vertebrate lineages.

PubMed

Bassham, Susan; Cañestro, Cristian; Postlethwait, John H

2008-08-22

Gene duplication provides opportunities for lineage diversification and evolution of developmental novelties. Duplicated genes generally either disappear by accumulation of mutations (nonfunctionalization), or are preserved either by the origin of positively selected functions in one or both duplicates (neofunctionalization), or by the partitioning of original gene subfunctions between the duplicates (subfunctionalization). The Pax2/5/8 family of important developmental regulators has undergone parallel expansion among chordate groups. After the divergence of urochordate and vertebrate lineages, two rounds of independent gene duplications resulted in the Pax2, Pax5, and Pax8 genes of most vertebrates (the sister group of the urochordates), and an additional duplication provided the pax2a and pax2b duplicates in teleost fish. Separate from the vertebrate genome expansions, a duplication also created two Pax2/5/8 genes in the common ancestor of ascidian and larvacean urochordates. To better understand mechanisms underlying the evolution of duplicated genes, we investigated, in the larvacean urochordate Oikopleura dioica, the embryonic gene expression patterns of Pax2/5/8 paralogs. We compared the larvacean and ascidian expression patterns to infer modular subfunctions present in the single pre-duplication Pax2/5/8 gene of stem urochordates, and we compared vertebrate and urochordate expression to infer the suite of Pax2/5/8 gene subfunctions in the common ancestor of olfactores (vertebrates + urochordates). Expression pattern differences of larvacean and ascidian Pax2/5/8 orthologs in the endostyle, pharynx and hindgut suggest that some ancestral gene functions have been partitioned differently to the duplicates in the two urochordate lineages. Novel expression in the larvacean heart may have resulted from the neofunctionalization of a Pax2/5/8 gene in the urochordates. Expression of larvacean Pax2/5/8 in the endostyle, in sites of epithelial remodeling, and in sensory tissues evokes like functions of Pax2, Pax5 and Pax8 in vertebrate embryos, and may indicate ancient origins for these functions in the chordate common ancestor. Comparative analysis of expression patterns of chordate Pax2/5/8 duplicates, rooted on the single-copy Pax2/5/8 gene of amphioxus, whose lineage diverged basally among chordates, provides new insights into the evolution and development of the heart, thyroid, pharynx, stomodeum and placodes in chordates; supports the controversial conclusion that the atrial siphon of ascidians and the otic placode in vertebrates are homologous; and backs the notion that Pax2/5/8 functioned in ancestral chordates to engineer epithelial fusions and perforations, including gill slit openings.

Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L.

PubMed

Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C

2018-05-01

Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

Transcriptional Analysis of Flowering Time in Switchgrass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Transcriptional Analysis of Flowering Time in Switchgrass

DOE PAGES

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon; ...

2017-04-27

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Gene Expression Changes in Developing Zebrafish as Potential Markers for Rapid Developmental Neurotoxicity Screening

EPA Science Inventory

Sparse information exists on many chemicals to guide developmental neurotoxicity (DNT) risk assessments. As DNT testing using rodents is laborious and expensive, alternative species such as zebrafish are being adapted for toxicity screening. Assessing the DNT potential of chem...

Genome-wide expression profiling of in vivo-derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

PubMed Central

Kabani, Sarah; Fenn, Katelyn; Ross, Alan; Ivens, Al; Smith, Terry K; Ghazal, Peter; Matthews, Keith

2009-01-01

Background Trypanosomes undergo extensive developmental changes during their complex life cycle. Crucial among these is the transition between slender and stumpy bloodstream forms and, thereafter, the differentiation from stumpy to tsetse-midgut procyclic forms. These developmental events are highly regulated, temporally reproducible and accompanied by expression changes mediated almost exclusively at the post-transcriptional level. Results In this study we have examined, by whole-genome microarray analysis, the mRNA abundance of genes in slender and stumpy forms of T.brucei AnTat1.1 cells, and also during their synchronous differentiation to procyclic forms. In total, five biological replicates representing the differentiation of matched parasite populations derived from five individual mouse infections were assayed, with RNAs being derived at key biological time points during the time course of their synchronous differentiation to procyclic forms. Importantly, the biological context of these mRNA profiles was established by assaying the coincident cellular events in each population (surface antigen exchange, morphological restructuring, cell cycle re-entry), thereby linking the observed gene expression changes to the well-established framework of trypanosome differentiation. Conclusion Using stringent statistical analysis and validation of the derived profiles against experimentally-predicted gene expression and phenotypic changes, we have established the profile of regulated gene expression during these important life-cycle transitions. The highly synchronous nature of differentiation between stumpy and procyclic forms also means that these studies of mRNA profiles are directly relevant to the changes in mRNA abundance within individual cells during this well-characterised developmental transition. PMID:19747379

RNA-seq analysis identifies an intricate regulatory network controlling cluster root development in white lupin

PubMed Central

2014-01-01

Background Highly adapted plant species are able to alter their root architecture to improve nutrient uptake and thrive in environments with limited nutrient supply. Cluster roots (CRs) are specialised structures of dense lateral roots formed by several plant species for the effective mining of nutrient rich soil patches through a combination of increased surface area and exudation of carboxylates. White lupin is becoming a model-species allowing for the discovery of gene networks involved in CR development. A greater understanding of the underlying molecular mechanisms driving these developmental processes is important for the generation of smarter plants for a world with diminishing resources to improve food security. Results RNA-seq analyses for three developmental stages of the CR formed under phosphorus-limited conditions and two of non-cluster roots have been performed for white lupin. In total 133,045,174 high-quality paired-end reads were used for a de novo assembly of the root transcriptome and merged with LAGI01 (Lupinus albus gene index) to generate an improved LAGI02 with 65,097 functionally annotated contigs. This was followed by comparative gene expression analysis. We show marked differences in the transcriptional response across the various cluster root stages to adjust to phosphate limitation by increasing uptake capacity and adjusting metabolic pathways. Several transcription factors such as PLT, SCR, PHB, PHV or AUX/IAA with a known role in the control of meristem activity and developmental processes show an increased expression in the tip of the CR. Genes involved in hormonal responses (PIN, LAX, YUC) and cell cycle control (CYCA/B, CDK) are also differentially expressed. In addition, we identify primary transcripts of miRNAs with established function in the root meristem. Conclusions Our gene expression analysis shows an intricate network of transcription factors and plant hormones controlling CR initiation and formation. In addition, functional differences between the different CR developmental stages in the acclimation to phosphorus starvation have been identified. PMID:24666749

Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

NASA Astrophysics Data System (ADS)

Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

1987-05-01

Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

A link among DNA replication, recombination, and gene expression revealed by genetic and genomic analysis of TEBICHI gene of Arabidopsis thaliana.

PubMed

Inagaki, Soichi; Nakamura, Kenzo; Morikami, Atsushi

2009-08-01

Spatio-temporal regulation of gene expression during development depends on many factors. Mutations in Arabidopsis thaliana TEBICHI (TEB) gene encoding putative helicase and DNA polymerase domains-containing protein result in defects in meristem maintenance and correct organ formation, as well as constitutive DNA damage response and a defect in cell cycle progression; but the molecular link between these phenotypes of teb mutants is unknown. Here, we show that mutations in the DNA replication checkpoint pathway gene, ATR, but not in ATM gene, enhance developmental phenotypes of teb mutants, although atr suppresses cell cycle defect of teb mutants. Developmental phenotypes of teb mutants are also enhanced by mutations in RAD51D and XRCC2 gene, which are involved in homologous recombination. teb and teb atr double mutants exhibit defects in adaxial-abaxial polarity of leaves, which is caused in part by the upregulation of ETTIN (ETT)/AUXIN RESPONSIVE FACTOR 3 (ARF3) and ARF4 genes. The Helitron transposon in the upstream of ETT/ARF3 gene is likely to be involved in the upregulation of ETT/ARF3 in teb. Microarray analysis indicated that teb and teb atr causes preferential upregulation of genes nearby the Helitron transposons. Furthermore, interestingly, duplicated genes, especially tandemly arrayed homologous genes, are highly upregulated in teb or teb atr. We conclude that TEB is required for normal progression of DNA replication and for correct expression of genes during development. Interplay between these two functions and possible mechanism leading to altered expression of specific genes will be discussed.

Divergent evolution of arrested development in the dauer stage of Caenorhabditis elegans and the infective stage of Heterodera glycines

PubMed Central

Elling, Axel A; Mitreva, Makedonka; Recknor, Justin; Gai, Xiaowu; Martin, John; Maier, Thomas R; McDermott, Jeffrey P; Hewezi, Tarek; McK Bird, David; Davis, Eric L; Hussey, Richard S; Nettleton, Dan; McCarter, James P; Baum, Thomas J

2007-01-01

Background The soybean cyst nematode Heterodera glycines is the most important parasite in soybean production worldwide. A comprehensive analysis of large-scale gene expression changes throughout the development of plant-parasitic nematodes has been lacking to date. Results We report an extensive genomic analysis of H. glycines, beginning with the generation of 20,100 expressed sequence tags (ESTs). In-depth analysis of these ESTs plus approximately 1,900 previously published sequences predicted 6,860 unique H. glycines genes and allowed a classification by function using InterProScan. Expression profiling of all 6,860 genes throughout the H. glycines life cycle was undertaken using the Affymetrix Soybean Genome Array GeneChip. Our data sets and results represent a comprehensive resource for molecular studies of H. glycines. Demonstrating the power of this resource, we were able to address whether arrested development in the Caenorhabditis elegans dauer larva and the H. glycines infective second-stage juvenile (J2) exhibits shared gene expression profiles. We determined that the gene expression profiles associated with the C. elegans dauer pathway are not uniformly conserved in H. glycines and that the expression profiles of genes for metabolic enzymes of C. elegans dauer larvae and H. glycines infective J2 are dissimilar. Conclusion Our results indicate that hallmark gene expression patterns and metabolism features are not shared in the developmentally arrested life stages of C. elegans and H. glycines, suggesting that developmental arrest in these two nematode species has undergone more divergent evolution than previously thought and pointing to the need for detailed genomic analyses of individual parasite species. PMID:17919324

Resveratrol-cyclodextrin complex affects the expression of genes associated with lipid metabolism in bovine in vitro produced embryos.

PubMed

Torres, V; Hamdi, M; Millán de la Blanca, M G; Urrego, R; Echeverri, J; López-Herrera, A; Rizos, D; Gutiérrez-Adán, A; Sánchez-Calabuig, M J

2018-03-26

Antioxidants have been widely used during in vitro production to decrease the negative effect of reactive oxygen species. It was reported that the complex resveratrol-methyl β-cyclodextrin (RV-CD) improves resveratrol's stability and bioavailability and increases its antioxidant activity. This study evaluates the effect of RV-CD during in vitro oocyte maturation (IVM) or in vitro embryo culture (IVC) on developmental competence and quantitative changes in gene expression of developmental important genes. In experiment 1, RV-CD was added to IVM media and maturation level, embryo development and oocytes, cumulus cells, and blastocysts gene expression by RT-qPCR were examined. In experiment 2, presumptive zygotes were cultured in SOF supplemented with RV-CD and embryo development and blastocysts gene expression by RT-qPCR were studied. A group without RV-CD (control - ) and a group with cyclodextrin (control + ) were included. No differences were found in cleavage rate or blastocyst yield between groups. However, the expression of LIPE was higher in blastocysts derived from oocytes treated with resveratrol compared with control groups (p < .05). Blastocysts produced by IVC with resveratrol showed that RV-CD could modify the expression of genes related to lipid metabolism (CYP51A1, PNPLA2 and MTORC1) compared with control groups (p < .05). RV-CD in the IVM and IVC media could reduce accumulated fat by increasing lipolysis and suppressing lipogenesis of blastocysts. © 2018 Blackwell Verlag GmbH.

The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility.

PubMed

Du, Hongling; Taylor, Hugh S

2015-11-09

HOX genes convey positional identity that leads to the proper partitioning and adult identity of the female reproductive track. Abnormalities in reproductive tract development can be caused by HOX gene mutations or altered HOX gene expression. Diethylstilbestrol (DES) and other endocrine disruptors cause Müllerian defects by changing HOX gene expression. HOX genes are also essential regulators of adult endometrial development. Regulated HOXA10 and HOXA11 expression is necessary for endometrial receptivity; decreased HOXA10 or HOXA11 expression leads to decreased implantation rates. Alternation of HOXA10 and HOXA11 expression has been identified as a mechanism of the decreased implantation associated with endometriosis, polycystic ovarian syndrome, leiomyoma, polyps, adenomyosis, and hydrosalpinx. Alteration of HOX gene expression causes both uterine developmental abnormalities and impaired adult endometrial development that prevent implantation and lead to female infertility. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain

PubMed Central

Okamura-Oho, Yuko; Shimokawa, Kazuro; Nishimura, Masaomi; Takemoto, Satoko; Sato, Akira; Furuichi, Teiichi; Yokota, Hideo

2014-01-01

Using a recently invented technique for gene expression mapping in the whole-anatomy context, termed transcriptome tomography, we have generated a dataset of 36,000 maps of overall gene expression in the adult-mouse brain. Here, using an informatics approach, we identified a broad co-expression network that follows an inverse power law and is rich in functional interaction and gene-ontology terms. Our framework for the integrated analysis of expression maps and graphs of co-expression networks revealed that groups of combinatorially expressed genes, which regulate cell differentiation during development, were present in the adult brain and each of these groups was associated with a discrete cell types. These groups included non-coding genes of unknown function. We found that these genes specifically linked developmentally conserved groups in the network. A previously unrecognized robust expression pattern covering the whole brain was related to the molecular anatomy of key biological processes occurring in particular areas. PMID:25382412

Characterizing the Grape Transcriptome. Analysis of Expressed Sequence Tags from Multiple Vitis Species and Development of a Compendium of Gene Expression during Berry Development1[w

PubMed Central

Silva, Francisco Goes da; Iandolino, Alberto; Al-Kayal, Fadi; Bohlmann, Marlene C.; Cushman, Mary Ann; Lim, Hyunju; Ergul, Ali; Figueroa, Rubi; Kabuloglu, Elif K.; Osborne, Craig; Rowe, Joan; Tattersall, Elizabeth; Leslie, Anna; Xu, Jane; Baek, JongMin; Cramer, Grant R.; Cushman, John C.; Cook, Douglas R.

2005-01-01

We report the analysis and annotation of 146,075 expressed sequence tags from Vitis species. The majority of these sequences were derived from different cultivars of Vitis vinifera, comprising an estimated 25,746 unique contig and singleton sequences that survey transcription in various tissues and developmental stages and during biotic and abiotic stress. Putatively homologous proteins were identified for over 17,752 of the transcripts, with 1,962 transcripts further subdivided into one or more Gene Ontology categories. A simple structured vocabulary, with modules for plant genotype, plant development, and stress, was developed to describe the relationship between individual expressed sequence tags and cDNA libraries; the resulting vocabulary provides query terms to facilitate data mining within the context of a relational database. As a measure of the extent to which characterized metabolic pathways were encompassed by the data set, we searched for homologs of the enzymes leading from glycolysis, through the oxidative/nonoxidative pentose phosphate pathway, and into the general phenylpropanoid pathway. Homologs were identified for 65 of these 77 enzymes, with 86% of enzymatic steps represented by paralogous genes. Differentially expressed transcripts were identified by means of a stringent believability index cutoff of ≥98.4%. Correlation analysis and two-dimensional hierarchical clustering grouped these transcripts according to similarity of expression. In the broadest analysis, 665 differentially expressed transcripts were identified across 29 cDNA libraries, representing a range of developmental and stress conditions. The groupings revealed expected associations between plant developmental stages and tissue types, with the notable exception of abiotic stress treatments. A more focused analysis of flower and berry development identified 87 differentially expressed transcripts and provides the basis for a compendium that relates gene expression and annotation to previously characterized aspects of berry development and physiology. Comparison with published results for select genes, as well as correlation analysis between independent data sets, suggests that the inferred in silico patterns of expression are likely to be an accurate representation of transcript abundance for the conditions surveyed. Thus, the combined data set reveals the in silico expression patterns for hundreds of genes in V. vinifera, the majority of which have not been previously studied within this species. PMID:16219919

A cross-species bi-clustering approach to identifying conserved co-regulated genes.

PubMed

Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

2016-06-15

A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

PubMed

Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

2016-01-01

Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators were known to be involved in muscle and adipose tissues development, but others not previously associated with pig muscle growth were also identified, as PVALB, KLF1 or IRF2. The present study discloses potential molecular mechanisms underlying phenotypic differences observed between IB and IBxDU pigs and highlights candidate genes implicated in these molecular mechanisms.

Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

PubMed Central

Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

2017-01-01

Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

Seq-ing answers: uncovering the unexpected in global gene regulation.

PubMed

Otto, George Maxwell; Brar, Gloria Ann

2018-04-19

The development of techniques for measuring gene expression globally has greatly expanded our understanding of gene regulatory mechanisms in depth and scale. We can now quantify every intermediate and transition in the canonical pathway of gene expression-from DNA to mRNA to protein-genome-wide. Employing such measurements in parallel can produce rich datasets, but extracting the most information requires careful experimental design and analysis. Here, we argue for the value of genome-wide studies that measure multiple outputs of gene expression over many timepoints during the course of a natural developmental process. We discuss our findings from a highly parallel gene expression dataset of meiotic differentiation, and those of others, to illustrate how leveraging these features can provide new and surprising insight into fundamental mechanisms of gene regulation.

Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects.

EPA Science Inventory

The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive developm...

Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

PubMed

Rosario, Christopher J; Tan, Ming

2016-01-15

Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Comparative transcriptomics among floral organs of the basal eudicot Eschscholzia californica as reference for floral evolutionary developmental studies

PubMed Central

2010-01-01

Background Molecular genetic studies of floral development have concentrated on several core eudicots and grasses (monocots), which have canalized floral forms. Basal eudicots possess a wider range of floral morphologies than the core eudicots and grasses and can serve as an evolutionary link between core eudicots and monocots, and provide a reference for studies of other basal angiosperms. Recent advances in genomics have enabled researchers to profile gene activities during floral development, primarily in the eudicot Arabidopsis thaliana and the monocots rice and maize. However, our understanding of floral developmental processes among the basal eudicots remains limited. Results Using a recently generated expressed sequence tag (EST) set, we have designed an oligonucleotide microarray for the basal eudicot Eschscholzia californica (California poppy). We performed microarray experiments with an interwoven-loop design in order to characterize the E. californica floral transcriptome and to identify differentially expressed genes in flower buds with pre-meiotic and meiotic cells, four floral organs at pre-anthesis stages (sepals, petals, stamens and carpels), developing fruits, and leaves. Conclusions Our results provide a foundation for comparative gene expression studies between eudicots and basal angiosperms. We identified whorl-specific gene expression patterns in E. californica and examined the floral expression of several gene families. Interestingly, most E. californica homologs of Arabidopsis genes important for flower development, except for genes encoding MADS-box transcription factors, show different expression patterns between the two species. Our comparative transcriptomics study highlights the unique evolutionary position of E. californica compared with basal angiosperms and core eudicots. PMID:20950453

Identification and expression profiles of fifteen delta-class glutathione S-transferase genes from a stored-product pest, Liposcelis entomophila (Enderlein) (Psocoptera: Liposcelididae).

PubMed

Jing, Tian-Xing; Wu, Yu-Xian; Li, Ting; Wei, Dan-Dan; Smagghe, Guy; Wang, Jin-Jun

2017-04-01

Glutathione S-transferases (GSTs) comprise a diverse family of enzymes found ubiquitously in aerobic organisms and they play important roles in insecticide resistance. In this study, we tested the sensitivities of Liposcelis entomophila, collected from four different field populations, to three insecticides. The results showed that the insects from Tongliang population had a relatively higher tolerance to malathion and propuxor than insects from other field populations. The insecticide sensitivities of different populations detected in psocids may be due to the different control practices. Through sequence mining and phylogenetic analyses, we identified 15 delta class GST genes that contained the conserved motifs of the GSTs. Quantitative real-time PCR (Q-PCR) analysis indicated that the 15 GST genes were expressed at all tested developmental stages, and 12 GST genes had significantly higher expression levels in adulthood than in egg stage. The expression levels of 15 GST genes in different field populations showed that 9 GST genes were significantly higher in Tongliang population compared to other populations. Furthermore, Q-PCR confirmed that the expression of several delta class GSTs was upregulated at different times after malathion, propuxor and deltamethrine exposure with the LC 50 concentration of insecticide. Taken together, these findings showed that delta class GST genes have various expression levels in different developmental stages and different field populations, and they were up-regulated in response to insecticide exposure, which suggested that these GSTs may be associated with insecticide metabolism in psocids. Copyright © 2017 Elsevier Inc. All rights reserved.

Three Drought-Responsive Members of the Nonspecific Lipid-Transfer Protein Gene Family in Lycopersicon pennellii Show Different Developmental Patterns of Expression1

PubMed Central

Treviño, Marcela B.; Connell, Mary A. O'

1998-01-01

Genomic clones of two nonspecific lipid-transfer protein genes from a drought-tolerant wild species of tomato (Lycopersicon pennellii Corr.) were isolated using as a probe a drought- and abscisic acid (ABA)-induced cDNA clone (pLE16) from cultivated tomato (Lycopersicon esculentum Mill.). Both genes (LpLtp1 and LpLtp2) were sequenced and their corresponding mRNAs were characterized; they are both interrupted by a single intron at identical positions and predict basic proteins of 114 amino acid residues. Genomic Southern data indicated that these genes are members of a small gene family in Lycopersicon spp. The 3′-untranslated regions from LpLtp1 and LpLtp2, as well as a polymerase chain reaction-amplified 3′-untranslated region from pLE16 (cross-hybridizing to a third gene in L. pennellii, namely LpLtp3), were used as gene-specific probes to describe expression in L. pennellii through northern-blot analyses. All LpLtp genes were exclusively expressed in the aerial tissues of the plant and all were drought and ABA inducible. Each gene had a different pattern of expression in fruit, and LpLtp1 and LpLtp2, unlike LpLtp3, were both primarily developmentally regulated in leaf tissue. Putative ABA-responsive elements were found in the proximal promoter regions of LpLtp1 and LpLtp2. PMID:9536064

Phenotypic Checkpoints Regulate Neuronal Development

PubMed Central

Ben-Ari, Yehezkel; Spitzer, Nicholas C.

2010-01-01

Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191

Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

PubMed Central

van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

1999-01-01

The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling.

PubMed

Prpic, Nikola-Michael; Janssen, Ralf; Wigand, Barbara; Klingler, Martin; Damen, Wim G M

2003-12-01

Leg development in Drosophila has been studied in much detail. However, Drosophila limbs form in the larva as imaginal discs and not during embryogenesis as in most other arthropods. Here, we analyze appendage genes in the spider Cupiennius salei and the beetle Tribolium castaneum. Differences in decapentaplegic (dpp) expression suggest a different mode of distal morphogen signaling suitable for the specific geometry of growing limb buds. Also, expression of the proximal genes homothorax (hth) and extradenticle (exd) is significantly altered: in the spider, exd is restricted to the proximal leg and hth expression extends distally, while in insects, exd is expressed in the entire leg and hth is restricted to proximal parts. This reversal of spatial specificity demonstrates an evolutionary shift, which is nevertheless compatible with a conserved role of this gene pair as instructor of proximal fate. Different expression dynamics of dachshund and Distal-less point to modifications in the regulation of the leg gap gene system. We comment on the significance of this finding for attempts to homologize leg segments in different arthropod classes. Comparison of the expression profiles of H15 and optomotor-blind to the Drosophila patterns suggests modifications also in the dorsal-ventral patterning system of the legs. Together, our results suggest alterations in many components of the leg developmental system, namely proximal-distal and dorsal-ventral patterning, and leg segmentation. Thus, the leg developmental system exhibits a propensity to evolutionary change, which probably forms the basis for the impressive diversity of arthropod leg morphologies.

Predicting neuroblastoma using developmental signals and a logic-based model.

PubMed

Kasemeier-Kulesa, Jennifer C; Schnell, Santiago; Woolley, Thomas; Spengler, Jennifer A; Morrison, Jason A; McKinney, Mary C; Pushel, Irina; Wolfe, Lauren A; Kulesa, Paul M

2018-07-01

Genomic information from human patient samples of pediatric neuroblastoma cancers and known outcomes have led to specific gene lists put forward as high risk for disease progression. However, the reliance on gene expression correlations rather than mechanistic insight has shown limited potential and suggests a critical need for molecular network models that better predict neuroblastoma progression. In this study, we construct and simulate a molecular network of developmental genes and downstream signals in a 6-gene input logic model that predicts a favorable/unfavorable outcome based on the outcome of the four cell states including cell differentiation, proliferation, apoptosis, and angiogenesis. We simulate the mis-expression of the tyrosine receptor kinases, trkA and trkB, two prognostic indicators of neuroblastoma, and find differences in the number and probability distribution of steady state outcomes. We validate the mechanistic model assumptions using RNAseq of the SHSY5Y human neuroblastoma cell line to define the input states and confirm the predicted outcome with antibody staining. Lastly, we apply input gene signatures from 77 published human patient samples and show that our model makes more accurate disease outcome predictions for early stage disease than any current neuroblastoma gene list. These findings highlight the predictive strength of a logic-based model based on developmental genes and offer a better understanding of the molecular network interactions during neuroblastoma disease progression. Copyright © 2018. Published by Elsevier B.V.

DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

PubMed Central

Hua, Brian L.; Orr-Weaver, Terry L.

2017-01-01

Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

Comparative genome and transcriptome analyses of the social amoeba Acytostelium subglobosum that accomplishes multicellular development without germ-soma differentiation.

PubMed

Urushihara, Hideko; Kuwayama, Hidekazu; Fukuhara, Kensuke; Itoh, Takehiko; Kagoshima, Hiroshi; Shin-I, Tadasu; Toyoda, Atsushi; Ohishi, Kazuyo; Taniguchi, Tateaki; Noguchi, Hideki; Kuroki, Yoko; Hata, Takashi; Uchi, Kyoko; Mohri, Kurato; King, Jason S; Insall, Robert H; Kohara, Yuji; Fujiyama, Asao

2015-02-14

Social amoebae are lower eukaryotes that inhabit the soil. They are characterized by the construction of a starvation-induced multicellular fruiting body with a spore ball and supportive stalk. In most species, the stalk is filled with motile stalk cells, as represented by the model organism Dictyostelium discoideum, whose developmental mechanisms have been well characterized. However, in the genus Acytostelium, the stalk is acellular and all aggregated cells become spores. Phylogenetic analyses have shown that it is not an ancestral genus but has lost the ability to undergo cell differentiation. We performed genome and transcriptome analyses of Acytostelium subglobosum and compared our findings to other available dictyostelid genome data. Although A. subglobosum adopts a qualitatively different developmental program from other dictyostelids, its gene repertoire was largely conserved. Yet, families of polyketide synthase and extracellular matrix proteins have not expanded and a serine protease and ABC transporter B family gene, tagA, and a few other developmental genes are missing in the A. subglobosum lineage. Temporal gene expression patterns are astonishingly dissimilar from those of D. discoideum, and only a limited fraction of the ortholog pairs shared the same expression patterns, so that some signaling cascades for development seem to be disabled in A. subglobosum. The absence of the ability to undergo cell differentiation in Acytostelium is accompanied by a small change in coding potential and extensive alterations in gene expression patterns.

Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming

PubMed Central

Bromer, Jason G.; Wu, Jie; Zhou, Yuping; Taylor, Hugh S.

2009-01-01

Diethylstilbestrol (DES) is a nonsteroidal estrogen that induces developmental anomalies of the female reproductive tract. The homeobox gene HOXA10 controls uterine organogenesis, and its expression is altered after in utero DES exposure. We hypothesized that an epigenetic mechanism underlies DES-mediated alterations in HOXA10 expression. We analyzed the expression pattern and methylation profile of HOXA10 after DES exposure. Expression of HOXA10 is increased in human endometrial cells after DES exposure, whereas Hoxa10 expression is repressed and shifted caudally from its normal location in mice exposed in utero. Cytosine guanine dinucleotide methylation frequency in the Hoxa10 intron was higher in DES-exposed offspring compared with controls (P = 0.017). The methylation level of Hoxa10 was also higher in the caudal portion of the uterus after DES exposure at the promoter and intron (P < 0.01). These changes were accompanied by increased expression of DNA methyltransferases 1 and 3b. No changes in methylation were observed after in vitro or adult DES exposure. DES has a dual mechanism of action as an endocrine disruptor; DES functions as a classical estrogen and directly stimulates HOXA10 expression with short-term exposure, however, in utero exposure results in hypermethylation of the HOXA10 gene and long-term altered HOXA10 expression. We identify hypermethylation as a novel mechanism of DES-induced altered developmental programming. PMID:19299448

Selection of housekeeping genes as internal controls for quantitative RT-PCR analysis of the veined rapa whelk (Rapana venosa)

PubMed Central

Song, Hao; Dang, Xin; He, Yuan-qiu

2017-01-01

Background The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa. For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. Methods In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1α (EF-1α), α-actin (ACT), cytochrome c oxidase subunit 1 (COX1), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1α subcomplex subunit 7 (NDUFA7), 60S ribosomal protein L5 (RL5), 60S ribosomal protein L28 (RL28), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-tubulin (TUBB), 40S ribosomal protein S25 (RS25), 40S ribosomal protein S8 (RS8), ubiquitin-conjugating enzyme E2 (UBE2), histone H3 (HH3), and peptidyl-prolyl cis-trans isomerase A (PPIA). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Results Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α, RL5, and NDUFA7 for liver, GAPDH, PPIA, and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene in all developmental stages measured, and COX1 and RL5 were appropriate secondary choices. For the specific developmental stage, we recommended the following combination for normalization, PPIA, RS25, and RL28 for stage 1, RL5 and RL28 for stage 2 and 5, RL28 and NDUFA7 for stage 3, and PPIA and TUBB for stage 4. Discussion Our results are instrumental for the selection of appropriately validated housekeeping genes for use as internal controls for gene expression studies in adult tissues or larval development of R. venosa in the future. PMID:28584723

Comparison of a teratogenic transcriptome-based predictive test based on human embryonic versus inducible pluripotent stem cells.

PubMed

Shinde, Vaibhav; Perumal Srinivasan, Sureshkumar; Henry, Margit; Rotshteyn, Tamara; Hescheler, Jürgen; Rahnenführer, Jörg; Grinberg, Marianna; Meisig, Johannes; Blüthgen, Nils; Waldmann, Tanja; Leist, Marcel; Hengstler, Jan Georg; Sachinidis, Agapios

2016-12-30

Human embryonic stem cells (hESCs) partially recapitulate early embryonic three germ layer development, allowing testing of potential teratogenic hazards. Because use of hESCs is ethically debated, we investigated the potential for human induced pluripotent stem cells (hiPSCs) to replace hESCs in such tests. Three cell lines, comprising hiPSCs (foreskin and IMR90) and hESCs (H9) were differentiated for 14 days. Their transcriptome profiles were obtained on day 0 and day 14 and analyzed by comprehensive bioinformatics tools. The transcriptomes on day 14 showed that more than 70% of the "developmental genes" (regulated genes with > 2-fold change on day 14 compared to day 0) exhibited variability among cell lines. The developmental genes belonging to all three cell lines captured biological processes and KEGG pathways related to all three germ layer embryonic development. In addition, transcriptome profiles were obtained after 14 days of exposure to teratogenic valproic acid (VPA) during differentiation. Although the differentially regulated genes between treated and untreated samples showed more than 90% variability among cell lines, VPA clearly antagonized the expression of developmental genes in all cell lines: suppressing upregulated developmental genes, while inducing downregulated ones. To quantify VPA-disturbed development based on developmental genes, we estimated the "developmental potency" (D p ) and "developmental index" (D i ). Despite differences in genes deregulated by VPA, uniform D i values were obtained for all three cell lines. Given that the D i values for VPA were similar for hESCs and hiPSCs, D i can be used for robust hazard identification, irrespective of whether hESCs or hiPSCs are used in the test systems.

Regulation of the epithelial adhesion molecule CEACAM1 is important for palate formation.

PubMed

Mima, Junko; Koshino, Aya; Oka, Kyoko; Uchida, Hitoshi; Hieda, Yohki; Nohara, Kanji; Kogo, Mikihiko; Chai, Yang; Sakai, Takayoshi

2013-01-01

Cleft palate results from a mixture of genetic and environmental factors and occurs when the bilateral palatal shelves fail to fuse. The objective of this study was to search for new genes involved in mouse palate formation. Gene expression of murine embryonic palatal tissue was analyzed at various developmental stages before, during, and after palate fusion using GeneChip® microarrays. Ceacam1 was one of the highly up-regulated genes during palate formation, and this was confirmed by quantitative real-time PCR. Immunohistochemical staining showed that CEACAM1 was present in prefusion palatal epithelium and was degraded during fusion. To investigate the developmental role of CEACAM1, function-blocking antibody was added to embryonic mouse palate in organ culture. Palatal fusion was inhibited by this function-blocking antibody. To investigate the subsequent developmental role of CEACAM1, we characterized Ceacam1-deficient (Ceacam1(-/-)) mice. Epithelial cells persisted abnormally at the midline of the embryonic palate even on day E16.0, and palatal fusion was delayed in Ceacam1(-/-) mice. TGFβ3 expression, apoptosis, and cell proliferation in palatal epithelium were not affected in the palate of Ceacam1(-/-)mice. However, CEACAM1 expression was retained in the remaining MEE of TGFβ-deficient mice. These results suggest that CEACAM1 has roles in the initiation of palatal fusion via epithelial cell adhesion.

Evolution of developmental regulation in the vertebrate FgfD subfamily.

PubMed

Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

2010-01-15

Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

Developmental Activation of the Proteolipid Protein Promoter Transgene in Neuronal and Oligodendroglial Cells of Neostriatum in Mice

PubMed Central

Fulton, Daniel; Paez, Pablo; Spreur, Vilma; Handley, Vance; Colwell, Christopher S.; Campagnoni, Anthony; Fisher, Robin

2011-01-01

Prior studies suggest that non-canonical proteolipid protein (PLP) gene expression occurs during development in non-myelinating neurons as well as myelinating oligodendroglia in mammalian brain. To assess this possibility in neostriatum, a region of uncertain PLP gene expression in neurons, morphological and electrophysiological tools were used to determine phenotypes of cells with activation of a PLP promoter transgene during the early postnatal period in mice. PLP gene expression is evident in both neuronal and oligodendroglial phenotypes in developing neostriatum, a conclusion based on three novel observations: (1) An enhanced green fluorescent protein (EGFP) reporter of PLP promoter activation was localized in two distinct populations of cells, which exhibit collective, developmental differences of morphological and electrophysiological characteristics in accord with neuronal and oligodendroglial phenotypes of neostriatal cells found during the early postnatal period in both transgenic and wild-type mice. (2) The EGFP reporter of PLP promoter activation was appropriately positioned to serve as a regulator of PLP gene expression. It colocalized with native PLP proteins in both neuronal and oligodendroglial phenotypes; however, only soma-restricted PLP protein isoforms were found in the neuronal phenotype, while classic and soma-restricted PLP protein isoforms were found in the oligodendroglial phenotype. (3) As shown by EGFP reporter, PLP promoter activation was placed to regulate PLP gene expression in only one neuronal phenotype among the several that constitute neostriatum. It was localized in medium spiny neurons, but not large aspiny neurons. These outcomes have significant implications for the non-canonical functional roles of PLP gene expression in addition to myelinogenesis in mammalian brain, and are consistent with potentially independent pathologic loci in neurons during the course of human mutational disorders of PLP gene expression. PMID:21912090

Developmental changes in skin collagen biosynthesis pathway in posthatch male and female chickens

NASA Technical Reports Server (NTRS)

Pines, M.; Schickler, M.; Hurwitz, S.; Yamauchi, M.

1996-01-01

The developmental changes in skin collagen biosynthesis pathway in male and female chickens were evaluated. Concentration of collagen, levels of mRNA for collagen type I subunits and for lysyl hydroxylase, and the level of three lysyl oxidase-derived cross-links: dehydro-dihydroxylysinonorleucine (DHLNL), dehydro-hydroxylysinonorleucine (HLNL), and dehydro-histidinohydroxymerodesmosine (HHMD) were determined during 4 wk posthatching. Skin collagen content increased with age and was higher in males than in females. In both sexes, the expression of the genes coding for alpha 1 and alpha 2 of collagen type I decreased with age: alpha 1(I) gene expression decreased from Day 3 onwards, whereas the reduction in alpha 2(I) gene expression started 1 wk later. At all ages examined, the expression of both genes was higher in male than in female skin. Males and females lysyl hydroxylase gene expression remained low until Day 16, after which an increase in the enzyme gene expression was observed. An increase in skin HLNL content was observed from Day 3 in both sexes reaching a peak in males at Day 9 and in females 1 wk later. The DHLNL content, which was higher in males than in females at all ages tested, dramatically decreased in both male and female skin from 3 d of age, reaching its lowest level at Day 16, and remained at that low level thereafter. The skin content of HHMD in males and females followed an oscillatory behavior with higher peaks in the male skin. The results suggest that the higher tensile strength of male skin than female skin may be due to the elevated skin collagen content that resulted from increased expression in collagen type I genes on the one hand, and from the higher amounts of various collagen cross-links on the other.

Differential expression of members of the annexin multigene family in Arabidopsis

NASA Technical Reports Server (NTRS)

Clark, G. B.; Sessions, A.; Eastburn, D. J.; Roux, S. J.

2001-01-01

Although in most plant species no more than two annexin genes have been reported to date, seven annexin homologs have been identified in Arabidopsis, Annexin Arabidopsis 1-7 (AnnAt1--AnnAt7). This establishes that annexins can be a diverse, multigene protein family in a single plant species. Here we compare and analyze these seven annexin gene sequences and present the in situ RNA localization patterns of two of these genes, AnnAt1 and AnnAt2, during different stages of Arabidopsis development. Sequence analysis of AnnAt1--AnnAt7 reveals that they contain the characteristic four structural repeats including the more highly conserved 17-amino acid endonexin fold region found in vertebrate annexins. Alignment comparisons show that there are differences within the repeat regions that may have functional importance. To assess the relative level of expression in various tissues, reverse transcription-PCR was carried out using gene-specific primers for each of the Arabidopsis annexin genes. In addition, northern blot analysis using gene-specific probes indicates differences in AnnAt1 and AnnAt2 expression levels in different tissues. AnnAt1 is expressed in all tissues examined and is most abundant in stems, whereas AnnAt2 is expressed mainly in root tissue and to a lesser extent in stems and flowers. In situ RNA localization demonstrates that these two annexin genes display developmentally regulated tissue-specific and cell-specific expression patterns. These patterns are both distinct and overlapping. The developmental expression patterns for both annexins provide further support for the hypothesis that annexins are involved in the Golgi-mediated secretion of polysaccharides.

Alteration of development and gene expression induced by in ovo-nanoinjection of 3-hydroxybenzo[c]phenanthrene into Japanese medaka (Oryzias latipes) embryos.

PubMed

Chen, Kun; Tsutsumi, Yuki; Yoshitake, Shuhei; Qiu, Xuchun; Xu, Hai; Hashiguchi, Yasuyuki; Honda, Masato; Tashiro, Kosuke; Nakayama, Kei; Hano, Takeshi; Suzuki, Nobuo; Hayakawa, Kazuichi; Shimasaki, Yohei; Oshima, Yuji

2017-01-01

Benzo[c]phenanthrene (BcP) is a highly toxic polycyclic aromatic hydrocarbon (PAHs) found throughout the environment. In fish, it is metabolized to 3-hydroxybenzo[c]phenanthrene (3-OHBcP). In the present study, we observed the effects of 1nM 3-OHBcP on the development and gene expression of Japanese medaka (Oryzias latipes) embryos. Embryos were nanoinjected with the chemical after fertilization. Survival, developmental stage, and heart rate of the embryos were observed, and gene expression differences were quantified by messenger RNA sequencing (mRNA-Seq). The exposure to 1nM 3-OHBcP accelerated the development of medaka embryos on the 1st, 4th, and 6th days post fertilization (dpf), and increased heart rates significantly on the 5th dpf. Physical development differences of exposed medaka embryos were consistent with the gene expression profiles of the mRNA-Seq results for the 3rd dpf, which show that the expression of 780 genes differed significantly between the solvent control and 1nM 3-OHBcP exposure groups. The obvious expression changes in the exposure group were found for genes involved in organ formation (eye, muscle, heart), energy supply (ATPase and ATP synthase), and stress-response (heat shock protein genes). The acceleration of development and increased heart rate, which were consistent with the changes in mRNA expression, suggested that 3-OHBcP affects the development of medaka embryos. The observation on the developmental stages and heart beat, in ovo-nanoinjection and mRNA-Seq may be efficient tools to evaluate the effects of chemicals on embryos. Copyright © 2016 Elsevier B.V. All rights reserved.

Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

PubMed Central

Preston, Jill C.; Kellogg, Elizabeth A.

2006-01-01

Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

Accelerated Evolution of Developmentally Biased Genes in the Tetraphenic Ant Cardiocondyla obscurior.

PubMed

Schrader, Lukas; Helanterä, Heikki; Oettler, Jan

2017-03-01

Plastic gene expression underlies phenotypic plasticity and plastically expressed genes evolve under different selection regimes compared with ubiquitously expressed genes. Social insects are well-suited models to elucidate the evolutionary dynamics of plastic genes for their genetically and environmentally induced discrete polymorphisms. Here, we study the evolution of plastically expressed genes in the ant Cardiocondyla obscurior-a species that produces two discrete male morphs in addition to the typical female polymorphism of workers and queens. Based on individual-level gene expression data from 28 early third instar larvae, we test whether the same evolutionary dynamics that pertain to plastically expressed genes in adults also pertain to genes with plastic expression during development. In order to quantify plasticity of gene expression over multiple contrasts, we develop a novel geometric measure. For genes expressed during development, we show that plasticity of expression is positively correlated with evolutionary rates. We furthermore find a strong correlation between expression plasticity and expression variation within morphs, suggesting a close link between active and passive plasticity of gene expression. Our results support the notion of relaxed selection and neutral processes as important drivers in the evolution of adaptive plasticity. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Evolutionary developmental genetics of fruit morphological variation within the Solanaceae

PubMed Central

Wang, Li; Li, Jing; Zhao, Jing; He, Chaoying

2015-01-01

Morphological variations of fruits such as shape and size, and color are a result of adaptive evolution. The evolution of morphological novelties is particularly intriguing. An understanding of these evolutionary processes calls for the elucidation of the developmental and genetic mechanisms that result in particular fruit morphological characteristics, which determine seed dispersal. The genetic and developmental basis for fruit morphological variation was established at a microevolutionary time scale. Here, we summarize the progress on the evolutionary developmental genetics of fruit size, shape and color in the Solanaceae. Studies suggest that the recruitment of a pre-existing gene and subsequent modification of its interaction and regulatory networks are frequently involved in the evolution of morphological diversity. The basic mechanisms underlying changes in plant morphology are alterations in gene expression and/or gene function. We also deliberate on the future direction in evolutionary developmental genetics of fruit morphological variation such as fruit type. These studies will provide insights into plant developmental processes and will help to improve the productivity and fruit quality of crops. PMID:25918515

Massive shift in gene expression during transitions between developmental stages of the Gall Midge, Mayetiola destructor

USDA-ARS?s Scientific Manuscript database

The gall midge Mayetiola destructor is a destructive pest of wheat worldwide and a model organism for studying plant – insect interactions. The insect has six different developmental stages including eggs, three instars of larvae, pupae, and adults. Molecular mechanisms controlling the transition ...

Incorporating "omics" in the study of reproduction and development: Virtual Tissue Models in Developmental Toxicity Research

EPA Science Inventory

In recent years, ground breaking research in genomic applications in the area of reproductive and developmental toxicology have been successful in linking changes in the expression of specific genes and their higher-level biological processes to effects induced by drugs or chemic...

Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

EPA Science Inventory

Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

Developmental expression and estrogen responses of endocrine genes in juvenile yellow perch (Perca flavescens)

USDA-ARS?s Scientific Manuscript database

The present study examines the expression of growth-regulating genes (gh, prl, smtl and igf1b), the estrogen receptors (esr1 and esr2a) and aromatase (cyp19a1a) in developing yellow perch. To gain an initial understanding into the endocrine control of growth preceding and involved with sexual size d...

In utero and lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: Effects on fetal and adult cardiac gene expression and adult cardiac and renal morphology

USDA-ARS?s Scientific Manuscript database

The mouse heart is a target of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) during fetal development, and microarray analysis demonstrates significant changes in expression of cardiac genes involved in extracellular matrix (ECM) remodeling. We tested the hypothesis that developmental TCDD exposure wo...

Functional autonomy of distant-acting human enhancers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Visel, Axel; Akiyama, Jennifer A.; Shoukry, Malak

2009-02-19

Many human genes are associated with dispersed arrays of transcriptional enhancers that regulate their expression in time and space. Studies in invertebrate model systems have suggested that these elements function as discrete and independent regulatory units, but the in vivo combinatorial properties of vertebrate enhancers remain poorly understood. To explore the modularity and regulatory autonomy of human developmental enhancers, we experimentally concatenated up to four enhancers from different genes and used a transgenic mouse assay to compare the in vivo activity of these compound elements with that of the single modules. In all of the six different combinations of elementsmore » tested, the reporter gene activity patterns were additive without signs of interference between the individual modules, indicating that regulatory specificity was maintained despite the presence of closely-positioned heterologous enhancers. Even in cases where two elements drove expression in close anatomical proximity, such as within neighboring subregions of the developing limb bud, the compound patterns did not show signs of cross-inhibition between individual elements or novel expression sites. These data indicate that human developmental enhancers are highly modular and functionally autonomous and suggest that genomic enhancer shuffling may have contributed to the evolution of complex gene expression patterns in vertebrates« less

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

Impaired tissue regeneration corresponds with altered expression of developmental genes that persists in the metabolic memory state of diabetic zebrafish

PubMed Central

Sarras, Michael P.; Leontovich, Alexey A.; Olsen, Ansgar S.; Intine, Robert V.

2013-01-01

As previously reported by our lab streptozocin-induced Diabetes mellitus (DM) in adult zebrafish results in an impairment of tissue regeneration as monitored by caudal fin regeneration. Following streptozocin withdrawal, a recovery phase occurs to re-establish euglycemia, via pancreatic beta-cell regeneration. However, DM-associated impaired fin regeneration continues indefinitely in the metabolic memory state (MM) allowing for subsequent molecular analysis of the underlying mechanisms of MM. This study focuses on elucidating the molecular basis that explains the DM-associated impaired fin regeneration and why it persists into the MM state with the aim of better understanding MM. Using a combination of microarray analysis and bioinformatics approaches our study found that of the 14,900 transcripts analyzed, aberrant expression of 71 genes relating to tissue developmental and regeneration processes were identified in DM fish and the altered expression of these 71 genes persisted in MM fish. Key regulatory genes of major development, and signal transduction pathways were identified among this group of 71. The aberrant expression of key regulatory genes in the DM state that persist into the MM state provides a plausible explanation for how hyperglycemia induced impaired fin regeneration in the adult zebrafish DM/MM model. PMID:23438205

Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

PubMed Central

Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

2013-01-01

Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Non-Small-Cell Lung Cancer Molecular Signatures Recapitulate Lung Developmental Pathways

PubMed Central

Borczuk, Alain C.; Gorenstein, Lyall; Walter, Kristin L.; Assaad, Adel A.; Wang, Liqun; Powell, Charles A.

2003-01-01

Current paradigms hold that lung carcinomas arise from pleuripotent stem cells capable of differentiation into one or several histological types. These paradigms suggest lung tumor cell ontogeny is determined by consequences of gene expression that recapitulate events important in embryonic lung development. Using oligonucleotide microarrays, we acquired gene profiles from 32 microdissected non-small-cell lung tumors. We determined the 100 top-ranked marker genes for adenocarcinoma, squamous cell, large cell, and carcinoid using nearest neighbor analysis. Results were validated by immunostaining for 11 selected proteins using a tissue microarray representing 80 tumors. Gene expression data of lung development were accessed from a publicly available dataset generated with the murine Mu11k genome microarray. Self-organized mapping identified two temporally distinct clusters of murine orthologues. Supervised clustering of lung development data showed large-cell carcinoma gene orthologues were in a cluster expressed in pseudoglandular and canalicular stages whereas adenocarcinoma homologues were predominantly in a cluster expressed later in the terminal sac and alveolar stages of murine lung development. Representative large-cell genes (E2F3, MYBL2, HDAC2, CDK4, PCNA) are expressed in the nucleus and are associated with cell cycle and proliferation. In contrast, adenocarcinoma genes are associated with lung-specific transcription pathways (SFTPB, TTF-1), cell adhesion, and signal transduction. In sum, non-small-cell lung tumors histology gene profiles suggest mechanisms relevant to ontogeny and clinical course. Adenocarcinoma genes are associated with differentiation and glandular formation whereas large-cell genes are associated with proliferation and differentiation arrest. The identification of developmentally regulated pathways active in tumorigenesis provides insights into lung carcinogenesis and suggests early steps may differ according to the eventual tumor morphology. PMID:14578194

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

PubMed Central

2013-01-01

Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes important to early stages of mushroom fruiting development, though their precise molecular functions and biological roles are not yet fully known. This study serves to advance our understanding of the molecular mechanisms of fruiting body development in the model mushroom C. cinerea. PMID:23514374

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcriptome profile analysis of floral sex determination in cucumber.

PubMed

Wu, Tao; Qin, Zhiwei; Zhou, Xiuyan; Feng, Zhuo; Du, Yalin

2010-07-15

Cucumber has been widely studied as a model for floral sex determination. In this investigation, we performed genome-wide transcriptional profiling of apical tissue of a gynoecious mutant (Csg-G) and the monoecious wild-type (Csg-M) of cucumber in an attempt to isolate genes involved in sex determination, using the Solexa technology. The profiling analysis revealed numerous changes in gene expression attributable to the mutation, which resulted in the down-regulation of 600 genes and the up-regulation of 143 genes. The Solexa data were confirmed by reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative RT-PCR (qRT-PCR). Gene ontology (GO) analysis revealed that the differentially expressed genes were mainly involved in biogenesis, transport and organization of cellular component, macromolecular and cellular biosynthesis, localization, establishment of localization, translation and other processes. Furthermore, the expression of some of these genes depended upon the tissue and the developmental stage of the flowers of gynoecious mutant. The results of this study suggest two important concepts, which govern sex determination in cucumber. First, the differential expression of genes involved in plant hormone signaling pathways, such as ACS, Asr1, CsIAA2, CS-AUX1 and TLP, indicate that phytohormones and their crosstalk might play a critical role in the sex determination. Second, the regulation of some transcription factors, including EREBP-9, may also be involved in this developmental process. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus.

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

2017-03-01

To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P<0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48h LD10 and LD50 were 1.35 and 1.84kJ/m 2 , and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5kJ/m 2 ) induced developmental delays, and higher doses (6-18kJ/m 2 ) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12kJ/m 2 ) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Xiaozhong; Hong, Sung Woo; Moreira, Estefania G.

Gonocytes exist in the neonatal testis and represent a transient population of male germ-line stem cells. It has been shown that stem cell self-renewal and progeny production is probably controlled by the neighboring differentiated cells and extracellular matrix (ECM) in vivo known as niches. Recently, we developed an in vitro three-dimensional (3D) Sertoli cell/gonocyte co-culture (SGC) model with ECM overlay, which creates an in vivo-like niche and supports germ-line stem cell functioning within a 3D environment. In this study, we applied morphological and cytotoxicity evaluations, as well as microarray-based gene expression to examine the effects of different phthalate esters (PE)more » on this model. Known in vivo male developmentally toxic PEs (DTPE) and developmentally non-toxic PEs (DNTPE) were evaluated. We observed that DTPE induced significantly greater dose-dependent morphological changes, a decrease in cell viability and an increase in cytotoxicity compared to those treated with DNTPE. Moreover, the gene expression was more greatly altered by DTPE than by DNTPE and non-supervised cluster analysis allowed the discrimination of DTPE from the DNTPE. Our systems-based GO-Quant analysis showed significant alterations in the gene pathways involved in cell cycle, phosphate transport and apoptosis regulation with DTPE but not with DNTPE treatment. Disruptions of steroidogenesis related-gene expression such as Star, Cyp19a1, Hsd17b8, and Nr4a3 were observed in the DTPE group, but not in the DNTPE group. In summary, our observation on cell viability, cytotoxicity, and microarray-based gene expression analysis induced by PEs demonstrate that our in vitro 3D-SGC system mimicked in vivo responses for PEs and suggests that the 3D-SGC system might be useful in identifying developmental reproductive toxicants.« less

Pathway modeling of microarray data: A case study of pathway activity changes in the testis following in utero exposure to dibutyl phthalate (DBP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ovacik, Meric A.; Sen, Banalata; Euling, Susan Y.

Pathway activity level analysis, the approach pursued in this study, focuses on all genes that are known to be members of metabolic and signaling pathways as defined by the KEGG database. The pathway activity level analysis entails singular value decomposition (SVD) of the expression data of the genes constituting a given pathway. We explore an extension of the pathway activity methodology for application to time-course microarray data. We show that pathway analysis enhances our ability to detect biologically relevant changes in pathway activity using synthetic data. As a case study, we apply the pathway activity level formulation coupled with significancemore » analysis to microarray data from two different rat testes exposed in utero to Dibutyl Phthalate (DBP). In utero DBP exposure in the rat results in developmental toxicity of a number of male reproductive organs, including the testes. One well-characterized mode of action for DBP and the male reproductive developmental effects is the repression of expression of genes involved in cholesterol transport, steroid biosynthesis and testosterone synthesis that lead to a decreased fetal testicular testosterone. Previous analyses of DBP testes microarray data focused on either individual gene expression changes or changes in the expression of specific genes that are hypothesized, or known, to be important in testicular development and testosterone synthesis. However, a pathway analysis may inform whether there are additional affected pathways that could inform additional modes of action linked to DBP developmental toxicity. We show that Pathway activity analysis may be considered for a more comprehensive analysis of microarray data.« less

Information Propagation in Developmental Enhancers

NASA Astrophysics Data System (ADS)

Jena, Siddhartha; Levine, Michael

Rather than encoding information about protein sequence, certain lengths of noncoding DNA, called enhancers, interact with protein machinery such as transcription factors to precisely regulate gene expression. Enhancers have been studied extensively in the fruit fly Drosophila melanogaster, where they regulate the expression of developmental genes that establish the blueprint of the adult fly. It has been suggested that enhancer sequences possess a specific but unknown syntax with regards to the placement and strength of transcription factor binding sites. Moreover, studies in divergent fly species have shown that compensatory evolution allows for maintenance of enhancer functionality despite considerable variation in primary DNA sequence. Here, the possible role of enhancers as signal processing modules is studied as a way of explaining these two findings. We first demonstrate how this framework can be used to explain the fine-tuned spatiotemporal dynamics of gene expression. We then explore the evolutionary pressure on enhancer sequences and the resulting emergence of enhancers that are linked by compensatory mutations. This study provides a possible mechanism for the function of multiple enhancers linked to a single gene.

An open reading frame in intron seven of the sea urchin DNA-methyltransferase gene codes for a functional AP1 endonuclease.

PubMed

Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita

2002-08-01

Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

PubMed

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

[Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

PubMed

Yang, Li-Wei; Shi, Ji-Sen

2012-04-01

To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

PubMed

Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

2015-05-15

The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice.

PubMed

Lew, D; Brady, H; Klausing, K; Yaginuma, K; Theill, L E; Stauber, C; Karin, M; Mellon, P L

1993-04-01

During pituitary development, the homeo domain protein GHF-1 is required for generation of somatotropes and lactotropes and for growth hormone (GH) and prolactin (PRL) gene expression. GHF-1 mRNA is detectable several days before the emergence of GH- or PRL-expressing cells, suggesting the existence of a somatotropic progenitor cell in which GHF-1 transcription is first activated. We have immortalized this cell type by using the GHF-1 regulatory region to target SV40 T-antigen (Tag) tumorigenesis in transgenic mice. The GHF-Tag transgene caused developmental entrapment of somatotropic progenitor cells that express GHF-1 but not GH or PRL, resulting in dwarfism. Immortalized cell lines derived from a transgenic pituitary tumor maintain the characteristics of the somato/lactotropic progenitor in that they express GHF-1 mRNA and protein yet fail to activate GH or PRL transcription. Using these cells, we identified an enhancer that activates GHF-1 transcription at this early stage of development yet is inactive in cells representing later developmental stages of the somatotropic lineage or in other cell types. These experiments not only demonstrate the potential for immortalization of developmental progenitor cells using the regulatory regions from cell type-specific transcription factor genes but illustrate the power of such model systems in the study of developmental control.

Identification and resolution of artifacts in the interpretation of imprinted gene expression

PubMed Central

Proudhon, Charlotte

2010-01-01

Genomic imprinting refers to genes that are epigenetically programmed in the germline to express exclusively or preferentially one allele in a parent-of-origin manner. Expression-based genome-wide screening for the identification of imprinted genes has failed to uncover a significant number of new imprinted genes, probably because of the high tissue- and developmental-stage specificity of imprinted gene expression. A very large number of technical and biological artifacts can also lead to the erroneous evidence of imprinted gene expression. In this article, we focus on three common sources of potential confounding effects: (i) random monoallelic expression in monoclonal cell populations, (ii) genetically determined monoallelic expression and (iii) contamination or infiltration of embryonic tissues with maternal material. This last situation specifically applies to genes that occur as maternally expressed in the placenta. Beside the use of reciprocal crosses that are instrumental to confirm the parental specificity of expression, we provide additional methods for the detection and elimination of these situations that can be misinterpreted as cases of imprinted expression. PMID:20829207

The histone chaperone ASF1 is essential for sexual development in the filamentous fungus Sordaria macrospora.

PubMed

Gesing, Stefan; Schindler, Daniel; Fränzel, Benjamin; Wolters, Dirk; Nowrousian, Minou

2012-05-01

Ascomycetes develop four major types of fruiting bodies that share a common ancestor, and a set of common core genes most likely controls this process. One way to identify such genes is to search for conserved expression patterns. We analysed microarray data of Fusarium graminearum and Sordaria macrospora, identifying 78 genes with similar expression patterns during fruiting body development. One of these genes was asf1 (anti-silencing function 1), encoding a predicted histone chaperone. asf1 expression is also upregulated during development in the distantly related ascomycete Pyronema confluens. To test whether asf1 plays a role in fungal development, we generated an S. macrospora asf1 deletion mutant. The mutant is sterile and can be complemented to fertility by transformation with the wild-type asf1 and its P. confluens homologue. An ASF1-EGFP fusion protein localizes to the nucleus. By tandem-affinity purification/mass spectrometry as well as yeast two-hybrid analysis, we identified histones H3 and H4 as ASF1 interaction partners. Several developmental genes are dependent on asf1 for correct transcriptional expression. Deletion of the histone chaperone genes rtt106 and cac2 did not cause any developmental phenotypes. These data indicate that asf1 of S. macrospora encodes a conserved histone chaperone that is required for fruiting body development. © 2012 Blackwell Publishing Ltd.

A rat RNA-Seq transcriptomic BodyMap across 11 organs and 4 developmental stages

PubMed Central

Yu, Ying; Fuscoe, James C.; Zhao, Chen; Guo, Chao; Jia, Meiwen; Qing, Tao; Bannon, Desmond I.; Lancashire, Lee; Bao, Wenjun; Du, Tingting; Luo, Heng; Su, Zhenqiang; Jones, Wendell D.; Moland, Carrie L.; Branham, William S.; Qian, Feng; Ning, Baitang; Li, Yan; Hong, Huixiao; Guo, Lei; Mei, Nan; Shi, Tieliu; Wang, Kevin Y.; Wolfinger, Russell D.; Nikolsky, Yuri; Walker, Stephen J.; Duerksen-Hughes, Penelope; Mason, Christopher E.; Tong, Weida; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Shi, Leming; Wang, Charles

2014-01-01

The rat has been used extensively as a model for evaluating chemical toxicities and for understanding drug mechanisms. However, its transcriptome across multiple organs, or developmental stages, has not yet been reported. Here we show, as part of the SEQC consortium efforts, a comprehensive rat transcriptomic BodyMap created by performing RNA-Seq on 320 samples from 11 organs of both sexes of juvenile, adolescent, adult and aged Fischer 344 rats. We catalogue the expression profiles of 40,064 genes, 65,167 transcripts, 31,909 alternatively spliced transcript variants and 2,367 non-coding genes/non-coding RNAs (ncRNAs) annotated in AceView. We find that organ-enriched, differentially expressed genes reflect the known organ-specific biological activities. A large number of transcripts show organ-specific, age-dependent or sex-specific differential expression patterns. We create a web-based, open-access rat BodyMap database of expression profiles with crosslinks to other widely used databases, anticipating that it will serve as a primary resource for biomedical research using the rat model. PMID:24510058

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention

PubMed Central

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V.

2012-01-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3′-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context. PMID:22661231

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention.

PubMed

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V

2012-06-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3'-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context.

Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis

PubMed Central

Han, Yu; Wan, Huihua; Cheng, Tangren; Wang, Jia; Yang, Weiru; Pan, Huitang; Zhang, Qixiang

2017-01-01

The developmental process that produces the ornate petals of the China rose (Rosa chinensis) is complex and is thought to depend on the balanced expression of a functionally diverse array of genes; however, the molecular basis of rose petal development is largely unknown. Here, petal growth of the R. chinensis cultivar ‘Old Blush’ was divided into four developmental stages, and RNA-seq technology was used to analyse the dynamic changes in transcription that occur as development progresses. In total, 598 million clean reads and 61,456 successfully annotated unigenes were obtained. Differentially expressed gene (DEG) analysis comparing the transcriptomes of the developmental stages resulted in the identification of several potential candidate genes involved in petal development. DEGs involved in anthocyanin biosynthesis, petal expansion, and phytohormone pathways were considered in depth, in addition to several candidate transcription factors. These results lay a foundation for future studies on the regulatory mechanisms underlying rose petal development and may be used in molecular breeding programs aimed at generating ornamental rose lines with desirable traits. PMID:28225056

Inferring the Skeletal Muscle Developmental Changes of Grazing and Barn-Fed Goats from Gene Expression Data.

PubMed

Huang, Jinyu; Jiao, Jinzhen; Tan, Zhi-Liang; He, Zhixiong; Beauchemin, Karen A; Forster, Robert; Han, Xue-Feng; Tang, Shao-Xun; Kang, Jinghe; Zhou, Chuanshe

2016-09-14

Thirty-six Xiangdong black goats were used to investigate age-related mRNA and protein expression levels of some genes related to skeletal muscle structural proteins, MRFs and MEF2 family, and skeletal muscle fiber type and composition during skeletal muscle growth under grazing (G) and barn-fed (BF) feeding systems. Goats were slaughtered at six time points selected to reflect developmental changes of skeletal muscle during nonrumination (days 0, 7, and 14), transition (day 42), and rumination phases (days 56 and 70). It was observed that the number of type IIx in the longissimus dorsi was increased quickly while numbers of type IIa and IIb decreased slightly, indicating that these genes were coordinated during the rapid growth and development stages of skeletal muscle. No gene expression was affected (P > 0.05) by feeding system except Myf5 and Myf6. Protein expressions of MYOZ3 and MEF2C were affected (P < 0.05) by age, whereas PGC-1α was linearly decreased in the G group, and only MYOZ3 protein was affected (P < 0.001) by feeding system. Moreover, it was found that PGC-1α and MEF2C proteins may interact with each other in promoting muscle growth. The current results indicate that (1) skeletal muscle growth during days 0-70 after birth is mainly myofiber hypertrophy and differentiation, (2) weaning affects the expression of relevant genes of skeletal muscle structural proteins, skeletal muscle growth, and skeletal muscle fiber type and composition, and (3) nutrition or feeding regimen mainly influences the expression of skeletal muscle growth genes.

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

A wing expressed sequence tag resource for Bicyclus anynana butterflies, an evo-devo model

PubMed Central

Beldade, Patrícia; Rudd, Stephen; Gruber, Jonathan D; Long, Anthony D

2006-01-01

Background Butterfly wing color patterns are a key model for integrating evolutionary developmental biology and the study of adaptive morphological evolution. Yet, despite the biological, economical and educational value of butterflies they are still relatively under-represented in terms of available genomic resources. Here, we describe an Expression Sequence Tag (EST) project for Bicyclus anynana that has identified the largest available collection to date of expressed genes for any butterfly. Results By targeting cDNAs from developing wings at the stages when pattern is specified, we biased gene discovery towards genes potentially involved in pattern formation. Assembly of 9,903 ESTs from a subtracted library allowed us to identify 4,251 genes of which 2,461 were annotated based on BLAST analyses against relevant gene collections. Gene prediction software identified 2,202 peptides, of which 215 longer than 100 amino acids had no homology to any known proteins and, thus, potentially represent novel or highly diverged butterfly genes. We combined gene and Single Nucleotide Polymorphism (SNP) identification by constructing cDNA libraries from pools of outbred individuals, and by sequencing clones from the 3' end to maximize alignment depth. Alignments of multi-member contigs allowed us to identify over 14,000 putative SNPs, with 316 genes having at least one high confidence double-hit SNP. We furthermore identified 320 microsatellites in transcribed genes that can potentially be used as genetic markers. Conclusion Our project was designed to combine gene and sequence polymorphism discovery and has generated the largest gene collection available for any butterfly and many potential markers in expressed genes. These resources will be invaluable for exploring the potential of B. anynana in particular, and butterflies in general, as models in ecological, evolutionary, and developmental genetics. PMID:16737530

RNA-sequencing of the sturgeon Acipenser baeri provides insights into expression dynamics of morphogenic differentiation and developmental regulatory genes in early versus late developmental stages.

PubMed

Song, Wei; Jiang, Keji; Zhang, Fengying; Lin, Yu; Ma, Lingbo

2016-08-08

Acipenser baeri, one of the critically endangered animals on the verge of extinction, is a key species for evolutionary, developmental, physiology and conservation studies and a standout amongst the most important food products worldwide. Though the transcriptome of the early development of A. baeri has been published recently, the transcriptome changes occurring in the transition from embryonic to late stages are still unknown. The aim of this work was to analyze the transcriptomes of embryonic and post-embryonic stages of A. baeri and identify differentially expressed genes (DEGs) and their expression patterns using mRNA collected from specimens at big yolk plug, wide neural plate and 64 day old sturgeon developmental stages for RNA-Seq. The paired-end sequencing of the transcriptome of samples of A. baeri collected at two early (big yolk plug (T1, 32 h after fertilization) and wide neural plate formation (T2, 45 h after fertilization)) and one late (T22, 64 day old sturgeon) developmental stages using Illumina Hiseq2000 platform generated 64039846, 64635214 and 75293762 clean paired-end reads for T1, T2 and T22, respectively. After quality control, the sequencing reads were de novo assembled to generate a set of 149,265 unigenes with N50 value of 1277 bp. Functional annotation indicated that a substantial number of these unigenes had significant similarity with proteins in public databases. Differential expression profiling allowed the identification of 2789, 12,819 and 10,824 DEGs from the respective T1 vs. T2, T1 vs. T22 and T2 vs. T22 comparisons. High correlation of DEGs' features was recorded among early stages while significant divergences were observed when comparing the late stage with early stages. GO and KEGG enrichment analyses revealed the biological processes, cellular component, molecular functions and metabolic pathways associated with identified DEGs. The qRT-PCR performed for candidate genes in specimens confirmed the validity of the RNA-seq data. This study presents, for the first time, an extensive overview of RNA-Seq based characterization of the early and post-embryonic developmental transcriptomes of A. baeri and provided 149,265 gene sequences that will be potentially valuable for future molecular and genetic studies in A. baeri.

Sodium butyrate improves the cloned yak embryo viability and corrects gene expression patterns.

PubMed

Xiong, Xian-rong; Lan, Dao-liang; Li, Jian; Wang, Yong; Zhong, Jin-cheng

2015-02-01

Interspecies somatic cell nuclear transfer (iSCNT), a powerful tool in basic scientific research, has been used widely to increase and preserve the population of endangered species. Yak (Bos grunniens) is one of these species. Development to term of interspecies cloned yak embryos has not been achieved, possibly due to abnormal epigenetic reprogramming. Previous studies have demonstrated that treatment of intraspecies cloned embryos with (NaBu) significantly improves nuclear-cytoplasmic reprogramming and viability in vitro. Therefore, in this study, we evaluated the effect of optimal NaBu concentration and exposure time on preimplantation development of yak iSCNT embryos and on the expression patterns of developmentally important genes. The results showed that 8-cell rate, blastocyst formation rate and total cell number increased significantly compared with their untreated counterparts when yak iSCNT embryos were treated with 5 nM NaBu for 12 h after activation, but that the 2-cell stage embryo rate was not significantly different. The treatment of NaBu also increased significantly the expression levels of Oct-4 and decreased the expression levels of HDAC-2, Dnmt-1 and IGF-1; the expression patterns of these genes were more similar to that of their bovine-yak in vitro fertilization (BY-IVF) counterparts. The results described above indicated that NaBu treatment improved developmental competence in vitro and 'corrected' the gene expression patterns of yak iSCNT embryos.

Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

PubMed Central

Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

2013-01-01

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

PubMed

Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

2013-01-04

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

Systematically labeling developmental stage-specific genes for the study of pancreatic β-cell differentiation from human embryonic stem cells.

PubMed

Liu, Haisong; Yang, Huan; Zhu, Dicong; Sui, Xin; Li, Juan; Liang, Zhen; Xu, Lei; Chen, Zeyu; Yao, Anzhi; Zhang, Long; Zhang, Xi; Yi, Xing; Liu, Meng; Xu, Shiqing; Zhang, Wenjian; Lin, Hua; Xie, Lan; Lou, Jinning; Zhang, Yong; Xi, Jianzhong; Deng, Hongkui

2014-10-01

The applications of human pluripotent stem cell (hPSC)-derived cells in regenerative medicine has encountered a long-standing challenge: how can we efficiently obtain mature cell types from hPSCs? Attempts to address this problem are hindered by the complexity of controlling cell fate commitment and the lack of sufficient developmental knowledge for guiding hPSC differentiation. Here, we developed a systematic strategy to study hPSC differentiation by labeling sequential developmental genes to encompass the major developmental stages, using the directed differentiation of pancreatic β cells from hPSCs as a model. We therefore generated a large panel of pancreas-specific mono- and dual-reporter cell lines. With this unique platform, we visualized the kinetics of the entire differentiation process in real time for the first time by monitoring the expression dynamics of the reporter genes, identified desired cell populations at each differentiation stage and demonstrated the ability to isolate these cell populations for further characterization. We further revealed the expression profiles of isolated NGN3-eGFP(+) cells by RNA sequencing and identified sushi domain-containing 2 (SUSD2) as a novel surface protein that enriches for pancreatic endocrine progenitors and early endocrine cells both in human embryonic stem cells (hESC)-derived pancreatic cells and in the developing human pancreas. Moreover, we captured a series of cell fate transition events in real time, identified multiple cell subpopulations and unveiled their distinct gene expression profiles, among heterogeneous progenitors for the first time using our dual reporter hESC lines. The exploration of this platform and our new findings will pave the way to obtain mature β cells in vitro.

Transcriptome analyses reveal genotype- and developmental stage-specific molecular responses to drought and salinity stresses in chickpea

PubMed Central

Garg, Rohini; Shankar, Rama; Thakkar, Bijal; Kudapa, Himabindu; Krishnamurthy, Lakshmanan; Mantri, Nitin; Varshney, Rajeev K.; Bhatia, Sabhyata; Jain, Mukesh

2016-01-01

Drought and salinity are the major factors that limit chickpea production worldwide. We performed whole transcriptome analyses of chickpea genotypes to investigate the molecular basis of drought and salinity stress response/adaptation. Phenotypic analyses confirmed the contrasting responses of the chickpea genotypes to drought or salinity stress. RNA-seq of the roots of drought and salinity related genotypes was carried out under control and stress conditions at vegetative and/or reproductive stages. Comparative analysis of the transcriptomes revealed divergent gene expression in the chickpea genotypes at different developmental stages. We identified a total of 4954 and 5545 genes exclusively regulated in drought-tolerant and salinity-tolerant genotypes, respectively. A significant fraction (~47%) of the transcription factor encoding genes showed differential expression under stress. The key enzymes involved in metabolic pathways, such as carbohydrate metabolism, photosynthesis, lipid metabolism, generation of precursor metabolites/energy, protein modification, redox homeostasis and cell wall component biogenesis, were affected by drought and/or salinity stresses. Interestingly, transcript isoforms showed expression specificity across the chickpea genotypes and/or developmental stages as illustrated by the AP2-EREBP family members. Our findings provide insights into the transcriptome dynamics and components of regulatory network associated with drought and salinity stress responses in chickpea. PMID:26759178

Stochastic gene expression in Arabidopsis thaliana.

PubMed

Araújo, Ilka Schultheiß; Pietsch, Jessica Magdalena; Keizer, Emma Mathilde; Greese, Bettina; Balkunde, Rachappa; Fleck, Christian; Hülskamp, Martin

2017-12-14

Although plant development is highly reproducible, some stochasticity exists. This developmental stochasticity may be caused by noisy gene expression. Here we analyze the fluctuation of protein expression in Arabidopsis thaliana. Using the photoconvertible KikGR marker, we show that the protein expressions of individual cells fluctuate over time. A dual reporter system was used to study extrinsic and intrinsic noise of marker gene expression. We report that extrinsic noise is higher than intrinsic noise and that extrinsic noise in stomata is clearly lower in comparison to several other tissues/cell types. Finally, we show that cells are coupled with respect to stochastic protein expression in young leaves, hypocotyls and roots but not in mature leaves. Our data indicate that stochasticity of gene expression can vary between tissues/cell types and that it can be coupled in a non-cell-autonomous manner.

Evolution of developmental roles of Pax2/5/8 paralogs after independent duplication in urochordate and vertebrate lineages

PubMed Central

Bassham, Susan; Cañestro, Cristian; Postlethwait, John H

2008-01-01

Background Gene duplication provides opportunities for lineage diversification and evolution of developmental novelties. Duplicated genes generally either disappear by accumulation of mutations (nonfunctionalization), or are preserved either by the origin of positively selected functions in one or both duplicates (neofunctionalization), or by the partitioning of original gene subfunctions between the duplicates (subfunctionalization). The Pax2/5/8 family of important developmental regulators has undergone parallel expansion among chordate groups. After the divergence of urochordate and vertebrate lineages, two rounds of independent gene duplications resulted in the Pax2, Pax5, and Pax8 genes of most vertebrates (the sister group of the urochordates), and an additional duplication provided the pax2a and pax2b duplicates in teleost fish. Separate from the vertebrate genome expansions, a duplication also created two Pax2/5/8 genes in the common ancestor of ascidian and larvacean urochordates. Results To better understand mechanisms underlying the evolution of duplicated genes, we investigated, in the larvacean urochordate Oikopleura dioica, the embryonic gene expression patterns of Pax2/5/8 paralogs. We compared the larvacean and ascidian expression patterns to infer modular subfunctions present in the single pre-duplication Pax2/5/8 gene of stem urochordates, and we compared vertebrate and urochordate expression to infer the suite of Pax2/5/8 gene subfunctions in the common ancestor of olfactores (vertebrates + urochordates). Expression pattern differences of larvacean and ascidian Pax2/5/8 orthologs in the endostyle, pharynx and hindgut suggest that some ancestral gene functions have been partitioned differently to the duplicates in the two urochordate lineages. Novel expression in the larvacean heart may have resulted from the neofunctionalization of a Pax2/5/8 gene in the urochordates. Expression of larvacean Pax2/5/8 in the endostyle, in sites of epithelial remodeling, and in sensory tissues evokes like functions of Pax2, Pax5 and Pax8 in vertebrate embryos, and may indicate ancient origins for these functions in the chordate common ancestor. Conclusion Comparative analysis of expression patterns of chordate Pax2/5/8 duplicates, rooted on the single-copy Pax2/5/8 gene of amphioxus, whose lineage diverged basally among chordates, provides new insights into the evolution and development of the heart, thyroid, pharynx, stomodeum and placodes in chordates; supports the controversial conclusion that the atrial siphon of ascidians and the otic placode in vertebrates are homologous; and backs the notion that Pax2/5/8 functioned in ancestral chordates to engineer epithelial fusions and perforations, including gill slit openings. PMID:18721460

Developmental transitions in C. elegans larval stages.

PubMed

Rougvie, Ann E; Moss, Eric G

2013-01-01

Molecular mechanisms control the timing, sequence, and synchrony of developmental events in multicellular organisms. In Caenorhabditis elegans, these mechanisms are revealed through the analysis of mutants with "heterochronic" defects: cell division or differentiation patterns that occur in the correct lineage, but simply at the wrong time. Subsets of cells in these mutants thus express temporal identities normally restricted to a different life stage. A seminal finding arising from studies of the heterochronic genes was the discovery of miRNAs; these tiny miRNAs are now a defining feature of the pathway. A series of sequentially expressed miRNAs guide larval transitions through stage-specific repression of key effector molecules. The wild-type lineage patterns are executed as discrete modules programmed between temporal borders imposed by the molting cycles. How these successive events are synchronized with the oscillatory molting cycle is just beginning to come to light. Progression through larval stages can be specifically, yet reversibly, halted in response to environmental cues, including nutrient availability. Here too, heterochronic genes and miRNAs play key roles. Remarkably, developmental arrest can, in some cases, either mask or reveal timing defects associated with mutations. In this chapter, we provide an overview of how the C. elegans heterochronic gene pathway guides developmental transitions during continuous and interrupted larval development. © 2013 Elsevier Inc. All rights reserved.

Putative synaptic genes defined from a Drosophila whole body developmental transcriptome by a machine learning approach.

PubMed

Pazos Obregón, Flavio; Papalardo, Cecilia; Castro, Sebastián; Guerberoff, Gustavo; Cantera, Rafael

2015-09-15

Assembly and function of neuronal synapses require the coordinated expression of a yet undetermined set of genes. Although roughly a thousand genes are expected to be important for this function in Drosophila melanogaster, just a few hundreds of them are known so far. In this work we trained three learning algorithms to predict a "synaptic function" for genes of Drosophila using data from a whole-body developmental transcriptome published by others. Using statistical and biological criteria to analyze and combine the predictions, we obtained a gene catalogue that is highly enriched in genes of relevance for Drosophila synapse assembly and function but still not recognized as such. The utility of our approach is that it reduces the number of genes to be tested through hypothesis-driven experimentation.

Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

PubMed

Lee, M M; Schiefelbein, J

2001-05-01

The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

Transcriptome and Gene Expression Analysis of the Rice Leaf Folder, Cnaphalocrosis medinalis

PubMed Central

Li, Shang-Wei; Yang, Hong; Liu, Yue-Feng; Liao, Qi-Rong; Du, Juan; Jin, Dao-Chao

2012-01-01

Background The rice leaf folder (RLF), Cnaphalocrocis medinalis (Guenee) (Lepidoptera: Pyralidae), is one of the most destructive pests affecting rice in Asia. Although several studies have been performed on the ecological and physiological aspects of this species, the molecular mechanisms underlying its developmental regulation, behavior, and insecticide resistance remain largely unknown. Presently, there is a lack of genomic information for RLF; therefore, studies aimed at profiling the RLF transcriptome expression would provide a better understanding of its biological function at the molecular level. Principal Findings De novo assembly of the RLF transcriptome was performed via the short read sequencing technology (Illumina). In a single run, we produced more than 23 million sequencing reads that were assembled into 44,941 unigenes (mean size = 474 bp) by Trinity. Through a similarity search, 25,281 (56.82%) unigenes matched known proteins in the NCBI Nr protein database. The transcriptome sequences were annotated with gene ontology (GO), cluster of orthologous groups of proteins (COG), and KEGG orthology (KO). Additionally, we profiled gene expression during RLF development using a tag-based digital gene expression (DGE) system. Five DGE libraries were constructed, and variations in gene expression were compared between collected samples: eggs vs. 3rd instar larvae, 3rd instar larvae vs. pupae, pupae vs. adults. The results demonstrated that thousands of genes were significantly differentially expressed during various developmental stages. A number of the differentially expressed genes were confirmed by quantitative real-time PCR (qRT-PCR). Conclusions The RLF transcriptome and DGE data provide a comprehensive and global gene expression profile that would further promote our understanding of the molecular mechanisms underlying various biological characteristics, including development, elevated fecundity, flight, sex differentiation, olfactory behavior, and insecticide resistance in RLF. Therefore, these findings could help elucidate the intrinsic factors involved in the RLF-mediated destruction of rice and offer sustainable insect pest management. PMID:23185238

Maternal immune activation dysregulation of the fetal brain transcriptome and relevance to the pathophysiology of autism spectrum disorder.

PubMed

Lombardo, M V; Moon, H M; Su, J; Palmer, T D; Courchesne, E; Pramparo, T

2018-04-01

Maternal immune activation (MIA) via infection during pregnancy is known to increase risk for autism spectrum disorder (ASD). However, it is unclear how MIA disrupts fetal brain gene expression in ways that may explain this increased risk. Here we examine how MIA dysregulates rat fetal brain gene expression (at a time point analogous to the end of the first trimester of human gestation) in ways relevant to ASD-associated pathophysiology. MIA downregulates expression of ASD-associated genes, with the largest enrichments in genes known to harbor rare highly penetrant mutations. MIA also downregulates expression of many genes also known to be persistently downregulated in the ASD cortex later in life and which are canonically known for roles in affecting prenatally late developmental processes at the synapse. Transcriptional and translational programs that are downstream targets of highly ASD-penetrant FMR1 and CHD8 genes are also heavily affected by MIA. MIA strongly upregulates expression of a large number of genes involved in translation initiation, cell cycle, DNA damage and proteolysis processes that affect multiple key neural developmental functions. Upregulation of translation initiation is common to and preserved in gene network structure with the ASD cortical transcriptome throughout life and has downstream impact on cell cycle processes. The cap-dependent translation initiation gene, EIF4E, is one of the most MIA-dysregulated of all ASD-associated genes and targeted network analyses demonstrate prominent MIA-induced transcriptional dysregulation of mTOR and EIF4E-dependent signaling. This dysregulation of translation initiation via alteration of the Tsc2-mTor-Eif4e axis was further validated across MIA rodent models. MIA may confer increased risk for ASD by dysregulating key aspects of fetal brain gene expression that are highly relevant to pathophysiology affecting ASD.

ABAEnrichment: an R package to test for gene set expression enrichment in the adult and developing human brain.

PubMed

Grote, Steffi; Prüfer, Kay; Kelso, Janet; Dannemann, Michael

2016-10-15

We present ABAEnrichment, an R package that tests for expression enrichment in specific brain regions at different developmental stages using expression information gathered from multiple regions of the adult and developing human brain, together with ontologically organized structural information about the brain, both provided by the Allen Brain Atlas. We validate ABAEnrichment by successfully recovering the origin of gene sets identified in specific brain cell-types and developmental stages. ABAEnrichment was implemented as an R package and is available under GPL (≥ 2) from the Bioconductor website (http://bioconductor.org/packages/3.3/bioc/html/ABAEnrichment.html). steffi_grote@eva.mpg.de, kelso@eva.mpg.de or michael_dannemann@eva.mpg.deSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

PubMed

Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

2015-01-01

Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Thrombospondin Type-1 Repeat Domain-Containing Proteins Are Strongly Expressed in the Head Region of Hydra.

PubMed

Hamaguchi-Hamada, Kayoko; Kurumata-Shigeto, Mami; Minobe, Sumiko; Fukuoka, Nozomi; Sato, Manami; Matsufuji, Miyuki; Koizumi, Osamu; Hamada, Shun

2016-01-01

The head region of Hydra, the hypostome, is a key body part for developmental control and the nervous system. We herein examined genes specifically expressed in the head region of Hydra oligactis using suppression subtractive hybridization (SSH) cloning. A total of 1414 subtracted clones were sequenced and found to be derived from at least 540 different genes by BLASTN analyses. Approximately 25% of the subtracted clones had sequences encoding thrombospondin type-1 repeat (TSR) domains, and were derived from 17 genes. We identified 11 TSR domain-containing genes among the top 36 genes that were the most frequently detected in our SSH library. Whole-mount in situ hybridization analyses confirmed that at least 13 out of 17 TSR domain-containing genes were expressed in the hypostome of Hydra oligactis. The prominent expression of TSR domain-containing genes suggests that these genes play significant roles in the hypostome of Hydra oligactis.

Dose-related gene expression changes in forebrain following acute, low-level chlorpyrifos exposure in neonatal rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ray, Anamika; Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK 74078; Liu Jing

2010-10-15

Chlorpyrifos (CPF) is a widely used organophosphorus insecticide (OP) and putative developmental neurotoxicant in humans. The acute toxicity of CPF is elicited by acetylcholinesterase (AChE) inhibition. We characterized dose-related (0.1, 0.5, 1 and 2 mg/kg) gene expression profiles and changes in cell signaling pathways 24 h following acute CPF exposure in 7-day-old rats. Microarray experiments indicated that approximately 9% of the 44,000 genes were differentially expressed following either one of the four CPF dosages studied (546, 505, 522, and 3,066 genes with 0.1, 0.5, 1.0 and 2.0 mg/kg CPF). Genes were grouped according to dose-related expression patterns using K-means clusteringmore » while gene networks and canonical pathways were evaluated using Ingenuity Pathway Analysis (registered) . Twenty clusters were identified and differential expression of selected genes was verified by RT-PCR. The four largest clusters (each containing from 276 to 905 genes) constituted over 50% of all differentially expressed genes and exhibited up-regulation following exposure to the highest dosage (2 mg/kg CPF). The total number of gene networks affected by CPF also rose sharply with the highest dosage of CPF (18, 16, 18 and 50 with 0.1, 0.5, 1 and 2 mg/kg CPF). Forebrain cholinesterase (ChE) activity was significantly reduced (26%) only in the highest dosage group. Based on magnitude of dose-related changes in differentially expressed genes, relative numbers of gene clusters and signaling networks affected, and forebrain ChE inhibition only at 2 mg/kg CPF, we focused subsequent analyses on this treatment group. Six canonical pathways were identified that were significantly affected by 2 mg/kg CPF (MAPK, oxidative stress, NF{Kappa}B, mitochondrial dysfunction, arylhydrocarbon receptor and adrenergic receptor signaling). Evaluation of different cellular functions of the differentially expressed genes suggested changes related to olfactory receptors, cell adhesion/migration, synapse/synaptic transmission and transcription/translation. Nine genes were differentially affected in all four CPF dosing groups. We conclude that the most robust, consistent changes in differential gene expression in neonatal forebrain across a range of acute CPF dosages occurred at an exposure level associated with the classical marker of OP toxicity, AChE inhibition. Disruption of multiple cellular pathways, in particular cell adhesion, may contribute to the developmental neurotoxicity potential of this pesticide.« less

RNA interference of cytochrome P450 CYP6F subfamily genes affects susceptibility to different insecticides in Locusta migratoria.

PubMed

Guo, Yanqiong; Wu, Haihua; Zhang, Xueyao; Ma, Enbo; Guo, Yaping; Zhu, Kun Yan; Zhang, Jianzhen

2016-11-01

Many insect cytochrome P450s (CYPs) play critical roles in detoxification of insecticides. The CYP6 family is unique to the class Insecta, and its biochemical function has essentially been associated with the metabolism of xenobiotics. In this study, we sequenced and characterised the full-length cDNAs of five CYP genes from Locusta migratoria, a highly destructive agricultural pest worldwide. The five genes were predominantly expressed in brain, guts, fat bodies or Malpighian tubules. CYP6FE1, CYP6FF1 and CYP6FG1 were expressed at higher levels in fourth-instar nymphs than in other developmental stages. CYPFD2 is specifically expressed in adults, whereas CYP6FD1, CYP6FD2 and CYP6FE1 showed significantly lower expression in eggs than in other developmental stages. Deltamethrin suppressed CYP6FD1 expression in third-instar nymphs and upregulated the expression level of CYP6FD2, CYP6FF1 and CYP6FG1 at the dose of LD 10 . Efficient RNA interference-mediated gene silencing was established for four of the five CYP genes. Silencing of CYP6FF1 increased the nymphal mortality from 23 to 50% in response to deltamethrin. Silencing of CYP6FD2 and CYP6FE1 increased the nymphal mortality from 32 to 72 and 66%, respectively, to carbaryl. Three of the four CYP6F subfamily genes in L. migratoria were associated with the detoxification of deltamethrin or carbaryl. The role of CYPs in insecticide detoxification appears to be both gene and insecticide specific. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

PubMed

Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

2002-05-01

Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

Expression and imprinting of MAGEL2 suggest a role in Prader-willi syndrome and the homologous murine imprinting phenotype.

PubMed

Lee, S; Kozlov, S; Hernandez, L; Chamberlain, S J; Brannan, C I; Stewart, C L; Wevrick, R

2000-07-22

Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13. Affected individuals exhibit neonatal hypotonia, developmental delay and childhood-onset obesity. Necdin, a protein implicated in the terminal differentiation of neurons, is the only PWS candidate gene to reduce viability when disrupted in a mouse model. In this study, we have characterized MAGEL2 (also known as NDNL1), a gene with 51% amino acid sequence similarity to necdin and located 41 kb distal to NDN in the PWS deletion region. MAGEL2 is expressed predominantly in brain, the primary tissue affected in PWS and in several fetal tissues as shown by northern blot analysis. MAGEL2 is imprinted with monoallelic expression in control brain, and paternal-only expression in the central nervous system as demonstrated by its lack of expression in brain from a PWS-affected individual. The orthologous mouse gene (Magel2) is located within 150 kb of NDN:, is imprinted with paternal-only expression and is expressed predominantly in late developmental stages and adult brain as shown by northern blotting, RT-PCR and whole-mount RNA in situ hybridization. Magel2 distribution partially overlaps that of NDN:, with strong expression being detected in the central nervous system in mid-gestation mouse embryos by in situ hybridization. We hypothesize that, although loss of necdin expression may be important in the neonatal presentation of PWS, loss of MAGEL2 may be critical to abnormalities in brain development and dysmorphic features in individuals with PWS.

Butterfly eyespot serial homology: enter the Hox genes

PubMed Central

2011-01-01

Hox genes modify serial homology patterns in many organisms, exemplified in vertebrates by modification of the axial skeleton and in arthropods by diversification of the body segments. Butterfly wing eyespots also appear in a serial homologous pattern that, in certain species, is subject to local modification. A paper in EvoDevo reports the Hox gene Antp is the earliest known gene to have eyespot-specific expression; however, not all Lepidoptera express Antp in eyespots, suggesting some developmental flexibility. See research article: http://www.evodevojournal.com/content/2/1/9 PMID:21527048

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Dynamic genome wide expression profiling of Drosophila head development reveals a novel role of Hunchback in retinal glia cell development and blood-brain barrier integrity

PubMed Central

Torres-Oliva, Montserrat; Schneider, Julia; Wiegleb, Gordon

2018-01-01

Drosophila melanogaster head development represents a valuable process to study the developmental control of various organs, such as the antennae, the dorsal ocelli and the compound eyes from a common precursor, the eye-antennal imaginal disc. While the gene regulatory network underlying compound eye development has been extensively studied, the key transcription factors regulating the formation of other head structures from the same imaginal disc are largely unknown. We obtained the developmental transcriptome of the eye-antennal discs covering late patterning processes at the late 2nd larval instar stage to the onset and progression of differentiation at the end of larval development. We revealed the expression profiles of all genes expressed during eye-antennal disc development and we determined temporally co-expressed genes by hierarchical clustering. Since co-expressed genes may be regulated by common transcriptional regulators, we combined our transcriptome dataset with publicly available ChIP-seq data to identify central transcription factors that co-regulate genes during head development. Besides the identification of already known and well-described transcription factors, we show that the transcription factor Hunchback (Hb) regulates a significant number of genes that are expressed during late differentiation stages. We confirm that hb is expressed in two polyploid subperineurial glia cells (carpet cells) and a thorough functional analysis shows that loss of Hb function results in a loss of carpet cells in the eye-antennal disc. Additionally, we provide for the first time functional data indicating that carpet cells are an integral part of the blood-brain barrier. Eventually, we combined our expression data with a de novo Hb motif search to reveal stage specific putative target genes of which we find a significant number indeed expressed in carpet cells. PMID:29360820

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

PubMed

Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Functional Characterization of Duplicated SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1-Like Genes in Petunia

PubMed Central

Preston, Jill C.; Jorgensen, Stacy A.; Jha, Suryatapa G.

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes UNSHAVEN (UNS) and FLORAL BINDING PROTEIN 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods. PMID:24787903

An Examination of Dynamic Gene Expression Changes in the Mouse Brain During Pregnancy and the Postpartum Period.

PubMed

Ray, Surjyendu; Tzeng, Ruei-Ying; DiCarlo, Lisa M; Bundy, Joseph L; Vied, Cynthia; Tyson, Gary; Nowakowski, Richard; Arbeitman, Michelle N

2015-11-23

The developmental transition to motherhood requires gene expression changes that alter the brain to drive the female to perform maternal behaviors. We broadly examined the global transcriptional response in the mouse maternal brain, by examining four brain regions: hypothalamus, hippocampus, neocortex, and cerebellum, in virgin females, two pregnancy time points, and three postpartum time points. We find that overall there are hundreds of differentially expressed genes, but each brain region and time point shows a unique molecular signature, with only 49 genes differentially expressed in all four regions. Interestingly, a set of "early-response genes" is repressed in all brain regions during pregnancy and postpartum stages. Several genes previously implicated in underlying postpartum depression change expression. This study serves as an atlas of gene expression changes in the maternal brain, with the results demonstrating that pregnancy, parturition, and postpartum maternal experience substantially impact diverse brain regions. Copyright © 2016 Ray et al.

Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

PubMed Central

Chen, Z. Jeffrey; Pikaard, Craig S.

1997-01-01

Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

PubMed

Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

2016-05-20

Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Relaxed selection is a precursor to the evolution of phenotypic plasticity.

PubMed

Hunt, Brendan G; Ometto, Lino; Wurm, Yannick; Shoemaker, DeWayne; Yi, Soojin V; Keller, Laurent; Goodisman, Michael A D

2011-09-20

Phenotypic plasticity allows organisms to produce alternative phenotypes under different conditions and represents one of the most important ways by which organisms adaptively respond to the environment. However, the relationship between phenotypic plasticity and molecular evolution remains poorly understood. We addressed this issue by investigating the evolution of genes associated with phenotypically plastic castes, sexes, and developmental stages of the fire ant Solenopsis invicta. We first determined if genes associated with phenotypic plasticity in S. invicta evolved at a rapid rate, as predicted under theoretical models. We found that genes differentially expressed between S. invicta castes, sexes, and developmental stages all exhibited elevated rates of evolution compared with ubiquitously expressed genes. We next investigated the evolutionary history of genes associated with the production of castes. Surprisingly, we found that orthologs of caste-biased genes in S. invicta and the social bee Apis mellifera evolved rapidly in lineages without castes. Thus, in contrast to some theoretical predictions, our results suggest that rapid rates of molecular evolution may not arise primarily as a consequence of phenotypic plasticity. Instead, genes evolving under relaxed purifying selection may more readily adopt new forms of biased expression during the evolution of alternate phenotypes. These results suggest that relaxed selective constraint on protein-coding genes is an important and underappreciated element in the evolutionary origin of phenotypic plasticity.

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

Quantitative system drift compensates for altered maternal inputs to the gap gene network of the scuttle fly Megaselia abdita

PubMed Central

Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Janssens, Hilde; Alcaine-Colet, Anna; Lemke, Steffen; Schmidt-Ott, Urs; Jaeger, Johannes

2015-01-01

The segmentation gene network in insects can produce equivalent phenotypic outputs despite differences in upstream regulatory inputs between species. We investigate the mechanistic basis of this phenomenon through a systems-level analysis of the gap gene network in the scuttle fly Megaselia abdita (Phoridae). It combines quantification of gene expression at high spatio-temporal resolution with systematic knock-downs by RNA interference (RNAi). Initiation and dynamics of gap gene expression differ markedly between M. abdita and Drosophila melanogaster, while the output of the system converges to equivalent patterns at the end of the blastoderm stage. Although the qualitative structure of the gap gene network is conserved, there are differences in the strength of regulatory interactions between species. We term such network rewiring ‘quantitative system drift’. It provides a mechanistic explanation for the developmental hourglass model in the dipteran lineage. Quantitative system drift is likely to be a widespread mechanism for developmental evolution. DOI: http://dx.doi.org/10.7554/eLife.04785.001 PMID:25560971

A transcriptome-based assessment of the astrocytic dystrophin-associated complex in the developing human brain.

PubMed

Simon, Matthew J; Murchison, Charles; Iliff, Jeffrey J

2018-02-01

Astrocytes play a critical role in regulating the interface between the cerebral vasculature and the central nervous system. Contributing to this is the astrocytic endfoot domain, a specialized structure that ensheathes the entirety of the vasculature and mediates signaling between endothelial cells, pericytes, and neurons. The astrocytic endfoot has been implicated as a critical element of the glymphatic pathway, and changes in protein expression profiles in this cellular domain are linked to Alzheimer's disease pathology. Despite this, basic physiological properties of this structure remain poorly understood including the developmental timing of its formation, and the protein components that localize there to mediate its functions. Here we use human transcriptome data from male and female subjects across several developmental stages and brain regions to characterize the gene expression profile of the dystrophin-associated complex (DAC), a known structural component of the astrocytic endfoot that supports perivascular localization of the astroglial water channel aquaporin-4. Transcriptomic profiling is also used to define genes exhibiting parallel expression profiles to DAC elements, generating a pool of candidate genes that encode gene products that may contribute to the physiological function of the perivascular astrocytic endfoot domain. We found that several genes encoding transporter proteins are transcriptionally associated with DAC genes. © 2017 Wiley Periodicals, Inc.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

Mitochondrial Gene Cytochrome b Developmental and Environmental Expression in Aedes aegypti (Diptera: Culicidae)

DTIC Science & Technology

2009-11-01

Culicidae), a primary vector of dengue and yellow fever viruses, has not been explored. By using real- time quantitative polymerase chain reaction (qPCR...pesticide) on AeaCytB gene expression. Taken together, these results suggest thatAeaCytB gene plays an important role in the development of Ae. aegypti...2and 9 d old) were exposed to three temperatures (24, 37, and 40C) and 56 1.5% RH in an environmental chamber (L-C incubator, Lab-Line Instruments

Transcriptome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing

PubMed Central

Shen, Yingjia; Venu, R.C.; Nobuta, Kan; Wu, Xiaohui; Notibala, Varun; Demirci, Caghan; Meyers, Blake C.; Wang, Guo-Liang; Ji, Guoli; Li, Qingshun Q.

2011-01-01

Polyadenylation sites mark the ends of mRNA transcripts. Alternative polyadenylation (APA) may alter sequence elements and/or the coding capacity of transcripts, a mechanism that has been demonstrated to regulate gene expression and transcriptome diversity. To study the role of APA in transcriptome dynamics, we analyzed a large-scale data set of RNA “tags” that signify poly(A) sites and expression levels of mRNA. These tags were derived from a wide range of tissues and developmental stages that were mutated or exposed to environmental treatments, and generated using digital gene expression (DGE)–based protocols of the massively parallel signature sequencing (MPSS-DGE) and the Illumina sequencing-by-synthesis (SBS-DGE) sequencing platforms. The data offer a global view of APA and how it contributes to transcriptome dynamics. Upon analysis of these data, we found that ∼60% of Arabidopsis genes have multiple poly(A) sites. Likewise, ∼47% and 82% of rice genes use APA, supported by MPSS-DGE and SBS-DGE tags, respectively. In both species, ∼49%–66% of APA events were mapped upstream of annotated stop codons. Interestingly, 10% of the transcriptomes are made up of APA transcripts that are differentially distributed among developmental stages and in tissues responding to environmental stresses, providing an additional level of transcriptome dynamics. Examples of pollen-specific APA switching and salicylic acid treatment-specific APA clearly demonstrated such dynamics. The significance of these APAs is more evident in the 3034 genes that have conserved APA events between rice and Arabidopsis. PMID:21813626

A novel X-linked disorder with developmental delay and autistic features.

PubMed

Kaya, Namik; Colak, Dilek; Albakheet, Albandary; Al-Owain, Mohammad; Abu-Dheim, Nada; Al-Younes, Banan; Al-Zahrani, Jawaher; Mukaddes, Nahit M; Dervent, Aysin; Al-Dosari, Naji; Al-Odaib, Ali; Kayaalp, Inci V; Al-Sayed, Moeenaladin; Al-Hassnan, Zuhair; Nester, Michael J; Al-Dosari, Mohammad; Al-Dhalaan, Hesham; Chedrawi, Aziza; Gunoz, Hulya; Karakas, Bedri; Sakati, Nadia; Alkuraya, Fowzan S; Gascon, Generaso G; Ozand, Pinar T

2012-04-01

Genomic duplications that lead to autism and other human diseases are interesting pathological lesions since the underlying mechanism almost certainly involves dosage sensitive genes. We aim to understand a novel genomic disorder with profound phenotypic consequences, most notably global developmental delay, autism, psychosis, and anorexia nervosa. We evaluated the affected individuals, all maternally related, using childhood autism rating scale (CARS) and Vineland Adaptive scales, magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS) brain, electroencephalography (EEG), electromyography (EMG), muscle biopsy, high-resolution molecular karyotype arrays, Giemsa banding (G-banding) and fluorescent in situ hybridization (FISH) experiments, mitochondrial DNA (mtDNA) sequencing, X-chromosome inactivation study, global gene expression analysis on Epstein-Barr virus (EBV)-transformed lymphoblasts, and quantitative reverse-transcription polymerase chain reaction (qRT-PCR). We have identified a novel Xq12-q13.3 duplication in an extended family. Clinically normal mothers were completely skewed in favor of the normal chromosome X. Global transcriptional profiling of affected individuals and controls revealed significant alterations of genes and pathways in a pattern consistent with previous microarray studies of autism spectrum disorder patients. Moreover, expression analysis revealed copy number-dependent increased messenger RNA (mRNA) levels in affected patients compared to control individuals. A subset of differentially expressed genes was validated using qRT-PCR. Xq12-q13.3 duplication is a novel global developmental delay and autism-predisposing chromosomal aberration; pathogenesis of which may be mediated by increased dosage of genes contained in the duplication, including NLGN3, OPHN1, AR, EFNB1, TAF1, GJB1, and MED12. Copyright © 2011 American Neurological Association.

Gene regulatory network architecture in different developmental contexts influences the genetic basis of morphological evolution.

PubMed

Kittelmann, Sebastian; Buffry, Alexandra D; Franke, Franziska A; Almudi, Isabel; Yoth, Marianne; Sabaris, Gonzalo; Couso, Juan Pablo; Nunes, Maria D S; Frankel, Nicolás; Gómez-Skarmeta, José Luis; Pueyo-Marques, Jose; Arif, Saad; McGregor, Alistair P

2018-05-01

Convergent phenotypic evolution is often caused by recurrent changes at particular nodes in the underlying gene regulatory networks (GRNs). The genes at such evolutionary 'hotspots' are thought to maximally affect the phenotype with minimal pleiotropic consequences. This has led to the suggestion that if a GRN is understood in sufficient detail, the path of evolution may be predictable. The repeated evolutionary loss of larval trichomes among Drosophila species is caused by the loss of shavenbaby (svb) expression. svb is also required for development of leg trichomes, but the evolutionary gain of trichomes in the 'naked valley' on T2 femurs in Drosophila melanogaster is caused by reduced microRNA-92a (miR-92a) expression rather than changes in svb. We compared the expression and function of components between the larval and leg trichome GRNs to investigate why the genetic basis of trichome pattern evolution differs in these developmental contexts. We found key differences between the two networks in both the genes employed, and in the regulation and function of common genes. These differences in the GRNs reveal why mutations in svb are unlikely to contribute to leg trichome evolution and how instead miR-92a represents the key evolutionary switch in this context. Our work shows that variability in GRNs across different developmental contexts, as well as whether a morphological feature is lost versus gained, influence the nodes at which a GRN evolves to cause morphological change. Therefore, our findings have important implications for understanding the pathways and predictability of evolution.

Dysregulation of major functional genes in frontal cortex by maternal exposure to carbon black nanoparticle is not ameliorated by ascorbic acid pretreatment.

PubMed

Onoda, Atsuto; Takeda, Ken; Umezawa, Masakazu

2018-09-01

Recent cohort studies have revealed that perinatal exposure to particulate air pollution, including carbon-based nanoparticles, increases the risk of brain disorders. Although developmental neurotoxicity is currently a major issue in the toxicology of nanoparticles, critical information for understanding the mechanisms underlying the developmental neurotoxicity of airway exposure to carbon black nanoparticle (CB-NP) is still lacking. In order to investigate these mechanisms, we comprehensively analyzed fluctuations in the gene expression profile of the frontal cortex of offspring mice exposed maternally to CB-NP, using microarray analysis combined with Gene Ontology information. We also analyzed differences in the enriched function of genes dysregulated by maternal CB-NP exposure with and without ascorbic acid pretreatment to refine specific alterations in gene expression induced by CB-NP. Total of 652 and 775 genes were dysregulated by CB-NP in the frontal cortex of 6- and 12-week-old offspring mice, respectively. Among the genes dysregulated by CB-NP, those related to extracellular matrix structural constituent, cellular response to interferon-beta, muscle organ development, and cysteine-type endopeptidase inhibitor activity were ameliorated by ascorbic acid pretreatment. A large proportion of the dysregulated genes, categorized in hemostasis, growth factor, chemotaxis, cell proliferation, blood vessel, and dopaminergic neurotransmission, were, however, not ameliorated by ascorbic acid pretreatment. The lack of effects of ascorbic acid on the dysregulation of genes following maternal CB-NP exposure suggests that the contribution of oxidative stress to the effects of CB-NP on these biological functions, i.e., cell migration and proliferation, blood vessel maintenance, and dopaminergic neuron system, may be limited. At least, ascorbic acid pretreatment is hardly likely to be able to protect the brain of offspring from developmental neurotoxicity of CB-NP. The present study provides insight into the mechanisms underlying developmental neurotoxicity following maternal nanoparticle exposure. Copyright © 2018 Elsevier B.V. All rights reserved.

Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

PubMed Central

2010-01-01

Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

Comprehensive Genomic Analysis and Expression Profiling of Phospholipase C Gene Family during Abiotic Stresses and Development in Rice

PubMed Central

Singh, Amarjeet; Kanwar, Poonam; Pandey, Amita; Tyagi, Akhilesh K.; Sopory, Sudhir K.; Kapoor, Sanjay; Pandey, Girdhar K.

2013-01-01

Background Phospholipase C (PLC) is one of the major lipid hydrolysing enzymes, implicated in lipid mediated signaling. PLCs have been found to play a significant role in abiotic stress triggered signaling and developmental processes in various plant species. Genome wide identification and expression analysis have been carried out for this gene family in Arabidopsis, yet not much has been accomplished in crop plant rice. Methodology/Principal Findings An exhaustive in-silico exploration of rice genome using various online databases and tools resulted in the identification of nine PLC encoding genes. Based on sequence, motif and phylogenetic analysis rice PLC gene family could be divided into phosphatidylinositol-specific PLCs (PI-PLCs) and phosphatidylcholine- PLCs (PC-PLC or NPC) classes with four and five members, respectively. A comparative analysis revealed that PLCs are conserved in Arabidopsis (dicots) and rice (monocot) at gene structure and protein level but they might have evolved through a separate evolutionary path. Transcript profiling using gene chip microarray and quantitative RT-PCR showed that most of the PLC members expressed significantly and differentially under abiotic stresses (salt, cold and drought) and during various developmental stages with condition/stage specific and overlapping expression. This finding suggested an important role of different rice PLC members in abiotic stress triggered signaling and plant development, which was also supported by the presence of relevant cis-regulatory elements in their promoters. Sub-cellular localization of few selected PLC members in Nicotiana benthamiana and onion epidermal cells has provided a clue about their site of action and functional behaviour. Conclusion/Significance The genome wide identification, structural and expression analysis and knowledge of sub-cellular localization of PLC gene family envisage the functional characterization of these genes in crop plants in near future. PMID:23638098

Comprehensive genomic analysis and expression profiling of phospholipase C gene family during abiotic stresses and development in rice.

PubMed

Singh, Amarjeet; Kanwar, Poonam; Pandey, Amita; Tyagi, Akhilesh K; Sopory, Sudhir K; Kapoor, Sanjay; Pandey, Girdhar K

2013-01-01

Phospholipase C (PLC) is one of the major lipid hydrolysing enzymes, implicated in lipid mediated signaling. PLCs have been found to play a significant role in abiotic stress triggered signaling and developmental processes in various plant species. Genome wide identification and expression analysis have been carried out for this gene family in Arabidopsis, yet not much has been accomplished in crop plant rice. An exhaustive in-silico exploration of rice genome using various online databases and tools resulted in the identification of nine PLC encoding genes. Based on sequence, motif and phylogenetic analysis rice PLC gene family could be divided into phosphatidylinositol-specific PLCs (PI-PLCs) and phosphatidylcholine- PLCs (PC-PLC or NPC) classes with four and five members, respectively. A comparative analysis revealed that PLCs are conserved in Arabidopsis (dicots) and rice (monocot) at gene structure and protein level but they might have evolved through a separate evolutionary path. Transcript profiling using gene chip microarray and quantitative RT-PCR showed that most of the PLC members expressed significantly and differentially under abiotic stresses (salt, cold and drought) and during various developmental stages with condition/stage specific and overlapping expression. This finding suggested an important role of different rice PLC members in abiotic stress triggered signaling and plant development, which was also supported by the presence of relevant cis-regulatory elements in their promoters. Sub-cellular localization of few selected PLC members in Nicotiana benthamiana and onion epidermal cells has provided a clue about their site of action and functional behaviour. The genome wide identification, structural and expression analysis and knowledge of sub-cellular localization of PLC gene family envisage the functional characterization of these genes in crop plants in near future.

Natural variation in gene expression in the early development of dauer larvae of Caenorhabditis elegans.

PubMed

Harvey, Simon C; Barker, Gary L A; Shorto, Alison; Viney, Mark E

2009-07-18

The free-living nematode Caenorhabditis elegans makes a developmental decision based on environmental conditions: larvae either arrest as dauer larva, or continue development into reproductive adults. There is natural variation among C. elegans lines in the sensitivity of this decision to environmental conditions; that is, there is variation in the phenotypic plasticity of dauer larva development. We hypothesised that these differences may be transcriptionally controlled in early stage larvae. We investigated this by microarray analysis of different C. elegans lines under different environmental conditions, specifically the presence and absence of dauer larva-inducing pheromone. There were substantial transcriptional differences between four C. elegans lines under the same environmental conditions. The expression of approximately 2,000 genes differed between genetically different lines, with each line showing a largely line-specific transcriptional profile. The expression of genes that are markers of larval moulting suggested that the lines may be developing at different rates. The expression of a total of 89 genes was putatively affected by dauer larva or non-dauer larva-inducing conditions. Among the upstream regions of these genes there was an over-representation of DAF-16-binding motifs. Under the same environmental conditions genetically different lines of C. elegans had substantial transcriptional differences. This variation may be due to differences in the developmental rates of the lines. Different environmental conditions had a rather smaller effect on transcription. The preponderance of DAF-16-binding motifs upstream of these genes was consistent with these genes playing a key role in the decision between development into dauer or into non-dauer larvae. There was little overlap between the genes whose expression was affected by environmental conditions and previously identified loci involved in the plasticity of dauer larva development.

Reference gene stability of a synanthropic fly, Chrysomya megacephala.

PubMed

Wang, Xiaoyun; Xiong, Mei; Wang, Jialu; Lei, Chaoliang; Zhu, Fen

2015-10-29

Stable reference genes are essential for accurate normalization in gene expression studies with reverse transcription quantitative polymerase chain reaction (qPCR). A synanthropic fly, Chrysomya megacephala, is a well known medical vector and forensic indicator. Unfortunately, previous studies did not look at the stability of reference genes used in C. megacephala. In this study, the expression level of Actin, ribosomal protein L8 (Rpl8), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor 1α (EF1), α-tubulin (α-TUB), β-tubulin (β-TUB), TATA binding box (TBP), 18S rRNA (18S) and ribosomal protein S7 (Rps7) were evaluated for their stability using online software RefFinder, which combines the normal software of the ΔCt method, BestKeeper, Normfinder, and geNorm. Moreover the number of suitable reference gene pairs was also suggested by Excel-based geNorm. The expression levels of these reference genes were evaluated under different experimental conditions with special perspectives of forensic applications: developmental stages (eggs, first, second and third instar larvae, pupae and adults); food sources of larvae (pork, fish and chicken); feeding larvae with drugs (untreated control, Estazolam and Marvelon); feeding larvae with heavy metals (untreated control, cadmium and zinc); tissues of adults (head, thorax, abdomen, legs and wings). According to RefFinder, EF1 was the most suitable reference gene of developmental stages, food and tissues; 18S and GAPDH were the most suitable reference genes for drugs and heavy metals, respectively, which could be widely used for quantification of target gene expression with qPCR in C. megacephala. Suitable reference gene pairs were also suggested by geNorm. This fundamental but vital work should facilitate the gene studies of related biological processes and deepen the understanding in physiology, toxicology, and especially medical and forensic entomology of C. megacephala.

Prochloraz and coumaphos induce different gene expression patterns in three developmental stages of the Carniolan honey bee (Apis mellifera carnica Pollmann).

PubMed

Cizelj, Ivanka; Glavan, Gordana; Božič, Janko; Oven, Irena; Mrak, Vesna; Narat, Mojca

2016-03-01

The Carniolan honey bee, Apis mellifera carnica, is a Slovenian autochthonous subspecies of honey bee. In recent years, the country has recorded an annual loss of bee colonies through mortality of up to 35%. One possible reason for such high mortality could be the exposure of honey bees to xenobiotic residues that have been found in honey bee and beehive products. Acaricides are applied by beekeepers to control varroosis, while the most abundant common agricultural chemicals found in honey bee and beehive products are fungicides, which may enter the system when applied to nearby flowering crops and fruit plants. Acaricides and fungicides are not intrinsically highly toxic to bees but their action in combination might lead to higher honey bee sensitivity or mortality. In the present study we investigated the molecular immune response of honey bee workers at different developmental stages (prepupa, white-eyed pupa, adult) exposed to the acaricide coumaphos and the fungicide prochloraz individually and in combination. Expression of 17 immune-related genes was examined by quantitative RT-PCR. In treated prepupae downregulation of most immune-related genes was observed in all treatments, while in adults upregulation of most of the genes was recorded. Our study shows for the first time that negative impacts of prochloraz and a combination of coumaphos and prochloraz differ among the different developmental stages of honey bees. The main effect of the xenobiotic combination was found to be upregulation of the antimicrobial peptide genes abaecin and defensin-1 in adult honey bees. Changes in immune-related gene expression could result in depressed immunity of honey bees and their increased susceptibility to various pathogens. Copyright © 2015 Elsevier Inc. All rights reserved.

Pleiotropy in the wild: the dormancy gene DOG1 exerts cascading control on life cycles.

PubMed

Chiang, George C K; Barua, Deepak; Dittmar, Emily; Kramer, Elena M; de Casas, Rafael Rubio; Donohue, Kathleen

2013-03-01

In the wild, organismal life cycles occur within seasonal cycles, so shifts in the timing of developmental transitions can alter the seasonal environment experienced subsequently. Effects of genes that control the timing of prior developmental events can therefore be magnified in the wild because they determine seasonal conditions experienced by subsequent life stages, which can influence subsequent phenotypic expression. We examined such environmentally induced pleiotropy of developmental-timing genes in a field experiment with Arabidopsis thaliana. When studied in the field under natural seasonal variation, an A. thaliana seed-dormancy gene, Delay Of Germination 1 (DOG1), was found to influence not only germination, but also flowering time, overall life history, and fitness. Flowering time of the previous generation, in turn, imposed maternal effects that altered germination, the effects of DOG1 alleles, and the direction of natural selection on these alleles. Thus under natural conditions, germination genes act as flowering genes and potentially vice versa. These results illustrate how seasonal environmental variation can alter pleiotropic effects of developmental-timing genes, such that effects of genes that regulate prior life stages ramify to influence subsequent life stages. In this case, one gene acting at the seed stage impacted the entire life cycle. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

PubMed

Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

2012-06-01

In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

The chromatin remodeling factor CHD7 controls cerebellar development by regulating reelin expression

PubMed Central

Whittaker, Danielle E.; Riegman, Kimberley L.H.; Kasah, Sahrunizam; Mohan, Conor; Yu, Tian; Sala, Blanca Pijuan; Hebaishi, Husam; Caruso, Angela; Marques, Ana Claudia; Michetti, Caterina; Smachetti, María Eugenia Sanz; Shah, Apar; Sabbioni, Mara; Kulhanci, Omer; Tee, Wee-Wei; Reinberg, Danny; Scattoni, Maria Luisa; McGonnell, Imelda; Wardle, Fiona C.; Fernandes, Cathy

2017-01-01

The mechanisms underlying the neurodevelopmental deficits associated with CHARGE syndrome, which include cerebellar hypoplasia, developmental delay, coordination problems, and autistic features, have not been identified. CHARGE syndrome has been associated with mutations in the gene encoding the ATP-dependent chromatin remodeler CHD7. CHD7 is expressed in neural stem and progenitor cells, but its role in neurogenesis during brain development remains unknown. Here we have shown that deletion of Chd7 from cerebellar granule cell progenitors (GCps) results in reduced GCp proliferation, cerebellar hypoplasia, developmental delay, and motor deficits in mice. Genome-wide expression profiling revealed downregulated expression of the gene encoding the glycoprotein reelin (Reln) in Chd7-deficient GCps. Recessive RELN mutations have been associated with severe cerebellar hypoplasia in humans. We found molecular and genetic evidence that reductions in Reln expression contribute to GCp proliferative defects and cerebellar hypoplasia in GCp-specific Chd7 mouse mutants. Finally, we showed that CHD7 is necessary for maintaining an open, accessible chromatin state at the Reln locus. Taken together, this study shows that Reln gene expression is regulated by chromatin remodeling, identifies CHD7 as a previously unrecognized upstream regulator of Reln, and provides direct in vivo evidence that a mammalian CHD protein can control brain development by modulating chromatin accessibility in neuronal progenitors. PMID:28165338

An ancient dental gene set governs development and continuous regeneration of teeth in sharks.

PubMed

Rasch, Liam J; Martin, Kyle J; Cooper, Rory L; Metscher, Brian D; Underwood, Charlie J; Fraser, Gareth J

2016-07-15

The evolution of oral teeth is considered a major contributor to the overall success of jawed vertebrates. This is especially apparent in cartilaginous fishes including sharks and rays, which develop elaborate arrays of highly specialized teeth, organized in rows and retain the capacity for life-long regeneration. Perpetual regeneration of oral teeth has been either lost or highly reduced in many other lineages including important developmental model species, so cartilaginous fishes are uniquely suited for deep comparative analyses of tooth development and regeneration. Additionally, sharks and rays can offer crucial insights into the characters of the dentition in the ancestor of all jawed vertebrates. Despite this, tooth development and regeneration in chondrichthyans is poorly understood and remains virtually uncharacterized from a developmental genetic standpoint. Using the emerging chondrichthyan model, the catshark (Scyliorhinus spp.), we characterized the expression of genes homologous to those known to be expressed during stages of early dental competence, tooth initiation, morphogenesis, and regeneration in bony vertebrates. We have found that expression patterns of several genes from Hh, Wnt/β-catenin, Bmp and Fgf signalling pathways indicate deep conservation over ~450 million years of tooth development and regeneration. We describe how these genes participate in the initial emergence of the shark dentition and how they are redeployed during regeneration of successive tooth generations. We suggest that at the dawn of the vertebrate lineage, teeth (i) were most likely continuously regenerative structures, and (ii) utilised a core set of genes from members of key developmental signalling pathways that were instrumental in creating a dental legacy redeployed throughout vertebrate evolution. These data lay the foundation for further experimental investigations utilizing the unique regenerative capacity of chondrichthyan models to answer evolutionary, developmental, and regenerative biological questions that are impossible to explore in classical models. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Molecular networks and the evolution of human cognitive specializations.

PubMed

Fontenot, Miles; Konopka, Genevieve

2014-12-01

Inroads into elucidating the origins of human cognitive specializations have taken many forms, including genetic, genomic, anatomical, and behavioral assays that typically compare humans to non-human primates. While the integration of all of these approaches is essential for ultimately understanding human cognition, here, we review the usefulness of coexpression network analysis for specifically addressing this question. An increasing number of studies have incorporated coexpression networks into brain expression studies comparing species, disease versus control tissue, brain regions, or developmental time periods. A clearer picture has emerged of the key genes driving brain evolution, as well as the developmental and regional contributions of gene expression patterns important for normal brain development and those misregulated in cognitive diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

PubMed

Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

2016-01-01

An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also report on splice variants for two Mnemiopsis Dmrt genes that impact the presence and composition of the DM DNA binding domain for these transcription factors. Our results are consistent with a potential role for vasa, piwi and nanos genes in the specification or maintenance of somatic stem cell populations during development in Mnemiopsis. These results are similar to previous results in the tentaculate ctenophore Pleurobrachia, with the exception that these genes were also expressed in gonads and developing gametes of adult Pleurobrachia. These differences suggest that the Mnemiopsis germline is either specified later in development than hypothesized, the germline undergoes extensive migration, or the germline does not express these classic molecular markers. Our results highlight the utility of comparing expression of orthologous genes across multiple species. We provide the first description of Dmrt expression in a ctenophore, which indicates that Dmrt genes are expressed in distinct structures and regions during development but not in future gametogenic regions, the only sex-specific structure for this hermaphroditic species.

Selection and Evaluation of Potential Reference Genes for Gene Expression Analysis in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Using Reverse-Transcription Quantitative PCR

PubMed Central

Zhu, Xun; Wan, Hu; Shakeel, Muhammad; Zhan, Sha; Jin, Byung-Rae; Li, Jianhong

2014-01-01

The brown planthopper (BPH), Nilaparvata lugens (Hemiptera, Delphacidae), is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR). Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT), muscle actin (MACT), ribosomal protein S11 (RPS11), ribosomal protein S15e (RPS15), alpha 2-tubulin (TUB), elongation factor 1 delta (EF), 18S ribosomal RNA (18S), and arginine kinase (AK) and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method) to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation) following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments) guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for expression studies of related insects. PMID:24466124

Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) using reverse-transcription quantitative PCR.

PubMed

Yuan, Miao; Lu, Yanhui; Zhu, Xun; Wan, Hu; Shakeel, Muhammad; Zhan, Sha; Jin, Byung-Rae; Li, Jianhong

2014-01-01

The brown planthopper (BPH), Nilaparvata lugens (Hemiptera, Delphacidae), is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR). Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT), muscle actin (MACT), ribosomal protein S11 (RPS11), ribosomal protein S15e (RPS15), alpha 2-tubulin (TUB), elongation factor 1 delta (EF), 18S ribosomal RNA (18S), and arginine kinase (AK) and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method) to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation) following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments) guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for expression studies of related insects.

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

Oxytocin, vasopressin, and autism: is there a connection?

PubMed

Insel, T R; O'Brien, D J; Leckman, J F

1999-01-15

Autism is a poorly understood developmental disorder characterized by social impairment, communication deficits, and compulsive behavior. The authors review evidence from animal studies demonstrating that the nonapeptides, oxytocin and vasopressin, have unique effects on the normal expression of species-typical social behavior, communication, and rituals. Based on this evidence, they hypothesize that an abnormality in oxytocin or vasopressin neurotransmission may account for several features of autism. As autism appears to be a genetic disorder, mutations in the various peptide, peptide receptor, or lineage-specific developmental genes could lead to altered oxytocin or vasopressin neurotransmission. Many of these genes have been cloned and sequenced, and several polymorphisms have been identified. Recent gene targeting studies that alter expression of either the peptides or their receptors in the rodent brain partially support the autism hypothesis. While previous experience suggests caution in hypothesizing a cause or suggesting a treatment for autism, the available preclinical evidence with oxytocin and vasopressin recommends the need for clinical studies using gene scanning, pharmacological and neurobiological approaches.

Comprehensive transcriptional map of primate brain development

PubMed Central

Bakken, Trygve E.; Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A.; Ng, Lydia; Szafer, Aaron; Dalley, Rachel A.; Royall, Joshua J.; Lemon, Tracy; Shapouri, Sheila; Aiona, Kaylynn; Arnold, James; Bennett, Jeffrey L.; Bertagnolli, Darren; Bickley, Kristopher; Boe, Andrew; Brouner, Krissy; Butler, Stephanie; Byrnes, Emi; Caldejon, Shiella; Carey, Anita; Cate, Shelby; Chapin, Mike; Chen, Jefferey; Dee, Nick; Desta, Tsega; Dolbeare, Tim A.; Dotson, Nadia; Ebbert, Amanda; Fulfs, Erich; Gee, Garrett; Gilbert, Terri L.; Goldy, Jeff; Gourley, Lindsey; Gregor, Ben; Gu, Guangyu; Hall, Jon; Haradon, Zeb; Haynor, David R.; Hejazinia, Nika; Hoerder-Suabedissen, Anna; Howard, Robert; Jochim, Jay; Kinnunen, Marty; Kriedberg, Ali; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Luong, Lon; Mastan, Naveed; May, Ryan; Melchor, Jose; Mosqueda, Nerick; Mott, Erika; Ngo, Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana; Pendergraft, Julie; Potekhina, Lydia; Reding, Melissa; Riley, Zackery L.; Roberts, Tyson; Rogers, Brandon; Roll, Kate; Rosen, David; Sandman, David; Sarreal, Melaine; Shapovalova, Nadiya; Shi, Shu; Sjoquist, Nathan; Sodt, Andy J.; Townsend, Robbie; Velasquez, Lissette; Wagley, Udi; Wakeman, Wayne B.; White, Cassandra; Bennett, Crissa; Wu, Jennifer; Young, Rob; Youngstrom, Brian L.; Wohnoutka, Paul; Gibbs, Richard A.; Rogers, Jeffrey; Hohmann, John G.; Hawrylycz, Michael J.; Hevner, Robert F.; Molnár, Zoltán; Phillips, John W.; Dang, Chinh; Jones, Allan R.; Amaral, David G.; Bernard, Amy; Lein, Ed S.

2017-01-01

The transcriptional underpinnings of brain development remain poorly understood, particularly in humans and closely related non-human primates. We describe a high resolution transcriptional atlas of rhesus monkey brain development that combines dense temporal sampling of prenatal and postnatal periods with fine anatomical parcellation of cortical and subcortical regions associated with human neuropsychiatric disease. Gene expression changes more rapidly before birth, both in progenitor cells and maturing neurons, and cortical layers and areas acquire adult-like molecular profiles surprisingly late postnatally. Disparate cell populations exhibit distinct developmental timing but also unexpected synchrony of processes underlying neural circuit construction including cell projection and adhesion. Candidate risk genes for neurodevelopmental disorders including primary microcephaly, autism spectrum disorder, intellectual disability, and schizophrenia show disease-specific spatiotemporal enrichment within developing neocortex. Human developmental expression trajectories are more similar to monkey than rodent, and approximately 9% of genes show human-specific regulation with evidence for prolonged maturation or neoteny. PMID:27409810

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Visualization of Notch signaling oscillation in cells and tissues.

PubMed

Shimojo, Hiromi; Harima, Yukiko; Kageyama, Ryoichiro

2014-01-01

The Notch signaling effectors Hes1 and Hes7 exhibit oscillatory expression with a period of about 2-3 h during embryogenesis. Hes1 oscillation is important for proliferation and differentiation of neural stem cells, whereas Hes7 oscillation regulates periodic formation of somites. Continuous expression of Hes1 and Hes7 inhibits these developmental processes. Thus, expression dynamics are very important for gene functions, but it is difficult to distinguish between oscillatory and persistent expression by conventional methods such as in situ hybridization and immunostaining. Here, we describe time-lapse imaging methods using destabilized luciferase reporters and a highly sensitive cooled charge-coupled device camera, which can monitor dynamic gene expression. Furthermore, the expression of two genes can be examined simultaneously by a dual reporter system using two-color luciferase reporters. Time-lapse imaging analyses reveal how dynamically gene expression changes in many biological events.

Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2

NASA Technical Reports Server (NTRS)

Johnson, K. A.; Sistrunk, M. L.; Polisensky, D. H.; Braam, J.; McIntire, L. V. (Principal Investigator)

1998-01-01

Plants exposed to repetitive touch or wind are generally shorter and stockier than sheltered plants. These mechanostimulus-induced developmental changes are termed thigmomorphogenesis and may confer resistance to subsequent stresses. An early response of Arabidopsis thaliana to touch or wind is the up-regulation of TCH (touch) gene expression. The signal transduction pathway that leads to mechanostimulus responses is not well defined. A role for ethylene has been proposed based on the observation that mechanostimulation of plants leads to ethylene evolution and exogenous ethylene leads to thigmomorphogenetic-like changes. To determine whether ethylene has a role in plant responses to mechanostimulation, we assessed the ability of two ethylene-insensitive mutants, etr1-3 and ein2-1, to undergo thigmomorphogenesis and TCH gene up-regulation of expression. The ethylene-insensitive mutants responded to wind similarly to the wild type, with a delay in flowering, decrease in inflorescence elongation rate, shorter mature primary inflorescences, more rosette paraclades, and appropriate TCH gene expression changes. Also, wild-type and mutant Arabidopsis responded to vibrational stimulation, with an increase in hypocotyl elongation and up-regulation of TCH gene expression. We conclude that the ETR1 and EIN2 protein functions are not required for the developmental and molecular responses to mechanical stimulation.

A Rosa canina WUSCHEL-related homeobox gene, RcWOX1, is involved in auxin-induced rhizoid formation.

PubMed

Gao, Bin; Wen, Chao; Fan, Lusheng; Kou, Yaping; Ma, Nan; Zhao, Liangjun

2014-12-01

Homeobox (HB) proteins are important transcription factors that regulate the developmental decisions of eukaryotes. WUSCHEL-related homeobox (WOX) transcription factors, known as a plant-specific HB family, play a key role in plant developmental processes. Our previous work has indicated that rhizoids are induced by auxin in rose (Rosa spp.), which acts as critical part of an efficient plant regeneration system. However, the function of WOX genes in auxin-induced rhizoid formation remains unclear. Here, we isolated and characterized a WUSCHEL-related homeobox gene from Rosa canina, RcWOX1, containing a typical homeodomain with 65 amino acid residues. Real-time reverse transcription PCR (qRT-PCR) analysis revealed that RcWOX1 was expressed in the whole process of callus formation and in the early stage of rhizoid formation. Moreover, its expression was induced by auxin treatment. In Arabidopsis transgenic lines expressing the RcWOX1pro::GUS and 35S::GFP-RcWOX1, RcWOX1 was specifically expressed in roots and localized to the nucleus. Overexpression of RcWOX1 in Arabidopsis increased lateral root density and induced upregulation of PIN1 and PIN7 genes. Therefore, we postulated that RcWOX1 is a functional transcription factor that plays an essential role in auxin-induced rhizoid formation.

Step-by-Step Construction of Gene Co-expression Networks from High-Throughput Arabidopsis RNA Sequencing Data.

PubMed

Contreras-López, Orlando; Moyano, Tomás C; Soto, Daniela C; Gutiérrez, Rodrigo A

2018-01-01

The rapid increase in the availability of transcriptomics data generated by RNA sequencing represents both a challenge and an opportunity for biologists without bioinformatics training. The challenge is handling, integrating, and interpreting these data sets. The opportunity is to use this information to generate testable hypothesis to understand molecular mechanisms controlling gene expression and biological processes (Fig. 1). A successful strategy to generate tractable hypotheses from transcriptomics data has been to build undirected network graphs based on patterns of gene co-expression. Many examples of new hypothesis derived from network analyses can be found in the literature, spanning different organisms including plants and specific fields such as root developmental biology.In order to make the process of constructing a gene co-expression network more accessible to biologists, here we provide step-by-step instructions using published RNA-seq experimental data obtained from a public database. Similar strategies have been used in previous studies to advance root developmental biology. This guide includes basic instructions for the operation of widely used open source platforms such as Bio-Linux, R, and Cytoscape. Even though the data we used in this example was obtained from Arabidopsis thaliana, the workflow developed in this guide can be easily adapted to work with RNA-seq data from any organism.

Shox2-deficiency leads to dysplasia and ankylosis of the temporomandibular joint in Mice

PubMed Central

Gu, Shuping; Wei, Na; Yu, Ling; Fei, Jian; Chen, YiPing

2010-01-01

The temporomandibular joint (TMJ) is a unique synovial joint whose development differs from the formation of other synovial joints. Mutations have been associated with the developmental defects of the TMJ only in a few genes. In this study, we report the expression of the homeobox gene Shox2 in the cranial neural crest derived mesenchymal cells of the maxilla-mandibular junction and later in the progenitor cells and undifferentiated chondrocytes of the condyle as well as the glenoid fossa of the developing TMJ. A conditional inactivation of Shox2 in the cranial neural crest-derived cells causes developmental abnormalities in the TMJ, including dysplasia of the condyle and glenoid fossa. The articulating disc forms but fuses with the fibrous layers of the condyle and glenoid fossa, clinically known as TMJ ankylosis. Histological examination indicates a delay in development in the mutant TMJ, accompanied by a significantly reduced rate of cell proliferation. In situ hybridization further demonstrates an altered expression of several key osteogenic genes and a delayed expression of the osteogenic differentiation markers. Shox2 appears to regulate the expression of osteogenic genes and is essential for the development and function of the TMJ. The Shox2 conditional mutant thus provides a unique animal model of TMJ ankylosis. PMID:18514492

Developmental switching in Physarum polycephalum: Petri net analysis of single cell trajectories of gene expression indicates responsiveness and genetic plasticity of the Waddington quasipotential landscape

NASA Astrophysics Data System (ADS)

Werthmann, Britta; Marwan, Wolfgang

2017-11-01

The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape.

Contribution of G protein-coupled estrogen receptor 1 (GPER) to 17β-estradiol-induced developmental toxicity in zebrafish.

PubMed

Diamante, Graciel; Menjivar-Cervantes, Norma; Leung, Man Sin; Volz, David C; Schlenk, Daniel

2017-05-01

Exposure to 17β-estradiol (E2) influences the regulation of multiple signaling pathways, and E2-mediated disruption of signaling events during early development can lead to malformations such as cardiac defects. In this study, we investigated the potential role of the G-protein estrogen receptor 1 (GPER) in E2-induced developmental toxicity. Zebrafish embryos were exposed to E2 from 2h post fertilization (hpf) to 76 hpf with subsequent transcriptional measurements of heart and neural crest derivatives expressed 2 (hand2), leucine rich repeat containing 10 (lrrc10), and gper at 12, 28 and 76 hpf. Alteration in the expression of lrrc10, hand2 and gper was observed at 12 hpf and 76 hpf, but not at 28 hpf. Expression of these genes was also altered after exposure to G1 (a GPER agonist) at 76 hpf. Expression of lrrc10, hand2 and gper all coincided with the formation of cardiac edema at 76 hpf as well as other developmental abnormalities. While co-exposure of G1 with G36 (a GPER antagonist) rescued G1-induced abnormalities and altered gene expression, co-exposure of E2 with G36, or ICI 182,780 (an estrogen receptor antagonist) did not rescue E2-induced cardiac deformities or gene expression. In addition, no effects on the concentrations of downstream ER and GPER signaling molecules (cAMP or calcium) were observed in embryo homogenates after E2 treatment. These data suggest that the impacts of E2 on embryonic development at this stage are complex and may involve multiple receptor and/or signaling pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

High-resolution gene expression data from blastoderm embryos of the scuttle fly Megaselia abdita

PubMed Central

Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Cicin-Sain, Damjan; Jaeger, Johannes

2015-01-01

Gap genes are involved in segment determination during early development in dipteran insects (flies, midges, and mosquitoes). We carried out a systematic quantitative comparative analysis of the gap gene network across different dipteran species. Our work provides mechanistic insights into the evolution of this pattern-forming network. As a central component of our project, we created a high-resolution quantitative spatio-temporal data set of gap and maternal co-ordinate gene expression in the blastoderm embryo of the non-drosophilid scuttle fly, Megaselia abdita. Our data include expression patterns in both wild-type and RNAi-treated embryos. The data—covering 10 genes, 10 time points, and over 1,000 individual embryos—consist of original embryo images, quantified expression profiles, extracted positions of expression boundaries, and integrated expression patterns, plus metadata and intermediate processing steps. These data provide a valuable resource for researchers interested in the comparative study of gene regulatory networks and pattern formation, an essential step towards a more quantitative and mechanistic understanding of developmental evolution. PMID:25977812

Modeling Glaucoma: Retinal Ganglion Cells Generated from Induced Pluripotent Stem Cells of Patients with SIX6 Risk Allele Show Developmental Abnormalities.

PubMed

Teotia, Pooja; Van Hook, Matthew J; Wichman, Christopher S; Allingham, R Rand; Hauser, Michael A; Ahmad, Iqbal

2017-11-01

Glaucoma represents a group of multifactorial diseases with a unifying pathology of progressive retinal ganglion cell (RGC) degeneration, causing irreversible vision loss. To test the hypothesis that RGCs are intrinsically vulnerable in glaucoma, we have developed an in vitro model using the SIX6 risk allele carrying glaucoma patient-specific induced pluripotent stem cells (iPSCs) for generating functional RGCs. Here, we demonstrate that the efficiency of RGC generation by SIX6 risk allele iPSCs is significantly lower than iPSCs-derived from healthy, age- and sex-matched controls. The decrease in the number of RGC generation is accompanied by repressed developmental expression of RGC regulatory genes. The SIX6 risk allele RGCs display short and simple neurites, reduced expression of guidance molecules, and immature electrophysiological signature. In addition, these cells have higher expression of glaucoma-associated genes, CDKN2A and CDKN2B, suggesting an early onset of the disease phenotype. Consistent with the developmental abnormalities, the SIX6 risk allele RGCs display global dysregulation of genes which map on developmentally relevant biological processes for RGC differentiation and signaling pathways such as mammalian target of rapamycin that integrate diverse functions for differentiation, metabolism, and survival. The results suggest that SIX6 influences different stages of RGC differentiation and their survival; therefore, alteration in SIX6 function due to the risk allele may lead to cellular and molecular abnormalities. These abnormalities, if carried into adulthood, may make RGCs vulnerable in glaucoma. Stem Cells 2017;35:2239-2252. © 2017 AlphaMed Press.

Molecular dissection of transcriptional reprogramming of steviol glycosides synthesis in leaf tissue during developmental phase transitions in Stevia rebaudiana Bert.

PubMed

Singh, Gopal; Singh, Gagandeep; Singh, Pradeep; Parmar, Rajni; Paul, Navgeet; Vashist, Radhika; Swarnkar, Mohit Kumar; Kumar, Ashok; Singh, Sanatsujat; Singh, Anil Kumar; Kumar, Sanjay; Sharma, Ram Kumar

2017-09-19

Stevia is a natural source of commercially important steviol glycosides (SGs), which share biosynthesis route with gibberellic acids (GAs) through plastidal MEP and cytosolic MVA pathways. Ontogeny-dependent deviation in SGs biosynthesis is one of the key factor for global cultivation of Stevia, has not been studied at transcriptional level. To dissect underlying molecular mechanism, we followed a global transcriptome sequencing approach and generated more than 100 million reads. Annotation of 41,262 de novo assembled transcripts identified all the genes required for SGs and GAs biosynthesis. Differential gene expression and quantitative analysis of important pathway genes (DXS, HMGR, KA13H) and gene regulators (WRKY, MYB, NAC TFs) indicated developmental phase dependent utilization of metabolic flux between SGs and GAs synthesis. Further, identification of 124 CYPs and 45 UGTs enrich the genomic resources, and their PPI network analysis with SGs/GAs biosynthesis proteins identifies putative candidates involved in metabolic changes, as supported by their developmental phase-dependent expression. These putative targets can expedite molecular breeding and genetic engineering efforts to enhance SGs content, biomass and yield. Futuristically, the generated dataset will be a useful resource for development of functional molecular markers for diversity characterization, genome mapping and evolutionary studies in Stevia.

Lasting Effects on Body Weight and Mammary Gland Gene Expression in Female Mice upon Early Life Exposure to n-3 but Not n-6 High-Fat Diets

EPA Science Inventory

Exposure to an imbalance of nutrients prior to conception and during critical developmental periods can have lasting consequences on physiological processes resulting in chronic diseases later in life. Developmental programming has been shown to involve structural and functional ...

Differential expression of genes in fetal brain as a consequence of maternal protein deficiency and nematode infection.

PubMed

Haque, Manjurul; Starr, Lisa M; Koski, Kristine G; Scott, Marilyn E

2018-01-01

Maternal dietary protein deficiency and gastrointestinal nematode infection during early pregnancy have negative impacts on both maternal placental gene expression and fetal growth in the mouse. Here we used next-generation RNA sequencing to test our hypothesis that maternal protein deficiency and/or nematode infection also alter the expression of genes in the developing fetal brain. Outbred pregnant CD1 mice were used in a 2×2 design with two levels of dietary protein (24% versus 6%) and two levels of infection (repeated sham versus Heligmosomoides bakeri beginning at gestation day 5). Pregnant dams were euthanized on gestation day 18 to harvest the whole fetal brain. Four fetal brains from each treatment group were analyzed using RNA Hi-Seq sequencing and the differential expression of genes was determined by the edgeR package using NetworkAnalyst. In response to maternal H. bakeri infection, 96 genes (88 up-regulated and eight down-regulated) were differentially expressed in the fetal brain. Differentially expressed genes were involved in metabolic processes, developmental processes and the immune system according to the PANTHER classification system. Among the important biological functions identified, several up-regulated genes have known neurological functions including neuro-development (Gdf15, Ing4), neural differentiation (miRNA let-7), synaptic plasticity (via suppression of NF-κβ), neuro-inflammation (S100A8, S100A9) and glucose metabolism (Tnnt1, Atf3). However, in response to maternal protein deficiency, brain-specific serine protease (Prss22) was the only up-regulated gene and only one gene (Dynlt1a) responded to the interaction of maternal nematode infection and protein deficiency. In conclusion, maternal exposure to GI nematode infection from day 5 to 18 of pregnancy may influence developmental programming of the fetal brain. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Identification, expression and phylogenetic analysis of EgG1Y162 from Echinococcus granulosus.

PubMed

Zhang, Fengbo; Ma, Xiumin; Zhu, Yuejie; Wang, Hongying; Liu, Xianfei; Zhu, Min; Ma, Haimei; Wen, Hao; Fan, Haining; Ding, Jianbing

2014-01-01

This study was to clone, identify and analyze the characteristics of egG1Y162 gene from Echinococcus granulosus. Genomic DNA and total RNAs were extracted from four different developmental stages of protoscolex, germinal layer, adult and egg of Echinococcus granulosus, respectively. Fluorescent quantitative PCR was used for analyzing the expression of egG1Y162 gene. Prokaryotic expression plasmid of pET41a-EgG1Y162 was constructed to express recombinant His-EgG1Y162 antigen. Western blot analysis was performed to detect antigenicity of EgG1Y162 antigen. Gene sequence, amino acid alignment and phylogenetic tree of EgG1Y162 were analyzed by BLAST, online Spidey and MEGA4 software, respectively. EgG1Y162 gene was expressed in four developmental stages of Echinococcus granulosus. And, egG1Y162 gene expression was the highest in the adult stage, with the relative value of 19.526, significantly higher than other three stages. Additionally, Western blot analysis revealed that EgG1Y162 recombinant protein had good reaction with serum samples from Echinococcus granulosus infected human and dog. Moreover, EgG1Y162 antigen was phylogenetically closest to EmY162 antigen, with the similarity over 90%. Our study identified EgG1Y162 antigen in Echinococcus granulosus for the first time. EgG1Y162 antigen had a high similarity with EmY162 antigen, with the genetic differences mainly existing in the intron region. And, EgG1Y162 recombinant protein showed good antigenicity.

Plasticity for axolotl lens regeneration is associated with age‐related changes in gene expression

PubMed Central

Sousounis, Konstantinos; Athippozhy, Antony T.; Voss, S. Randal

2014-01-01

Abstract Mexican axolotls lose potential for lens regeneration 2 weeks after hatching. We used microarrays to identify differently expressed genes before and after this critical time, using RNA isolated from iris. Over 3700 genes were identified as differentially expressed in response to lentectomy between young (7 days post‐hatching) and old (3 months post‐hatching) axolotl larvae. Strikingly, many of the genes were only expressed in the early or late iris. Genes that were highly expressed in young iris significantly enriched electron transport chain, transcription, metabolism, and cell cycle gene ontologies, all of which are associated with lens regeneration. In contrast, genes associated with cellular differentiation and tissue maturation were uniquely expressed in old iris. Many of these expression differences strongly suggest that young and old iris samples were collected before and after the spleen became developmentally competent to produce and secrete cells with humoral and innate immunity functions. Our study establishes the axolotl as a powerful model to investigate age‐related cellular differentiation and immune system ontogeny within the context of tissue regeneration. PMID:27499863

Validating internal controls for quantitative plant gene expression studies.

PubMed

Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

2004-08-18

Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.

Control of early seed development.

PubMed

Chaudhury, A M; Koltunow, A; Payne, T; Luo, M; Tucker, M R; Dennis, E S; Peacock, W J

2001-01-01

Seed development requires coordinated expression of embryo and endosperm and has contributions from both sporophytic and male and female gametophytic genes. Genetic and molecular analyses in recent years have started to illuminate how products of these multiple genes interact to initiate seed development. Imprinting or differential expression of paternal and maternal genes seems to be involved in controlling seed development, presumably by controlling gene expression in developing endosperm. Epigenetic processes such as chromatin remodeling and DNA methylation affect imprinting of key seed-specific genes; however, the identity of many of these genes remains unknown. The discovery of FIS genes has illuminated control of autonomous endosperm development, a component of apomixis, which is an important developmental and agronomic trait. FIS genes are targets of imprinting, and the genes they control in developing endosperm are also regulated by DNA methylation and chromatin remodeling genes. These results define some exciting future areas of research in seed development.

X chromosome regulation: diverse patterns in development, tissues and disease

PubMed Central

Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.

2014-01-01

Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023

Essential role of grim-led programmed cell death for the establishment of corazonin-producing peptidergic nervous system during embryogenesis and metamorphosis in Drosophila melanogaster.

PubMed

Lee, Gyunghee; Sehgal, Ritika; Wang, Zixing; Nair, Sudershana; Kikuno, Keiko; Chen, Chun-Hong; Hay, Bruce; Park, Jae H

2013-03-15

In Drosophila melanogaster, combinatorial activities of four death genes, head involution defective (hid), reaper (rpr), grim, and sickle (skl), have been known to play crucial roles in the developmentally regulated programmed cell death (PCD) of various tissues. However, different expression patterns of the death genes also suggest distinct functions played by each. During early metamorphosis, a great number of larval neurons unfit for adult life style are removed by PCD. Among them are eight pairs of corazonin-expressing larval peptidergic neurons in the ventral nerve cord (vCrz). To reveal death genes responsible for the PCD of vCrz neurons, we examined extant and recently available mutations as well as RNA interference that disrupt functions of single or multiple death genes. We found grim as a chief proapoptotic gene and skl and rpr as minor ones. The function of grim is also required for PCD of the mitotic sibling cells of the vCrz neuronal precursors (EW3-sib) during embryonic neurogenesis. An intergenic region between grim and rpr, which, it has been suggested, may enhance expression of three death genes in embryonic neuroblasts, appears to play a role for the vCrz PCD, but not for the EW3-sib cell death. The death of vCrz neurons and EW3-sib is triggered by ecdysone and the Notch signaling pathway, respectively, suggesting distinct regulatory mechanisms of grim expression in a cell- and developmental stage-specific manner.

A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus

Treesearch

Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover

2015-01-01

Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...

Weighted gene co-expression network analysis reveals potential genes involved in early metamorphosis process in sea cucumber Apostichopus japonicus.

PubMed

Li, Yongxin; Kikuchi, Mani; Li, Xueyan; Gao, Qionghua; Xiong, Zijun; Ren, Yandong; Zhao, Ruoping; Mao, Bingyu; Kondo, Mariko; Irie, Naoki; Wang, Wen

2018-01-01

Sea cucumbers, one main class of Echinoderms, have a very fast and drastic metamorphosis process during their development. However, the molecular basis under this process remains largely unknown. Here we systematically examined the gene expression profiles of Japanese common sea cucumber (Apostichopus japonicus) for the first time by RNA sequencing across 16 developmental time points from fertilized egg to juvenile stage. Based on the weighted gene co-expression network analysis (WGCNA), we identified 21 modules. Among them, MEdarkmagenta was highly expressed and correlated with the early metamorphosis process from late auricularia to doliolaria larva. Furthermore, gene enrichment and differentially expressed gene analysis identified several genes in the module that may play key roles in the metamorphosis process. Our results not only provide a molecular basis for experimentally studying the development and morphological complexity of sea cucumber, but also lay a foundation for improving its emergence rate. Copyright © 2017 Elsevier Inc. All rights reserved.

Regulation of melanin biosynthesis via the dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete Sordaria macrospora.

PubMed

Engh, Ines; Nowrousian, Minou; Kück, Ulrich

2007-10-01

The filamentous ascomycete Sordaria macrospora accumulates melanin during sexual development. The four melanin biosynthesis genes pks, teh, sdh and tih were isolated and their homology to genes involved in 1,8 dihydroxynaphthalene (DHN) melanin biosynthesis was shown. The presence of DHN melanin in S. macrospora was further confirmed by disrupting the pks gene encoding a putative polyketide synthase and by RNA interference-mediated silencing of the sdh gene encoding a putative scytalone dehydratase. Because melanin occurs in fruiting bodies that develop through several intermediate stages within 7 days of growth, a Northern analysis of a developmental time-course was conducted. These data revealed a time-dependent regulation of teh and sdh transcript levels. Comparing the transcriptional expression by real-time PCR of melanin biosynthesis genes in the wild type under conditions allowing or repressing sexual development, a significant downregulation during vegetative growth was detected. Quantitative real-time PCR and Northern blot analysis of melanin biosynthesis gene expression in different developmental mutants confirmed that melanin biosynthesis is linked to fruiting body development and is under the control of specific regulatory genes that participate in sexual differentiation.

Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

PubMed Central

Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

2014-01-01

Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

Hox genes and the parasitic flatworms: new opportunities, challenges and lessons from the free-living.

PubMed

Olson, P D

2008-03-01

Research into the roles played by Hox and related homeotic gene families in the diverse and complex developmental programmes exhibited by parasitic flatworms (Platyhelminthes) can hardly be said to have begun, and thus presents considerable opportunity for new research. Although featured in some of the earliest screens for homeotic genes outside Drosophila and mice, surveys in parasitic flatworms are few in number and almost nothing is yet known of where or when the genes are expressed during ontogeny. This contrasts sharply with a significant body of literature concerning Hox genes in free-living flatworms which have long served as models for the study of regeneration and the maintenance of omnipotent cell lines. Nevertheless, available information suggests that the complement of Hox genes and other classes of homeobox-containing genes in parasitic flatworms is typical of their free-living cousins and of other members of the Lophotrochozoa. Recent work on Schistosoma combined with information on Hox gene expression in planarians indicates that at least some disruption of the clustered genomic arrangement of the genes, as well as of the strict spatial and temporal colinear patterns of expression typical in other groups, may be characteristic of flatworms. However, available data on the genomic arrangement and expression of flatworm Hox genes is so limited at present that such generalities are highly tenuous. Moreover, a basic underlying pattern of colinearity is still observed in their spatial expression patterns making them suitable as cell or region-specific markers. I discuss a number of fundamental developmental questions and some of the challenges to addressing them in relation to each of the major parasitic lineages. In addition, I present newly characterized Hox genes from the model tapeworm Hymenolepis and analyze these by Bayesian inference together with >100 Hox and ParaHox homeodomains of flatworms and select lophotrochozoan taxa, providing a phylogenetic scaffold for their identification.

Convergence of the Insulin and Serotonin Programs in the Pancreatic β-Cell

PubMed Central

Ohta, Yasuharu; Kosaka, Yasuhiro; Kishimoto, Nina; Wang, Juehu; Smith, Stuart B.; Honig, Gerard; Kim, Hail; Gasa, Rosa M.; Neubauer, Nicole; Liou, Angela; Tecott, Laurence H.; Deneris, Evan S.; German, Michael S.

2011-01-01

OBJECTIVE Despite their origins in different germ layers, pancreatic islet cells share many common developmental features with neurons, especially serotonin-producing neurons in the hindbrain. Therefore, we tested whether these developmental parallels have functional consequences. RESEARCH DESIGN AND METHODS We used transcriptional profiling, immunohistochemistry, DNA-binding analyses, and mouse genetic models to assess the expression and function of key serotonergic genes in the pancreas. RESULTS We found that islet cells expressed the genes encoding all of the products necessary for synthesizing, packaging, and secreting serotonin, including both isoforms of the serotonin synthetic enzyme tryptophan hydroxylase and the archetypal serotonergic transcription factor Pet1. As in serotonergic neurons, Pet1 expression in islets required homeodomain transcription factor Nkx2.2 but not Nkx6.1. In β-cells, Pet1 bound to the serotonergic genes but also to a conserved insulin gene regulatory element. Mice lacking Pet1 displayed reduced insulin production and secretion and impaired glucose tolerance. CONCLUSIONS These studies demonstrate that a common transcriptional cascade drives the differentiation of β-cells and serotonergic neurons and imparts the shared ability to produce serotonin. The interrelated biology of these two cell types has important implications for the pathology and treatment of diabetes. PMID:22013016

Convergence of the insulin and serotonin programs in the pancreatic β-cell.

PubMed

Ohta, Yasuharu; Kosaka, Yasuhiro; Kishimoto, Nina; Wang, Juehu; Smith, Stuart B; Honig, Gerard; Kim, Hail; Gasa, Rosa M; Neubauer, Nicole; Liou, Angela; Tecott, Laurence H; Deneris, Evan S; German, Michael S

2011-12-01

Despite their origins in different germ layers, pancreatic islet cells share many common developmental features with neurons, especially serotonin-producing neurons in the hindbrain. Therefore, we tested whether these developmental parallels have functional consequences. We used transcriptional profiling, immunohistochemistry, DNA-binding analyses, and mouse genetic models to assess the expression and function of key serotonergic genes in the pancreas. We found that islet cells expressed the genes encoding all of the products necessary for synthesizing, packaging, and secreting serotonin, including both isoforms of the serotonin synthetic enzyme tryptophan hydroxylase and the archetypal serotonergic transcription factor Pet1. As in serotonergic neurons, Pet1 expression in islets required homeodomain transcription factor Nkx2.2 but not Nkx6.1. In β-cells, Pet1 bound to the serotonergic genes but also to a conserved insulin gene regulatory element. Mice lacking Pet1 displayed reduced insulin production and secretion and impaired glucose tolerance. These studies demonstrate that a common transcriptional cascade drives the differentiation of β-cells and serotonergic neurons and imparts the shared ability to produce serotonin. The interrelated biology of these two cell types has important implications for the pathology and treatment of diabetes.

Gene expression profile of patients with Mayer-Rokitansky-Küster-Hauser syndrome: new insights into the potential role of developmental pathways.

PubMed

Nodale, Cristina; Ceccarelli, Simona; Giuliano, Mariateresa; Cammarota, Marcella; D'Amici, Sirio; Vescarelli, Enrica; Maffucci, Diana; Bellati, Filippo; Panici, Pierluigi Benedetti; Romano, Ferdinando; Angeloni, Antonio; Marchese, Cinzia

2014-01-01

Mayer-Rokitansky-Küster-Hauser syndrome (MRKHS) is a rare disease characterized by congenital aplasia of uterus and vagina. Although many studies have investigated several candidate genes, up to now none of them seem to be responsible for the aetiology of the syndrome. In our study, we identified differences in gene expression profile of in vitro cultured vaginal tissue of MRHKS patients using whole-genome microarray analysis. A group of eight out of sixteen MRKHS patients that underwent reconstruction of neovagina with an autologous in vitro cultured vaginal tissue were subjected to microarray analysis and compared with five healthy controls. Results obtained by array were confirmed by qRT-PCR and further extended to other eight MRKHS patients. Gene profiling of MRKHS patients delineated 275 differentially expressed genes, of which 133 downregulated and 142 upregulated. We selected six deregulated genes (MUC1, HOXC8, HOXB2, HOXB5, JAG1 and DLL1) on the basis of their fold change, their differential expression in most patients and their relevant role in embryological development. All patients showed upregulation of MUC1, while HOXB2 and HOXB5 were downregulated, as well as Notch ligands JAG1 and DLL1 in the majority of them. Interestingly, HOXC8 was significantly upregulated in 47% of patients, with a differential expression only in MRKHS type I patients. Taken together, our results highlighted the dysregulation of developmental genes, thus suggesting a potential alteration of networks involved in the formation of the female reproductive tract and providing a useful clue for understanding the pathophysiology of MRKHS.

Gene Expression Profile of Patients with Mayer-Rokitansky-Küster-Hauser Syndrome: New Insights into the Potential Role of Developmental Pathways

PubMed Central

Giuliano, Mariateresa; Cammarota, Marcella; D’Amici, Sirio; Vescarelli, Enrica; Maffucci, Diana; Bellati, Filippo; Panici, Pierluigi Benedetti; Romano, Ferdinando; Angeloni, Antonio; Marchese, Cinzia

2014-01-01

Mayer-Rokitansky-Küster-Hauser syndrome (MRKHS) is a rare disease characterized by congenital aplasia of uterus and vagina. Although many studies have investigated several candidate genes, up to now none of them seem to be responsible for the aetiology of the syndrome. In our study, we identified differences in gene expression profile of in vitro cultured vaginal tissue of MRHKS patients using whole-genome microarray analysis. A group of eight out of sixteen MRKHS patients that underwent reconstruction of neovagina with an autologous in vitro cultured vaginal tissue were subjected to microarray analysis and compared with five healthy controls. Results obtained by array were confirmed by qRT-PCR and further extended to other eight MRKHS patients. Gene profiling of MRKHS patients delineated 275 differentially expressed genes, of which 133 downregulated and 142 upregulated. We selected six deregulated genes (MUC1, HOXC8, HOXB2, HOXB5, JAG1 and DLL1) on the basis of their fold change, their differential expression in most patients and their relevant role in embryological development. All patients showed upregulation of MUC1, while HOXB2 and HOXB5 were downregulated, as well as Notch ligands JAG1 and DLL1 in the majority of them. Interestingly, HOXC8 was significantly upregulated in 47% of patients, with a differential expression only in MRKHS type I patients. Taken together, our results highlighted the dysregulation of developmental genes, thus suggesting a potential alteration of networks involved in the formation of the female reproductive tract and providing a useful clue for understanding the pathophysiology of MRKHS. PMID:24608967

Gene architecture and expression analyses provide insights into the role of glutathione peroxidases (GPXs) in bread wheat (Triticum aestivum L.).

PubMed

Tyagi, Shivi; Himani; Sembi, Jaspreet K; Upadhyay, Santosh Kumar

2018-04-01

Glutathione peroxidases (GPXs) are redox sensor proteins that maintain a steady-state of H 2 O 2 in plant cells. They exhibit distinct sub-cellular localization and have diverse functionality in response to different stimuli. In this study, a total of 14 TaGPX genes and three splice variants were identified in the genome of Triticum aestivum and evaluated for various physicochemical properties. The TaGPX genes were scattered on the various chromosomes of the A, B, and D sub-genomes and clustered into five homeologous groups based on high sequence homology. The majority of genes were derived from the B sub-genome and localized on chromosome 2. The intron-exon organization, motif and domain architecture, and phylogenetic analyses revealed the conserved nature of TaGPXs. The occurrence of both development-related and stress-responsive cis-acting elements in the promoter region, the differential expression of these genes during various developmental stages, and the modulation of expression in the presence of biotic and abiotic stresses suggested their diverse role in T. aestivum. The majority of TaGPX genes showed higher expression in various leaf developmental stages. However, TaGPX1-A1 was upregulated in the presence of each abiotic stress treatment. A co-expression analysis revealed the interaction of TaGPXs with numerous development and stress-related genes, which indicated their vital role in numerous biological processes. Our study revealed the opportunities for further characterization of individual TaGPX proteins, which might be useful in designing future crop improvement strategies. Copyright © 2018 Elsevier GmbH. All rights reserved.

Developmental programming: interaction between prenatal BPA and postnatal overfeeding on cardiac tissue gene expression in female sheep

PubMed Central

Koneva, LA; Vyas, AK; McEachin, RC; Puttabyatappa, M; H-S, Wang; Sartor, MA; Padmanabhan, V

2017-01-01

Epidemiologic studies and studies in rodents point to potential risks from developmental exposure to BPA on cardiometabolic diseases. Furthermore, it is becoming increasingly evident that the manifestation and severity of adverse outcomes is the result of interaction between developmental insults and the prevailing environment. Consistent with this premise, recent studies in sheep found prenatal BPA treatment prevented the adverse effects of postnatal obesity in inducing hypertension. The gene networks underlying these complex interactions are not known. mRNA-seq of myocardium was performed on four groups of four female sheep to assess the effects of prenatal BPA exposure, postnatal overfeeding and their interaction on gene transcription, pathway perturbations and functional effects. The effects of prenatal exposure to BPA, postnatal overfeeding, and prenatal BPA with postnatal overfeeding all resulted in transcriptional changes (85–141 significant differentially expressed genes). Although the effects of prenatal BPA and postnatal overfeeding did not involve dysregulation of many of the same genes, they affected a remarkably similar set of biological pathways. Furthermore, an additive or synergistic effect was not found in the combined treatment group, but rather prenatal BPA treatment led to a partial reversal of the effects of overfeeding alone. Many genes previously known to be affected by BPA and involved in obesity, hypertension, or heart disease were altered following these treatments, and AP-1, EGR1, and EGFR were key hubs affected by BPA and/or overfeeding. PMID:28079927

Developmental gene regulatory network architecture across 500 million years of echinoderm evolution

NASA Technical Reports Server (NTRS)

Hinman, Veronica F.; Nguyen, Albert T.; Cameron, R. Andrew; Davidson, Eric H.

2003-01-01

Evolutionary change in morphological features must depend on architectural reorganization of developmental gene regulatory networks (GRNs), just as true conservation of morphological features must imply retention of ancestral developmental GRN features. Key elements of the provisional GRN for embryonic endomesoderm development in the sea urchin are here compared with those operating in embryos of a distantly related echinoderm, a starfish. These animals diverged from their common ancestor 520-480 million years ago. Their endomesodermal fate maps are similar, except that sea urchins generate a skeletogenic cell lineage that produces a prominent skeleton lacking entirely in starfish larvae. A relevant set of regulatory genes was isolated from the starfish Asterina miniata, their expression patterns determined, and effects on the other genes of perturbing the expression of each were demonstrated. A three-gene feedback loop that is a fundamental feature of the sea urchin GRN for endoderm specification is found in almost identical form in the starfish: a detailed element of GRN architecture has been retained since the Cambrian Period in both echinoderm lineages. The significance of this retention is highlighted by the observation of numerous specific differences in the GRN connections as well. A regulatory gene used to drive skeletogenesis in the sea urchin is used entirely differently in the starfish, where it responds to endomesodermal inputs that do not affect it in the sea urchin embryo. Evolutionary changes in the GRNs since divergence are limited sharply to certain cis-regulatory elements, whereas others have persisted unaltered.

Mutation of the XIST gene upregulates expression of X-linked genes but decreases the developmental rates of cloned male porcine embryos.

PubMed

Yang, Yang; Wu, Dan; Liu, Dewu; Shi, Junsong; Zhou, Rong; He, Xiaoyan; Quan, Jianping; Cai, Gengyuan; Zheng, Enqin; Wu, Zhenfang; Li, Zicong

2017-06-01

XIST is an X-linked, non-coding gene responsible for the cis induction of X-chromosome inactivation (XCI). Knockout of the XIST allele on an active X chromosome abolishes erroneous XCI and enhances the in vivo development of cloned mouse embryos by more than 10-fold. This study aimed to investigate whether a similar manipulation would improve cloning efficiency in pigs. A male, porcine kidney cell line containing an EGFP insert in exon 1 of the XIST gene, resulting in a knockout allele (XIST-KO), was generated by homologous recombination using transcription activator-like effector nucleases (TALENs). The expression of X-linked genes in embryos cloned from the XIST-KO kidney cells was significantly higher than in male embryos cloned from wild-type (WT) kidney cells, but remained lower than that of in vivo fertilization-produced counterparts. The XIST-KO cloned embryos also had a significantly lower blastocyst rate and a reduced full-term development rate compared to cloned WT embryos. These data suggested that while mutation of a XIST gene can partially rescue abnormal XCI, it cannot improve the developmental efficiency of cloned male porcine embryos-a deficiency that may be caused by incomplete rescue of abnormal XCI and/or by long-term drug selection of the XIST-KO nuclear donor cells, which might adversely affect the developmental efficiency of embryos created from them. © 2017 Wiley Periodicals, Inc.

Effects of gamma radiation on the early developmental stages of Zebrafish (Danio rerio).

PubMed

Praveen Kumar, M K; Shyama, S K; Kashif, Shamim; Dubey, S K; Avelyno, D'costa; Sonaye, B H; Kadam Samit, B; Chaubey, R C

2017-08-01

The zebrafish is gaining importance as a popular vertebrate model organism and is widely employed in ecotoxicological studies, especially for the biomonitoring of pollution in water bodies. There is limited data on the genetic mechanisms governing the adverse health effects in regards to an early developmental exposure to gamma radiation. In the present study zebrafish (Danio rerio) embryos were exposed to 1, 2.5, 5, 7.5 and 10Gy of gamma radiation at 3h post fertilization (hpf). Different developmental toxicity endpoints were investigated. Further, expression of genes associated with the development and DNA damage i.e. (sox2 sox19a and p53) were evaluated using Quantitative PCR (qPCR). The significant changes in the expression of sox2 sox19a and p53 genes were observed. This data was supported the developmental defects observed in the zebrafish embryo exposed to gamma radiation such as i.e. increased DNA damage, decreased hatching rate, increase in median hatching time, decreased body length, increased mortality rate, increased morphological deformities. Further, study shows that the potential ecotoxicological threat of gamma radiation on the early developmental stages of zebrafish. Further, it revealed that the above parameters can be used as predictive biomarkers of gamma radiation exposure. Copyright © 2017. Published by Elsevier Inc.

AmphiFoxE4, an amphioxus winged helix/forkhead gene encoding a protein closely related to vertebrate thyroid transcription factor-2: expression during pharyngeal development

NASA Technical Reports Server (NTRS)

Yu, Jr-Kai; Holland, Linda Z.; Jamrich, Milan; Blitz, Ira L.; Hollan, Nicholas D.

2002-01-01

The full-length sequence and developmental expression of amphioxus AmphiFoxE4 are described. Transcripts of the gene are first detected in the pharyngeal endoderm, where the club-shaped gland is forming and subsequently in the definitive gland itself. AmphiFoxE4 is closely related to vertebrate genes encoding the thyroid-specific transcription factor-2 (TTF2), which plays an early developmental role in the morphogenesis of the thyroid gland and a later role in hormone-mediated control of thyroid function. In amphioxus, AmphiFoxE4 expression is not thyroid specific because the club-shaped gland, the only structure expressing the gene, is not homologous to the vertebrate thyroid; instead, the thyroid homologue of amphioxus is a specialized region of the pharyngeal endoderm called the endostyle. We propose that (a) the pharynx of an amphioxus-like ancestor of the vertebrates included a club-shaped gland that expressed FoxE4 as well as an endostyle that did not, and (b) the club-shaped gland soon disappeared in the vertebrate line of descent but (c) not before there was a homeogenetic transfer of FoxE4 expression from the club-shaped gland to the nearby endostyle. Such a transfer could have provided part of the genetic program enabling the endostyle to separate from the pharyngeal endoderm and migrate away as the rudiment of the thyroid gland.

De novo Assembly of the Burying Beetle Nicrophorus orbicollis (Coleoptera: Silphidae) Transcriptome Across Developmental Stages with Identification of Key Immune Transcripts

PubMed Central

Won, Harim I.; Schulze, Thomas T.; Clement, Emalie J.; Watson, Gabrielle F.; Watson, Sean M.; Warner, Rosalie C.; Ramler, Elizabeth A. M.; Witte, Elias J.; Schoenbeck, Mark A.; Rauter, Claudia M.; Davis, Paul H.

2018-01-01

Burying beetles (Nicrophorus spp.) are among the relatively few insects that provide parental care while not belonging to the eusocial insects such as ants or bees. This behavior incurs energy costs as evidenced by immune deficits and shorter life-spans in reproducing beetles. In the absence of an assembled transcriptome, relatively little is known concerning the molecular biology of these beetles. This work details the assembly and analysis of the Nicrophorus orbicollis transcriptome at multiple developmental stages. RNA-Seq reads were obtained by next-generation sequencing and the transcriptome was assembled using the Trinity assembler. Validation of the assembly was performed by functional characterization using Gene Ontology (GO), Eukaryotic Orthologous Groups (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Differential expression analysis highlights developmental stage-specific expression patterns, and immunity-related transcripts are discussed. The data presented provides a valuable molecular resource to aid further investigation into immunocompetence throughout this organism's sexual development. PMID:29707046

A gene network model accounting for development and evolution of mammalian teeth

PubMed Central

Salazar-Ciudad, Isaac; Jernvall, Jukka

2002-01-01

Generation of morphological diversity remains a challenge for evolutionary biologists because it is unclear how an ultimately finite number of genes involved in initial pattern formation integrates with morphogenesis. Ideally, models used to search for the simplest developmental principles on how genes produce form should account for both developmental process and evolutionary change. Here we present a model reproducing the morphology of mammalian teeth by integrating experimental data on gene interactions and growth into a morphodynamic mechanism in which developing morphology has a causal role in patterning. The model predicts the course of tooth-shape development in different mammalian species and also reproduces key transitions in evolution. Furthermore, we reproduce the known expression patterns of several genes involved in tooth development and their dynamics over developmental time. Large morphological effects frequently can be achieved by small changes, according to this model, and similar morphologies can be produced by different changes. This finding may be consistent with why predicting the morphological outcomes of molecular experiments is challenging. Nevertheless, models incorporating morphology and gene activity show promise for linking genotypes to phenotypes. PMID:12048258

Developmental expression of human hemoglobins mediated by maturation of their subunit interfaces

PubMed Central

Manning, Lois R; Popowicz, Anthony M; Padovan, Julio; Chait, Brian T; Russell, J Eric; Manning, James M

2010-01-01

Different types of human hemoglobins (Hbs) consisting of various combinations of the embryonic, fetal, and adult Hb subunits are present at certain times during development representing a major paradigm of developmental biology that is still not understood and one which we address here. We show that the subunit interfaces of these Hbs have increasing bonding strengths as demonstrated by their distinct distribution of tetramers, dimers, and monomers during gel filtration at very low-Hb concentration. This maturation is mediated by competition between subunits for more favorable partners with stronger subunit interactions. Thus, the protein products of gene expression can themselves have a role in the developmental process due to their intrinsic properties. PMID:20572018

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

Life-cycle and growth-phase-dependent regulation of the ubiquitin genes of Trypanosoma cruzi.

PubMed

Manning-Cela, Rebeca; Jaishankar, Sobha; Swindle, John

2006-07-01

Trypanosoma cruzi, the causative agent of Chagas disease, exhibits a complex life cycle that is accompanied by the stage-specific gene expression. At the molecular level, very little is known about gene regulation in trypanosomes. Complex gene organizations coupled with polycistronic transcription units make the analysis of regulated gene expression difficult in trypanosomes. The ubiquitin genes of T. cruzi are a good example of this complexity. They are organized as a single cluster containing five ubiquitin fusion (FUS) and five polyubiquitin (PUB) genes that are polycistronically transcribed but expressed differently in response to developmental and environmental changes. Gene replacements were used to study FUS and PUB gene expression at different stages of growth and at different points in the life cycle of T. cruzi. Based on the levels of reporter gene expression, it was determined that FUS1 expression was downregulated as the parasites approached stationary phase, whereas PUB12.5 polyubiquitin gene expression increased. Conversely, FUS1 expression increases when epimastigotes and amastigotes differentiate into trypomastigotes, whereas the expression of PUB12.5 decreases when epimastigotes differentiate into amastigotes and trypomastigotes. Although the level of CAT activity in logarithmic growing epimastigotes is six- to seven-fold higher when the gene was expressed from the FUS1 locus than when expressed from the PUB12.5 locus, the rate of transcription from the two loci was the same implying that post-transcriptional mechanisms play a dominant role in the regulation of gene expression.

Effects of Metabolic Programming on Juvenile Play Behavior and Gene Expression in the Prefrontal Cortex of Rats.

PubMed

Hehar, Harleen; Ma, Irene; Mychasiuk, Richelle

2016-01-01

Early developmental processes, such as metabolic programming, can provide cues to an organism, which allow it to make modifications that are predicted to be beneficial for survival. Similarly, social play has a multifaceted role in promoting survival and fitness of animals. Play is a complex behavior that is greatly influenced by motivational and reward circuits, as well as the energy reserves and metabolism of an organism. This study examined the association between metabolic programming and juvenile play behavior in an effort to further elucidate insight into the consequences that early adaptions have on developmental trajectories. The study also examined changes in expression of four genes (Drd2, IGF1, Opa1, and OxyR) in the prefrontal cortex known to play significant roles in reward, bioenergetics, and social-emotional functioning. Using four distinct variations in developmental programming (high-fat diet, caloric restriction, exercise, or high-fat diet combined with exercise), we found that dietary programming (high-fat diet vs. caloric restriction) had the greatest impact on play behavior and gene expression. However, exercise also induced changes in both measures. This study demonstrates that metabolic programming can alter neural circuits and bioenergetics involved in play behavior, thus providing new insights into mechanisms that allow programming to influence the evolutionary success of an organism. © 2016 S. Karger AG, Basel.

Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

PubMed Central

2009-01-01

Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic genes in grape berries. Integration of the transcript, radiotracer and metabolite data demonstrates that Asc and TA metabolism are developmentally regulated in grapevines; resulting in low accumulated levels of the biosynthetic intermediate Asc, and high accumulated levels of the metabolic end-product TA. PMID:19995454

Hey bHLH transcription factors.

PubMed

Weber, David; Wiese, Cornelia; Gessler, Manfred

2014-01-01

Hey bHLH transcription factors are direct targets of canonical Notch signaling. The three mammalian Hey proteins are closely related to Hes proteins and they primarily repress target genes by either directly binding to core promoters or by inhibiting other transcriptional activators. Individual candidate gene approaches and systematic screens identified a number of Hey target genes, which often encode other transcription factors involved in various developmental processes. Here, we review data on interaction partners and target genes and conclude with a model for Hey target gene regulation. Furthermore, we discuss how expression of Hey proteins affects processes like cell fate decisions and differentiation, e.g., in cardiovascular, skeletal, and neural development or oncogenesis and how this relates to the observed developmental defects and phenotypes observed in various knockout mice. © 2014 Elsevier Inc. All rights reserved.

Deep sequencing reveals complex mechanisms of diapause preparation in the invasive mosquito, Aedes albopictus.

PubMed

Poelchau, Monica F; Reynolds, Julie A; Elsik, Christine G; Denlinger, David L; Armbruster, Peter A

2013-05-22

Seasonal environments present fundamental physiological challenges to a wide range of insects. Many temperate insects surmount the exigencies of winter by undergoing photoperiodic diapause, in which photoperiod provides a token cue that initiates an alternative developmental programme leading to dormancy. Pre-diapause is a crucial preparatory phase of this process, preceding developmental arrest. However, the regulatory and physiological mechanisms of diapause preparation are largely unknown. Using high-throughput gene expression profiling in the Asian tiger mosquito, Aedes albopictus, we reveal major shifts in endocrine signalling, cell proliferation, metabolism, energy production and cellular structure across pre-diapause development. While some hallmarks of diapause, such as insulin signalling and stress response, were not important at the transcriptional level, two genes, Pepck and PCNA, appear to show diapause-induced transcriptional changes across insect taxa. These processes demonstrate physiological commonalities between Ae. albopictus pre-diapause and diapause strategies across insects, and support the idea of a genetic 'toolkit' for diapause. Observations of gene expression trends from a comparative developmental perspective suggest that individual physiological processes are delayed against a background of a fixed morphological ontogeny. Our results demonstrate how deep sequencing can provide new insights into elusive molecular bases of complex ecological adaptations.

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Granger, C. L.; Cyr, R. J.

2001-01-01

Inducible promoters or gene-switches are used to both spatially and temporally regulate gene expression. Such regulation can provide information concerning the function of a gene in a developmental context as well as avoid potential harmful effects due to overexpression. A gfp construct under the control of a copper-inducible promoter was introduced into Arabidopsis thaliana (L.) Heynh. and the regulatory parameters of this inducible promoter were determined. Here, we describe the time-course of up- and down-regulation of GFP expression in response to copper level, the optimal regulatory levels of copper, and the tissue specificity of expression in three transgenic lines. We conclude that the copper-inducible promoter system may be useful in regulating the time and location of gene expression in A. thaliana.

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

The Tribolium homeotic gene Abdominal is homologous to abdominal-A of the Drosophila bithorax complex

NASA Technical Reports Server (NTRS)

Stuart, J. J.; Brown, S. J.; Beeman, R. W.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

1993-01-01

The Abdominal gene is a member of the single homeotic complex of the beetle, Tribolium castaneum. An integrated developmental genetic and molecular analysis shows that Abdominal is homologous to the abdominal-A gene of the bithorax complex of Drosophila. abdominal-A mutant embryos display strong homeotic transformations of the anterior abdomen (parasegments 7-9) to PS6, whereas developmental commitments in the posterior abdomen depend primarily on Abdominal-B. In beetle embryos lacking Abdominal function, parasegments throughout the abdomen are transformed to PS6. This observation demonstrates the general functional significance of parasegmental expression among insects and shows that the control of determinative decisions in the posterior abdomen by homeotic selector genes has undergone considerable evolutionary modification.

The Tribolium homeotic gene Abdominal is homologous to abdominal-A of the Drosophila bithorax complex.

PubMed

Stuart, J J; Brown, S J; Beeman, R W; Denell, R E

1993-01-01

The Abdominal gene is a member of the single homeotic complex of the beetle, Tribolium castaneum. An integrated developmental genetic and molecular analysis shows that Abdominal is homologous to the abdominal-A gene of the bithorax complex of Drosophila. abdominal-A mutant embryos display strong homeotic transformations of the anterior abdomen (parasegments 7-9) to PS6, whereas developmental commitments in the posterior abdomen depend primarily on Abdominal-B. In beetle embryos lacking Abdominal function, parasegments throughout the abdomen are transformed to PS6. This observation demonstrates the general functional significance of parasegmental expression among insects and shows that the control of determinative decisions in the posterior abdomen by homeotic selector genes has undergone considerable evolutionary modification.