MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Differential expression of calcium-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit

USDA-ARS?s Scientific Manuscript database

Calcium has been shown to increase stress tolerance, enhance fruit firmness and reduce decay. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also resp...

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

PubMed

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

NASA Technical Reports Server (NTRS)

Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

2000-01-01

beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

PubMed

Izard, Carroll E; Abe, Jo Ann A

2004-09-01

Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

Development and regulation of chloride homeostasis in the central nervous system.

PubMed

Watanabe, Miho; Fukuda, Atsuo

2015-01-01

γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter of the mature central nervous system (CNS). The developmental switch of GABAergic transmission from excitation to inhibition is induced by changes in Cl(-) gradients, which are generated by cation-Cl(-) co-transporters. An accumulation of Cl(-) by the Na(+)-K(+)-2Cl(-) co-transporter (NKCC1) increases the intracellular Cl(-) concentration ([Cl(-)]i) such that GABA depolarizes neuronal precursors and immature neurons. The subsequent ontogenetic switch, i.e., upregulation of the Cl(-)-extruder KCC2, which is a neuron-specific K(+)-Cl(-) co-transporter, with or without downregulation of NKCC1, results in low [Cl(-)]i levels and the hyperpolarizing action of GABA in mature neurons. Development of Cl(-) homeostasis depends on developmental changes in NKCC1 and KCC2 expression. Generally, developmental shifts (decreases) in [Cl(-)]i parallel the maturation of the nervous system, e.g., early in the spinal cord, hypothalamus and thalamus, followed by the limbic system, and last in the neocortex. There are several regulators of KCC2 and/or NKCC1 expression, including brain-derived neurotrophic factor (BDNF), insulin-like growth factor (IGF), and cystic fibrosis transmembrane conductance regulator (CFTR). Therefore, regionally different expression of these regulators may also contribute to the regional developmental shifts of Cl(-) homeostasis. KCC2 and NKCC1 functions are also regulated by phosphorylation by enzymes such as PKC, Src-family tyrosine kinases, and WNK1-4 and their downstream effectors STE20/SPS1-related proline/alanine-rich kinase (SPAK)-oxidative stress responsive kinase-1 (OSR1). In addition, activation of these kinases is modulated by humoral factors such as estrogen and taurine. Because these transporters use the electrochemical driving force of Na(+) and K(+) ions, topographical interaction with the Na(+)-K(+) ATPase and its modulators such as creatine kinase (CK) should modulate functions of Cl(-) transporters. Therefore, regional developmental regulation of these regulators and modulators of Cl(-) transporters may also play a pivotal role in the development of Cl(-) homeostasis.

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

PubMed

Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

2017-01-01

Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

PubMed

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

PubMed

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation

USDA-ARS?s Scientific Manuscript database

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing ac...

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

Developmentally regulated expression of APG-1, a member of heat shock protein 110 family in murine male germ cells.

PubMed

Kaneko, Y; Kimura, T; Nishiyama, H; Noda, Y; Fujita, J

1997-04-07

Apg-1 encodes a heat shock protein belonging to the heat shock protein 110 family, and is inducible by a 32 degrees C to 39 degrees C heat shock. Northern blot analysis of the testis from immature and adult mice, and of the purified germ cells revealed the quantitative change of the apg-1 transcripts during germ cell development. By in situ hybridization histochemistry the expressions of the apg-1 transcripts were detected in germ cells at specific stages of development including spermatocytes and spermatids. Although heat-induction of the apg-1 transcripts was observed in W/Wv mutant testis lacking germ cells, it was not detected in wild-type testis nor in the purified germ cells. Thus, the apg-1 expression is not heat-regulated but developmentally regulated in germ cells, suggesting that APG-1 plays a role in normal development of germ cells.

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

Progranulin regulates neurogenesis in the developing vertebrate retina.

PubMed

Walsh, Caroline E; Hitchcock, Peter F

2017-09-01

We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

PubMed Central

Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

2013-01-01

MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

PubMed

Baskar, Venkidasamy; Park, Se Won

2015-07-01

Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

PubMed Central

Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

2006-01-01

Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

NASA Astrophysics Data System (ADS)

Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

1987-05-01

Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

USDA-ARS?s Scientific Manuscript database

A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

PubMed

Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

2006-01-01

In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Developmental expression of VGF mRNA in the prenatal and postnatal rat.

PubMed

Snyder, S E; Pintar, J E; Salton, S R

1998-04-27

VGF is a developmentally regulated, secretory peptide precursor that is expressed by neurons and neuroendocrine cells and that has its transcription and secretion induced rapidly by neurotrophins and by depolarization. To gain insight into the possible functions and regulation of VGF in vivo, we have characterized the distribution of VGF mRNA in the developing rat nervous system. VGF expression was first detectable at embryonic day 11.5 in the primordia of cranial, sympathetic, and dorsal root ganglia, and its distribution expanded throughout development to include significant expression throughout the brain, spinal cord, and retina of the adult rat. The earliest expression of VGF, therefore, appeared in the peripheral nervous system as developing neurons settled in their designated ganglia. In many regions of the brain, VGF mRNA levels were found to be highest during periods when axonal outgrowth and synaptogenesis predominate. Areas of the central nervous system that contain predominantly dividing cells never displayed any VGF mRNA expression, nor did the vast majority of nonneural tissues.

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

PubMed Central

Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

2016-01-01

Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

Signal transduction in the carnivorous plant Sarracenia purpurea. Regulation of secretory hydrolase expression during development and in response to resources.

PubMed Central

Gallie, D R; Chang, S C

1997-01-01

Carnivory in plants has developed as an evolutionary adaptation to nutrient-poor environments. A significant investment of the resources of a carnivorous plant is committed to producing the traps, attractants, and digestive enzymes needed for the carnivory. The cost:benefit ratio of carnivory can be improved by either maximizing the prey capture rate or by reducing the metabolic commitment toward carnivory. Using the pitcher plant Sarracenia purpurea, we have investigated whether the expression of the hydrolytic enzymes needed for digestion is regulated in response to the presence of prey. Expression of protease, RNase, nuclease, and phosphatase activities could be induced in the fluid of nonactive traps by the addition of nucleic acids, protein, or reduced nitrogen, suggesting that hydrolase expression is induced upon perception of the appropriate chemical signal. Hydrolase expression was also developmentally controlled since expression commenced upon opening of a trap, increased for several days, and in the absence of prey largely ceased within 2 weeks. Nevertheless, the traps remained competent to induce expression in response to the appropriate signals. These data suggest that in young traps hydrolase expression is developmentally regulated, which is later replaced by a signal transduction mechanism, and they demonstrate the ability of a carnivorous species to respond to the availability of resources. PMID:9414556

Signal transduction in the carnivorous plant Sarracenia purpurea. Regulation of secretory hydrolase expression during development and in response to resources.

PubMed

Gallie, D R; Chang, S C

1997-12-01

Carnivory in plants has developed as an evolutionary adaptation to nutrient-poor environments. A significant investment of the resources of a carnivorous plant is committed to producing the traps, attractants, and digestive enzymes needed for the carnivory. The cost:benefit ratio of carnivory can be improved by either maximizing the prey capture rate or by reducing the metabolic commitment toward carnivory. Using the pitcher plant Sarracenia purpurea, we have investigated whether the expression of the hydrolytic enzymes needed for digestion is regulated in response to the presence of prey. Expression of protease, RNase, nuclease, and phosphatase activities could be induced in the fluid of nonactive traps by the addition of nucleic acids, protein, or reduced nitrogen, suggesting that hydrolase expression is induced upon perception of the appropriate chemical signal. Hydrolase expression was also developmentally controlled since expression commenced upon opening of a trap, increased for several days, and in the absence of prey largely ceased within 2 weeks. Nevertheless, the traps remained competent to induce expression in response to the appropriate signals. These data suggest that in young traps hydrolase expression is developmentally regulated, which is later replaced by a signal transduction mechanism, and they demonstrate the ability of a carnivorous species to respond to the availability of resources.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae).

PubMed

Chen, Juan; Liu, Si Si; Kohler, Annegret; Yan, Bo; Luo, Hong Mei; Chen, Xiao Mei; Guo, Shun Xing

2017-06-02

Mycorrhizal fungi colonize orchid seeds and induce germination. This so-called symbiotic germination is a critical developmental process in the lifecycle of all orchid species. However, the molecular changes that occur during orchid seed symbiotic germination remain largely unknown. To better understand the molecular mechanism of orchid seed germination, we performed a comparative transcriptomic and proteomic analysis of the Chinese traditional medicinal orchid Dendrobium officinale to explore the change in protein expression at the different developmental stages during asymbiotic and symbiotic germination and identify the key proteins that regulate the symbiotic germination of orchid seeds. Among 2256 identified plant proteins, 308 were differentially expressed across three developmental stages during asymbiotic and symbiotic germination, and 229 were differentially expressed during symbiotic germination compared to asymbiotic development. Of these, 32 proteins were coup-regulated at both the proteomic and transcriptomic levels during symbiotic germination compared to asymbiotic germination. Our results suggest that symbiotic germination of D. officinale seeds shares a common signaling pathway with asymbiotic germination during the early germination stage. However, compared to asymbiotic germination, fungal colonization of orchid seeds appears to induce higher and earlier expression of some key proteins involved in lipid and carbohydrate metabolism and thus improves the efficiency of utilization of stored substances present in the embryo. This study provides new insight into the molecular basis of orchid seed germination.

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

PubMed

Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

2017-10-01

Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

USDA-ARS?s Scientific Manuscript database

Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

PubMed Central

Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

2016-01-01

Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

PubMed Central

Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

2012-01-01

The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

Caffeine biosynthesis and degradation in tea [Camellia sinensis (L.) O. Kuntze] is under developmental and seasonal regulation.

PubMed

Mohanpuria, Prashant; Kumar, Vinay; Joshi, Robin; Gulati, Ashu; Ahuja, Paramvir Singh; Yadav, Sudesh Kumar

2009-10-01

To study caffeine biosynthesis and degradation, here we monitored caffeine synthase gene expression and caffeine and allantoin content in various tissues of four Camellia sinensis (L.) O. Kuntze cultivars during non-dormant (ND) and dormant (D) growth phases. Caffeine synthase expression as well as caffeine content was found to be higher in commercially utilized tissues like apical bud, 1st leaf, 2nd leaf, young stem, and was lower in old leaf during ND compared to D growth phase. Among fruit parts, fruit coats have higher caffeine synthase expression, caffeine content, and allantoin content. On contrary, allantoin content was found lower in the commercially utilized tissues and higher in old leaf. Results suggested that caffeine synthesis and degradation in tea appears to be under developmental and seasonal regulation.

Membrane-tethered transcription factors provide a connection between stress response and developmental pathways

PubMed Central

Slabaugh, Erin

2011-01-01

Membrane-tethered transcription factors (MTTFs) are proteins that are targeted to membranes and are capable of regulating gene expression. In this way, they are physically restrained from entering the nucleus and are innately dormant. Upon specific signal recognition cues, MTTFs are activated through cleavage by a protease that releases the transcription factor domain into the cytosol thus allowing it to translocate to the nucleus where it can regulate gene expression. MTTFs are classically thought to provide an advantage to an organism by allowing for rapid signal transduction in response to cellular and environmental stresses. However, recent findings suggest that MTTFs may not only act as a means to respond quickly to stress but also are able to regulate developmental pathways, illustrating a point of interaction between stress and development. PMID:21758012

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs

PubMed Central

Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De

2015-01-01

Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for the low reproductive efficiency reported in other obese breeds. The ovarian developmental potential was found to be greater in Meishan pigs than in Yorkshire pigs. PMID:26305539

CB1 Cannabinoid Receptor Expression in the Striatum: Association with Corticostriatal Circuits and Developmental Regulation

PubMed Central

Van Waes, Vincent; Beverley, Joel A.; Siman, Homayoun; Tseng, Kuei Y.; Steiner, Heinz

2012-01-01

Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains). We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25) and then progressively decreases toward adolescent (P40) and adult (P70) levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors) tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors) receive inputs from cortical regions with higher expression (medial prefrontal cortex). In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important. PMID:22416230

A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

PubMed

Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

1991-10-01

Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development.

PubMed

Phippard, D J; Weber-Hall, S J; Sharpe, P T; Naylor, M S; Jayatalake, H; Maas, R; Woo, I; Roberts-Clark, D; Francis-West, P H; Liu, Y H; Maxson, R; Hill, R E; Dale, T C

1996-09-01

Expression of the Msx-1 and Msx-2 homeobox genes have been shown to be coordinately regulated with the Bmp-2 and Bmp-4 ligands in a variety of developing tissues. Here we report that transcripts from all four genes are developmentally regulated during both foetal and postnatal mammary gland development. The location and time-course of the Bmp and Msx expression point to a role for Msx and Bmp gene products in the control of epithelial-mesenchymal interactions. Expression of Msx-2, but not Msx-1, Bmp-2 or Bmp-4 was decreased following ovariectomy, while expression of the human Msx-2 homologue was regulated by 17beta-oestradiol in the MCF-7 breast cancer cell line. The regulation of Msx-2 expression by oestrogen raises the possibility that hormonal regulation of mammary development is mediated through the control of epithelial-mesenchymal interactions.

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

The chromatin remodeling factor CHD7 controls cerebellar development by regulating reelin expression

PubMed Central

Whittaker, Danielle E.; Riegman, Kimberley L.H.; Kasah, Sahrunizam; Mohan, Conor; Yu, Tian; Sala, Blanca Pijuan; Hebaishi, Husam; Caruso, Angela; Marques, Ana Claudia; Michetti, Caterina; Smachetti, María Eugenia Sanz; Shah, Apar; Sabbioni, Mara; Kulhanci, Omer; Tee, Wee-Wei; Reinberg, Danny; Scattoni, Maria Luisa; McGonnell, Imelda; Wardle, Fiona C.; Fernandes, Cathy

2017-01-01

The mechanisms underlying the neurodevelopmental deficits associated with CHARGE syndrome, which include cerebellar hypoplasia, developmental delay, coordination problems, and autistic features, have not been identified. CHARGE syndrome has been associated with mutations in the gene encoding the ATP-dependent chromatin remodeler CHD7. CHD7 is expressed in neural stem and progenitor cells, but its role in neurogenesis during brain development remains unknown. Here we have shown that deletion of Chd7 from cerebellar granule cell progenitors (GCps) results in reduced GCp proliferation, cerebellar hypoplasia, developmental delay, and motor deficits in mice. Genome-wide expression profiling revealed downregulated expression of the gene encoding the glycoprotein reelin (Reln) in Chd7-deficient GCps. Recessive RELN mutations have been associated with severe cerebellar hypoplasia in humans. We found molecular and genetic evidence that reductions in Reln expression contribute to GCp proliferative defects and cerebellar hypoplasia in GCp-specific Chd7 mouse mutants. Finally, we showed that CHD7 is necessary for maintaining an open, accessible chromatin state at the Reln locus. Taken together, this study shows that Reln gene expression is regulated by chromatin remodeling, identifies CHD7 as a previously unrecognized upstream regulator of Reln, and provides direct in vivo evidence that a mammalian CHD protein can control brain development by modulating chromatin accessibility in neuronal progenitors. PMID:28165338

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

Is Transcriptomic Regulation of Berry Development More Important at Night than During the Day?

PubMed Central

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T.; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far. PMID:24551177

Is transcriptomic regulation of berry development more important at night than during the day?

PubMed

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

PubMed Central

Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

2017-01-01

Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity.

PubMed

Terenzi, Fulvia; Ladd, Andrea N

2010-01-01

Muscleblind-like (MBNL) proteins have been shown to regulate pre-mRNA alternative splicing, and MBNL1 has been implicated in regulating fetal-to-adult transitions in alternative splicing in the heart. MBNL1 is highly conserved, exhibiting more than 95% identity at the amino acid level between birds and mammals. To investigate MBNL1 expression during embryonic heart development, we examined MBNL1 transcript and protein expression in the embryonic chicken heart from the formation of the primitive heart tube through cardiac morphogenesis (embryonic days 1.5 through 8). MBNL1 transcript levels remained steady throughout these stages, whereas MBNL1 protein levels increased and exhibited a shift in isoforms. MBNL1 has several alternatively spliced exons. Using RT-PCR, we determined that the inclusion of one of these, exon 5, decreases dramatically during cardiac morphogenesis. This developmental transition is conserved in mice. Functional analyses of MBNL1 isoforms containing or lacking exon 5-encoded sequences revealed that exon 5 is important for the regulation of the subcellular localization, RNA binding affinity, and alternative splicing activity of MBNL1 proteins. A second MBNL protein, MBNL2, is also expressed in the embryonic heart. We found that MBNL2 exon 5, which is paralogous to MBNL1 exon 5, is similarly regulated during embryonic heart development. Analysis of MBNL1 and MBNL2 transcripts in several embryonic tissues in chicken and mouse indicate that exon 5 alternative splicing is highly conserved and tissue-specific. Thus, we propose that conserved developmental stage- and tissue-specific alternative splicing of MBNL transcripts is an important mechanism by which MBNL activity is regulated during embryonic development.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

NASA Astrophysics Data System (ADS)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

2017-03-01

Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

PubMed Central

2009-01-01

Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic genes in grape berries. Integration of the transcript, radiotracer and metabolite data demonstrates that Asc and TA metabolism are developmentally regulated in grapevines; resulting in low accumulated levels of the biosynthetic intermediate Asc, and high accumulated levels of the metabolic end-product TA. PMID:19995454

Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

PubMed Central

Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

2006-01-01

The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

Functional characterization of three MicroRNAs of the Asian Tiger Mosquito, Aedes albopictus

PubMed Central

2013-01-01

Background Temporal and stage specific expression of microRNAs (miRNAs) in embryos, larvae, pupae and adults of Aedes albopictus showed differential expression levels across the four developmental stages, indicating their potential regulatory roles in mosquito development. The functional characterization of these miRNAs was not known. Accordingly our study evaluated the functional characterization of three miRNAs, which are temporally up-regulated in the various developmental stages of Ae. albopictus mosquitoes. Methods miRNA mimics, inhibitors and negative controls were designed and their knock-in and knock-down efficiency were analyzed by qRT-PCR after transfecting the mosquito cell lines C6/36, and also by injecting in their specific developmental stages. The functional role of each individual miRNA was analyzed with various parameters of development such as, hatching rate and hatching time in embryos, eclosion rate in larvae, longevity and fecundity in the adult mosquitoes. Results The knock-in with the specifically designed miRNA mimics showed increased levels of expression of miRNA compared with their normal controls. We confirmed these findings using qRT-PCR, both by in vitro expression in C6/36 mosquito cell lines after transfection as well as in in vivo expression in developmental stages of mosquitoes by microinjection. The knock-down of expression with the corresponding inhibitors showed a considerable decrease in the expression levels of these miRNAs and obvious functional effects in Ae. albopictus development, detected by a decrease in the hatching rate of embryos and eclosion rate in larvae and a marked reduction in longevity and fecundity in adults. Conclusion This study carried out by knock-in and knock-down of specifically and temporally expressed miRNAs in Ae. albopictus by microinjection is a novel study to delineate the importance of the miRNA expression in regulating mosquito development. The knock-down and loss of function of endogenously expressed miRNAs by the miRNA inhibitors in specific developmental stages had considerable effects on development, but enhancement of their gain of function was not observed on knock-in of these specific miRNAs. Hence, our study indicates that an optimal level of endogenous expression of miRNA is indispensable for the normal development and maintenance of the vectorial population density and pathogen transmissibility of this mosquito vector. PMID:23924583

Zebrafish E-cadherin: expression during early embryogenesis and regulation during brain development.

PubMed

Babb, S G; Barnett, J; Doedens, A L; Cobb, N; Liu, Q; Sorkin, B C; Yelick, P C; Raymond, P A; Marrs, J A

2001-06-01

Zebrafish E-cadherin (cdh1) cell adhesion molecule cDNAs were cloned. We investigated spatial and temporal expression of cdh1 during early embryogenesis. Expression was observed in blastomeres, the anterior mesoderm during gastrulation, and developing epithelial structures. In the developing nervous system, cdh1 was detected at the pharyngula stage (24 hpf) in the midbrain-hindbrain boundary (MHB). Developmental regulation of MHB formation involves wnt1 and pax2.1. wnt1 expression preceded cdh1 expression during MHB formation, and cdh1 expression in the MHB was dependent on normal development of this structure. Copyright 2001 Wiley-Liss, Inc.

Identification of miRNAs during mouse postnatal ovarian development and superovulation.

PubMed

Khan, Hamid Ali; Zhao, Yi; Wang, Li; Li, Qian; Du, Yu-Ai; Dan, Yi; Huo, Li-Jun

2015-07-08

MicroRNAs are small noncoding RNAs that play critical roles in regulation of gene expression in wide array of tissues including the ovary through sequence complementarity at post-transcriptional level. Tight regulation of multitude of genes involved in ovarian development and folliculogenesis could be regulated at transcription level by these miRNAs. Therefore, tissue specific miRNAs identification is considered a key step towards understanding the role of miRNAs in biological processes. To investigate the role of microRNAs during ovarian development and folliculogenesis we sequenced eight different libraries using Illumina deep sequencing technology. Different developmental stages were selected to explore miRNAs expression pattern at different stages of gonadal maturation with/without treatment of PMSG/hCG for superovulation. From massive sequencing reads, clean reads of 16-26 bp were selected for further analysis of differential expression analysis and novel microRNA annotation. Expression analysis of all miRNAs at different developmental stages showed that some miRNAs were present ubiquitously while others were differentially expressed at different stages. Among differentially expressed miRNAs we reported 61 miRNAs with a fold change of more than 2 at different developmental stages among all libraries. Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 while mmu-mir-150 was down-regulated more than 3 fold. Furthermore, we found 2659 target genes for 20 differentially expressed microRNAs using seven different target predictions programs (DIANA-mT, miRanda, miRDB, miRWalk, RNAhybrid, PICTAR5, TargetScan). Analysis of the predicted targets showed certain ovary specific genes targeted by single or multiple microRNAs. Furthermore, pathway annotation and Gene ontology showed involvement of these microRNAs in basic cellular process. These results suggest the presence of different miRNAs at different stages of ovarian development and superovulation. Potential role of these microRNAs was elucidated using bioinformatics tools in regulation of different pathways, biological functions and cellular components underlying ovarian development and superovulation. These results provide a framework for extended analysis of miRNAs and their roles during ovarian development and superovulation. Furthermore, this study provides a base for characterization of individual miRNAs to discover their role in ovarian development and female fertility.

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

PubMed

Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

2006-09-01

Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Identification of a NAC transcription factor, EPHEMERAL1, that controls petal senescence in Japanese morning glory.

PubMed

Shibuya, Kenichi; Shimizu, Keiichi; Niki, Tomoko; Ichimura, Kazuo

2014-09-01

In flowering plants, floral longevity is species-specific and is closely linked to reproductive strategy; petal senescence, a type of programmed cell death (PCD), is a highly regulated developmental process. However, little is known about regulatory pathways for cell death in petal senescence, which is developmentally controlled in an age-dependent manner. Here, we show that a NAC transcription factor, designated EPHEMERAL1 (EPH1), positively regulates PCD during petal senescence in the ephemeral flowers of Japanese morning glory (Ipomoea nil). EPH1 expression is induced independently of ethylene signaling, and suppression of EPH1 resulted in Japanese morning glory flowers that are in bloom until the second day. The suppressed expression of EPH1 delays progression of PCD, possibly through suppression of the expression of PCD-related genes, including genes for plant caspase and autophagy in the petals. Our data further suggest that EPH1 is involved in the regulation of ethylene-accelerated petal senescence. In this study, we identified a key regulator of PCD in petal senescence, which will facilitate further elucidation of the regulatory network of petal senescence. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

NASA Technical Reports Server (NTRS)

Stegenga, S. L.; Kalb, R. G.

2001-01-01

Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

PubMed

Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

2012-07-10

A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b, involved in the regulation of GHR. SOCS3 plays a critical role in regulating skeletal muscle growth and fat deposition via let-7b-mediated GHR expression.

Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens

PubMed Central

2012-01-01

Background A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. Results At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3′ untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. Conclusions There is a critical miRNA, let-7b, involved in the regulation of GHR. SOCS3 plays a critical role in regulating skeletal muscle growth and fat deposition via let-7b-mediated GHR expression. PMID:22781587

Developmental Changes in Anger Expression and Attention Focus: Learning to Wait

ERIC Educational Resources Information Center

Cole, Pamela M.; Tan, Patricia Z.; Hall, Sarah E.; Zhang, Yiyun; Crnic, Keith A.; Blair, Clancy B.; Li, Runze

2011-01-01

Being able to wait is an essential part of self-regulation. In the present study, the authors examined the developmental course of changes in the latency to and duration of target-waiting behaviors by following 65 boys and 55 girls from rural and semirural economically strained homes from ages 18 months to 48 months. Age-related changes in latency…

Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

PubMed

Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

2017-01-01

Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Laminar-specific and developmental expression of aquaporin-4 in the mouse hippocampus

PubMed Central

Hsu, Mike S.; Seldin, Marcus; Lee, Darrin J.; Seifert, Gerald; Steinhäuser, Christian; Binder, Devin K.

2011-01-01

Mice deficient in the water channel AQP4 demonstrate increased seizure duration in response to hippocampal stimulation as well as impaired extracellular K+ clearance. However, the expression of AQP4 in the hippocampus is not well described. In this study, we investigated i) the developmental, laminar and cell-type specificity of AQP4 expression in the hippocampus; ii) the effect of Kir4.1 deletion on AQP4 expression; and iii) performed Western blot and RT-PCR analyses. AQP4 immunohistochemistry on coronal sections from WT or Kir4.1-/- mice revealed a developmentally-regulated and laminar-specific pattern, with highest expression in the CA1 stratum lacunosummoleculare (SLM) and the molecular layer (ML) of the dentate gyrus (DG). AQP4 was colocalized with the glial markers GFAP and S100ß in the hippocampus, and was also ubiquitously expressed on astrocytic endfeet around blood vessels. No difference in AQP4 immunoreactivity was observed in Kir4.1-/- mice. Electrophysiological and postrecording RT-PCR analyses of individual cells revealed that AQP4 and Kir4.1 were co-expressed in nearly all CA1 astrocytes. In NG2 cells, AQP4 was also expressed at the transcript level. This study is the first to examine subregional AQP4 expression during development of the hippocampus. The strikingly high expression of AQP4 in the CA1 SLM and DG ML identifies these regions as potential sites of astrocytic K+ and H2O regulation. These results begin to delineate the functional capabilities of hippocampal subregions and cell types for K+ and H2O homeostasis, which is critical to excitability and serves as a potential target for modulation in diverse diseases. PMID:21256195

Systematic identification of genes involved in divergent skeletal muscle growth rates of broiler and layer chickens.

PubMed

Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai

2009-02-22

The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Longitudinal associations between physically abusive parents' emotional expressiveness and children's self-regulation.

PubMed

Milojevich, Helen M; Haskett, Mary E

2018-03-01

The present study took a developmental psychopathology approach to examine the longitudinal association between parents' emotional expressiveness and children's self-regulation. Data collection spanned from 2004 to 2008. Ninety-two physically abusive parents completed yearly assessments of their emotional expressiveness, as well as their children's self-regulation abilities. Observational and behavioral measures were also obtained yearly to capture both parents' emotional expressiveness and children's self-regulation. Specifically, parents participated in a parent-child interaction task, which provided insight into their levels of flat affect. A puzzle box task was completed by each child to assess self-regulation. Results indicated, first, that greater parental expression of negative emotions predicted poorer self-regulation in children, both concurrently and across time. Second, parental expressions of positive emotions and parents' flat affect were unrelated to children's self-regulation. Findings inform our understanding of parental socialization of self-regulation and provide insight into the roles of distinct components of emotional expressiveness. Moreover, findings have crucial implications for understanding emotional expressiveness in high-risk samples and increase our understanding of within-group functioning among maltreating families that may serve as a means to direct intervention efforts. Copyright © 2018 Elsevier Ltd. All rights reserved.

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Characterization of the yeast copper-inducible promoter system in Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Granger, C. L.; Cyr, R. J.

2001-01-01

Inducible promoters or gene-switches are used to both spatially and temporally regulate gene expression. Such regulation can provide information concerning the function of a gene in a developmental context as well as avoid potential harmful effects due to overexpression. A gfp construct under the control of a copper-inducible promoter was introduced into Arabidopsis thaliana (L.) Heynh. and the regulatory parameters of this inducible promoter were determined. Here, we describe the time-course of up- and down-regulation of GFP expression in response to copper level, the optimal regulatory levels of copper, and the tissue specificity of expression in three transgenic lines. We conclude that the copper-inducible promoter system may be useful in regulating the time and location of gene expression in A. thaliana.

Thyroid hormone regulates the expression of the sonic hedgehog signaling pathway in the embryonic and adult Mammalian brain.

PubMed

Desouza, Lynette A; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E; Kottmann, Andreas H; Tole, Shubha; Vaidya, Vidita A

2011-05-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and hyperthyroidism bidirectionally influenced Shh mRNA in embryonic forebrain signaling centers at stages before fetal thyroid hormone synthesis. Further, Smo and Ptc expression were significantly decreased in the forebrain of embryos derived from hypothyroid dams. Adult-onset thyroid hormone perturbations also regulated expression of the Shh pathway bidirectionally, with a significant induction of Shh, Ptc, and Smo after hyperthyroidism and a decline in Smo expression in the hypothyroid brain. Short-term T₃ administration resulted in a significant induction of cortical Shh mRNA expression and also enhanced reporter gene expression in Shh(+/LacZ) mice. Further, acute T₃ treatment of cortical neuronal cultures resulted in a rapid and significant increase in Shh mRNA, suggesting direct effects. Chromatin immunoprecipitation assays performed on adult neocortex indicated enhanced histone acetylation at the Shh promoter after acute T₃ administration, providing further support that Shh is a thyroid hormone-responsive gene. Our results indicate that maternal and adult-onset perturbations of euthyroid status cause robust and region-specific changes in the Shh pathway in the embryonic and adult forebrain, implicating Shh as a possible mechanistic link for specific neurodevelopmental effects of thyroid hormone.

The POU Factor Ventral Veins Lacking/Drifter Directs the Timing of Metamorphosis through Ecdysteroid and Juvenile Hormone Signaling

PubMed Central

Chaieb, Leila; Koyama, Takashi; Sarwar, Prioty; Mirth, Christen K.; Smith, Wendy A.; Suzuki, Yuichiro

2014-01-01

Although endocrine changes are known to modulate the timing of major developmental transitions, the genetic mechanisms underlying these changes remain poorly understood. In insects, two developmental hormones, juvenile hormone (JH) and ecdysteroids, are coordinated with each other to induce developmental changes associated with metamorphosis. However, the regulation underlying the coordination of JH and ecdysteroid synthesis remains elusive. Here, we examined the function of a homolog of the vertebrate POU domain protein, Ventral veins lacking (Vvl)/Drifter, in regulating both of these hormonal pathways in the red flour beetle, Tribolium castaneum (Tenebrionidae). RNA interference-mediated silencing of vvl expression led to both precocious metamorphosis and inhibition of molting in the larva. Ectopic application of a JH analog on vvl knockdown larvae delayed the onset of metamorphosis and led to a prolonged larval stage, indicating that Vvl acts upstream of JH signaling. Accordingly, vvl knockdown also reduced the expression of a JH biosynthesis gene, JH acid methyltransferase 3 (jhamt3). In addition, ecdysone titer and the expression of the ecdysone response gene, hormone receptor 3 (HR3), were reduced in vvl knockdown larvae. The expression of the ecdysone biosynthesis gene phantom (phm) and spook (spo) were reduced in vvl knockdown larvae in the anterior and posterior halves, respectively, indicating that Vvl might influence ecdysone biosynthesis in both the prothoracic gland and additional endocrine sources. Injection of 20-hydroxyecdysone (20E) into vvl knockdown larvae could restore the expression of HR3 although molting was never restored. These findings suggest that Vvl coordinates both JH and ecdysteroid biosynthesis as well as molting behavior to influence molting and the timing of metamorphosis. Thus, in both vertebrates and insects, POU factors modulate the production of major neuroendocrine regulators during sexual maturation. PMID:24945490

Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

PubMed Central

Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

2011-01-01

Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

microRNAs of parasites: current status and future perspectives

USDA-ARS?s Scientific Manuscript database

MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs regulating gene expression in eukaryotes at the post-transcriptional level. The complex life cycles of parasites may require the ability to respond to environmental and developmental signals through miRNA-mediated gene expression. Ov...

Dynamic changes of genome-wide DNA methylation during soybean seed development

USDA-ARS?s Scientific Manuscript database

Seed development is programmed by expression of many genes in plants. Seed maturation is an important developmental process to soybean seed quality and yield. DNA methylation is a major epigenetic modification regulating gene expression. However, little is known about the dynamic nature of DNA me...

IN VITRO TO IN VIVO SCREENING OF THYROID HORMONE RECEPTOR DISRUPTING CHEMICALS

EPA Science Inventory

Upon completion of these studies, we will have established the predictive value of the GH3.TRE-LUC cell line to detect chemicals that can impact TH regulated gene expression and TH regulated developmental events in vivo. These studies have excellent potential to discover new c...

Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

PubMed

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

PubMed Central

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer.

PubMed

Gelmedin, Verena; Brodigan, Thomas; Gao, Xin; Krause, Michael; Wang, Zhu; Hawdon, John M

2011-01-01

Parasitic hookworms and the free-living model nematode Caenorhabtidis elegans share a developmental arrested stage, called the dauer stage in C. elegans and the infective third-stage larva (L3) in hookworms. One of the key transcription factors that regulate entrance to and exit from developmental arrest is the forkhead transcription factor DAF-16/FoxO. During the dauer stage, DAF-16 is activated and localized in the nucleus. DAF-16 is negatively regulated by phosphorylation by the upstream kinase AKT, which causes DAF-16 to localize out of the nucleus and the worm to exit from dauer. DAF-16 is conserved in hookworms, and hypothesized to control recovery from L3 arrest during infection. Lacking reverse genetic techniques for use in hookworms, we used C. elegans complementation assays to investigate the function of Ancylostoma caninum DAF-16 during entrance and exit from L3 developmental arrest. We performed dauer switching assays and observed the restoration of the dauer phenotype when Ac-DAF-16 was expressed in temperature-sensitive dauer defective C. elegans daf-2(e1370);daf-16(mu86) mutants. AKT phosphorylation site mutants of Ac-DAF-16 were also able to restore the dauer phenotype, but surprisingly allowed dauer exit when temperatures were lowered. We used fluorescence microscopy to localize DAF-16 during dauer and exit from dauer in C. elegans DAF-16 mutant worms expressing Ac-DAF-16, and found that Ac-DAF-16 exited the nucleus during dauer exit. Surprisingly, Ac-DAF-16 with mutated AKT phosphorylation sites also exited the nucleus during dauer exit. Our results suggest that another mechanism may be involved in the regulation DAF-16 nuclear localization during recovery from developmental arrest.

Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

PubMed

Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

2012-02-01

MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

Neuroendocrine Regulation of Maternal Behavior

PubMed Central

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Neuroendocrine regulation of maternal behavior.

PubMed

Bridges, Robert S

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

GABA-CREB signalling regulates maturation and survival of newly generated neurons in the adult hippocampus

PubMed Central

Jagasia, Ravi; Steib, Kathrin; Englberger, Elisabeth; Herold, Sabine; Faus-Kessler, Theresa; Saxe, Michael; Gage, Fred H.; Song, Hongjun; Lie, D. Chichung

2009-01-01

Survival and integration of new neurons in the hippocampal circuit are rate-limiting steps in adult hippocampal neurogenesis. Neuronal network activity is a major regulator of these processes, yet little is known about the respective downstream signalling pathways. Here, we investigate the role of CREB signalling in adult hippocampal neurogenesis. CREB is activated in new granule neurons during a distinct developmental period. Loss of CREB function in a cell-autonomous fashion impairs dendritic development, decreases the expression of the neurogenic transcription factor NeuroD and of the neuronal microtubule associated protein, DCX, and compromises the survival of newborn neurons. In addition, GABA-mediated excitation regulates CREB activation at early developmental stages. Importantly, developmental defects following loss of GABA-mediated excitation can be compensated by enhanced CREB signalling. These results indicate that CREB signalling is a central pathway in adult hippocampal neurogenesis, regulating the development and survival of new hippocampal neurons downstream of GABA-mediated excitation. PMID:19553437

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Transcriptomic and functional analyses unveil the role of long non-coding RNAs in anthocyanin biosynthesis during sea buckthorn fruit ripening.

PubMed

Zhang, Guoyun; Chen, Daoguo; Zhang, Tong; Duan, Aiguo; Zhang, Jianguo; He, Caiyun

2018-06-04

Fruit ripening is a developmental process regulated by a complex network of endogenous and exogenous cues. Sea buckthorn is an excellent material for fruit ripening studies due to its dramatic ripening process and high contents of nutritional and anti-oxidant compounds in berries. Here, the whole transcriptome of sea buckthorn fruit at three development stages were analysed using multiple high-throughput sequencings. We assembled and annotated 9,008 long non-coding RNAs (lncRNAs) in sea buckthorn fruits, and identified 118 differentially expressed lncRNAs (DE-lncRNAs) and 32 differentially expressed microRNAs in fruit developmental process. In addition, we predicted 1,061 cis-regulated and 782 trans-regulated targets of DE-lncRNAs, and these DE-lncRNAs are specifically enriched in the biosynthesis of ascorbic acid, carotenoids and flavonoids. Moreover, the silencing of two lncRNAs (LNC1 and LNC2) in vivo and expression analysis revealed that LNC1 and LNC2 can act as endogenous target mimics of miR156a and miR828a to reduce SPL9 and induce MYB114 expression, respectively, which lead to increased and decreased anthocyanin content as revealed by high-performance liquid chromatography analysis. Our results present the first global functional analysis of lncRNA in sea buckthorn and provide two essential regulators of anthocyanin biosynthesis, which provides new insights into the regulation of fruit quality.

Measuring children's regulation of emotion-expressive behavior.

PubMed

Bar-Haim, Yair; Bar-Av, Gali; Sadeh, Avi

2011-04-01

Emotion regulation has become a pivotal concept in developmental and clinical research. However, the measurement of regulatory processes has proved extremely difficult, particularly in the context of within-subject designs. Here, we describe a formal conceptualization and a new experimental procedure, the Balloons Game, to measure a regulatory component of emotion-expressive behavior. We present the internal consistency and stability of the indices derived from the Balloons Game in a sample of 121 kindergarten children. External validation against measures that have been associated with emotion regulation processes is also provided. The findings suggest that the Balloons Game provides a reliable tool for the study of regulation of emotion expression in young children. PsycINFO Database Record (c) 2011 APA, all rights reserved.

Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin

PubMed Central

2015-01-01

Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. To study the developmental processes that require intact ubiquitin, we executed the most extensive characterization of the lens proteome to date. We quantified lens protein expression changes in multiple replicate pools of P1 wild-type and K6W-Ub-expressing mouse lenses. Lens proteins were digested with trypsin, peptides were separated using strong cation exchange and reversed-phase liquid chromatography, and tandem mass (MS/MS) spectra were collected with a linear ion trap. Transgenic mice that expressed low levels of K6W-Ub (low expressers) had normal, clear lenses at birth, whereas the lenses that expressed high levels of K6W-Ub (higher expressers) had abnormal lenses and cataracts at birth. A total of 2052 proteins were identified, of which 996 were reliably quantified and compared between wild-type and K6W-Ub transgenic mice. Consistent with a delayed developmental program, fiber-cell-specific proteins, such as γ-crystallins (γA, γB, γC, and γE), were down-regulated in K6W-Ub higher expressers. Up-regulated proteins were involved in energy metabolism, signal transduction, and proteolysis. The K6W-Ub low expressers exhibited delayed onset and milder cataract consistent with smaller changes in protein expression. Because lens protein expression changes occurred prior to lens morphological abnormalities and cataract formation in K6W-Ub low expressers, it appears that expression of K6W-Ub sets in motion a process of altered protein expression that results in developmental defects and cataract. PMID:24450463

Dynamic genome wide expression profiling of Drosophila head development reveals a novel role of Hunchback in retinal glia cell development and blood-brain barrier integrity

PubMed Central

Torres-Oliva, Montserrat; Schneider, Julia; Wiegleb, Gordon

2018-01-01

Drosophila melanogaster head development represents a valuable process to study the developmental control of various organs, such as the antennae, the dorsal ocelli and the compound eyes from a common precursor, the eye-antennal imaginal disc. While the gene regulatory network underlying compound eye development has been extensively studied, the key transcription factors regulating the formation of other head structures from the same imaginal disc are largely unknown. We obtained the developmental transcriptome of the eye-antennal discs covering late patterning processes at the late 2nd larval instar stage to the onset and progression of differentiation at the end of larval development. We revealed the expression profiles of all genes expressed during eye-antennal disc development and we determined temporally co-expressed genes by hierarchical clustering. Since co-expressed genes may be regulated by common transcriptional regulators, we combined our transcriptome dataset with publicly available ChIP-seq data to identify central transcription factors that co-regulate genes during head development. Besides the identification of already known and well-described transcription factors, we show that the transcription factor Hunchback (Hb) regulates a significant number of genes that are expressed during late differentiation stages. We confirm that hb is expressed in two polyploid subperineurial glia cells (carpet cells) and a thorough functional analysis shows that loss of Hb function results in a loss of carpet cells in the eye-antennal disc. Additionally, we provide for the first time functional data indicating that carpet cells are an integral part of the blood-brain barrier. Eventually, we combined our expression data with a de novo Hb motif search to reveal stage specific putative target genes of which we find a significant number indeed expressed in carpet cells. PMID:29360820

Regulation of Chlamydia Gene Expression by Tandem Promoters with Different Temporal Patterns.

PubMed

Rosario, Christopher J; Tan, Ming

2016-01-15

Chlamydia is a genus of pathogenic bacteria with an unusual intracellular developmental cycle marked by temporal waves of gene expression. The three main temporal groups of chlamydial genes are proposed to be controlled by separate mechanisms of transcriptional regulation. However, we have noted genes with discrepancies, such as the early gene dnaK and the midcycle genes bioY and pgk, which have promoters controlled by the late transcriptional regulators EUO and σ(28). To resolve this issue, we analyzed the promoters of these three genes in vitro and in Chlamydia trachomatis bacteria grown in cell culture. Transcripts from the σ(28)-dependent promoter of each gene were detected only at late times in the intracellular infection, bolstering the role of σ(28) RNA polymerase in late gene expression. In each case, however, expression prior to late times was due to a second promoter that was transcribed by σ(66) RNA polymerase, which is the major form of chlamydial polymerase. These results demonstrate that chlamydial genes can be transcribed from tandem promoters with different temporal profiles, leading to a composite expression pattern that differs from the expression profile of a single promoter. In addition, tandem promoters allow a gene to be regulated by multiple mechanisms of transcriptional regulation, such as DNA supercoiling or late regulation by EUO and σ(28). We discuss how tandem promoters broaden the repertoire of temporal gene expression patterns in the chlamydial developmental cycle and can be used to fine-tune the expression of specific genes. Chlamydia is a pathogenic bacterium that is responsible for the majority of infectious disease cases reported to the CDC each year. It causes an intracellular infection that is characterized by coordinated expression of chlamydial genes in temporal waves. Chlamydial transcription has been shown to be regulated by DNA supercoiling, alternative forms of RNA polymerase, and transcription factors, but the number of transcription factors found in Chlamydia is far fewer than the number found in most bacteria. This report describes the use of tandem promoters that allow the temporal expression of a gene or operon to be controlled by more than one regulatory mechanism. This combinatorial strategy expands the range of expression patterns that are available to regulate chlamydial genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Modulation of organic acids and sugar content in tomato fruits by an abscisic acid-regulated transcription factor.

PubMed

Bastías, Adriana; López-Climent, María; Valcárcel, Mercedes; Rosello, Salvador; Gómez-Cadenas, Aurelio; Casaretto, José A

2011-03-01

Growing evidence suggests that the phytohormone abscisic acid (ABA) plays a role in fruit development. ABA signaling components of developmental programs and responses to stress conditions include the group of basic leucine zipper transcriptional activators known as ABA-response element binding factors (AREBs/ABFs). AREB transcription factors mediate ABA-regulated gene expression involved in desiccation tolerance and are expressed mainly in seeds and in vegetative tissues under stress; however, they are also expressed in some fruits such as tomato. In order to get an insight into the role of ABA signaling in fruit development, the expression of two AREB-like factors were investigated during different developmental stages. In addition, tomato transgenic lines that overexpress and downregulate one AREB-like transcription factor, SlAREB1, were used to determine its effect on the levels of some metabolites determining fruit quality. Higher levels of citric acid, malic acid, glutamic acid, glucose and fructose were observed in SlAREB1-overexpressing lines compared with those in antisense suppression lines in red mature fruit pericarp. The higher hexose concentration correlated with increased expression of genes encoding a vacuolar invertase (EC 3.2.1.26) and a sucrose synthase (EC 2.4.1.13). No significant changes were found in ethylene content which agrees with the normal ripening phenotype observed in transgenic fruits. These results suggest that an AREB-mediated ABA signal affects the metabolism of these compounds during the fruit developmental program. Copyright © Physiologia Plantarum 2010.

Protective effects of puerarin against tetrabromobisphenol a-induced apoptosis and cardiac developmental toxicity in zebrafish embryo-larvae.

PubMed

Yang, Suwen; Wang, Shengrui; Sun, Fengchao; Zhang, Mengmeng; Wu, Fengchang; Xu, Fanfan; Ding, Zhishan

2015-09-01

Tetrabromobisphenol A (TBBPA), a brominated flame retardant, is detected commonly in aquatic environments, where it is thought to be highly toxic to the development of aquatic life. In this study, zebrafish embryos and larvae were used to investigate the protective effects of puerarin after exposure to TBBPA. Malformation, blood flow disorders, pericardial edema, and spawn coagulation rates increased, whereas survival decreased significantly after exposure to 0.5 and 1.0 mg L(-1) TBBPA. The measured indices of morphological toxicity improved after treatment with puerarin. TBBPA also induced reactive oxygen species (ROS) production in a dose-dependent manner. Acridine orange staining results revealed that TBBPA exposure caused cardiomyocyte apoptosis and induced the expression of three proapoptotic genes: P53, Bax, and Caspase9. In contrast, the expression of the antiapoptotic gene Bcl2 was down-regulated. When genes related to cardiac development were assessed, the expression of Tbx1, Raldh2, and Bmp2b changed after exposure to the combination of TBBPA and puerarin. These results suggest that TBBPA induces cardiomyocyte apoptosis and ROS production, resulting in cardiac developmental toxicity in zebrafish embryos or larvae. Therefore, puerarin regulates the expression of cardiac developmental genes, such as Tbx1, Bmp2b, and Raldh2 by inhibiting ROS production, and subsequently modulates cardiac development after the exposure of zebrafish larvae to TBBPA. © 2014 Wiley Periodicals, Inc.

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

PubMed Central

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

PubMed

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

MicroRNA-276 promotes egg-hatching synchrony by up-regulating brm in locusts

PubMed Central

He, Jing; Chen, Qianquan; Wei, Yuanyuan; Jiang, Feng; Yang, Meiling; Hao, Shuguang; Guo, Xiaojiao; Chen, Dahua; Kang, Le

2016-01-01

Developmental synchrony, the basis of uniform swarming, migration, and sexual maturation, is an important strategy for social animals to adapt to variable environments. However, the molecular mechanisms underlying developmental synchrony are largely unexplored. The migratory locust exhibits polyphenism between gregarious and solitarious individuals, with the former displaying more synchronous sexual maturation and migration than the latter. Here, we found that the egg-hatching time of gregarious locusts was more uniform compared with solitarious locusts and that microRNA-276 (miR-276) was expressed significantly higher in both ovaries and eggs of gregarious locusts than in solitarious locusts. Interestingly, inhibiting miR-276 in gregarious females and overexpressing it in solitarious females, respectively, caused more heterochronic and synchronous hatching of progeny eggs. Moreover, miR-276 directly targeted a transcription coactivator gene, brahma (brm), resulting in its up-regulation. Knockdown of brm not only resulted in asynchronous egg hatching in gregarious locusts but also impaired the miR-276–induced synchronous egg hatching in solitarious locusts. Mechanistically, miR-276 mediated brm activation in a manner that depended on the secondary structure of brm, namely, a stem-loop around the binding site of miR-276. Collectively, our results unravel a mechanism by which miR-276 enhances brm expression to promote developmental synchrony and provide insight into regulation of developmental homeostasis and population sustaining that are closely related to biological synchrony. PMID:26729868

Applications of Gene Targeting Technology to Mental Retardation and Developmental Disability Research

ERIC Educational Resources Information Center

Pimenta, Aurea F.; Levitt, Pat

2005-01-01

The human and mouse genome projects elucidated the sequence and position map of innumerous genes expressed in the central nervous system (CNS), advancing our ability to manipulate these sequences and create models to investigate regulation of gene expression and function. In this article, we reviewed gene targeting methodologies with emphasis on…

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal mouse tissues.

EPA Science Inventory

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...

Wt1 Flip-Flops Chromatin in a CTCF Domain

PubMed Central

Gurudatta, B. V.; Corces, Victor G.

2011-01-01

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. PMID:21920307

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE PAGES

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.; ...

2017-04-26

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

Alcohol exposure during development: Impact on the epigenome.

PubMed

Perkins, Amy; Lehmann, Claudia; Lawrence, R Charles; Kelly, Sandra J

2013-10-01

Fetal alcohol spectrum disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposureresulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol's impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. Copyright © 2013 ISDN. Published by Elsevier Ltd. All rights reserved.

Alcohol exposure during development: Impact on the epigenome

PubMed Central

Perkins, Amy; Lehmann, Claudia; Lawrence, R. Charles; Kelly, Sandra J.

2013-01-01

Fetal Alcohol Spectrum Disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposure resulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol’s impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. PMID:23542005

A Proteolytic Regulator Controlling Chalcone Synthase Stability and Flavonoid Biosynthesis in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xuebin; Abrahan, Carolina; Colquhoun, Thomas A.

Flavonoids represent a large family of specialized metabolites involved in plant growth, development, and adaptation. Chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from general phenylpropanoid metabolism to flavonoid pathway. Despite extensive characterization of its function and transcriptional regulation, the molecular basis governing its posttranslational modification is enigmatic. Here, we report the discovery of a proteolytic regulator of CHS, namely, KFB CHS, a Kelch domain-containing F-box protein in Arabidopsis thaliana. KFB CHS physically interacts with CHS and specifically mediates its ubiquitination and degradation. KFB CHS exhibits developmental expression patterns in Arabidopsis leaves, stems, andmore » siliques and strongly responds to the dark-to-light (or the light-to-dark) switch, the blue, red, and far-red light signals, and UV-B irradiation. Alteration of KFB CHS expression negatively correlates to the cellular concentration of CHS and the production of flavonoids. Our study suggests that KFB CHS serves as a crucial negative regulator, via mediating CHS degradation, coordinately controlling flavonoid biosynthesis in response to the developmental cues and environmental stimuli.« less

RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

PubMed Central

Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

2011-01-01

microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

[Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

PubMed

Yang, Li-Wei; Shi, Ji-Sen

2012-04-01

To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

PubMed

Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

2008-11-01

Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

Stuxnet Facilitates the Degradation of Polycomb Protein during Development.

PubMed

Du, Juan; Zhang, Junzheng; He, Tao; Li, Yajuan; Su, Ying; Tie, Feng; Liu, Min; Harte, Peter J; Zhu, Alan Jian

2016-06-20

Polycomb-group (PcG) proteins function to ensure correct deployment of developmental programs by epigenetically repressing target gene expression. Despite the importance, few studies have been focused on the regulation of PcG activity itself. Here, we report a Drosophila gene, stuxnet (stx), that controls Pc protein stability. We find that heightened stx activity leads to homeotic transformation, reduced Pc activity, and de-repression of PcG targets. Conversely, stx mutants, which can be rescued by decreased Pc expression, display developmental defects resembling hyperactivation of Pc. Our biochemical analyses provide a mechanistic basis for the interaction between stx and Pc; Stx facilitates Pc degradation in the proteasome, independent of ubiquitin modification. Furthermore, this mode of regulation is conserved in vertebrates. Mouse stx promotes degradation of Cbx4, an orthologous Pc protein, in vertebrate cells and induces homeotic transformation in Drosophila. Our results highlight an evolutionarily conserved mechanism of regulated protein degradation on PcG homeostasis and epigenetic activity. Copyright © 2016 Elsevier Inc. All rights reserved.

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

PubMed Central

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2

NASA Technical Reports Server (NTRS)

Johnson, K. A.; Sistrunk, M. L.; Polisensky, D. H.; Braam, J.; McIntire, L. V. (Principal Investigator)

1998-01-01

Plants exposed to repetitive touch or wind are generally shorter and stockier than sheltered plants. These mechanostimulus-induced developmental changes are termed thigmomorphogenesis and may confer resistance to subsequent stresses. An early response of Arabidopsis thaliana to touch or wind is the up-regulation of TCH (touch) gene expression. The signal transduction pathway that leads to mechanostimulus responses is not well defined. A role for ethylene has been proposed based on the observation that mechanostimulation of plants leads to ethylene evolution and exogenous ethylene leads to thigmomorphogenetic-like changes. To determine whether ethylene has a role in plant responses to mechanostimulation, we assessed the ability of two ethylene-insensitive mutants, etr1-3 and ein2-1, to undergo thigmomorphogenesis and TCH gene up-regulation of expression. The ethylene-insensitive mutants responded to wind similarly to the wild type, with a delay in flowering, decrease in inflorescence elongation rate, shorter mature primary inflorescences, more rosette paraclades, and appropriate TCH gene expression changes. Also, wild-type and mutant Arabidopsis responded to vibrational stimulation, with an increase in hypocotyl elongation and up-regulation of TCH gene expression. We conclude that the ETR1 and EIN2 protein functions are not required for the developmental and molecular responses to mechanical stimulation.

Discovery of Transcription Factors Novel to Mouse Cerebellar Granule Cell Development Through Laser-Capture Microdissection.

PubMed

Zhang, Peter G Y; Yeung, Joanna; Gupta, Ishita; Ramirez, Miguel; Ha, Thomas; Swanson, Douglas J; Nagao-Sato, Sayaka; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O; Arner, Erik; de Hoon, Michiel; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide; Goldowitz, Dan

2018-06-01

Laser-capture microdissection was used to isolate external germinal layer tissue from three developmental periods of mouse cerebellar development: embryonic days 13, 15, and 18. The cerebellar granule cell-enriched mRNA library was generated with next-generation sequencing using the Helicos technology. Our objective was to discover transcriptional regulators that could be important for the development of cerebellar granule cells-the most numerous neuron in the central nervous system. Through differential expression analysis, we have identified 82 differentially expressed transcription factors (TFs) from a total of 1311 differentially expressed genes. In addition, with TF-binding sequence analysis, we have identified 46 TF candidates that could be key regulators responsible for the variation in the granule cell transcriptome between developmental stages. Altogether, we identified 125 potential TFs (82 from differential expression analysis, 46 from motif analysis with 3 overlaps in the two sets). From this gene set, 37 TFs are considered novel due to the lack of previous knowledge about their roles in cerebellar development. The results from transcriptome-wide analyses were validated with existing online databases, qRT-PCR, and in situ hybridization. This study provides an initial insight into the TFs of cerebellar granule cells that might be important for development and provide valuable information for further functional studies on these transcriptional regulators.

X chromosome regulation: diverse patterns in development, tissues and disease

PubMed Central

Deng, Xinxian; Berletch, Joel B.; Nguyen, Di K.; Disteche, Christine M.

2014-01-01

Genes on the mammalian X chromosome are present in one copy in males and two copies in females. The complex mechanisms that regulate the X chromosome lead to evolutionary and physiological variability in gene expression between species, the sexes, individuals, developmental stages, tissues and cell types. In early development, delayed and incomplete X chromosome inactivation (XCI) in some species causes variability in gene expression. Additional diversity stems from escape from XCI and from mosaicism or XCI skewing in females. This causes sex-specific differences that manifest as differential gene expression and associated phenotypes. Furthermore, the complexity and diversity of X dosage regulation affect the severity of diseases caused by X-linked mutations. PMID:24733023

Thyroid Hormone Regulates the Expression of the Sonic Hedgehog Signaling Pathway in the Embryonic and Adult Mammalian Brain

PubMed Central

Desouza, Lynette A.; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E.; Kottmann, Andreas H.; Tole, Shubha

2011-01-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and hyperthyroidism bidirectionally influenced Shh mRNA in embryonic forebrain signaling centers at stages before fetal thyroid hormone synthesis. Further, Smo and Ptc expression were significantly decreased in the forebrain of embryos derived from hypothyroid dams. Adult-onset thyroid hormone perturbations also regulated expression of the Shh pathway bidirectionally, with a significant induction of Shh, Ptc, and Smo after hyperthyroidism and a decline in Smo expression in the hypothyroid brain. Short-term T3 administration resulted in a significant induction of cortical Shh mRNA expression and also enhanced reporter gene expression in Shh+/LacZ mice. Further, acute T3 treatment of cortical neuronal cultures resulted in a rapid and significant increase in Shh mRNA, suggesting direct effects. Chromatin immunoprecipitation assays performed on adult neocortex indicated enhanced histone acetylation at the Shh promoter after acute T3 administration, providing further support that Shh is a thyroid hormone-responsive gene. Our results indicate that maternal and adult-onset perturbations of euthyroid status cause robust and region-specific changes in the Shh pathway in the embryonic and adult forebrain, implicating Shh as a possible mechanistic link for specific neurodevelopmental effects of thyroid hormone. PMID:21363934

Arabidopsis thaliana G2-LIKE FLAVONOID REGULATOR and BRASSINOSTEROID ENHANCED EXPRESSION1 are low-temperature regulators of flavonoid accumulation.

PubMed

Petridis, Antonios; Döll, Stefanie; Nichelmann, Lars; Bilger, Wolfgang; Mock, Hans-Peter

2016-08-01

Flavonoid synthesis is predominantly regulated at the transcriptional level through the MYB-basic helix-loop-helix (bHLH)-WD40 (MBW) (MYB: transcription factor of the myeloblastosis protein family, WD40: tanscription factor with a short structural motif of 40 amino acids which terminates in an aspartic acid-tryptophan dipeptide) complex, and responds to both environmental and developmental stimuli. Although the developmental regulation of flavonoid accumulation in Arabidopsis thaliana has been examined in great detail, the response of the flavonoid synthesis pathway to abiotic stress (particularly low temperature) remains unclear. A screen of a Dissociation element (Ds) transposon-induced mutation collection identified two lines which exhibited an altered profile of phenylpropanoid accumulation following exposure to low-temperature stress. One of the mutated genes (BRASSINOSTEROID ENHANCED EXPRESSION1 (BEE1)) encoded a brassinosteroid enhanced expression transcription factor, while the other (G2-LIKE FLAVONOID REGULATOR (GFR)) encoded a G2-like flavonoid regulator. Phenylpropanoid-targeted analysis was performed using high-performance LC-MS, and gene expression analysis using quantitative reverse transcription-PCR. In both mutants, the accumulation of quercetins and scopolin was reduced under low-temperature growing conditions, whereas that of anthocyanin was increased. BEE1 and GFR were both shown to negatively regulate anthocyanin accumulation by inhibiting anthocyanin synthesis genes via the suppression of the bHLH (TRANSPARENT TESTA8 (TT8) and GLABROUS3 (GL3)) and/or the MYB (PRODUCTION OF ANTHOCYANIN PIGMENTS2 (PAP2)) components of the MBW complex. Our results provide new insight into the regulatory control of phenylpropanoid metabolism at low temperatures, and reveal that BEE1 and GFR act as important components of the signal transduction chain. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

PubMed

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-12-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

PubMed Central

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Computational synchronization of microarray data with application to Plasmodium falciparum.

PubMed

Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

2012-06-21

Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

PubMed Central

Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

2012-01-01

The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

OsMADS26 Negatively Regulates Resistance to Pathogens and Drought Tolerance in Rice1[OPEN

PubMed Central

Khong, Giang Ngan; Richaud, Frédérique; Parizot, Boris; Mai, Chung Duc; Bès, Martine; Bourrié, Isabelle; Meynard, Donaldo; Beeckman, Tom; Selvaraj, Michael Gomez; Manabu, Ishitani; Brugidou, Christophe; Nang Do, Vinh; Guiderdoni, Emmanuel; Morel, Jean-Benoit; Gantet, Pascal

2015-01-01

Functional analyses of MADS-box transcription factors in plants have unraveled their role in major developmental programs (e.g. flowering and floral organ identity) as well as stress-related developmental processes, such as abscission, fruit ripening, and senescence. Overexpression of the rice (Oryza sativa) MADS26 gene in rice has revealed a possible function related to stress response. Here, we show that OsMADS26-down-regulated plants exhibit enhanced resistance against two major rice pathogens: Magnaporthe oryzae and Xanthomonas oryzae. Despite this enhanced resistance to biotic stresses, OsMADS26-down-regulated plants also displayed enhanced tolerance to water deficit. These phenotypes were observed in both controlled and field conditions. Interestingly, alteration of OsMADS26 expression does not have a strong impact on plant development. Gene expression profiling revealed that a majority of genes misregulated in overexpresser and down-regulated OsMADS26 lines compared with control plants are associated to biotic or abiotic stress response. Altogether, our data indicate that OsMADS26 acts as an upstream regulator of stress-associated genes and thereby, a hub to modulate the response to various stresses in the rice plant. PMID:26424158

Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

PubMed

Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

Dynamic and Widespread lncRNA Expression in a Sponge and the Origin of Animal Complexity

PubMed Central

Gaiti, Federico; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Calcino, Andrew D.; Yanai, Itai; Tanurdzic, Milos; Degnan, Bernard M.

2015-01-01

Long noncoding RNAs (lncRNAs) are important developmental regulators in bilaterian animals. A correlation has been claimed between the lncRNA repertoire expansion and morphological complexity in vertebrate evolution. However, this claim has not been tested by examining morphologically simple animals. Here, we undertake a systematic investigation of lncRNAs in the demosponge Amphimedon queenslandica, a morphologically simple, early-branching metazoan. We combine RNA-Seq data across multiple developmental stages of Amphimedon with a filtering pipeline to conservatively predict 2,935 lncRNAs. These include intronic overlapping lncRNAs, exonic antisense overlapping lncRNAs, long intergenic nonprotein coding RNAs, and precursors for small RNAs. Sponge lncRNAs are remarkably similar to their bilaterian counterparts in being relatively short with few exons and having low primary sequence conservation relative to protein-coding genes. As in bilaterians, a majority of sponge lncRNAs exhibit typical hallmarks of regulatory molecules, including high temporal specificity and dynamic developmental expression. Specific lncRNA expression profiles correlate tightly with conserved protein-coding genes likely involved in a range of developmental and physiological processes, such as the Wnt signaling pathway. Although the majority of Amphimedon lncRNAs appears to be taxonomically restricted with no identifiable orthologs, we find a few cases of conservation between demosponges in lncRNAs that are antisense to coding sequences. Based on the high similarity in the structure, organization, and dynamic expression of sponge lncRNAs to their bilaterian counterparts, we propose that these noncoding RNAs are an ancient feature of the metazoan genome. These results are consistent with lncRNAs regulating the development of animals, regardless of their level of morphological complexity. PMID:25976353

Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

PubMed Central

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

PubMed Central

Almoguera, C.; Coca, M. A.; Jordano, J.

1995-01-01

We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

Conceptualizing Child Health Disparities: A Role for Developmental Neurogenomics

PubMed Central

Francis, Darlene D.

2010-01-01

Biological, psychological, and social processes interact over a lifetime to influence health and vulnerability to disease. Those interested in studying and understanding how and why racial/ethnic and social disparities emerge need to focus on the intersection of these processes. Recent work exploring molecular epigenetic mechanisms of gene expression (in humans as well and other mammalian systems) has provided evidence demonstrating that the genome is subject to regulation by surrounding contexts (eg, cytoplasmic, cellular, organismic, social). The developing stress axis is exquisitely sensitive to regulation by social forces represented at the level of the epigenome. Old assumptions about an inert genome are simply incorrect. Epigenetic processes may provide the missing link that will allow us to understand how social and political conditions, along with individual subjective experiences, can directly alter gene expression and thereby contribute to observed social inequalities in health. Developmental neurogenomics may provide the direct link between the biological and social/psychological worlds. These biological mechanisms of plasticity (at the level of gene expression and regulation) may play a profound role in how we conceptualize health inequalities by informing our concepts regarding the somatization or embodiment of social inequalities. PMID:19861470

The Role of BDNF in the Development of Fear Learning.

PubMed

Dincheva, Iva; Lynch, Niccola B; Lee, Francis S

2016-10-01

Brain-derived neurotrophic factor (BDNF) is a growth factor that is dynamically expressed in the brain across postnatal development, regulating neuronal differentiation and synaptic plasticity. The neurotrophic hypothesis of psychiatric mood disorders postulates that in the adult brain, decreased BDNF levels leads to altered neural plasticity, contributing to disease. Although BDNF has been established as a key factor regulating the critical period plasticity in the developing visual system, it has recently been shown to also play a role in fear circuitry maturation, which has implications for the emergence of fear-related mood disorders. This review provides a detailed overview of developmental changes in expression of BDNF isoforms, as well as their receptors across postnatal life. In addition, recent developmental studies utilizing a genetic BDNF single nucleotide polymorphism (Val66Met) knock-in mouse highlight the impact of BDNF on fear learning during a sensitive period spanning the transition into adolescent time frame. We hypothesize that BDNF in the developing brain regulates fear circuit plasticity during a sensitive period in early adolescence, and alterations in BDNF expression (genetic or environmental) have a persistent impact on fear behavior and fear-related disorders. © 2016 Wiley Periodicals, Inc.

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention

PubMed Central

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V.

2012-01-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3′-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context. PMID:22661231

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention.

PubMed

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V

2012-06-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3'-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context.

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

Identification and Expression Analysis of microRNAs at the Grain Filling Stage in Rice(Oryza sativa L.)via Deep Sequencing

PubMed Central

Yi, Rong; Zhu, Zhixuan; Hu, Jihong; Qian, Qian; Dai, Jincheng; Ding, Yi

2013-01-01

MicroRNAs (miRNAs) have been shown to play crucial roles in the regulation of plant development. In this study, high-throughput RNA-sequencing technology was used to identify novel miRNAs, and to reveal miRNAs expression patterns at different developmental stages during rice (Oryza sativa L.) grain filling. A total of 434 known miRNAs (380, 402, 390 and 392 at 5, 7, 12 and 17 days after fertilization, respectively.) were obtained from rice grain. The expression profiles of these identified miRNAs were analyzed and the results showed that 161 known miRNAs were differentially expressed during grain development, a high proportion of which were up-regulated from 5 to 7 days after fertilization. In addition, sixty novel miRNAs were identified, and five of these were further validated experimentally. Additional analysis showed that the predicted targets of the differentially expressed miRNAs may participate in signal transduction, carbohydrate and nitrogen metabolism, the response to stimuli and epigenetic regulation. In this study, differences were revealed in the composition and expression profiles of miRNAs among individual developmental stages during the rice grain filling process, and miRNA editing events were also observed, analyzed and validated during this process. The results provide novel insight into the dynamic profiles of miRNAs in developing rice grain and contribute to the understanding of the regulatory roles of miRNAs in grain filling. PMID:23469249

Odors regulate Arc expression in neuronal ensembles engaged in odor processing.

PubMed

Guthrie, K; Rayhanabad, J; Kuhl, D; Gall, C

2000-06-26

Synaptic activity is critical to developmental and plastic processes that produce long-term changes in neuronal connectivity and function. Genes expressed by neurons in an activity-dependent fashion are of particular interest since the proteins they encode may mediate neuronal plasticity. One such gene encodes the activity-regulated cytoskeleton-associated protein, Arc. The present study evaluated the effects of odor stimulation on Arc expression in rat olfactory bulb. Arc mRNA was rapidly increased in functionally linked cohorts of neurons topographically activated by odor stimuli. These included neurons surrounding individual glomeruli, mitral cells and transynaptically activated granule cells. Dendritic Arc immunoreactivity was also increased in odor-activated glomeruli. Our results suggest that odor regulation of Arc expression may contribute to activity-dependent structural changes associated with olfactory experience.

Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

PubMed

Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

2005-07-01

Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

PubMed

Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

2015-04-13

Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

PubMed Central

2010-01-01

Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

Novel R2R3-MYB transcription factors from Prunus Americana regulates differential patterns of anthocyanin accumulation in tobacco and citrus

USDA-ARS?s Scientific Manuscript database

The levels of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

Novel R2R3-MYB transcription factors from Prunus americana regulate differential patterns of anthocyanin accumulation in tobacco and citrus

USDA-ARS?s Scientific Manuscript database

The level of anthocyanins in plants vary widely among cultivars, developmental stages and environmental stimuli. Previous studies have reported that the expression of various MYBs regulate anthocyanin pigmentation during growth and development. Here we examine the activity of three novel R2R3-MYB ...

Identification and expression analysis of a novel stylicin antimicrobial peptide from Kuruma shrimp (Marsupenaeus japonicus).

PubMed

Liu, Hong-tao; Wang, Jun; Mao, Yong; Liu, Min; Niu, Su-fang; Qiao, Ying; Su, Yong-quan; Wang, Chun-zhong; Zheng, Zhi-peng

2015-12-01

Antimicrobial peptides (AMPs) are important components of the innate immune system and function as the first line of defense against invading pathogens. In current study we identified, cloned and characterized a novel stylicin AMP from Kuruma shrimp Marsupenaeus japonicus (Mj-sty). The full-length cDNA of Mj-sty was 428 bp with an open reading frame of 315 bp that encoded 104 amino acids. The theoretical molecular mass of mature Mj-sty was 8.693 kDa with an isoelectric point (pI) of 4.79. A proline-rich N-terminal region and a C-terminal region contained 13 cysteine residues were identified. Genomic sequence analysis with respect to its cDNA showed that Mj-sty was organized into two exons interrupted by one intron. Tissue-specific expression revealed that Mj-sty was mainly transcribed in gills and hemocytes. Expression of Mj-sty in early developmental stages demonstrated that Mj-sty mRNA were present from fertilized eggs to post-larvae of 17 days (PL17), and the expression levels showed a significant variation in different developmental stages. After challenge of white spot syndrome virus (WSSV), the time-dependent expression pattern of Mj-sty in both gills and hepatopancrease showed down-regulation at the early hours of infection, subsequently up-regulation and down-regulation, and then up-regulation at the end hours to almost the half of the controls. The results indicate that Mj-sty is potentially involved in the ontogenesis and immune responses against WSSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

PubMed

Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

2002-05-01

Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

PubMed

Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

2010-08-01

Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

Genome-wide dynamics of alternative polyadenylation in rice

PubMed Central

Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

2016-01-01

Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

PubMed Central

Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies. PMID:23145190

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

PubMed

Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies.

Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

PubMed Central

Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

2011-01-01

PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

Genome-wide expression profiling of in vivo-derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

PubMed Central

Kabani, Sarah; Fenn, Katelyn; Ross, Alan; Ivens, Al; Smith, Terry K; Ghazal, Peter; Matthews, Keith

2009-01-01

Background Trypanosomes undergo extensive developmental changes during their complex life cycle. Crucial among these is the transition between slender and stumpy bloodstream forms and, thereafter, the differentiation from stumpy to tsetse-midgut procyclic forms. These developmental events are highly regulated, temporally reproducible and accompanied by expression changes mediated almost exclusively at the post-transcriptional level. Results In this study we have examined, by whole-genome microarray analysis, the mRNA abundance of genes in slender and stumpy forms of T.brucei AnTat1.1 cells, and also during their synchronous differentiation to procyclic forms. In total, five biological replicates representing the differentiation of matched parasite populations derived from five individual mouse infections were assayed, with RNAs being derived at key biological time points during the time course of their synchronous differentiation to procyclic forms. Importantly, the biological context of these mRNA profiles was established by assaying the coincident cellular events in each population (surface antigen exchange, morphological restructuring, cell cycle re-entry), thereby linking the observed gene expression changes to the well-established framework of trypanosome differentiation. Conclusion Using stringent statistical analysis and validation of the derived profiles against experimentally-predicted gene expression and phenotypic changes, we have established the profile of regulated gene expression during these important life-cycle transitions. The highly synchronous nature of differentiation between stumpy and procyclic forms also means that these studies of mRNA profiles are directly relevant to the changes in mRNA abundance within individual cells during this well-characterised developmental transition. PMID:19747379

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

PubMed Central

van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

1999-01-01

The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

Developmental origin of lung macrophage diversity

PubMed Central

Tan, Serena Y. S.; Krasnow, Mark A.

2016-01-01

Macrophages are specialized phagocytic cells, present in all tissues, which engulf and digest pathogens, infected and dying cells, and debris, and can recruit and regulate other immune cells and the inflammatory response and aid in tissue repair. Macrophage subpopulations play distinct roles in these processes and in disease, and are typically recognized by differences in marker expression, immune function, or tissue of residency. Although macrophage subpopulations in the brain have been found to have distinct developmental origins, the extent to which development contributes to macrophage diversity between tissues and within tissues is not well understood. Here, we investigate the development and maintenance of mouse lung macrophages by marker expression patterns, genetic lineage tracing and parabiosis. We show that macrophages populate the lung in three developmental waves, each giving rise to a distinct lineage. These lineages express different markers, reside in different locations, renew in different ways, and show little or no interconversion. Thus, development contributes significantly to lung macrophage diversity and targets each lineage to a different anatomical domain. PMID:26952982

Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

PubMed

Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

2018-04-11

The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

Coordination of flower development by homeotic master regulators.

PubMed

Ito, Toshiro

2011-02-01

Floral homeotic genes encode transcription factors and act as master regulators of flower development. The homeotic protein complex is expressed in a specific whorl of the floral primordium and determines floral organ identity by the combinatorial action. Homeotic proteins continue to be expressed until late in flower development to coordinate growth and organogenesis. Recent genomic studies have shown that homeotic proteins bind thousands of target sites in the genome and regulate the expression of transcription factors, chromatin components and various proteins involved in hormone biosynthesis and signaling and other physiological activities. Further, homeotic proteins program chromatin to direct the developmental coordination of stem cell maintenance and differentiation in shaping floral organs. Copyright © 2010 Elsevier Ltd. All rights reserved.

DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

PubMed Central

Hua, Brian L.; Orr-Weaver, Terry L.

2017-01-01

Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

PubMed

Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

PubMed Central

Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

Enhancer modularity and the evolution of new traits.

PubMed

Koshikawa, Shigeyuki

2015-01-01

Animals have modular cis-regulatory regions in their genomes, and expression of a single gene is often regulated by multiple enhancers residing in such a region. In the laboratory, and also in natural populations, loss of an enhancer can result in a loss of gene expression. Although only a few examples have been well characterized to date, some studies have suggested that an evolutionary gain of a new enhancer function can establish a new gene expression domain. Our recent study showed that Drosophila guttifera has more enhancers and additional expression domains of the wingless gene during the pupal stage, compared to D. melanogaster, and that these new features appear to have evolved in the ancestral lineage leading to D. guttifera. (1) Gain of a new expression domain of a developmental regulatory gene (toolkit gene), such as wingless, can cause co-option of the expression of its downstream genes to the new domain, resulting in duplication of a preexisting structure at this new body position. Recently, with the advancement of evo-devo studies, we have learned that the developmental regulatory systems are strikingly similar across various animal taxa, in spite of the great diversity of the animals' morphology. Even behind "new" traits, co-options of essential developmental genes from known systems are very common. We previously provided concrete evidence of gains of enhancer activities of a developmental regulatory gene underlying gains of new traits. (1) Broad occurrence of this scenario is testable and should be validated in the future.

Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

PubMed

Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

2009-04-01

Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

Evolution of developmental regulation in the vertebrate FgfD subfamily.

PubMed

Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

2010-01-15

Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

PubMed Central

2013-01-01

Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes important to early stages of mushroom fruiting development, though their precise molecular functions and biological roles are not yet fully known. This study serves to advance our understanding of the molecular mechanisms of fruiting body development in the model mushroom C. cinerea. PMID:23514374

microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach.

PubMed

Macchiaroli, Natalia; Cucher, Marcela; Zarowiecki, Magdalena; Maldonado, Lucas; Kamenetzky, Laura; Rosenzvit, Mara Cecilia

2015-02-06

microRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in fundamental biological processes such as development and metabolism. The particular developmental and metabolic characteristics of cestode parasites highlight the importance of studying miRNA gene regulation in these organisms. Here, we perform a comprehensive analysis of miRNAs in the parasitic cestode Echinococcus canadensis G7, one of the causative agents of the neglected zoonotic disease cystic echinococcosis. Small RNA libraries from protoscoleces and cyst walls of E. canadensis G7 and protoscoleces of E. granulosus sensu stricto G1 were sequenced using Illumina technology. For miRNA prediction, miRDeep2 core algorithm was used. The output list of candidate precursors was manually curated to generate a high confidence set of miRNAs. Differential expression analysis of miRNAs between stages or species was estimated with DESeq. Expression levels of selected miRNAs were validated using poly-A RT-qPCR. In this study we used a high-throughput approach and found transcriptional evidence of 37 miRNAs thus expanding the miRNA repertoire of E. canadensis G7. Differential expression analysis showed highly regulated miRNAs between life cycle stages, suggesting a role in maintaining the features of each developmental stage or in the regulation of developmental timing. In this work we characterize conserved and novel Echinococcus miRNAs which represent 30 unique miRNA families. Here we confirmed the remarkable loss of conserved miRNA families in E. canadensis, reflecting their low morphological complexity and high adaptation to parasitism. We performed the first in-depth study profiling of small RNAs in the zoonotic parasite E. canadensis G7. We found that miRNAs are the preponderant small RNA silencing molecules, suggesting that these small RNAs could be an essential mechanism of gene regulation in this species. We also identified both parasite specific and divergent miRNAs which are potential biomarkers of infection. This study will provide valuable information for better understanding of the complex biology of this parasite and could help to find new potential targets for therapy and/or diagnosis.

Expression of Glycosaminoglycan Epitopes During Zebrafish Skeletogenesis

PubMed Central

Hayes, Anthony J; Mitchell, Ruth E; Bashford, Andrew; Reynolds, Scott; Caterson, Bruce; Hammond, Chrissy L

2013-01-01

Background: The zebrafish is an important developmental model. Surprisingly, there are few studies that describe the glycosaminoglycan composition of its extracellular matrix during skeletogenesis. Glycosaminoglycans on proteoglycans contribute to the material properties of musculo skeletal connective tissues, and are important in regulating signalling events during morphogenesis. Sulfation motifs within the chain structure of glycosaminoglycans on cell-associated and extracellular matrix proteoglycans allow them to bind and regulate the sequestration/presentation of bioactive signalling molecules important in musculo-skeletal development. Results: We describe the spatio-temporal expression of different glycosaminoglycan moieties during zebrafish skeletogenesis with antibodies recognising (1) native sulfation motifs within chondroitin and keratan sulfate chains, and (2) enzyme-generated neoepitope sequences within the chain structure of chondroitin sulfate (i.e., 0-, 4-, and 6-sulfated isoforms) and heparan sulfate glycosaminoglycans. We show that all the glycosaminoglycan moieties investigated are expressed within the developing skeletal tissues of larval zebrafish. However, subtle changes in their patterns of spatio-temporal expression over the period examined suggest that their expression is tightly and dynamically controlled during development. Conclusions: The subtle differences observed in the domains of expression between different glycosaminoglycan moieties suggest differences in their functional roles during establishment of the primitive analogues of the skeleton. Developmental Dynamics 242:778–789, 2013. © 2013 Wiley Periodicals, Inc. Key Findings The developing zebrafish skeleton expresses many different glycosaminoglycan modifications. Multiple different glycosaminoglycan epitopes are dynamically expressed in the craniofacial skeleton. Expression of chondroitin sulfate moieties are dynamically expressed in the vertebral column and precede mineralisation. PMID:23576310

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

Characterization of the cork oak transcriptome dynamics during acorn development.

PubMed

Miguel, Andreia; de Vega-Bartol, José; Marum, Liliana; Chaves, Inês; Santo, Tatiana; Leitão, José; Varela, Maria Carolina; Miguel, Célia M

2015-06-25

Cork oak (Quercus suber L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water. A total of 80,357 expressed sequence tags (ESTs) were de novo assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in Q. suber transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability. To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.

Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

PubMed

Eickelberg, Garrett J; Fisher, Alison J

2013-01-01

We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

Developmental expression and estrogen responses of endocrine genes in juvenile yellow perch (Perca flavescens)

USDA-ARS?s Scientific Manuscript database

The present study examines the expression of growth-regulating genes (gh, prl, smtl and igf1b), the estrogen receptors (esr1 and esr2a) and aromatase (cyp19a1a) in developing yellow perch. To gain an initial understanding into the endocrine control of growth preceding and involved with sexual size d...

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

USDA-ARS?s Scientific Manuscript database

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

PubMed

Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

2015-06-01

Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Developmental Role and Auxin Responsiveness of Class III Homeodomain Leucine Zipper Gene Family Members in Rice1[C][W][OA

PubMed Central

Itoh, Jun-Ichi; Hibara, Ken-Ichiro; Sato, Yutaka; Nagato, Yasuo

2008-01-01

Members of the Class III homeodomain leucine zipper (Class III HD-Zip) gene family are central regulators of crucial aspects of plant development. To better understand the roles of five Class III HD-Zip genes in rice (Oryza sativa) development, we investigated their expression patterns, ectopic expression phenotypes, and auxin responsiveness. Four genes, OSHB1 to OSHB4, were expressed in a localized domain of the shoot apical meristem (SAM), the adaxial cells of leaf primordia, the leaf margins, and the xylem tissue of vascular bundles. In contrast, expression of OSHB5 was observed only in phloem tissue. Plants ectopically expressing microRNA166-resistant versions of the OSHB3 gene exhibited severe defects, including the ectopic production of leaf margins, shoots, and radialized leaves. The treatment of seedlings with auxin quickly induced ectopic OSHB3 expression in the entire region of the SAM, but not in other tissues. Furthermore, this ectopic expression of OSHB3 was correlated with leaf initiation defects. Our findings suggest that rice Class III HD-Zip genes have conserved functions with their homologs in Arabidopsis (Arabidopsis thaliana), but have also acquired specific developmental roles in grasses or monocots. In addition, some Class III HD-Zip genes may regulate the leaf initiation process in the SAM in an auxin-dependent manner. PMID:18567825

Theory of Mind, Socio-Emotional Problem-Solving, Socio-Emotional Regulation in Children with Intellectual Disability and in Typically Developing Children

ERIC Educational Resources Information Center

Baurain, Celine; Nader-Grosbois, Nathalie

2013-01-01

This study has examined the link between social information processing (SIP) and socio-emotional regulation (SER) in 45 children with intellectual disability (ID) and 45 typically developing (TD) children, matched on their developmental age. A Coding Grid of SER, focusing on Emotional Expression, Social Behaviour and Behaviours towards Social…

Wt1 flip-flops chromatin in a CTCF domain.

PubMed

Gurudatta, B V; Corces, Victor G

2011-09-13

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

Regulation of the epithelial adhesion molecule CEACAM1 is important for palate formation.

PubMed

Mima, Junko; Koshino, Aya; Oka, Kyoko; Uchida, Hitoshi; Hieda, Yohki; Nohara, Kanji; Kogo, Mikihiko; Chai, Yang; Sakai, Takayoshi

2013-01-01

Cleft palate results from a mixture of genetic and environmental factors and occurs when the bilateral palatal shelves fail to fuse. The objective of this study was to search for new genes involved in mouse palate formation. Gene expression of murine embryonic palatal tissue was analyzed at various developmental stages before, during, and after palate fusion using GeneChip® microarrays. Ceacam1 was one of the highly up-regulated genes during palate formation, and this was confirmed by quantitative real-time PCR. Immunohistochemical staining showed that CEACAM1 was present in prefusion palatal epithelium and was degraded during fusion. To investigate the developmental role of CEACAM1, function-blocking antibody was added to embryonic mouse palate in organ culture. Palatal fusion was inhibited by this function-blocking antibody. To investigate the subsequent developmental role of CEACAM1, we characterized Ceacam1-deficient (Ceacam1(-/-)) mice. Epithelial cells persisted abnormally at the midline of the embryonic palate even on day E16.0, and palatal fusion was delayed in Ceacam1(-/-) mice. TGFβ3 expression, apoptosis, and cell proliferation in palatal epithelium were not affected in the palate of Ceacam1(-/-)mice. However, CEACAM1 expression was retained in the remaining MEE of TGFβ-deficient mice. These results suggest that CEACAM1 has roles in the initiation of palatal fusion via epithelial cell adhesion.

Phenotypic Checkpoints Regulate Neuronal Development

PubMed Central

Ben-Ari, Yehezkel; Spitzer, Nicholas C.

2010-01-01

Nervous system development proceeds by sequential gene expression mediated by cascades of transcription factors in parallel with sequences of patterned network activity driven by receptors and ion channels. These sequences are cell type- and developmental stage-dependent and modulated by paracrine actions of substances released by neurons and glia. How and to what extent these sequences interact to enable neuronal network development is not understood. Recent evidence demonstrates that CNS development requires intermediate stages of differentiation providing functional feedback that influences gene expression. We suggest that embryonic neuronal functions constitute a series of phenotypic checkpoint signatures; neurons failing to express these functions are delayed or developmentally arrested. Such checkpoints are likely to be a general feature of neuronal development and may constitute presymptomatic signatures of neurological disorders when they go awry. PMID:20864191

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

PubMed Central

2012-01-01

Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental stages as well as in barley cultivars with different seed size was evidenced for both genes. The two barley Type I MADS-box genes were found to be induced by ABA and JA. DNA methylation differences in different seed developmental stages and after exogenous application of ABA is suggestive of epigenetic regulation of gene expression. The study of barley Type I-like MADS-box genes extends our investigations of gene regulation during endosperm and seed development in a monocot crop like barley. PMID:22985436

ONTOGENIC EXPRESSION OF HUMAN CARBOXYLESTERASE-2 AND CYTOCHROME P450 3A4 IN LIVER AND DUODENUM: POSTNATAL SURGE AND ORGAN-DEPENDENT REGULATION1

PubMed Central

Chen, Yi-Tzai; Trzoss, Lynnie; Yang, Dongfang; Yan, Bingfang

2015-01-01

Human carboxylesterase-2 (CES2) and cytochrome P450 3A4 (CYP3A4) are two major drug metabolizing enzymes that play critical roles in hydrolytic and oxidative biotransformation, respectively. They share substrates but may have opposite effect on therapeutic potential such as the metabolism of the anticancer prodrug irinotecan. Both CES2 and CYP3A4 are expressed in the liver and the gastrointestinal tract. This study was conducted to determine whether CES2 and CYP3A4 are expressed under developmental regulation and whether the regulation occurs differentially between the liver and duodenum. A large number of tissues (112) were collected with majority of them from donors at 1-198 days of age. In addition, multi-sampling (liver, duodenum and jejunum) was performed in some donors. The expression was determined at mRNA and protein levels. In the liver, CES2 and CYP3A4 mRNA exhibited a postnatal surge (1 versus 2 months of age) by 2.7 and 29 fold, respectively. CYP3A4 but not CES2 mRNA in certain pediatric groups reached or even exceeded the adult level. The duodenal samples, on the other hand, showed a gene-specific expression pattern at mRNA level. CES2 mRNA increased with age but the opposite was true with CYP3A4 mRNA. The levels of CES2 and CYP3A4 protein, on the other hand, increased with age in both liver and duodenum. The multi-sampling study demonstrated significant correlation of CES2 expression between the duodenum and jejunum. However, neither duodenal nor jejunal expression correlated with hepatic expression of CES2. These findings establish that developmental regulation occurs in a gene and organ-dependent manner. PMID:25724353

Information Propagation in Developmental Enhancers

NASA Astrophysics Data System (ADS)

Jena, Siddhartha; Levine, Michael

Rather than encoding information about protein sequence, certain lengths of noncoding DNA, called enhancers, interact with protein machinery such as transcription factors to precisely regulate gene expression. Enhancers have been studied extensively in the fruit fly Drosophila melanogaster, where they regulate the expression of developmental genes that establish the blueprint of the adult fly. It has been suggested that enhancer sequences possess a specific but unknown syntax with regards to the placement and strength of transcription factor binding sites. Moreover, studies in divergent fly species have shown that compensatory evolution allows for maintenance of enhancer functionality despite considerable variation in primary DNA sequence. Here, the possible role of enhancers as signal processing modules is studied as a way of explaining these two findings. We first demonstrate how this framework can be used to explain the fine-tuned spatiotemporal dynamics of gene expression. We then explore the evolutionary pressure on enhancer sequences and the resulting emergence of enhancers that are linked by compensatory mutations. This study provides a possible mechanism for the function of multiple enhancers linked to a single gene.

Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

PubMed Central

Kaneko, Kunihiko

2011-01-01

The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

Micro-RNAs and their roles in eye disorders.

PubMed

Raghunath, Azhwar; Perumal, Ekambaram

2015-01-01

Micro-RNAs (miRNAs) are members of the family of noncoding RNA molecules that regulate gene expression by translational repression and mRNA degradation. Initial identification of miRNAs revealed them only as developmental regulators; later, their radiated roles in various cellular processes have been established. They regulate several pathways, including developmental timing, hematopoiesis, organogenesis, apoptosis, cell differentiation and proliferation. Their roles in eye disorders are being explored by biologists around the world. Eye physiology requires the perfect orchestration of all the regulatory networks; any defect in any of the networks leads to eye disorders. The dysregulation of miRNA expression has been reported in many eye disorders, which paves the way for new therapeutics. This review summarizes the biogenesis of miRNAs and their role in eye disorders. miRNA studies also have implications for the understanding of various complex metabolic pathways leading to disorders of the eye. The ultimate understanding leads to potential opportunities in evaluating miRNAs as molecular biomarkers, prognostic tools, diagnostic tools and therapeutic agents for eye disorders. © 2015 S. Karger AG, Basel.

Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

PubMed Central

Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

2010-01-01

Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

Patterns of expression of position-dependent integrated transgenes in mouse embryo.

PubMed Central

Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

1990-01-01

The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

Developmental stage-specific regulation of the circadian clock by temperature in zebrafish.

PubMed

Lahiri, Kajori; Froehlich, Nadine; Heyd, Andreas; Foulkes, Nicholas S; Vallone, Daniela

2014-01-01

The circadian clock enables animals to adapt their physiology and behaviour in anticipation of the day-night cycle. Light and temperature represent two key environmental timing cues (zeitgebers) able to reset this mechanism and so maintain its synchronization with the environmental cycle. One key challenge is to unravel how the regulation of the clock by zeitgebers matures during early development. The zebrafish is an ideal model for studying circadian clock ontogeny since the process of development occurs ex utero in an optically transparent chorion and many tools are available for genetic analysis. However, the role played by temperature in regulating the clock during zebrafish development is poorly understood. Here, we have established a clock-regulated luciferase reporter transgenic zebrafish line (Tg (-3.1) per1b::luc) to study the effects of temperature on clock entrainment. We reveal that under complete darkness, from an early developmental stage onwards (48 to 72 hpf), exposure to temperature cycles is a prerequisite for the establishment of self-sustaining rhythms of zfper1b, zfaanat2, and zfirbp expression and also for circadian cell cycle rhythms. Furthermore, we show that following the 5-9 somite stage, the expression of zfper1b is regulated by acute temperature shifts.

FRUITFULL controls SAUR10 expression and regulates Arabidopsis growth and architecture.

PubMed

Bemer, Marian; van Mourik, Hilda; Muiño, Jose M; Ferrándiz, Cristina; Kaufmann, Kerstin; Angenent, Gerco C

2017-06-15

MADS-domain transcription factors are well known for their roles in plant development and regulate sets of downstream genes that have been uncovered by high-throughput analyses. A considerable number of these targets are predicted to function in hormone responses or responses to environmental stimuli, suggesting that there is a close link between developmental and environmental regulators of plant growth and development. Here, we show that the Arabidopsis MADS-domain factor FRUITFULL (FUL) executes several functions in addition to its noted role in fruit development. Among the direct targets of FUL, we identified SMALL AUXIN UPREGULATED RNA 10 (SAUR10), a growth regulator that is highly induced by a combination of auxin and brassinosteroids and in response to reduced R:FR light. Interestingly, we discovered that SAUR10 is repressed by FUL in stems and inflorescence branches. SAUR10 is specifically expressed at the abaxial side of these branches and this localized activity is influenced by hormones, light conditions and by FUL, which has an effect on branch angle. Furthermore, we identified a number of other genes involved in hormone pathways and light signalling as direct targets of FUL in the stem, demonstrating a connection between developmentally and environmentally regulated growth programs. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

PubMed Central

Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

2014-01-01

Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

Arabidopsis REGULATOR OF AXILLARY MERISTEMS1 controls a leaf axil stem cell niche and modulates vegetative development.

PubMed

Keller, Thomas; Abbott, Jessica; Moritz, Thomas; Doerner, Peter

2006-03-01

Shoot branching is a major determinant of variation in plant stature. Branches, which form secondary growth axes, originate from stem cells activated in leaf axils. The initial steps by which axillary meristems (AMs) are specified and their stem cells organized are still poorly understood. We identified gain- and loss-of-function alleles at the Arabidopsis thaliana REGULATOR OF AXILLARY MERISTEMS1 (RAX1) locus. RAX1 is encoded by the Myb-like transcription factor MYB37 and is an Arabidopsis homolog of the tomato (Solanum lycopersicum) Blind gene. RAX1 is transiently expressed in a small central domain within the boundary zone separating shoot apical meristem and leaf primordia early in leaf primordium development. RAX1 genetically interacts with CUP-SHAPED COTYLEDON (CUC) genes and is required for the expression of CUC2 in the RAX1 expression domain, suggesting that RAX1 acts through CUC2. We propose that RAX1 functions to positionally specify a stem cell niche for AM formation. RAX1 also affects the timing of developmental phase transitions by negatively regulating gibberellic acid levels in the shoot apex. RAX1 thus defines a novel activity that links the specification of AM formation with the modulation of the rate of progression through developmental phases.

Mobile microRNAs hit the target.

PubMed

Gursanscky, Nial R; Searle, Iain R; Carroll, Bernard J

2011-11-01

MicroRNAs (miRNAs) are negative regulators of gene expression in eukaryotic organisms, whereas small interfering RNAs (siRNAs) guide host-cell defence against viruses, transposons and transgenes. A key issue in plant biology is whether miRNAs act only in cells in which they are formed, or if, like siRNAs, they also function after passive diffusion or active transportation into other cells. Recent reports show that miRNAs are indeed able to move between plant cells to direct developmental programming of gene expression. In both leaf and root development, miRNAs establish intercellular gradients of gene expression that are essential for cell and tissue differentiation. Gradients in gene expression also play crucial roles in animal development, and there is strong evidence for intercellular movement of miRNAs in animals. Thus, intercellular movement of miRNAs may be crucial to animal developmental biology as well as plants. © 2011 John Wiley & Sons A/S.

Definition of Drosophila hemocyte subsets by cell-type specific antigens.

PubMed

Kurucz, Eva; Váczi, B; Márkus, R; Laurinyecz, Barbara; Vilmos, P; Zsámboki, J; Csorba, Kinga; Gateff, Elisabeth; Hultmark, D; Andó, I

2007-01-01

We analyzed the heterogeneity of Drosophila hemocytes on the basis of the expression of cell-type specific antigens. The antigens characterize distinct subsets which partially overlap with those defined by morphological criteria. On the basis of the expression or the lack of expression of blood cell antigens the following hemocyte populations have been defined: crystal cells, plasmatocytes, lamellocytes and precursor cells. The expression of the antigens and thus the different cell types are developmentally regulated. The hemocytes are arranged in four main compartments: the circulating blood cells, the sessile tissue, the lymph glands and the posterior hematopoietic tissue. Each hemocyte compartment has a specific and characteristic composition of the various cell types. The described markers represent the first successful attempt to define hemocyte lineages by immunological markers in Drosophila and help to define morphologically, functionally, spatially and developmentally distinct subsets of hemocytes.

Exposure to butachlor causes thyroid endocrine disruption and promotion of metamorphosis in Xenopus laevis.

PubMed

Li, Shuying; Li, Meng; Wang, Qiangwei; Gui, Wenjun; Zhu, Guonian

2016-06-01

Butachlor is extensively applied in rice paddy ecosystem in china, and has been widespread contaminant in the aquatic environment. Here, Xenopus laevis was used for the evaluation of teratogenesis developmental toxicity, and disruption of thyroid system when exposure to different concentrations of butachlor by window phase exposure. Acute toxicity investigation shown that 96 h-LC50 value of butachlor was 1.424 mg L(-1) and 0.962 mg L(-1) for tadpoles (starting from stages 46/47) and embryos (starting from stages 8/9), respectively. Exposure to butachlor caused malformation, including abnormal eye, pericardial edema, enlarged proctodaeum and bent tail. Window phase exposure test indicated that butachlor significantly promote the contents of whole-body thyroid hormones (THs, T3 and T4) at higher levels, indicating thyroid endocrine disruption. At 7 days, exposure to butachlor up-regulated the mRNA expression of genes involved in THs synthesis and metabolism (tshα, tg, tpo and dio1) and THs receptors (trα and trβ). At 14 days, up-regulation of the mRNA expression of genes related to THs synthesis and metabolism (tshα, tshβ, tg, tpo, dio1, dio2 and ttr) and THs receptors (trβ) were also observed after the exposure to butachlor. At 21 days, butachlor up-regulated the mRNA expression of tshα, tg, tpo genes and down-regulated the mRNA expression of tshβ, tg, dio1, ttr and trα genes. These results showed that butachlor could change the mRNA expression of genes involved in the HPT axis and increase whole-body thyroid hormones levels of X. laevis tadpoles in a dose- and time-dependent manner, causing thyroid endocrine disruption and developmental toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

PubMed Central

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna.

PubMed

Ku, Hui-Yu; Sun, Y Henry

2017-07-01

Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.

Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna

PubMed Central

2017-01-01

Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields. PMID:28708823

Retinal Determination genes function along with cell-cell signals to regulate Drosophila eye development: examples of multi-layered regulation by Master Regulators

PubMed Central

Baker, Nicholas E.; Firth, Lucy C.

2015-01-01

It is thought that Retinal Determination gene products define the response made to cell-cell signals within the eye developmental field by binding to enhancers of genes that are also regulated by cell-cell signaling pathways. In Drosophila, Retinal Determination genes including Eyeless, teashirt, eyes absent, dachsous and sine oculis, are required for normal eye development and can induce ectopic eyes when mis-expressed. Characterization of the enhancers responsible for eye expression of the hedgehog, shaven, and atonal genes, as well as the dynamics of Retinal Determination gene expression themselves, now suggest a multilayered network whereby transcriptional regulation by either Retinal Determination genes or cell-cell signaling pathways can sometimes be indirect and mediated by other transcription factor intermediates. In this updated view of the interaction between extracellular information and cell intrinsic programs during development, regulation of individual genes might sometimes be several steps removed from either the Retinal Determination genes or cell-cell signaling pathways that nevertheless govern their expression. PMID:21607995

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Developmental expression of Toll‑like receptors in the guinea pig lung.

PubMed

Ma, Lingjie; Yang, Jiali; Yang, Li; Shi, Juan; Xue, Jing; Li, Yong; Liu, Xiaoming

2017-03-01

The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders.

PubMed

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M; Weinberger, Daniel R; Kleinman, Joel E; Law, Amanda J

2017-03-01

Genes implicated in schizophrenia are enriched in networks differentially regulated during human CNS development. Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Isoform-specific increases in NRG3 are observed in schizophrenia and associated with rs10748842, a NRG3 risk polymorphism, suggesting NRG3 transcriptional dysregulation as a molecular mechanism of risk. The authors quantitatively mapped the temporal trajectories of NRG3 isoforms (classes I-IV) in the neocortex throughout the human lifespan, examined whether tissue-specific regulation of NRG3 occurs in humans, and determined if abnormalities in NRG3 transcriptomics occur in mood disorders and are genetically determined. NRG3 isoform classes I-IV were quantified using quantitative real-time polymerase chain reaction in human postmortem dorsolateral prefrontal cortex from 286 nonpsychiatric control individuals, from gestational week 14 to 85 years old, and individuals diagnosed with either bipolar disorder (N=34) or major depressive disorder (N=69). Tissue-specific mapping was investigated in several human tissues. rs10748842 was genotyped in individuals with mood disorders, and association with NRG3 isoform expression examined. NRG3 classes displayed individually specific expression trajectories across human neocortical development and aging; classes I, II, and IV were significantly associated with developmental stage. NRG3 class I was increased in bipolar and major depressive disorder, consistent with observations in schizophrenia. NRG3 class II was increased in bipolar disorder, and class III was increased in major depression. The rs10748842 risk genotype predicted elevated class II and III expression, consistent with previous reports in the brain, with tissue-specific analyses suggesting that classes II and III are brain-specific isoforms of NRG3. Mapping the temporal expression of genes during human brain development provides vital insight into gene function and identifies critical sensitive periods whereby genetic factors may influence risk for psychiatric disease. Here the authors provide comprehensive insight into the transcriptional landscape of the psychiatric risk gene, NRG3, in human neocortical development and expand on previous findings in schizophrenia to identify increased expression of developmentally and genetically regulated isoforms in the brain of patients with mood disorders. Principally, the finding that NRG3 classes II and III are brain-specific isoforms predicted by rs10748842 risk genotype and are increased in mood disorders further implicates a molecular mechanism of psychiatric risk at the NRG3 locus and identifies a potential developmental role for NRG3 in bipolar disorder and major depression. These observations encourage investigation of the neurobiology of NRG3 isoforms and highlight inhibition of NRG3 signaling as a potential target for psychiatric treatment development.

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders

PubMed Central

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M.; Weinberger, Daniel R.; Kleinman, Joel E.; Law, Amanda J.

2018-01-01

Objective Genes implicated in schizophrenia are enriched in networks differentially regulated during human CNS development. Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Isoform-specific increases in NRG3 are observed in schizophrenia and associated with rs10748842, a NRG3 risk polymorphism, suggesting NRG3 transcriptional dysregulation as a molecular mechanism of risk. The authors quantitatively mapped the temporal trajectories of NRG3 isoforms (classes I–IV) in the neocortex throughout the human lifespan, examined whether tissue-specific regulation of NRG3 occurs in humans, and determined if abnormalities in NRG3 transcriptomics occur in mood disorders and are genetically determined. Method NRG3 isoform classes I–IV were quantified using quantitative real-time polymerase chain reaction in human postmortem dorsolateral prefrontal cortex from 286 nonpsychiatric control individuals, from gestational week 14 to 85 years old, and individuals diagnosed with either bipolar disorder (N=34) or major depressive disorder (N=69). Tissue-specific mapping was investigated in several human tissues. rs10748842 was genotyped in individuals with mood disorders, and association with NRG3 isoform expression examined. Results NRG3 classes displayed individually specific expression trajectories across human neocortical development and aging; classes I, II, and IV were significantly associated with developmental stage. NRG3 class I was increased in bipolar and major depressive disorder, consistent with observations in schizophrenia. NRG3 class II was increased in bipolar disorder, and class III was increased in major depression. The rs10748842 risk genotype predicted elevated class II and III expression, consistent with previous reports in the brain, with tissue-specific analyses suggesting that classes II and III are brain-specific isoforms of NRG3. Conclusions Mapping the temporal expression of genes during human brain development provides vital insight into gene function and identifies critical sensitive periods whereby genetic factors may influence risk for psychiatric disease. Here the authors provide comprehensive insight into the transcriptional landscape of the psychiatric risk gene, NRG3, in human neocortical development and expand on previous findings in schizophrenia to identify increased expression of developmentally and genetically regulated isoforms in the brain of patients with mood disorders. Principally, the finding that NRG3 classes II and III are brain-specific isoforms predicted by rs10748842 risk genotype and are increased in mood disorders further implicates a molecular mechanism of psychiatric risk at the NRG3 locus and identifies a potential developmental role for NRG3 in bipolar disorder and major depression. These observations encourage investigation of the neurobiology of NRG3 isoforms and highlight inhibition of NRG3 signaling as a potential target for psychiatric treatment development. PMID:27771971

Neuropeptide Y2 Receptor (NPY2R) Expression in Saliva Predicts Feeding Immaturity in the Premature Neonate

PubMed Central

Maron, Jill L.; Johnson, Kirby L.; Dietz, Jessica A.; Chen, Minghua L.; Bianchi, Diana W.

2012-01-01

Background The current practice in newborn medicine is to subjectively assess when a premature infant is ready to feed by mouth. When the assessment is inaccurate, the resulting feeding morbidities may be significant, resulting in long-term health consequences and millions of health care dollars annually. We hypothesized that the developmental maturation of hypothalamic regulation of feeding behavior is a predictor of successful oral feeding in the premature infant. To test this hypothesis, we analyzed the gene expression of neuropeptide Y2 receptor (NPY2R), a known hypothalamic regulator of feeding behavior, in neonatal saliva to determine its role as a biomarker in predicting oral feeding success in the neonate. Methodology/Principal Findings Salivary samples (n = 116), were prospectively collected from 63 preterm and 13 term neonates (post-conceptual age (PCA) 26 4/7 to 41 4/7 weeks) from five predefined feeding stages. Expression of NPY2R in neonatal saliva was determined by multiplex RT-qPCR amplification. Expression results were retrospectively correlated with feeding status at time of sample collection. Statistical analysis revealed that expression of NPY2R had a 95% positive predictive value for feeding immaturity. NPY2R expression statistically significantly decreased with advancing PCA (Wilcoxon test p value<0.01), and was associated with feeding status (chi square p value  =  0.013). Conclusions/Significance Developmental maturation of hypothalamic regulation of feeding behavior is an essential component of oral feeding success in the newborn. NPY2R expression in neonatal saliva is predictive of an immature feeding pattern. It is a clinically relevant biomarker that may be monitored in saliva to improve clinical care and reduce significant feeding-associated morbidities that affect the premature neonate. PMID:22629465

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila.

PubMed

Pan, Jia Wern; McLaughlin, Joi; Yang, Haining; Leo, Charles; Rambarat, Paula; Okuwa, Sumie; Monroy-Eklund, Anaïs; Clark, Sabrina; Jones, Corbin D; Volkan, Pelin Cayirlioglu

2017-10-02

Carbon dioxide is an important environmental cue for many insects, regulating many behaviors including some that have direct human impacts. To further improve our understanding of how this system varies among closely related insect species, we examined both the behavioral response to CO 2 as well as the transcriptional profile of key developmental regulators of CO 2 sensory neurons in the olfactory system across the Drosophila genus. We found that CO 2 generally evokes repulsive behavior across most of the Drosophilids we examined, but this behavior has been lost or reduced in several lineages. Comparisons of transcriptional profiles from the developing and adult antennae for subset these species suggest that behavioral differences in some species may be due to differences in the expression of the CO 2 co-receptor Gr63a. Furthermore, these differences in Gr63a expression are correlated with changes in the expression of a few genes known to be involved in the development of the CO 2 circuit, namely dac, an important regulator of sensilla fate for sensilla that house CO 2 ORNs, and mip120, a member of the MMB/dREAM epigenetic regulatory complex that regulates CO 2 receptor expression. In contrast, most of the other known structural, molecular, and developmental components of the peripheral Drosophila CO 2 olfactory system seem to be well-conserved across all examined lineages. These findings suggest that certain components of CO 2 sensory ORN development may be more evolutionarily labile, and may contribute to differences in CO 2 -evoked behavioral responses across species.

Rhomboid Enhancer Activity Defines a Subset of Drosophila Neural Precursors Required for Proper Feeding, Growth and Viability

PubMed Central

Gresser, Amy L.; Gutzwiller, Lisa M.; Gauck, Mackenzie K.; Hartenstein, Volker; Cook, Tiffany A.; Gebelein, Brian

2015-01-01

Organismal growth regulation requires the interaction of multiple metabolic, hormonal and neuronal pathways. While the molecular basis for many of these are well characterized, less is known about the developmental origins of growth regulatory structures and the mechanisms governing control of feeding and satiety. For these reasons, new tools and approaches are needed to link the specification and maturation of discrete cell populations with their subsequent regulatory roles. In this study, we characterize a rhomboid enhancer element that selectively labels four Drosophila embryonic neural precursors. These precursors give rise to the hypopharyngeal sensory organ of the peripheral nervous system and a subset of neurons in the deutocerebral region of the embryonic central nervous system. Post embryogenesis, the rhomboid enhancer is active in a subset of cells within the larval pharyngeal epithelium. Enhancer-targeted toxin expression alters the morphology of the sense organ and results in impaired larval growth, developmental delay, defective anterior spiracle eversion and lethality. Limiting the duration of toxin expression reveals differences in the critical periods for these effects. Embryonic expression causes developmental defects and partially penetrant pre-pupal lethality. Survivors of embryonic expression, however, ultimately become viable adults. In contrast, post-embryonic toxin expression results in fully penetrant lethality. To better define the larval growth defect, we used a variety of assays to demonstrate that toxin-targeted larvae are capable of locating, ingesting and clearing food and they exhibit normal food search behaviors. Strikingly, however, following food exposure these larvae show a rapid decrease in consumption suggesting a satiety-like phenomenon that correlates with the period of impaired larval growth. Together, these data suggest a critical role for these enhancer-defined lineages in regulating feeding, growth and viability. PMID:26252385

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Poly(A) tail length regulates PABPC1 expression to tune translation in the heart.

PubMed

Chorghade, Sandip; Seimetz, Joseph; Emmons, Russell; Yang, Jing; Bresson, Stefan M; Lisio, Michael De; Parise, Gianni; Conrad, Nicholas K; Kalsotra, Auinash

2017-06-27

The rate of protein synthesis in the adult heart is one of the lowest in mammalian tissues, but it increases substantially in response to stress and hypertrophic stimuli through largely obscure mechanisms. Here, we demonstrate that regulated expression of cytosolic poly(A)-binding protein 1 (PABPC1) modulates protein synthetic capacity of the mammalian heart. We uncover a poly(A) tail-based regulatory mechanism that dynamically controls PABPC1 protein synthesis in cardiomyocytes and thereby titrates cellular translation in response to developmental and hypertrophic cues. Our findings identify PABPC1 as a direct regulator of cardiac hypertrophy and define a new paradigm of gene regulation in the heart, where controlled changes in poly(A) tail length influence mRNA translation.

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana

PubMed Central

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H.; Trivedi, Prabodh K.

2016-01-01

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana. PMID:27539368

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

PubMed

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

2016-08-19

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

Developmental transcriptome profiling of bovine muscle tissue reveals an abundant GosB that regulates myoblast proliferation and apoptosis

PubMed Central

Yang, Jiameng; Dong, Dong; Huang, Yongzhen; Lan, Xianyong; Plath, Martin; Lei, Chuzhao; Qi, Xinglei; Bai, Yueyu; Chen, Hong

2017-01-01

The formation of bovine skeletal muscle involves complex developmental and physiological processes that play a vital role in determining the quality of beef; however, the regulatory mechanisms underlying differences in meat quality are largely unknown. We conducted transcriptome analysis of bovine muscle tissues to compare gene expression profiles between embryonic and adult stages. Total RNAs from skeletal muscle of Qinchuan cattle at fetal and adult stages were used to construct libraries for Illumina next-generation sequencing using the Ribo-Zero RNA sequencing (RNA-Seq) method. We found a total of 19,695 genes to be expressed in fetal and adult stages, whereby 3,299 were expressed only in fetal, and 433 only in adult tissues. We characterized the role of a candidate gene (GosB), which was highly (but differentially) expressed in embryonic and adult skeletal muscle tissue. GosB increased the number of myoblasts in the S-phase of the cell cycle, and decreased the proportion of cells in the G0/G1 phase. GosB promoted the proliferation of myoblasts and protected them from apoptosis via regulating Bcl-2 expression and controlling the intracellular calcium concentration. Modulation of GosB expression in muscle tissue may emerge as a potential target in breeding strategies attempting to alter myoblast numbers in cattle. PMID:28404879

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

NASA Astrophysics Data System (ADS)

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-01

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

PubMed

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-17

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

PubMed

Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

2016-11-01

Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

S6K1ing to ResTOR Adipogenesis with Polycomb.

PubMed

Juan, Aster H; Sartorelli, Vittorio

2016-05-05

Signal-directed chromatin recruitment of mammalian Polycomb complexes is a fundamental component of epigenetic regulation. In this issue, Yi et al. (2016) reveal how mTORC1 activation deploys the ribosomal serine/threonine kinase S6K1 and Polycomb proteins at genomic regulatory regions to repress expression of anti-adipogenic developmental regulators. Copyright © 2016 Elsevier Inc. All rights reserved.

A cross-species bi-clustering approach to identifying conserved co-regulated genes.

PubMed

Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

2016-06-15

A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

K-Cl Cotransporter 2-mediated Cl- Extrusion Determines Developmental Stage-dependent Impact of Propofol Anesthesia on Dendritic Spines.

PubMed

Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia-Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

2017-05-01

General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABAA)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABAA)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. The KCC2-dependent developmental increase in the efficacy of GABAA-mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

Chromatin programming by developmentally regulated transcription factors: lessons from the study of haematopoietic stem cell specification and differentiation.

PubMed

Obier, Nadine; Bonifer, Constanze

2016-11-01

Although the body plan of individuals is encoded in their genomes, each cell type expresses a different gene expression programme and therefore has access to only a subset of this information. Alterations to gene expression programmes are the underlying basis for the differentiation of multiple cell types and are driven by tissue-specific transcription factors (TFs) that interact with the epigenetic regulatory machinery to programme the chromatin landscape into transcriptionally active and inactive states. The haematopoietic system has long served as a paradigm for studying the molecular principles that regulate gene expression in development. In this review article, we summarize the current knowledge on the mechanism of action of TFs regulating haematopoietic stem cell specification and differentiation, and place this information into the context of general principles governing development. © 2016 Federation of European Biochemical Societies.

Learning the Languages of the Chloroplast: Retrograde Signaling and Beyond.

PubMed

Chan, Kai Xun; Phua, Su Yin; Crisp, Peter; McQuinn, Ryan; Pogson, Barry J

2016-04-29

The chloroplast can act as an environmental sensor, communicating with the cell during biogenesis and operation to change the expression of thousands of proteins. This process, termed retrograde signaling, regulates expression in response to developmental cues and stresses that affect photosynthesis and yield. Recent advances have identified many signals and pathways-including carotenoid derivatives, isoprenes, phosphoadenosines, tetrapyrroles, and heme, together with reactive oxygen species and proteins-that build a communication network to regulate gene expression, RNA turnover, and splicing. However, retrograde signaling pathways have been viewed largely as a means of bilateral communication between organelles and nuclei, ignoring their potential to interact with hormone signaling and the cell as a whole to regulate plant form and function. Here, we discuss new findings on the processes by which organelle communication is initiated, transmitted, and perceived, not only to regulate chloroplastic processes but also to intersect with cellular signaling and alter physiological responses.

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

Serial analysis of gene expression in the silkworm, Bombyx mori.

PubMed

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

Regulation of mouse lung development by the extracellular calcium-sensing receptor, CaR

PubMed Central

Finney, Brenda A; del Moral, Pierre M; Wilkinson, William J; Cayzac, Sebastien; Cole, Martin; Warburton, David; Kemp, Paul J; Riccardi, Daniela

2008-01-01

Postnatal lung function is critically dependent upon optimal embryonic lung development. As the free ionized plasma calcium concentration ([Ca2+]o) of the fetus is higher than that of the adult, the process of lung development occurs in a hypercalcaemic environment. In the adult, [Ca2+]o is monitored by the G-protein coupled, extracellular calcium-sensing receptor (CaR), but neither its ontogeny nor its potential role in lung development are known. Here, we demonstrate that CaR is expressed in the mouse lung epithelium, and that its expression is developmentally regulated, with a peak of expression at embryonic day 12.5 (E12.5) and a subsequent decrease by E18, after which the receptor is absent. Experiments carried out using the lung explant culture model in vitro show that lung branching morphogenesis is sensitive to [Ca2+]o, being maximal at physiological adult [Ca2+]o (i.e. 1.0–1.3 mm) and lowest at the higher, fetal (i.e. 1.7 mm) [Ca2+]o. Administration of the specific CaR positive allosteric modulator, the calcimimetic R-568, mimics the suppressive effects of high [Ca2+]o on branching morphogenesis while both phospholipase C and PI3 kinase inhibition reverse these effects. CaR activation suppresses cell proliferation while it enhances intracellular calcium signalling, lung distension and fluid secretion. Conditions which are restrictive either to branching or to secretion can be rescued by manipulating [Ca2+]o in the culture medium. In conclusion, fetal Cao2+, acting through a developmentally regulated CaR, is an important extrinsic factor that modulates the intrinsic lung developmental programme. Our observations support a novel role for the CaR in preventing hyperplastic lung disease in utero. PMID:18955379

Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

PubMed Central

Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

2014-01-01

The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

The mouse F3/contactin glycoprotein

PubMed Central

Bizzoca, Antonella; Corsi, Patrizia

2009-01-01

F3/Contactin is an immunoglobulin superfamily component expressed in the nervous tissue of several species. Here we focus on the structural and functional properties of its mouse relative, on the mechanisms driving its regulated expression and on its developmental role. F3/Contactin is differentially expressed in distinct populations of central and peripheral neurons and in some non-neuronal cells. Accordingly, the regulatory region of the underlying gene includes promoter elements undergoing differential activation, associated with an intricate splicing profile, indicating that transcriptional and posttranscriptional mechanisms contribute to its expression. Transgenic models allowed to follow F3/Contactin promoter activation in vivo and to modify F3/Contactin gene expression under a heterologous promoter, which resulted in morphological and functional phenotypes. Besides axonal growth and pathfinding, these concerned earlier events, including precursor proliferation and commitment. This wide role in neural ontogenesis is consistent with the recognized interaction of F3/Contactin with developmental control genes belonging to the Notch pathway. PMID:19372728

A network of epigenetic regulators guides developmental haematopoiesis in vivo.

PubMed

Huang, Hsuan-Ting; Kathrein, Katie L; Barton, Abby; Gitlin, Zachary; Huang, Yue-Hua; Ward, Thomas P; Hofmann, Oliver; Dibiase, Anthony; Song, Anhua; Tyekucheva, Svitlana; Hide, Winston; Zhou, Yi; Zon, Leonard I

2013-12-01

The initiation of cellular programs is orchestrated by key transcription factors and chromatin regulators that activate or inhibit target gene expression. To generate a compendium of chromatin factors that establish the epigenetic code during developmental haematopoiesis, a large-scale reverse genetic screen was conducted targeting orthologues of 425 human chromatin factors in zebrafish. A set of chromatin regulators was identified that target different stages of primitive and definitive blood formation, including factors not previously implicated in haematopoiesis. We identified 15 factors that regulate development of primitive erythroid progenitors and 29 factors that regulate development of definitive haematopoietic stem and progenitor cells. These chromatin factors are associated with SWI/SNF and ISWI chromatin remodelling, SET1 methyltransferase, CBP-p300-HBO1-NuA4 acetyltransferase, HDAC-NuRD deacetylase, and Polycomb repressive complexes. Our work provides a comprehensive view of how specific chromatin factors and their associated complexes play a major role in the establishment of haematopoietic cells in vivo.

doublesex alters aggressiveness as a function of social context and sex in the polyphenic beetle Onthophagus taurus.

PubMed

Beckers, Oliver M; Kijimoto, Teiya; Moczek, Armin P

2017-10-01

Despite sharing nearly the same genome, individuals within the same species can vary drastically in both morphology and behaviour as a function of developmental stage, sex or developmental plasticity. Thus, regulatory processes must exist that enable the stage-, sex- or environment-specific expression of traits and their integration during ontogeny, yet exactly how trait complexes are co-regulated and integrated is poorly understood. In this study, we explore the developmental genetic basis of the regulation and integration of environment-dependent sexual dimorphism in behaviour and morphology in the horn-polyphenic dung beetle Onthophagus taurus through the experimental manipulation of the transcription factor doublesex (dsx). The gene dsx plays a profound role in the developmental regulation of morphological differences between sexes as well as alternative male morphs by inhibiting horn formation in females but enabling nutrition-responsive horn growth in males. Specifically, we investigated whether experimental downregulation of dsx expression affects male and female aggressive and courtship behaviours in two social contexts: interactions between individuals of the same sex and interactions between males and females. We find that dsx downregulation significantly alters aggressiveness in both males and females, yet does so differently for both sexes as a function of social context: dsx RNAi males exhibited elevated aggression towards males but showed reduced aggression towards females, whereas dsx RNAi females became more aggressive towards males, while their aggressiveness towards other females was unaffected. Moreover, we document unexpectedly high levels of female aggression independent of dsx treatment in both wild-type and control-injected individuals. Lastly, we found no effects of dsx RNAi on courtship and mating behaviours. We discuss the role of dsx in the regulation of sex-specific and plastic behaviours, the unexpectedly high levels of aggression of hornless dsx RNAi males in relation to the well-established description of the hornless sneaker phenotype and the potential ecological function of high female aggression.

Brg1 modulates enhancer activation in mesoderm lineage commitment

DOE PAGES

Alexander, Jeffrey M.; Hota, Swetansu K.; He, Daniel; ...

2015-03-26

The interplay between different levels of gene regulation in modulating developmental transcriptional programs, such as histone modifications and chromatin remodeling, is not well understood. Here, we show that the chromatin remodeling factor Brg1 is required for enhancer activation in mesoderm induction. In an embryonic stem cell-based directed differentiation assay, the absence of Brg1 results in a failure of cardiomyocyte differentiation and broad deregulation of lineage-specific gene expression during mesoderm induction. We find that Brg1 co-localizes with H3K27ac at distal enhancers and is required for robust H3K27 acetylation at distal enhancers that are activated during mesoderm induction. Brg1 is also requiredmore » to maintain Polycomb-mediated repression of non-mesodermal developmental regulators, suggesting cooperativity between Brg1 and Polycomb complexes. Thus, Brg1 is essential for modulating active and repressive chromatin states during mesoderm lineage commitment, in particular the activation of developmentally important enhancers. In conclusion, these findings demonstrate interplay between chromatin remodeling complexes and histone modifications that, together, ensure robust and broad gene regulation during crucial lineage commitment decisions.« less

Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

PubMed Central

2010-01-01

Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

MicroRNAs: New Players in Anesthetic-Induced Developmental Neurotoxicity

PubMed Central

Twaroski, Danielle; Bosnjak, Zeljko J.; Bai, Xiaowen

2015-01-01

Growing evidence demonstrates that prolonged exposure to general anesthetics during brain development induces widespread neuronal cell death followed by long-term memory and learning disabilities in animal models. These studies have raised serious concerns about the safety of anesthetic use in pregnant women and young children. However, the underlying mechanisms of anesthetic-induced neurotoxicity are complex and are not well understood. MicroRNAs are endogenous, small, non-coding RNAs that have been implicated to play important roles in many different disease processes by negatively regulating target gene expression. A possible role for microRNAs in anesthetic-induced developmental neurotoxicity has recently been identified, suggesting that microRNA-based signaling might be a novel target for preventing the neurotoxicity. Here we provide an overview of anesthetic-induced developmental neurotoxicity and focus on the role of microRNAs in the neurotoxicity observed in both human stem cell-derived neuron and animal models. Aberrant expression of some microRNAs has been shown to be involved in anesthetic-induced developmental neurotoxicity, revealing the potential of microRNAs as therapeutic or preventive targets against the toxicity. PMID:26146587

20-Hydroxyecdysone (20E) Primary Response Gene E75 Isoforms Mediate Steroidogenesis Autoregulation and Regulate Developmental Timing in Bombyx*

PubMed Central

Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng

2016-01-01

The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399

Landscape of histone modifications in a sponge reveals the origin of animal cis-regulatory complexity

PubMed Central

Gaiti, Federico; Jindrich, Katia; Fernandez-Valverde, Selene L; Roper, Kathrein E; Degnan, Bernard M; Tanurdžić, Miloš

2017-01-01

Combinatorial patterns of histone modifications regulate developmental and cell type-specific gene expression and underpin animal complexity, but it is unclear when this regulatory system evolved. By analysing histone modifications in a morphologically-simple, early branching animal, the sponge Amphimedonqueenslandica, we show that the regulatory landscape used by complex bilaterians was already in place at the dawn of animal multicellularity. This includes distal enhancers, repressive chromatin and transcriptional units marked by H3K4me3 that vary with levels of developmental regulation. Strikingly, Amphimedon enhancers are enriched in metazoan-specific microsyntenic units, suggesting that their genomic location is extremely ancient and likely to place constraints on the evolution of surrounding genes. These results suggest that the regulatory foundation for spatiotemporal gene expression evolved prior to the divergence of sponges and eumetazoans, and was necessary for the evolution of animal multicellularity. DOI: http://dx.doi.org/10.7554/eLife.22194.001 PMID:28395144

Epigenomic Analysis of Multi-lineage Differentiation of Human Embryonic Stem Cells

PubMed Central

Xie, Wei; Schultz, Matthew D.; Lister, Ryan; Hou, Zhonggang; Rajagopal, Nisha; Ray, Pradipta; Whitaker, John W.; Tian, Shulan; Hawkins, R. David; Leung, Danny; Yang, Hongbo; Wang, Tao; Lee, Ah Young; Swanson, Scott A.; Zhang, Jiuchun; Zhu, Yun; Kim, Audrey; Nery, Joseph R.; Urich, Mark A.; Kuan, Samantha; Yen, Chia-an; Klugman, Sarit; Yu, Pengzhi; Suknuntha, Kran; Propson, Nicholas E.; Chen, Huaming; Edsall, Lee E.; Wagner, Ulrich; Li, Yan; Ye, Zhen; Kulkarni, Ashwinikumar; Xuan, Zhenyu; Chung, Wen-Yu; Chi, Neil C.; Antosiewicz-Bourget, Jessica E.; Slukvin, Igor; Stewart, Ron; Zhang, Michael Q.; Wang, Wei; Thomson, James A.; Ecker, Joseph R.; Ren, Bing

2013-01-01

SUMMARY Epigenetic mechanisms have been proposed to play crucial roles in mammalian development, but their precise functions are only partially understood. To investigate epigenetic regulation of embryonic development, we differentiated human embryonic stem cells into mesendoderm, neural progenitor cells, trophoblast-like cells, and mesenchymal stem cells, and systematically characterized DNA methylation, chromatin modifications, and the transcriptome in each lineage. We found that promoters that are active in early developmental stages tend to be CG rich and mainly engage H3K27me3 upon silencing in non-expressing lineages. By contrast, promoters for genes expressed preferentially at later stages are often CG poor and primarily employ DNA methylation upon repression. Interestingly, the early developmental regulatory genes are often located in large genomic domains that are generally devoid of DNA methylation in most lineages, which we termed DNA methylation valleys (DMVs). Our results suggest that distinct epigenetic mechanisms regulate early and late stages of ES cell differentiation. PMID:23664764

Network theory inspired analysis of time-resolved expression data reveals key players guiding P. patens stem cell development.

PubMed

Busch, Hauke; Boerries, Melanie; Bao, Jie; Hanke, Sebastian T; Hiss, Manuel; Tiko, Theodhor; Rensing, Stefan A

2013-01-01

Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems.

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire.

PubMed

Gates, Michael A; Kannan, Ramakrishnan; Giniger, Edward

2011-11-30

The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis.

An Atypical Phr Peptide Regulates the Developmental Switch Protein RapH ▿ †

PubMed Central

Mirouze, Nicolas; Parashar, Vijay; Baker, Melinda D.; Dubnau, David A.; Neiditch, Matthew B.

2011-01-01

Under conditions of nutrient limitation and high population density, the bacterium Bacillus subtilis can initiate a variety of developmental pathways. The signaling systems regulating B. subtilis differentiation are tightly controlled by switch proteins called Raps, named after the founding members of the family, which were shown to be response regulator aspartate phosphatases. A phr gene encoding a secreted pentapeptide that regulates the activity of its associated Rap protein was previously identified downstream of 8 of the chromosomally encoded rap genes. We identify and validate here the sequence of an atypical Phr peptide, PhrH, by in vivo and in vitro analyses. Using a luciferase reporter bioassay combined with in vitro experiments, we found that PhrH is a hexapeptide (TDRNTT), in contrast to the other characterized Phr pentapeptides. We also determined that phrH expression is driven by a promoter lying within rapH. Unlike the previously identified dedicated σH-driven phr promoters, it appears that phrH expression most likely requires σA. Furthermore, we show that PhrH can antagonize both of the known activities of RapH: the dephosphorylation of Spo0F and the sequestration of ComA, thus promoting the development of spores and the competent state. Finally, we propose that PhrH is the prototype of a newly identified class of Phr signaling molecules consisting of six amino acids. This class likely includes PhrI, which regulates RapI and the expression, excision, and transfer of the mobile genetic element ICEBs1. PMID:21908671

Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

PubMed Central

Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

2016-01-01

For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

Association of abnormal morphology and altered gene expression in human preimplantation embryos.

PubMed

Wells, Dagan; Bermúdez, Mercedes G; Steuerwald, Nury; Malter, Henry E; Thornhill, Alan R; Cohen, Jacques

2005-08-01

We set out to characterize the expression of nine genes in human preimplantation embryos and determine whether abnormal morphology is associated with altered gene activity. Reverse transcription and real-time polymerase chain reaction were used to quantify the expression of multiple genes in each embryo. The genes studied have various important cellular roles (e.g., cell cycle regulation, DNA repair, and apoptosis). Research laboratory working closely with a clinical IVF practice. Over 50 embryos were donated by infertile patients (various etiologies). Among these, all major stages of preimplantation development and a variety of common morphologic abnormalities were represented. None. Quantification of mRNA transcripts. We detected an association between certain forms of abnormal morphology and disturbances of gene activity. Cellular fragmentation was associated with altered expression of several genes, including TP53, suggesting that fragmenting blastomeres are suffering stress of a type monitored by p53, possibly as a consequence of suboptimal culture conditions. Appropriate gene expression is vital for the regulation of metabolic pathways and key developmental events. Our data indicates a possible causal relationship between changes in gene expression and the formation of clinically relevant abnormal embryo morphologies. We hypothesize that embryos with expression profiles characteristic of good morphology and appropriate for their developmental stage have the greatest potential for implantation. If confirmed, this could lead to a new generation of preimplantation genetic diagnosis (PGD) tests for assessing embryo viability and predicting implantation potential.

The Splice Isoforms of the Drosophila Ecdysis Triggering Hormone Receptor Have Developmentally Distinct Roles

PubMed Central

Diao, Feici; Mena, Wilson; Shi, Jonathan; Park, Dongkook; Diao, Fengqiu; Taghert, Paul; Ewer, John; White, Benjamin H.

2016-01-01

To grow, insects must periodically shed their exoskeletons. This process, called ecdysis, is initiated by the endocrine release of Ecdysis Trigger Hormone (ETH) and has been extensively studied as a model for understanding the hormonal control of behavior. Understanding how ETH regulates ecdysis behavior, however, has been impeded by limited knowledge of the hormone’s neuronal targets. An alternatively spliced gene encoding a G-protein-coupled receptor (ETHR) that is activated by ETH has been identified, and several lines of evidence support a role in ecdysis for its A-isoform. The function of a second ETHR isoform (ETHRB) remains unknown. Here we use the recently introduced “Trojan exon” technique to simultaneously mutate the ETHR gene and gain genetic access to the neurons that express its two isoforms. We show that ETHRA and ETHRB are expressed in largely distinct subsets of neurons and that ETHRA- but not ETHRB-expressing neurons are required for ecdysis at all developmental stages. However, both genetic and neuronal manipulations indicate an essential role for ETHRB at pupal and adult, but not larval, ecdysis. We also identify several functionally important subsets of ETHR-expressing neurons including one that coexpresses the peptide Leucokinin and regulates fluid balance to facilitate ecdysis at the pupal stage. The general strategy presented here of using a receptor gene as an entry point for genetic and neuronal manipulations should be useful in establishing patterns of functional connectivity in other hormonally regulated networks. PMID:26534952

Transcriptome profile analysis of floral sex determination in cucumber.

PubMed

Wu, Tao; Qin, Zhiwei; Zhou, Xiuyan; Feng, Zhuo; Du, Yalin

2010-07-15

Cucumber has been widely studied as a model for floral sex determination. In this investigation, we performed genome-wide transcriptional profiling of apical tissue of a gynoecious mutant (Csg-G) and the monoecious wild-type (Csg-M) of cucumber in an attempt to isolate genes involved in sex determination, using the Solexa technology. The profiling analysis revealed numerous changes in gene expression attributable to the mutation, which resulted in the down-regulation of 600 genes and the up-regulation of 143 genes. The Solexa data were confirmed by reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative RT-PCR (qRT-PCR). Gene ontology (GO) analysis revealed that the differentially expressed genes were mainly involved in biogenesis, transport and organization of cellular component, macromolecular and cellular biosynthesis, localization, establishment of localization, translation and other processes. Furthermore, the expression of some of these genes depended upon the tissue and the developmental stage of the flowers of gynoecious mutant. The results of this study suggest two important concepts, which govern sex determination in cucumber. First, the differential expression of genes involved in plant hormone signaling pathways, such as ACS, Asr1, CsIAA2, CS-AUX1 and TLP, indicate that phytohormones and their crosstalk might play a critical role in the sex determination. Second, the regulation of some transcription factors, including EREBP-9, may also be involved in this developmental process. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

Environmental perception and epigenetic memory: mechanistic insight through FLC

PubMed Central

Berry, Scott; Dean, Caroline

2015-01-01

Chromatin plays a central role in orchestrating gene regulation at the transcriptional level. However, our understanding of how chromatin states are altered in response to environmental and developmental cues, and then maintained epigenetically over many cell divisions, remains poor. The floral repressor gene FLOWERING LOCUS C (FLC) in Arabidopsis thaliana is a useful system to address these questions. FLC is transcriptionally repressed during exposure to cold temperatures, allowing studies of how environmental conditions alter expression states at the chromatin level. FLC repression is also epigenetically maintained during subsequent development in warm conditions, so that exposure to cold may be remembered. This memory depends on molecular complexes that are highly conserved among eukaryotes, making FLC not only interesting as a paradigm for understanding biological decision-making in plants, but also an important system for elucidating chromatin-based gene regulation more generally. In this review, we summarize our understanding of how cold temperature induces a switch in the FLC chromatin state, and how this state is epigenetically remembered. We also discuss how the epigenetic state of FLC is reprogrammed in the seed to ensure a requirement for cold exposure in the next generation. Significance Statement FLOWERING LOCUS C (FLC) regulation provides a paradigm for understanding how chromatin can be modulated to determine gene expression in a developmental context. This review describes our current mechanistic understanding of how FLC expression is genetically specified and epigenetically regulated throughout the plant life cycle, and how this determines plant life-history strategy. PMID:25929799

Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

PubMed

Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

2018-01-01

The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

PubMed

Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

2005-05-13

Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

Developmental Regulation of p66Shc Is Altered by Bronchopulmonary Dysplasia in Baboons and Humans

PubMed Central

Lee, Matt K.; Pryhuber, Gloria S.; Schwarz, Margaret A.; Smith, Susan M.; Pavlova, Zdena; Sunday, Mary E.

2005-01-01

Rationale: The p66Shc adapter protein antagonizes mitogen-activated protein, or MAP, kinase, mediates oxidative stress, and is developmentally regulated in fetal mouse lungs. Objectives: To determine if p66Shc is similarly regulated in primates and in bronchopulmonary dysplasia (BPD), which results from oxidative injury to immature lungs. Methods: Normal and injured lungs from humans and baboons were evaluated by Western analysis and immunohistochemistry. Measurements and Main Results: In baboons, p66Shc decreased 80% between 125 and 175 days' gestation (p = 0.025), then doubled after term delivery at 185 days (p = 0.0013). In the hyperoxic 140-day fetal baboon BPD model, p66Shc expression persisted, and its localization shifted from the epithelium of gestational controls to the mesenchyme of diseased lungs, coincident with expression of proliferating cell nuclear antigen and cleaved poly(adenyl ribose) polymerase, a marker of apoptosis. Treatment with the antibombesin antibody 2A11 attenuated BPD, reduced cell proliferation, increased p66Shc expression 10.5-fold, and preserved epithelial p66Shc localization. p66Shc also decreased during normal human lung development, falling 87% between 18 and 24 weeks' gestation (p = 0.02). p66Shc was expressed throughout 18-week human lungs, became restricted to scattered epithelial cells by 24 weeks, and localized to isolated mesenchymal cells after term delivery. In contrast, p66Shc remained prominent in the epithelium of lungs with acute injury or mild BPD, and in the mesenchyme of lungs with severe disease. p66Shc localized to tissues expressing proliferating cell nuclear antigen and cleaved poly(adenyl ribose) polymerase. Conclusions: p66Shc expression, cell proliferation, and apoptosis are concomitantly altered during lung development and in BPD. PMID:15778491

Characterization of a calcium/calmodulin-regulated SR/CAMTA gene family during tomato fruit development and ripening

PubMed Central

2012-01-01

Background Fruit ripening is a complicated development process affected by a variety of external and internal cues. It is well established that calcium treatment delays fruit ripening and senescence. However, the underlying molecular mechanisms remain unclear. Results Previous studies have shown that calcium/calmodulin-regulated SR/CAMTAs are important for modulation of disease resistance, cold sensitivity and wounding response in vegetative tissues. To study the possible roles of this gene family in fruit development and ripening, we cloned seven SR/CAMTAs, designated as SlSRs, from tomato, a model fruit-bearing crop. All seven genes encode polypeptides with a conserved DNA-binding domain and a calmodulin-binding site. Calmodulin specifically binds to the putative targeting site in a calcium-dependent manner. All SlSRs were highly yet differentially expressed during fruit development and ripening. Most notably, the expression of SlSR2 was scarcely detected at the mature green and breaker stages, two critical stages of fruit development and ripening; and SlSR3L and SlSR4 were expressed exclusively in fruit tissues. During the developmental span from 10 to 50 days post anthesis, the expression profiles of all seven SlSRs were dramatically altered in ripening mutant rin compared with wildtype fruit. By contrast, only minor alterations were noted for ripening mutant nor and Nr fruit. In addition, ethylene treatment of mature green wildtype fruit transiently stimulated expression of all SlSRs within one to two hours. Conclusions This study indicates that SlSR expression is influenced by both the Rin-mediated developmental network and ethylene signaling. The results suggest that calcium signaling is involved in the regulation of fruit development and ripening through calcium/calmodulin/SlSR interactions. PMID:22330838

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

Chronic methamphetamine administration causes differential regulation of transcription factors in the rat midbrain.

PubMed

Krasnova, Irina N; Ladenheim, Bruce; Hodges, Amber B; Volkow, Nora D; Cadet, Jean Lud

2011-04-25

Methamphetamine (METH) is an addictive and neurotoxic psychostimulant widely abused in the USA and throughout the world. When administered in large doses, METH can cause depletion of striatal dopamine terminals, with preservation of midbrain dopaminergic neurons. Because alterations in the expression of transcription factors that regulate the development of dopaminergic neurons might be involved in protecting these neurons after toxic insults, we tested the possibility that their expression might be affected by toxic doses of METH in the adult brain. Male Sprague-Dawley rats pretreated with saline or increasing doses of METH were challenged with toxic doses of the drug and euthanized two weeks later. Animals that received toxic METH challenges showed decreases in dopamine levels and reductions in tyrosine hydroxylase protein concentration in the striatum. METH pretreatment protected against loss of striatal dopamine and tyrosine hydroxylase. In contrast, METH challenges caused decreases in dopamine transporters in both saline- and METH-pretreated animals. Interestingly, METH challenges elicited increases in dopamine transporter mRNA levels in the midbrain in the presence but not in the absence of METH pretreatment. Moreover, toxic METH doses caused decreases in the expression of the dopamine developmental factors, Shh, Lmx1b, and Nurr1, but not in the levels of Otx2 and Pitx3, in saline-pretreated rats. METH pretreatment followed by METH challenges also decreased Nurr1 but increased Otx2 and Pitx3 expression in the midbrain. These findings suggest that, in adult animals, toxic doses of METH can differentially influence the expression of transcription factors involved in the developmental regulation of dopamine neurons. The combined increases in Otx2 and Pitx3 expression after METH preconditioning might represent, in part, some of the mechanisms that served to protect against METH-induced striatal dopamine depletion observed after METH preconditioning.

Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

PubMed Central

Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

2015-01-01

Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases

PubMed Central

Wang, Yun; Botolin, Daniela; Christian, Barbara; Busik, Julia; Xu, Jinghua; Jump, Donald B.

2008-01-01

Of the six fatty acid elongase (Elovl) subtypes expressed in mammals, adult rat liver expresses four subtypes: Elovl-5 > Elovl-1 = Elovl-2 = Elovl-6. Overnight starvation and fish oil-enriched diets repressed hepatic elongase activity in livers of adult male rats. Diet-induced changes in elongase activity correlate with Elovl-5 and Elovl-6 mRNA abundance. Adult rats fed the peroxisome proliferator-activated receptor α (PPARα) agonist WY14,643 have increased hepatic elongase activity, Elovl-1, Elovl-5, Elovl-6, Δ5, Δ6, and Δ9 desaturase mRNA abundance, and mead acid (20:3,n-9) content. PPARα agonists affect both fatty acid elongation and desaturation pathways leading to changes in hepatic lipid composition. Elovl activity is low in fetal liver but increases significantly after birth. Developmental changes in hepatic elongase activity paralleled the postnatal induction of Elovl-5 mRNA and mRNAs encoding the PPARα-regulated transcripts, Δ5 and Δ6 desaturase, and cytochrome P450 4A. In contrast, Elovl-6, Δ9 desaturase, and FAS mRNA abundance paralleled changes in hepatic sterol regulatory element binding protein 1c (SREBP-1c) nuclear content. SREBP-1c is present in fetal liver nuclei, absent from nuclei immediately after birth, and reappears in nuclei at weaning, 21 days postpartum. In conclusion, changes in Elovl-5 expression may account for much of the nutritional and developmental control of fatty acid elongation activity in the rat liver. PMID:15654130

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

PubMed

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

C. elegans sym-1 is a downstream target of the hunchback-like-1 developmental timing transcription factor

PubMed Central

Niwa, Ryusuke; Hada, Kazumasa; Moliyama, Kouichi; Ohniwa, Ryosuke L.; Tan, Yi-Meng; Olsson-Carter, Katherine; Chi, Woo; Reinke, Valerie; Slack, Frank J.

2010-01-01

In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) and its family members control the timing of key developmental events in part by directly regulating expression of hunchback-like-1 (hbl-1). C. elegans hbl-1 mutants display multiple developmental timing deficiencies, including cell cycle defects during larval development. While hbl-1 is predicted to encode a transcriptional regulator, downstream targets of HBL-1 have not been fully elucidated. Here we report using microarray analysis to uncover genes downstream of HBL-1. We established a transgenic strain that overexpresses hbl-1 under the control of a heat shock promoter. Heat shock-induced hbl-1 overexpression led to retarded hypodermal structures at the adult stage, opposite to the effect seen in loss of function (lf) hbl-1 mutants. The microarray screen identified numerous potential genes that are upregulated or downregulated by HBL-1, including sym-1, which encodes a leucine-rich repeat protein with a signal sequence. We found an increase in sym-1 transcription in the heat shock-induced hbl-1 overexpression strain, while loss of hbl-1 function caused a decrease in sym-1 expression levels. Furthermore, we found that sym-1(lf) modified the hypodermal abnormalities in hbl-1 mutants. Given that SYM-1 is a protein secreted from hypodermal cells to the surrounding cuticle, we propose that the adult-specific cuticular structures may be under the temporal control of HBL-1 through regulation of sym-1 transcription. PMID:19923914

The expression of the Alzheimer’s Amyloid Precursor Protein-like gene is regulated by developmental timing microRNAs and their targets in Caenorhabditis elegans

PubMed Central

Niwa, Ryusuke; Zhou, Feng; Li, Chris; Slack, Frank J.

2008-01-01

Alzheimer’s Disease (AD) is a neurodegenerative disorder characterized by the accumulation of dense plaques in the brain, resulting in progressive dementia. A major plaque component is the β-amyloid peptide, which is a cleavage product of the amyloid precursor protein (APP). Studies of dominant inheritable familial AD support the hypothesis that APP is critical for AD development. On the other hand, the pathogenesis of amyloid plaque deposition in AD is thought to be the result of age-related changes with unknown mechanisms. Here we show that the Caenorhabditis elegans homolog of APP, APP-like-1 (apl-1), functions with and is under the control of molecules regulating developmental progression. In C. elegans, the timing of cell fate determination is controlled by the heterochronic genes, including let-7 microRNAs. C. elegans apl-1 shows significant genetic interactions with let-7 family microRNAs and let-7-targeted heterochronic genes, hbl-1, lin-41 and lin-42. apl-1 expression is upregulated during the last larval stage in hypodermal seam cells which is transcriptionally regulated by hbl-1, lin-41 and lin-42. Moreover, the levels of the apl-1 transcription are modulated by the activity of let-7 family microRNAs. Our works places apl-1 in a developmental timing pathway and may provide new insights into the time-dependent progression of AD. PMID:18262516

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

Developmentally regulated, alternative splicing of the Rpn10 gene generates multiple forms of 26S proteasomes

PubMed Central

Kawahara, Hiroyuki; Kasahara, Masanori; Nishiyama, Atsuya; Ohsumi, Keita; Goto, Tetsuya; Kishimoto, Takeo; Saeki, Yasushi; Yokosawa, Hideyoshi; Shimbara, Naoki; Murata, Shigeo; Chiba, Tomoki; Suzuki, Koichi; Tanaka, Keiji

2000-01-01

The 26S proteasome is a multisubunit protein- destroying machinery that degrades ubiquitin-tagged proteins. To date only a single species of Rpn10, which possibly functions as a multiubiquitin chain-binding subunit, has been identified in various organisms. Here we report that mouse Rpn10 mRNAs occur in at least five distinct forms, named Rpn10a to Rpn10e, and that they are generated from a single gene by developmentally regulated, alternative splicing. Rpn10a is ubiquitously expressed, whereas Rpn10e is expressed only in embryos, with the highest levels of expression in the brain. Both forms of Rpn10 are components of the 26S proteasome, with an apparently similar affinity for multiubiquitylated [125I]lysozyme in vitro. However, they exert markedly divergent effects on the destruction of B-type cyclin in Xenopus egg extracts. Thus, the 26S proteasome occurs in at least two functionally distinct forms: one containing a ubiquitously expressed Rpn10a and the other a newly identified, embryo-specific Rpn10e. While the former is thought to perform proteolysis constitutively in a wide variety of cells, the latter may play a specialized role in early embryonic development. PMID:10921894

Distinct Contributions of Conserved Modules to Runt Transcription Factor Activity

PubMed Central

Walrad, Pegine B.; Hang, Saiyu; Joseph, Genevieve S.; Salas, Julia

2010-01-01

Runx proteins play vital roles in regulating transcription in numerous developmental pathways throughout the animal kingdom. Two Runx protein hallmarks are the DNA-binding Runt domain and a C-terminal VWRPY motif that mediates interaction with TLE/Gro corepressor proteins. A phylogenetic analysis of Runt, the founding Runx family member, identifies four distinct regions C-terminal to the Runt domain that are conserved in Drosophila and other insects. We used a series of previously described ectopic expression assays to investigate the functions of these different conserved regions in regulating gene expression during embryogenesis and in controlling axonal projections in the developing eye. The results indicate each conserved region is required for a different subset of activities and identify distinct regions that participate in the transcriptional activation and repression of the segmentation gene sloppy-paired-1 (slp1). Interestingly, the C-terminal VWRPY-containing region is not required for repression but instead plays a role in slp1 activation. Genetic experiments indicating that Groucho (Gro) does not participate in slp1 regulation further suggest that Runt's conserved C-terminus interacts with other factors to promote transcriptional activation. These results provide a foundation for further studies on the molecular interactions that contribute to the context-dependent properties of Runx proteins as developmental regulators. PMID:20462957

Arabidopsis TCH4, regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase

NASA Technical Reports Server (NTRS)

Xu, W.; Purugganan, M. M.; Polisensky, D. H.; Antosiewicz, D. M.; Fry, S. C.; Braam, J.

1995-01-01

Adaptation of plants to environmental conditions requires that sensing of external stimuli be linked to mechanisms of morphogenesis. The Arabidopsis TCH (for touch) genes are rapidly upregulated in expression in response to environmental stimuli, but a connection between this molecular response and developmental alterations has not been established. We identified TCH4 as a xyloglucan endotransglycosylase by sequence similarity and enzyme activity. Xyloglucan endotransglycosylases most likely modify cell walls, a fundamental determinant of plant form. We determined that TCH4 expression is regulated by auxin and brassinosteroids, by environmental stimuli, and during development, by a 1-kb region. Expression was restricted to expanding tissues and organs that undergo cell wall modification. Regulation of genes encoding cell wall-modifying enzymes, such as TCH4, may underlie plant morphogenetic responses to the environment.

Differential expression of genes in fetal brain as a consequence of maternal protein deficiency and nematode infection.

PubMed

Haque, Manjurul; Starr, Lisa M; Koski, Kristine G; Scott, Marilyn E

2018-01-01

Maternal dietary protein deficiency and gastrointestinal nematode infection during early pregnancy have negative impacts on both maternal placental gene expression and fetal growth in the mouse. Here we used next-generation RNA sequencing to test our hypothesis that maternal protein deficiency and/or nematode infection also alter the expression of genes in the developing fetal brain. Outbred pregnant CD1 mice were used in a 2×2 design with two levels of dietary protein (24% versus 6%) and two levels of infection (repeated sham versus Heligmosomoides bakeri beginning at gestation day 5). Pregnant dams were euthanized on gestation day 18 to harvest the whole fetal brain. Four fetal brains from each treatment group were analyzed using RNA Hi-Seq sequencing and the differential expression of genes was determined by the edgeR package using NetworkAnalyst. In response to maternal H. bakeri infection, 96 genes (88 up-regulated and eight down-regulated) were differentially expressed in the fetal brain. Differentially expressed genes were involved in metabolic processes, developmental processes and the immune system according to the PANTHER classification system. Among the important biological functions identified, several up-regulated genes have known neurological functions including neuro-development (Gdf15, Ing4), neural differentiation (miRNA let-7), synaptic plasticity (via suppression of NF-κβ), neuro-inflammation (S100A8, S100A9) and glucose metabolism (Tnnt1, Atf3). However, in response to maternal protein deficiency, brain-specific serine protease (Prss22) was the only up-regulated gene and only one gene (Dynlt1a) responded to the interaction of maternal nematode infection and protein deficiency. In conclusion, maternal exposure to GI nematode infection from day 5 to 18 of pregnancy may influence developmental programming of the fetal brain. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex

PubMed Central

Clare, Alison J.; Wicky, Hollie E.; Empson, Ruth M.; Hughes, Stephanie M.

2017-01-01

Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their expression could contribute to the progression of disease phenotypes. PMID:28936162

Seq-ing answers: uncovering the unexpected in global gene regulation.

PubMed

Otto, George Maxwell; Brar, Gloria Ann

2018-04-19

The development of techniques for measuring gene expression globally has greatly expanded our understanding of gene regulatory mechanisms in depth and scale. We can now quantify every intermediate and transition in the canonical pathway of gene expression-from DNA to mRNA to protein-genome-wide. Employing such measurements in parallel can produce rich datasets, but extracting the most information requires careful experimental design and analysis. Here, we argue for the value of genome-wide studies that measure multiple outputs of gene expression over many timepoints during the course of a natural developmental process. We discuss our findings from a highly parallel gene expression dataset of meiotic differentiation, and those of others, to illustrate how leveraging these features can provide new and surprising insight into fundamental mechanisms of gene regulation.

YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.

PubMed

Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio

2018-04-01

Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.

The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility.

PubMed

Du, Hongling; Taylor, Hugh S

2015-11-09

HOX genes convey positional identity that leads to the proper partitioning and adult identity of the female reproductive track. Abnormalities in reproductive tract development can be caused by HOX gene mutations or altered HOX gene expression. Diethylstilbestrol (DES) and other endocrine disruptors cause Müllerian defects by changing HOX gene expression. HOX genes are also essential regulators of adult endometrial development. Regulated HOXA10 and HOXA11 expression is necessary for endometrial receptivity; decreased HOXA10 or HOXA11 expression leads to decreased implantation rates. Alternation of HOXA10 and HOXA11 expression has been identified as a mechanism of the decreased implantation associated with endometriosis, polycystic ovarian syndrome, leiomyoma, polyps, adenomyosis, and hydrosalpinx. Alteration of HOX gene expression causes both uterine developmental abnormalities and impaired adult endometrial development that prevent implantation and lead to female infertility. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE PAGES

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

2017-06-21

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Complex expression patterns of lymphocyte-specific genes during the development of cartilaginous fish implicate unique lymphoid tissues in generating an immune repertoire

NASA Technical Reports Server (NTRS)

Miracle, A. L.; Anderson, M. K.; Litman, R. T.; Walsh, C. J.; Luer, C. A.; Rothenberg, E. V.; Litman, G. W.

2001-01-01

Cartilaginous fish express canonical B and T cell recognition genes, but their lymphoid organs and lymphocyte development have been poorly defined. Here, the expression of Ig, TCR, recombination-activating gene (Rag)-1 and terminal deoxynucleosidase (TdT) genes has been used to identify roles of various lymphoid tissues throughout development in the cartilaginous fish, Raja eglanteria (clearnose skate). In embryogenesis, Ig and TCR genes are sharply up-regulated at 8 weeks of development. At this stage TCR and TdT expression is limited to the thymus; later, TCR gene expression appears in peripheral sites in hatchlings and adults, suggesting that the thymus is a source of T cells as in mammals. B cell gene expression indicates more complex roles for the spleen and two special organs of cartilaginous fish-the Leydig and epigonal (gonad-associated) organs. In the adult, the Leydig organ is the site of the highest IgM and IgX expression. However, the spleen is the first site of IgM expression, while IgX is expressed first in gonad, liver, Leydig and even thymus. Distinctive spatiotemporal patterns of Ig light chain gene expression also are seen. A subset of Ig genes is pre-rearranged in the germline of the cartilaginous fish, making expression possible without rearrangement. To assess whether this allows differential developmental regulation, IgM and IgX heavy chain cDNA sequences from specific tissues and developmental stages have been compared with known germline-joined genomic sequences. Both non-productively rearranged genes and germline-joined genes are transcribed in the embryo and hatchling, but not in the adult.

Genome-wide discovery and differential regulation of conserved and novel microRNAs in chickpea via deep sequencing.

PubMed

Jain, Mukesh; Chevala, V V S Narayana; Garg, Rohini

2014-11-01

MicroRNAs (miRNAs) are essential components of complex gene regulatory networks that orchestrate plant development. Although several genomic resources have been developed for the legume crop chickpea, miRNAs have not been discovered until now. For genome-wide discovery of miRNAs in chickpea (Cicer arietinum), we sequenced the small RNA content from seven major tissues/organs employing Illumina technology. About 154 million reads were generated, which represented more than 20 million distinct small RNA sequences. We identified a total of 440 conserved miRNAs in chickpea based on sequence similarity with known miRNAs in other plants. In addition, 178 novel miRNAs were identified using a miRDeep pipeline with plant-specific scoring. Some of the conserved and novel miRNAs with significant sequence similarity were grouped into families. The chickpea miRNAs targeted a wide range of mRNAs involved in diverse cellular processes, including transcriptional regulation (transcription factors), protein modification and turnover, signal transduction, and metabolism. Our analysis revealed several miRNAs with differential spatial expression. Many of the chickpea miRNAs were expressed in a tissue-specific manner. The conserved and differential expression of members of the same miRNA family in different tissues was also observed. Some of the same family members were predicted to target different chickpea mRNAs, which suggested the specificity and complexity of miRNA-mediated developmental regulation. This study, for the first time, reveals a comprehensive set of conserved and novel miRNAs along with their expression patterns and putative targets in chickpea, and provides a framework for understanding regulation of developmental processes in legumes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The miRNAome dynamics during developmental and metabolic reprogramming of tomato root infected with potato cyst nematode.

PubMed

Koter, Marek D; Święcicka, Magdalena; Matuszkiewicz, Mateusz; Pacak, Andrzej; Derebecka, Natalia; Filipecki, Marcin

2018-03-01

Cyst-forming plant-parasitic nematodes are pests threatening many crops. By means of their secretions cyst nematodes induce the developmental and metabolic reprogramming of host cells that lead to the formation of a syncytium, which is the sole food source for growing nematodes. The in depth micro RNA (miRNA) dynamics in the syncytia induced by Globodera rostochiensis in tomato roots was studied. The miRNAomes were obtained from syncytia covering the early and intermediate developmental stages, and were the subject of differential expression analysis. The expression of 1235 miRNAs was monitored. The fold change (log 2 FC) ranged from -7.36 to 8.38, indicating that this transcriptome fraction was very variable. Moreover, we showed that the DE (differentially expressed) miRNAs do not fully overlap between the selected time points, suggesting infection stage specific regulation by miRNA. The correctness of RNA-seq expression profiling was confirmed by qRT-PCR (quantitative Real Time Polymerase Chain Reaction) for seven miRNA species. Down- and up-regulated miRNA species, including their isomiRs, were further used to identify their potential targets. Among them there are a large number of transcription factors linked to different aspects of plant development belonging to gene families, such as APETALA2 (AP2), SQUAMOSA (MADS-box), MYB, GRAS, and AUXIN RESPONSE FACTOR (ARF). The substantial portion of potential target genes belong to the NB-LRR and RLK (RECEPTOR-LIKE KINASE) families, indicating the involvement of miRNA mediated regulation in defense responses. We also collected the evidence for target cleavage in the case of 29 miRNAs using one of three alternative methods: 5' RACE (5' Rapid Amplification of cDNA Ends), a search of tasiRNA within our datasets, and the meta-analysis of tomato degradomes in the GEO (Gene Expression Omnibus) database. Eight target transcripts showed a negative correlation with their respective miRNAs at two or three time points. These results indicate a large regulatory potential for miRNAs in tuning the development and defense responses. Copyright © 2017 Elsevier B.V. All rights reserved.

Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

PubMed

Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

2015-05-29

MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

Sucrose affects the developmental transition of rhizomes in Oryza longistaminata.

PubMed

Bessho-Uehara, Kanako; Nugroho, Jovano Erris; Kondo, Hirono; Angeles-Shim, Rosalyn B; Ashikari, Motoyuki

2018-05-08

Oryza longistaminata, the African wild rice, can propagate vegetatively through rhizomes. Rhizomes elongate horizontally underground as sink organs, however, they undergo a developmental transition that shifts their growth to the surface of the ground to become aerial stems. This particular stage is essential for the establishment of new ramets. While several determinants such as abiotic stimuli and plant hormones have been reported as key factors effecting developmental transition in aerial stem, the cause of this phenomenon in rhizome remains elusive. This study shows that depletion of nutrients, particularly sucrose, is the key stimulus that induces the developmental transition in rhizomes, as indicated by the gradient of sugars from the base to the tip of the rhizome. Sugar treatments revealed that sucrose specifically represses the developmental transition from rhizome to aerial stem by inhibiting the expression of sugar metabolism and hormone synthesis genes at the bending point. Sucrose depletion affected several factors contributing to the developmental transition of rhizome including signal transduction, transcriptional regulation and plant hormone balance.

Gene expression as a sensitive endpoint to evaluate cell differentiation and maturation of the developing central nervous system in primary cultures of rat cerebellar granule cells (CGCs) exposed to pesticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogberg, Helena T.; Department of Physiology, Wenner-Gren Institute, Stockholm University; Kinsner-Ovaskainen, Agnieszka

The major advantage of primary neuronal cultures for developmental neurotoxicity (DNT) testing is their ability to replicate the crucial stages of neurodevelopment. In our studies using primary culture of cerebellar granule cells (CGCs) we have evaluated whether the gene expression relevant to the most critical developmental processes such as neuronal differentiation (NF-68 and NF-200) and functional maturation (NMDA and GABA{sub A} receptors), proliferation and differentiation of astrocytes (GFAP and S100{beta}) as well as the presence of neural precursor cells (nestin and Sox10) could be used as an endpoint for in vitro DNT. The expression of these genes was assessed aftermore » exposure to various pesticides (paraquat parathion, dichlorvos, pentachlorophenol and cycloheximide) that could induce developmental neurotoxicity through different mechanisms. All studied pesticides significantly modified the expression of selected genes, related to the different stages of neuronal and/or glial cell development and maturation. The most significant changes were observed after exposure to paraquat and parathion (i.e. down-regulation of mRNA expression of NF-68 and NF-200, NMDA and GABA{sub A} receptors). Similarly, dichlorvos affected mainly neurons (decreased mRNA expression of NF-68 and GABA{sub A} receptors) whereas cycloheximide had an effect on neurons and astrocytes, as significant decreases in the mRNA expression of both neurofilaments (NF-68 and NF-200) and the astrocyte marker (S100{beta}) were observed. Our results suggest that toxicity induced by pesticides that target multiple pathways of neurodevelopment can be identified by studying expression of genes that are involved in different stages of cell development and maturation, and that gene expression could be used as a sensitive endpoint for initial screening to identify the compounds with the potential to cause developmental neurotoxicity.« less

Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

PubMed

Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

2016-01-01

Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators were known to be involved in muscle and adipose tissues development, but others not previously associated with pig muscle growth were also identified, as PVALB, KLF1 or IRF2. The present study discloses potential molecular mechanisms underlying phenotypic differences observed between IB and IBxDU pigs and highlights candidate genes implicated in these molecular mechanisms.

A common genetic variant in FOXP2 is associated with language-based learning (dis)abilities: Evidence from two Italian independent samples.

PubMed

Mozzi, Alessandra; Riva, Valentina; Forni, Diego; Sironi, Manuela; Marino, Cecilia; Molteni, Massimo; Riva, Stefania; Guerini, Franca R; Clerici, Mario; Cagliani, Rachele; Mascheretti, Sara

2017-04-24

Language-based Learning Disabilities (LLDs) encompass a group of complex, comorbid, and developmentally associated deficits in communication. Language impairment and developmental dyslexia (DD) represent the most recognized forms of LLDs. Substantial genetic correlations exist between language and reading (dis)abilities. Common variants in the FOXP2 gene were consistently associated with language- and reading-related neuropsychological and neuroanatomical phenotypes. We tested the effect of a FOXP2 common variant, that is, rs6980093 (A/G), on quantitative measures of language and reading in two independent Italian samples: a population-based cohort of 699 subjects (3-11 years old) and a sample of 572 children with DD (6-18 years old). rs6980093 modulates expressive language in the general population sample, with an effect on fluency scores. In the DD sample, the variant showed an association with the accuracy in the single word reading task. rs6980093 shows distinct genetic models of association in the two cohorts, with a dominant effect of the G allele in the general population sample and heterozygote advantage in the DD cohort. We provide preliminary evidence that rs6980093 associates with language and reading (dis)abilities in two independent Italian cohorts. rs6980093 is an intronic SNP, suggesting that it (or a linked variant) modulates phenotypic association via regulation of FOXP2 expression. Because FOXP2 brain expression is finely regulated, both temporally and spatially, it is possible that the two alleles at rs6980093 differentially modulate expression levels in a developmental stage- or brain area-specific manner. This might help explaining the heterozygote advantage effect and the different genetic models in the two cohorts. © 2017 Wiley Periodicals, Inc.

Ontogenetic changes and developmental adjustments in lactate dehydrogenase isozymes of an obligate air-breathing fish Channa punctatus during deprivation of air access.

PubMed

Ahmad, Riaz; Hasnain, Absar-Ul

2005-02-01

In air-breathing snakehead Channa punctatus, Ldh-B is expressed at all ontogenetic and developmental stages, while Ldh-A is expressed temporally in pre-hatchlings 12-13 days ahead of bimodal respiration marked by air-breathing. Remarkable differences are observed in the LDH isozyme expression among various ontogenetic and developmental stages upon denying air access. When denied air access, water-breathing larvae show two distinct characteristics: (i) they survive longer than transitory air-breathers due to independence from air-breathing and (ii) there is more transient induction of Ldh-B than Ldh-A. Transition to bimodal breathing, which occurred post-hatching in 15-day old larvae, is coincidental with inducibility of Ldh-A and concomitant down-regulation of Ldh-B. Heart tissue from air-breathing adults denied air access shows a preferential expression of LDH-A subunit and slight down-regulation of LDH-B. Heterotetramers of A and B subunits participate in adjusting LDH levels among those stages which either precede air-breathing switchover, or are subsequent to this transition. The contribution of heterotetramers depends on the stage-specific levels of LDH homotetramers A(4) or B(4). Scaling of muscle mass during growth, tolerance to extended deprivation of air access and induction of Ldh-A are correlated. Response to restoring air contact indicated that advanced air-breathing stages of C. punctatus possess an inherent capacity to sense surface air. In kinetic properties, LDH isozymes of C. punctatus are teleost-like but species specificity is displayed in oxidative potential by cardiac muscle and in L-lactate reduction by skeletal muscle.

Compound-specific effects of diverse neurodevelopmental toxicants on global gene expression in the neural embryonic stem cell test (ESTn)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Theunissen, P.T., E-mail: Peter.Theunissen@rivm.nl; Department of Toxicogenomics, Maastricht University, Maastricht; Robinson, J.F.

Alternative assays for developmental toxicity testing are needed to reduce animal use in regulatory toxicology. The in vitro murine neural embryonic stem cell test (ESTn) was designed as an alternative for neurodevelopmental toxicity testing. The integration of toxicogenomic-based approaches may further increase predictivity as well as provide insight into underlying mechanisms of developmental toxicity. In the present study, we investigated concentration-dependent effects of six mechanistically diverse compounds, acetaldehyde (ACE), carbamazepine (CBZ), flusilazole (FLU), monoethylhexyl phthalate (MEHP), penicillin G (PENG) and phenytoin (PHE), on the transcriptome and neural differentiation in the ESTn. All compounds with the exception of PENG altered ESTnmore » morphology (cytotoxicity and neural differentiation) in a concentration-dependent manner. Compound induced gene expression changes and corresponding enriched gene ontology biological processes (GO–BP) were identified after 24 h exposure at equipotent differentiation-inhibiting concentrations of the compounds. Both compound-specific and common gene expression changes were observed between subsets of tested compounds, in terms of significance, magnitude of regulation and functionality. For example, ACE, CBZ and FLU induced robust changes in number of significantly altered genes (≥ 687 genes) as well as a variety of GO–BP, as compared to MEHP, PHE and PENG (≤ 55 genes with no significant changes in GO–BP observed). Genes associated with developmentally related processes (embryonic morphogenesis, neuron differentiation, and Wnt signaling) showed diverse regulation after exposure to ACE, CBZ and FLU. In addition, gene expression and GO–BP enrichment showed concentration dependence, allowing discrimination of non-toxic versus toxic concentrations on the basis of transcriptomics. This information may be used to define adaptive versus toxic responses at the transcriptome level.« less

Extending juvenility in grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaeppler, Shawn; de Leon Gatti, Natalia; Foerster, Jillian

The present invention relates to compositions and methods for modulating the juvenile to adult developmental growth transition in plants, such as grasses (e.g. maize). In particular, the invention provides methods for enhancing agronomic properties in plants by modulating expression of GRMZM2G362718, GRMZM2G096016, or homologs thereof. Modulation of expression of one or more additional genes which affect juvenile to adult developmental growth transition such as Glossy15 or Cg1, in conjunction with such modulation of expression is also contemplated. Nucleic acid constructs for down-regulation of GRMZM2G362718 and/or GRMZM2G096016 are also contemplated, as are transgenic plants and products produced there from, that demonstratemore » altered, such as extended juvenile growth, and display associated phenotypes such as enhanced yield, improved digestibility, and increased disease resistance. Plants described herein may be used, for example, as improved forage or feed crops or in biofuel production.« less

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis)

USDA-ARS?s Scientific Manuscript database

Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and ...

Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...

MicroRNA Transcriptome Profiles During Swine Skeletal Muscle Development

USDA-ARS?s Scientific Manuscript database

MicroRNA (miR) are a class of small RNAs that regulate gene expression by inhibiting translation of protein encoding transcripts. To evaluate the role of miR in skeletal muscle of swine, global microRNA abundance was measured at specific developmental stages including proliferating satellite cells,...

Life cycle expression analysis of three cell wall degradation-related genes in ethylene-treated grass

USDA-ARS?s Scientific Manuscript database

Ethylene regulates multiple developmental processes during a plant life cycle, but the effect of ethylene on the upregulation of senescence-, stress-, and post-harvest-related genes in forage grasses is poorly understood. In this work, we used quantitative PCR to determine whether ethylene applicat...

Regulation of Alternative Splicing in Vivo by Overexpression of Antagonistic Splicing Factors

NASA Astrophysics Data System (ADS)

Caceres, Javier F.; Stamm, Stefan; Helfman, David M.; Krainer, Adrian R.

1994-09-01

The opposing effects of SF2/ASF and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 influence alternative splicing in vitro. SF2/ASF or hnRNP A1 complementary DNAs were transiently overexpressed in HeLa cells, and the effect on alternative splicing of several cotransfected reporter genes was measured. Increased expression of SF2/ASF activated proximal 5' splice sites, promoted inclusion of a neuron-specific exon, and prevented abnormal exon skipping. Increased expression of hnRNP A1 activated distal 5' splice sites. Therefore, variations in the intracellular levels of antagonistic splicing factors influence different modes of alternative splicing in vivo and may be a natural mechanism for tissue-specific or developmental regulation of gene expression.

Circular RNAs: analysis, expression and potential functions

PubMed Central

Salzman, Julia

2016-01-01

Just a few years ago, it had been assumed that the dominant RNA isoforms produced from eukaryotic genes were variants of messenger RNA, functioning as intermediates in gene expression. In early 2012, however, a surprising discovery was made: circular RNA (circRNA) was shown to be a transcriptional product in thousands of human and mouse genes and in hundreds of cases constituted the dominant RNA isoform. Subsequent studies revealed that the expression of circRNAs is developmentally regulated, tissue and cell-type specific, and shared across the eukaryotic tree of life. These features suggest important functions for these molecules. Here, we describe major advances in the field of circRNA biology, focusing on the regulation of and functional roles played by these molecules. PMID:27246710

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

Developmental programming: prenatal testosterone excess disrupts anti-Müllerian hormone expression in preantral and antral follicles.

PubMed

Veiga-Lopez, Almudena; Ye, Wen; Padmanabhan, Vasantha

2012-03-01

To investigate the impact of prenatal T excess on the expression of key ovarian regulators implicated in follicular recruitment and persistence using a large animal model of polycystic ovarian syndrome (PCOS). Interventional, animal model study. Academic research unit. A total of 25 female fetuses, 14 prepubertal female, and 24 adult female Suffolk sheep. Prenatal T treatment. Immunohistochemical determination of expression of anti-Müllerian hormone (AMH), kit ligand, and growth differentiation factor 9 (GDF9) in fetal, prepubertal, and adult ovarian tissues. Prenatal T treatment reduced the AMH protein expression in granulosa cells (GC) of preantral follicles and increased its expression in antral follicles compared with age-matched adult controls. These differences were not evident in prepubertal animals. Protein expression of GDF9 and kit ligand was not altered at any of the developmental time points studied. Prenatal T exposure is associated with changes in AMH expression in preantral and antral follicles in adult ovaries, similar to findings in women with PCOS. These findings indicate that abnormal folliculogenesis in PCOS may be at least in part mediated by changes in AMH expression. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Developmental changes in somatostatin-positive interneurons in a freeze-lesion model of epilepsy.

PubMed

Patrick, Saundra L; Connors, Barry W; Landisman, Carole E

2006-08-01

Somatostatin-expressing (SS) cells are inhibitory interneurons critical to the regulation of excitability in the cerebral cortex. It has been suggested in several animal models of epilepsy that the activity of these neurons reduces the occurrence and strength of epileptiform activity. The physiological properties of SS cells further support these hypotheses. Freeze lesions of neonatal rats serve as a model of human polymicrogyria, which is often characterized by severe seizures. Here we investigate the effects of neonatal freeze lesions on SS-expressing neurons by measuring their densities in control and lesioned hemispheres at two ages. We found that in late juveniles (P30-P32), SS-expressing neurons were depleted by 20% in areas adjacent to the freeze lesion, but at an earlier developmental age (P14-15), there was no significant loss. Since the deficit in SS-expressing neurons occurs well after the onset of epileptiform activity (P12-P18), we conclude that the death of these interneurons does not initiate hyperexcitability in this model.

A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

PubMed

Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

2016-02-01

Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

BMP7 and SHH regulate Pax2 in mouse retinal astrocytes by relieving TLX repression.

PubMed

Sehgal, Rachna; Sheibani, Nader; Rhodes, Simon J; Belecky Adams, Teri L

2009-08-15

Pax2 is essential for development of the neural tube, urogenital system, optic vesicle, optic cup and optic tract. In the eye, Pax2 deficiency is associated with coloboma, a loss of astrocytes in the optic nerve and retina, and abnormal axonal pathfinding of the ganglion cell axons at the optic chiasm. Thus, appropriate expression of Pax2 is essential for astrocyte determination and differentiation. Although BMP7 and SHH have been shown to regulate Pax2 expression, the molecular mechanism by which this regulation occurs is not well understood. In this study, we determined that BMP7 and SHH activate Pax2 expression in mouse retinal astrocyte precursors in vitro. SHH appeared to play a dual role in Pax2 regulation; 1) SHH may regulate BMP7 expression, and 2) the SHH pathway cooperates with the BMP pathway to regulate Pax2 expression. BMP and SHH pathway members can interact separately or together with TLX, a repressor protein in the tailless transcription factor family. Here we show that the interaction of both pathways with TLX relieves the repression of Pax2 expression in mouse retinal astrocytes. Together these data reveal a new mechanism for the cooperative actions of signaling pathways in astrocyte determination and differentiation and suggest interactions of regulatory pathways that are applicable to other developmental programs.

Loss of Cation-Chloride Cotransporter Expression in Preterm Infants With White Matter Lesions: Implications for the Pathogenesis of Epilepsy

PubMed Central

Robinson, Shenandoah; Mikolaenko, Irina; Thompson, Ian; Cohen, Mark L.; Goyal, Monisha

2011-01-01

Epilepsy associated with preterm birth is often refractory to anticonvulsants. Children who are born preterm are also prone to cognitive delay and behavioral problems. Brains from these children often show diffuse abnormalities in cerebral circuitry that is likely caused by disrupted development during critical stages of cortical formation. To test the hypothesis that prenatal injury impairs the developmental switch of γ-amino butyric acid (GABA)ergic synapses from excitatory to inhibitory, thereby disrupting cortical circuit formation and predisposing to epilepsy, we used immunohistochemistry to compare the expression of cation-chloride transporters that developmentally regulate postsynaptic GABAergic discharges in postmortem cerebral samples from infants born preterm with known white matter injury (n = 11) with that of controls with minimal white matter gliosis (n = 7). Controls showed the expected developmental expression of cation-chloride transporters NKCC1 and KCC2 and of calretinin, a marker of a GABAergic neuronal subpopulation. Samples from infants with white matter damage showed a significant loss of expression of both NKCC1 and KCC2 in subplate and white matter. By contrast, there were no significant differences in total cell number or glutamate transporter VGLUT1 expression. Together, these novel findings suggest a molecular mechanism involved in the disruption of a critical stage of cerebral circuit development after brain injury from preterm birth that may predispose to epilepsy. PMID:20467335

Enriched expression of the ciliopathy gene Ick in cell proliferating regions of adult mice.

PubMed

Tsutsumi, Ryotaro; Chaya, Taro; Furukawa, Takahisa

2018-04-07

Cilia are essential for sensory and motile functions across species. In humans, ciliary dysfunction causes "ciliopathies", which show severe developmental abnormalities in various tissues. Several missense mutations in intestinal cell kinase (ICK) gene lead to endocrine-cerebro-osteodysplasia syndrome or short rib-polydactyly syndrome, lethal recessive developmental ciliopathies. We and others previously reported that Ick-deficient mice exhibit neonatal lethality with developmental defects. Mechanistically, Ick regulates intraflagellar transport and cilia length at ciliary tips. Although Ick plays important roles during mammalian development, roles of Ick at the adult stage are poorly understood. In the current study, we investigated the Ick gene expression in adult mouse tissues. RT-PCR analysis showed that Ick is ubiquitously expressed, with enrichment in the retina, brain, lung, intestine, and reproductive system. In the adult brain, we found that Ick expression is enriched in the walls of the lateral ventricle, in the rostral migratory stream of the olfactory bulb, and in the subgranular zone of the hippocampal dentate gyrus by in situ hybridization analysis. We also observed that Ick staining pattern is similar to pachytene spermatocyte to spermatid markers in the mature testis and to an intestinal stem cell marker in the adult small intestine. These results suggest that Ick is expressed in proliferating regions in the adult mouse brain, testis, and intestine. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire

PubMed Central

2011-01-01

Background The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. Results We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. Conclusions These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis. PMID:22129300

Cannabinoid receptor signaling in progenitor/stem cell proliferation and differentiation.

PubMed

Galve-Roperh, Ismael; Chiurchiù, Valerio; Díaz-Alonso, Javier; Bari, Monica; Guzmán, Manuel; Maccarrone, Mauro

2013-10-01

Cannabinoids, the active components of cannabis (Cannabis sativa) extracts, have attracted the attention of human civilizations for centuries, much earlier than the discovery and characterization of their substrate of action, the endocannabinoid system (ECS). The latter is an ensemble of endogenous lipids, their receptors [in particular type-1 (CB1) and type-2 (CB2) cannabinoid receptors] and metabolic enzymes. Cannabinoid signaling regulates cell proliferation, differentiation and survival, with different outcomes depending on the molecular targets and cellular context involved. Cannabinoid receptors are expressed and functional from the very early developmental stages, when they regulate embryonic and trophoblast stem cell survival and differentiation, and thus may affect the formation of manifold adult specialized tissues derived from the three different germ layers (ectoderm, mesoderm and endoderm). In the ectoderm-derived nervous system, both CB1 and CB2 receptors are present in neural progenitor/stem cells and control their self-renewal, proliferation and differentiation. CB1 and CB2 show opposite patterns of expression, the former increasing and the latter decreasing along neuronal differentiation. Recently, endocannabinoid (eCB) signaling has also been shown to regulate proliferation and differentiation of mesoderm-derived hematopoietic and mesenchymal stem cells, with a key role in determining the formation of several cell types in peripheral tissues, including blood cells, adipocytes, osteoblasts/osteoclasts and epithelial cells. Here, we will review these new findings, which unveil the involvement of eCB signaling in the regulation of progenitor/stem cell fate in the nervous system and in the periphery. The developmental regulation of cannabinoid receptor expression and cellular/subcellular localization, together with their role in progenitor/stem cell biology, may have important implications in human health and disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Bioinformatics and expressional analysis of cDNA clones from floral buds

NASA Astrophysics Data System (ADS)

Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

2017-08-01

The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

Function and Evolution of DNA Methylation in Nasonia vitripennis

PubMed Central

Wang, Xu; Wheeler, David; Avery, Amanda; Rago, Alfredo; Choi, Jeong-Hyeon; Colbourne, John K.; Clark, Andrew G.; Werren, John H.

2013-01-01

The parasitoid wasp Nasonia vitripennis is an emerging genetic model for functional analysis of DNA methylation. Here, we characterize genome-wide methylation at a base-pair resolution, and compare these results to gene expression across five developmental stages and to methylation patterns reported in other insects. An accurate assessment of DNA methylation across the genome is accomplished using bisulfite sequencing of adult females from a highly inbred line. One-third of genes show extensive methylation over the gene body, yet methylated DNA is not found in non-coding regions and rarely in transposons. Methylated genes occur in small clusters across the genome. Methylation demarcates exon-intron boundaries, with elevated levels over exons, primarily in the 5′ regions of genes. It is also elevated near the sites of translational initiation and termination, with reduced levels in 5′ and 3′ UTRs. Methylated genes have higher median expression levels and lower expression variation across development stages than non-methylated genes. There is no difference in frequency of differential splicing between methylated and non-methylated genes, and as yet no established role for methylation in regulating alternative splicing in Nasonia. Phylogenetic comparisons indicate that many genes maintain methylation status across long evolutionary time scales. Nasonia methylated genes are more likely to be conserved in insects, but even those that are not conserved show broader expression across development than comparable non-methylated genes. Finally, examination of duplicated genes shows that those paralogs that have lost methylation in the Nasonia lineage following gene duplication evolve more rapidly, show decreased median expression levels, and increased specialization in expression across development. Methylation of Nasonia genes signals constitutive transcription across developmental stages, whereas non-methylated genes show more dynamic developmental expression patterns. We speculate that loss of methylation may result in increased developmental specialization in evolution and acquisition of methylation may lead to broader constitutive expression. PMID:24130511

Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

PubMed Central

Veldman, Matthew B.; Lin, Shuo

2012-01-01

Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

PubMed

Veldman, Matthew B; Lin, Shuo

2012-01-20

Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

PubMed Central

Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

2010-01-01

Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

PubMed

Metzger, David C H; Schulte, Patricia M

2018-04-14

Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

Impact of developmental lead exposure on splenic factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kasten-Jolly, Jane, E-mail: kjolly@wadsworth.or; Heo, Yong, E-mail: yheo@cu.ac.k; Lawrence, David A., E-mail: david.lawrence@wadsworth.or

2010-09-01

Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, inmore » order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.« less

Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

PubMed

Cho, Jungnam; Paszkowski, Jerzy

2017-08-26

It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

USGS Publications Warehouse

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

Identification of ARF and AUX/IAA gene families in Rafflesia cantleyi

NASA Astrophysics Data System (ADS)

Elias, Nur Atiqah Mohd; Goh, Hoe-Han; Isa, Nurulhikma Md; Wan, Kiew-Lian

2016-11-01

Rafflesia is a unique plant that produces the largest flowers in the world. It has a short blooming period of 6 to 7 days. Due to its rarity and limited accessibility, little is known about the growth and developmental process in the Rafflesia plant. In all plant species, auxin is the key hormone that is involved in growth and development. The auxin signal transduction involves members of the ARF transcription factor and AUX/IAA regulator families, which activate or inhibit the regulation of auxin response genes, thereby control the developmental process in plants. To gain a better understanding of molecular regulations in the Rafflesia plant development during flowering, members of the ARF and AUX/IAA gene families were identified from the transcriptome data of flower blooming stages in Rafflesia cantleyi. Based on Rafflesia unique transcripts (UTs) against the Arabidopsis TAIR database using BLASTX search, a total of nine UTs were identified as ARF transcription factors, while another seven UTs were identified as AUX/IAA regulators. These genes were found to be expressed in all three R. cantleyi flower stages i.e. days 1 (F1), 3 (F2), and 5 (F3). Gene expression analysis identified three genes that are differentially expressed in stage F1 vs. F2 i.e. IAA4 is upregulated while IAA8 and ARF3 are downregulated. These genes may be involved in the activation and/or inhibition of the auxin signal transduction pathway. Further analysis of these genes may unravel their function in the phenotypic development of the Rafflesia plant.

Characterization of a novel glycine-rich protein from the cell wall of maize silk tissues.

PubMed

Tao, T Y; Ouellet, T; Dadej, K; Miller, S S; Johnson, D A; Singh, J

2006-08-01

The isolation, characterization and regulation of expression of a maize silk-specific gene is described. zmgrp5 (Zea mays glycine-rich protein 5) encodes a 187 amino acid glycine-rich protein that displays developmentally regulated silk-specific expression. Northern, Western, in situ mRNA hybridization and transient gene expression analyses indicate that zmgrp5 is expressed in silk hair and in cells of the vascular bundle and pollen tube transmitting tissue elements. The protein is secreted into the extracellular matrix and is localized in the cell wall fraction mainly through interactions mediated by covalent disulphide bridges. Taken together, these results suggest that the protein may play a role in maintaining silk structure during development. This is the first documented isolation of a stigma-specific gene from maize, an important agronomic member of the Poaceae family.

A knock-in mouse line conditionally expressing the tumor suppressor WTX/AMER1.

PubMed

Boutet, Agnès; Comai, Glenda; Charlet, Aurélie; Jian Motamedi, Fariba; Dhib, Haroun; Bandiera, Roberto; Schedl, Andreas

2017-11-01

WTX/AMER1 is an important developmental regulator, mutations in which have been identified in a proportion of patients suffering from the renal neoplasm Wilms' tumor and in the bone malformation syndrome Osteopathia Striata with Cranial Sclerosis (OSCS). Its cellular functions appear complex and the protein can be found at the membrane, within the cytoplasm and the nucleus. To understand its developmental and cellular function an allelic series for Wtx in the mouse is crucial. Whereas mice carrying a conditional knock out allele for Wtx have been previously reported, a gain-of-function mouse model that would allow studying the molecular, cellular and developmental role of Wtx is still missing. Here we describe the generation of a novel mouse strain that permits the conditional activation of WTX expression. Wtx fused to GFP was introduced downstream a stop cassette flanked by loxP sites into the Rosa26 locus by gene targeting. Ectopic WTX expression is reported after crosses with several Cre transgenic mice in different embryonic tissues. Further, functionality of the fusion protein was demonstrated in the context of a Wtx null allele. © 2017 Wiley Periodicals, Inc.

Differential expression of syndecan isoforms during mouse incisor amelogenesis.

PubMed

Muto, Taro; Miyoshi, Keiko; Munesue, Seiichi; Nakada, Hiroshi; Okayama, Minoru; Matsuo, Takashi; Noma, Takafumi

2007-08-01

Syndecans are transmembranous heparan sulfate proteoglycans (HSPGs) with covalently attached glycosaminoglycan side-chains located on the cell surface. The mammalian syndecan family is composed of four types of syndecans (syndecan-1 to -4). Syndecans interact with the intracellular cytoskeleton through the cytoplasmic domains of their core proteins and membrane proteins, extracellular enzymes, growth factors, and matrix components, through their heparan-sulfate chains, to regulate developmental processes.Here, as a first step to assess the possible roles of syndecan proteins in amelogenesis, we examined the expression patterns of all syndecan isoforms in continuously growing mouse incisors, in which we can overview major differentiation stages of amelogenesis at a glance. Understanding the expression domain of each syndecan isoform during specific developmental stages seems useful for investigating their physiological roles in amelogenesis. Immunohistochemical analysis of syndecan core proteins in the lower incisors from postnatal day 1 mice revealed spatially and temporally specific expression patterns, with syndecan-1 expressed in undifferentiated epithelial and mesenchymal cells, and syndecan-2, -3, and -4 in more differentiated cells. These findings suggest that each syndecan isoform functions distinctly during the amelogenesis of the incisors of mice.

A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

PubMed Central

Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.

PubMed

Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha

2013-01-01

Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

Genetical Toxicogenomics in Drosophila Identifies Master Modulatory Loci that are Regulated by Developmental Exposure to Lead

PubMed Central

Ruden, Douglas M.; Chen, Lang; Possidente, Debra; Possidente, Bernard; Rasouli, Parsa; Wang, Luan; Lu, Xiangyi; Garfinkel, Mark D.; Hirsch, Helmut V. B.; Page, Grier P.

2009-01-01

The genetics of gene expression in recombinant inbred lines (RILs) can be mapped as expression quantitative trait loci (eQTLs). So-called “genetical genomics” studies have identified locally-acting eQTLs (cis-eQTLs) for genes that show differences in steady state RNA levels. These studies have also identified distantly-acting master-modulatory trans-eQTLs that regulate tens or hundreds of transcripts (hotspots or transbands). We expand on these studies by performing genetical genomics experiments in two environments in order to identify trans-eQTL that might be regulated by developmental exposure to the neurotoxin lead. Flies from each of 75 RIL were raised from eggs to adults on either control food (made with 250 µM sodium acetate), or lead-treated food (made with 250 µM lead acetate, PbAc). RNA expression analyses of whole adult male flies (5–10 days old) were performed with Affymetrix DrosII whole genome arrays (18,952 probesets). Among the 1,389 genes with cis-eQTL, there were 405 genes unique to control flies and 544 genes unique to lead-treated ones (440 genes had the same cis-eQTLs in both samples). There are 2,396 genes with trans-eQTL which mapped to 12 major transbands with greater than 95 genes. Permutation analyses of the strain labels but not the expression data suggests that the total number of eQTL and the number of transbands are more important criteria for validation than the size of the transband. Two transbands, one located on the 2nd chromosome and one on the 3rd chromosome, co-regulate 33 lead-induced genes, many of which are involved in neurodevelopmental processes. For these 33 genes, rather than allelic variation at one locus exerting differential effects in two environments, we found that variation at two different loci are required for optimal effects on lead-induced expression. PMID:19737576

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

PubMed

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-09-15

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration

PubMed Central

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2, which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words “neuron” or “axonogenesis” were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer’s, Parkinson’s, and Huntington’s diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell–cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin–radixin–moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2’s importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases. PMID:28798667

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration.

PubMed

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2 , which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words "neuron" or "axonogenesis" were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer's, Parkinson's, and Huntington's diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell-cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin-radixin-moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2's importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases.

Conserved patterns of integrated developmental plasticity in a group of polyphenic tropical butterflies.

PubMed

van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M

2017-02-27

Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.

Nuclear Lamins

PubMed Central

Dechat, Thomas; Adam, Stephen A.; Taimen, Pekka; Shimi, Takeshi; Goldman, Robert D.

2010-01-01

The nuclear lamins are type V intermediate filament proteins that are critically important for the structural properties of the nucleus. In addition, they are involved in the regulation of numerous nuclear processes, including DNA replication, transcription and chromatin organization. The developmentally regulated expression of lamins suggests that they are involved in cellular differentiation. Their assembly dynamic properties throughout the cell cycle, particularly in mitosis, are influenced by posttranslational modifications. Lamins may regulate nuclear functions by direct interactions with chromatin and determining the spatial organization of chromosomes within the nuclear space. They may also regulate chromatin functions by interacting with factors that epigenetically modify the chromatin or directly regulate replication or transcription. PMID:20826548

C. elegans microRNAs.

PubMed

Vella, Monica C; Slack, Frank J

2005-09-21

MicroRNAs (miRNAs) are small, non-coding regulatory RNAs found in many phyla that control such diverse events as development, metabolism, cell fate and cell death. They have also been implicated in human cancers. The C. elegans genome encodes hundreds of miRNAs, including the founding members of the miRNA family lin-4 and let-7. Despite the abundance of C. elegans miRNAs, few miRNA targets are known and little is known about the mechanism by which they function. However, C. elegans research continues to push the boundaries of discovery in this area. lin-4 and let-7 are the best understood miRNAs. They control the timing of adult cell fate determination in hypodermal cells by binding to partially complementary sites in the mRNA of key developmental regulators to repress protein expression. For example, lin-4 is predicted to bind to seven sites in the lin-14 3' untranslated region (UTR) to repress LIN-14, while let-7 is predicted to bind two let-7 complementary sites in the lin-41 3' UTR to down-regulate LIN-41. Two other miRNAs, lsy-6 and mir-273, control left-right asymmetry in neural development, and also target key developmental regulators for repression. Approximately one third of the C. elegans miRNAs are differentially expressed during development indicating a major role for miRNAs in C. elegans development. Given the remarkable conservation of developmental mechanism across phylogeny, many of the principles of miRNAs discovered in C. elegans are likely to be applicable to higher animals.

Role of fibroblast growth factor receptors (FGFR) and FGFR like-1 (FGFRL1) in mesenchymal stromal cell differentiation to osteoblasts and adipocytes.

PubMed

Kähkönen, T E; Ivaska, K K; Jiang, M; Büki, K G; Väänänen, H K; Härkönen, P L

2018-02-05

Fibroblast growth factors (FGF) and their receptors (FGFRs) regulate many developmental processes including differentiation of mesenchymal stromal cells (MSC). We developed two MSC lines capable of differentiating to osteoblasts and adipocytes and studied the role of FGFRs in this process. We identified FGFR2 and fibroblast growth factor receptor like-1 (FGFRL1) as possible actors in MSC differentiation with gene microarray and qRT-PCR. FGFR2 and FGFRL1 mRNA expression strongly increased during MSC differentiation to osteoblasts. FGF2 treatment, resulting in downregulation of FGFR2, or silencing FGFR2 expression with siRNAs inhibited osteoblast differentiation. During adipocyte differentiation expression of FGFR1 and FGFRL1 increased and was down-regulated by FGF2. FGFR1 knockdown inhibited adipocyte differentiation. Silencing FGFR2 and FGFR1 in MSCs was associated with decreased FGFRL1 expression in osteoblasts and adipocytes, respectively. Our results suggest that FGFR1 and FGFR2 regulate FGFRL1 expression. FGFRL1 may mediate or modulate FGFR regulation of MSC differentiation together with FGFR2 in osteoblastic and FGFR1 in adipocytic lineage. Copyright © 2017 Elsevier B.V. All rights reserved.

Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

PubMed

Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

2016-09-08

The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

The role of Drosophila TNF Eiger in developmental and damage-induced neuronal apoptosis.

PubMed

Shklover, Jeny; Levy-Adam, Flonia; Kurant, Estee

2015-04-02

Eiger, the sole Drosophila TNF-alpha homolog, causes ectopic apoptosis through JNK pathway activation. Yet, its role in developmental apoptosis remains unclear. eiger mutant flies are viable and fertile but display compromised elimination of oncogenic cells and extracellular bacteria. Here we show that Eiger, specifically expressed in embryonic neurons and glia, is not involved in developmental neuronal apoptosis or in apoptotic cell clearance. Instead, we provide evidence that Eiger is required for damage-induced apoptosis in the embryonic CNS through regulation of the pro-apoptotic gene hid independently of the JNK pathway. Our study thus reveals a new requirement for Eiger in eliminating damaged cells during development. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular cloning, characterization, and expression analysis of an ecdysone receptor homolog in Teleogryllus emma (Orthoptera: Gryllidae).

PubMed

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5'-untranslated region of 555 bp and a 3'-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Molecular Cloning, Characterization, and Expression Analysis of an Ecdysone Receptor Homolog in Teleogryllus emma (Orthoptera: Gryllidae)

PubMed Central

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5′-untranslated region of 555 bp and a 3′-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. PMID:25797799

nAChRs-ERK1/2-Egr-1 signaling participates in the developmental toxicity of nicotine by epigenetically down-regulating placental 11β-HSD2.

PubMed

Zhou, Jin; Liu, Fulin; Yu, Luting; Xu, Dan; Li, Bin; Zhang, Guohui; Huang, Wen; Li, Lu; Zhang, Yuanzhen; Zhang, Wei; Wang, Hui

2018-04-01

Impaired placental 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2) activity which inactivates maternal glucocorticoids is associated with poor fetal growth and a higher risk of chronic diseases in adulthood. This study aimed to elucidate the epigenetically regulatory mechanism of nicotine on placental 11β-HSD2 expression. Pregnant Wistar rats were administered 1.0 mg/kg nicotine subcutaneously twice a day from gestational day 9 to 20. The results showed that prenatal nicotine exposure increased corticosterone levels in the placenta and fetal serum, disrupted placental morphology and endocrine function, and reduced fetal bodyweight. Meanwhile, histone modification abnormalities (decreased acetylation and increased di-methylation of histone 3 Lysine 9) on the HSD11B2 promoter and lower-expression of 11β-HSD2 were observed. Furthermore, the expression of nicotinic acetylcholine receptor (nAChR) α4/β2, the phosphorylation of extracellular regulated kinase 1/2 (ERK1/2) and Ets-like protein-1 (Elk-1), and the expression of early growth response-1 (Egr-1) were increased in the nicotine groups. In human BeWo cells, nicotine decreased 11β-HSD2 expression, increased nAChRα9 expression, and activated ERK1/2/Elk-1/Egr-1 signaling in the concentration (0.1-10 μM)-dependent manner. Antagonism of nAChRs, inhibition of ERK1/2 and Egr-1 knockdown by siRNA were able to block/abrogate the effects of nicotine on histone modification and expression of 11β-HSD2. Taken together, nicotine can impair placental structure and function, and induce fetal developmental toxicity. The underlying mechanism involves histone modifications and down-regulation of 11β-HSD2 through nAChRs/ERK1/2/Elk-1/Egr-1 signaling, which increases active glucocorticoids levels in the placenta and fetus, and eventually inhibits the fetal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

PubMed

Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

PubMed Central

Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

Developmental expression and distribution of nesfatin-1/NUCB2 in the canine digestive system.

PubMed

Jiang, Shudong; Zhou, Weijuan; Zhang, Xingwang; Wang, Dengfeng; Zhu, Hui; Hong, Meizhen; Gong, Yajing; Ye, Jing; Fang, Fugui

2016-03-01

Nesfatin-1/NUCB2 is a neuropeptide that plays important roles in regulating food intake and energy homeostasis. The distribution of nesfatin-1/NUCB2 protein and mRNA has not been investigated in the canine digestive system. The present study was conducted to evaluate the expression of nesfatin-1/NUCB2 protein and NUCB2 mRNA in the canine digestive organs (esophagus, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, liver and pancreas). The tissues of the digestive system were collected from dogs at different developmental stages (infantile, juvenile, pubertal and adult). Nesfatin-1/NUCB2 protein localization in the organs of adult dogs was detected by immunohistochemistry. The expression of NUCB2 mRNA at the four developmental stages was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). Nesfatin-1/NUCB2 protein was distributed in the fundic gland region of the stomach, and the islet area and exocrine portions of the pancreas. However, NUCB2 mRNA was found in all digestive organs, although the expression levels in the pancreas and stomach were higher than those in liver, duodenum and other digestive tract tissues (P<0.05) at the four different developmental stages of the dogs. In this study, nesfatin-1/NUCB2 was found to be present at high levels in the stomach and pancreas at both the protein and mRNA levels; however, NUCB2 expression was found at lower levels in all of the digestive organs. These findings provide the basis of further investigations to elucidate the functions of nefatin-1 in the canine digestive system. Copyright © 2015 Elsevier GmbH. All rights reserved.

Systems biology of embryonic development: Prospects for a complete understanding of the Caenorhabditis elegans embryo.

PubMed

Murray, John Isaac

2018-05-01

The convergence of developmental biology and modern genomics tools brings the potential for a comprehensive understanding of developmental systems. This is especially true for the Caenorhabditis elegans embryo because its small size, invariant developmental lineage, and powerful genetic and genomic tools provide the prospect of a cellular resolution understanding of messenger RNA (mRNA) expression and regulation across the organism. We describe here how a systems biology framework might allow large-scale determination of the embryonic regulatory relationships encoded in the C. elegans genome. This framework consists of two broad steps: (a) defining the "parts list"-all genes expressed in all cells at each time during development and (b) iterative steps of computational modeling and refinement of these models by experimental perturbation. Substantial progress has been made towards defining the parts list through imaging methods such as large-scale green fluorescent protein (GFP) reporter analysis. Imaging results are now being augmented by high-resolution transcriptome methods such as single-cell RNA sequencing, and it is likely the complete expression patterns of all genes across the embryo will be known within the next few years. In contrast, the modeling and perturbation experiments performed so far have focused largely on individual cell types or genes, and improved methods will be needed to expand them to the full genome and organism. This emerging comprehensive map of embryonic expression and regulatory function will provide a powerful resource for developmental biologists, and would also allow scientists to ask questions not accessible without a comprehensive picture. This article is categorized under: Invertebrate Organogenesis > Worms Technologies > Analysis of the Transcriptome Gene Expression and Transcriptional Hierarchies > Gene Networks and Genomics. © 2018 Wiley Periodicals, Inc.

Serotonin Receptor 6 Mediates Defective Brain Development in Monoamine Oxidase A-deficient Mouse Embryos

PubMed Central

Wang, Chi Chiu; Man, Gene Chi Wai; Chu, Ching Yan; Borchert, Astrid; Ugun-Klusek, Aslihan; Billett, E. Ellen; Kühn, Hartmut; Ufer, Christoph

2014-01-01

Monoamine oxidases A and B (MAO-A and MAO-B) are enzymes of the outer mitochondrial membrane that metabolize biogenic amines. In the adult central nervous system, MAOs have important functions for neurotransmitter homeostasis. Expression of MAO isoforms has been detected in the developing embryo. However, suppression of MAO-B does not induce developmental alterations. In contrast, targeted inhibition and knockdown of MAO-A expression (E7.5–E10.5) caused structural abnormalities in the brain. Here we explored the molecular mechanisms underlying defective brain development induced by MAO-A knockdown during in vitro embryogenesis. The developmental alterations were paralleled by diminished apoptotic activity in the affected neuronal structures. Moreover, dysfunctional MAO-A expression led to elevated levels of embryonic serotonin (5-hydroxytryptamine (5-HT)), and we found that knockdown of serotonin receptor-6 (5-Htr6) expression or pharmacologic inhibition of 5-Htr6 activity rescued the MAO-A knockdown phenotype and restored apoptotic activity in the developing brain. Our data suggest that excessive 5-Htr6 activation reduces activation of caspase-3 and -9 of the intrinsic apoptotic pathway and enhances expression of antiapoptotic proteins Bcl-2 and Bcl-XL. Moreover, we found that elevated 5-HT levels in MAO-A knockdown embryos coincided with an enhanced activation of extracellular signal-regulated kinase 1/2 (ERK1/2) and a reduction of proliferating cell numbers. In summary, our findings suggest that excessive 5-HT in MAO-A-deficient mouse embryos triggers cellular signaling cascades via 5-Htr6, which suppresses developmental apoptosis in the brain and thus induces developmental retardations. PMID:24497636

Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

PubMed

Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

2017-10-01

The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

Life-cycle and growth-phase-dependent regulation of the ubiquitin genes of Trypanosoma cruzi.

PubMed

Manning-Cela, Rebeca; Jaishankar, Sobha; Swindle, John

2006-07-01

Trypanosoma cruzi, the causative agent of Chagas disease, exhibits a complex life cycle that is accompanied by the stage-specific gene expression. At the molecular level, very little is known about gene regulation in trypanosomes. Complex gene organizations coupled with polycistronic transcription units make the analysis of regulated gene expression difficult in trypanosomes. The ubiquitin genes of T. cruzi are a good example of this complexity. They are organized as a single cluster containing five ubiquitin fusion (FUS) and five polyubiquitin (PUB) genes that are polycistronically transcribed but expressed differently in response to developmental and environmental changes. Gene replacements were used to study FUS and PUB gene expression at different stages of growth and at different points in the life cycle of T. cruzi. Based on the levels of reporter gene expression, it was determined that FUS1 expression was downregulated as the parasites approached stationary phase, whereas PUB12.5 polyubiquitin gene expression increased. Conversely, FUS1 expression increases when epimastigotes and amastigotes differentiate into trypomastigotes, whereas the expression of PUB12.5 decreases when epimastigotes differentiate into amastigotes and trypomastigotes. Although the level of CAT activity in logarithmic growing epimastigotes is six- to seven-fold higher when the gene was expressed from the FUS1 locus than when expressed from the PUB12.5 locus, the rate of transcription from the two loci was the same implying that post-transcriptional mechanisms play a dominant role in the regulation of gene expression.

Developmental studies of the lamprey and hierarchical evolutionary steps towards the acquisition of the jaw

PubMed Central

Kuratani, Shigeru

2005-01-01

The evolution of animal morphology can be understood as a series of changes in developmental programs. Among vertebrates, some developmental stages are conserved across species, representing particular developmental constraints. One of the most conserved stages is the vertebrate pharyngula, in which similar embryonic morphology is observed and the Hox code is clearly expressed. The oral developmental program also appears to be constrained to some extent, as both its morphology and the the Hox-code-default state of the oropharyngeal region are well conserved between the lamprey and gnathostome embryos. These features do not by themselves explain the evolution of jaws, but should be regarded as a prerequisite for evolutionary diversification of the mandibular arch. By comparing the pharyngula morphology of the lamprey and gnathostomes, it has become clear that the oral pattern is not entirely identical; in particular, the positional differentiation of the rostral ectomesenchyme is shifted between these animals. Therefore, the jaw seems to have arisen as an evolutionary novelty by overriding ancestral constraints, a process in which morphological homologies are partially lost. This change involves the heterotopic shift of tissue interaction, which appears to have been preceded by the transition from monorhiny to diplorhiny, as well as separation of the hypophysis. When gene expression patterns are compared between the lamprey and gnathostomes, cell-autonomously functioning genes tend to be associated with identical cell types or equivalent anatomical domains, whereas growth-factor-encoding genes have changed their expression domains during evolution. Thus, the heterotopic evolution may be based on changes in the regulation of signalling-molecule-encoding genes. PMID:16313390

Dual Diathesis-Stressor Model of Emotional and Linguistic Contributions to Developmental Stuttering

ERIC Educational Resources Information Center

Walden, Tedra A.; Frankel, Carl B.; Buhr, Anthony P.; Johnson, Kia N.; Conture, Edward G.; Karrass, Jan M.

2012-01-01

This study assessed emotional and speech-language contributions to childhood stuttering. A dual diathesis-stressor framework guided this study, in which both linguistic requirements and skills, and emotion and its regulation, are hypothesized to contribute to stuttering. The language diathesis consists of expressive and receptive language skills.…

Effects on specific promoter DNA methylation in zebrafish embryos and larvae following benzo[a]pyrene exposure

USDA-ARS?s Scientific Manuscript database

Benzo[a]pyrene (BaP) is an established reproductive and developmental toxicant. BaP exposure in humans and animals has been linked to infertility and multigenerational health consequences. DNA methylation is the most studied epigenetic mechanism that regulates gene expression, and mapping of methyla...

Transcriptomic Analysis of Flower Blooming in Jasminum sambac through De Novo RNA Sequencing.

PubMed

Li, Yong-Hua; Zhang, Wei; Li, Yong

2015-06-10

Flower blooming is a critical and complicated plant developmental process in flowering plants. However, insufficient information is available about the complex network that regulates flower blooming in Jasminum sambac. In this study, we used the RNA-Seq platform to analyze the molecular regulation of flower blooming in J. sambac by comparing the transcript profiles at two flower developmental stages: budding and blooming. A total of 4577 differentially-expressed genes (DEGs) were identified between the two floral stages. The Gene Ontology and the Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses revealed that the DEGs in the "oxidation-reduction process", "extracellular region", "steroid biosynthesis", "glycosphingolipid biosynthesis", "plant hormone signal transduction" and "pentose and glucuronate interconversions" might be associated with flower development. A total of 103 and 92 unigenes exhibited sequence similarities to the known flower development and floral scent genes from other plants. Among these unigenes, five flower development and 19 floral scent unigenes exhibited at least four-fold differences in expression between the two stages. Our results provide abundant genetic resources for studying the flower blooming mechanisms and molecular breeding of J. sambac.

STATs in Lung Development: Distinct Early and Late Expression, Growth Modulation and Signaling Dysregulation in Congenital Diaphragmatic Hernia.

PubMed

Piairo, Paulina; Moura, Rute S; Baptista, Maria João; Correia-Pinto, Jorge; Nogueira-Silva, Cristina

2018-01-01

Congenital diaphragmatic hernia (CDH) is a life-threatening developmental anomaly, intrinsically combining severe pulmonary hypoplasia and hypertension. During development, signal transducers and activators of transcription (STAT) are utilized to elicit cell growth, differentiation, and survival. We used the nitrofen-induced CDH rat model. At selected gestational time points, lungs were divided into two experimental groups, i.e., control or CDH. We performed immunohistochemistry and western blotting analysis to investigate the developmental expression profile of the complete family of STATs (STAT1-6), plus specific STATs activation (p-STAT3, p-STAT6) and regulation by SOCS (SOCS3) in normal lungs against those of diseased lungs. The normal fetal lung explants were treated with piceatannol (STAT3 inhibitor) in vitro followed by morphometrical analysis. Molecular profiling of STATs during the lung development revealed distinct early and late expression signatures. Experimental CDH altered the STATs expression, activation, and regulation in the fetal lungs. In particular, STAT3 and STAT6 were persistently over-expressed and early over-activated. Piceatannol treatment dose-dependently stimulated the fetal lung growth. These findings suggest that STATs play an important role during normal fetal lung development and CDH pathogenesis. Moreover, functionally targeting STAT signaling modulates fetal lung growth, which highlights that STAT3 and STAT6 signaling might be promising therapeutic targets in reducing or preventing pulmonary hypoplasia in CDH. © 2018 The Author(s). Published by S. Karger AG, Basel.

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function

PubMed Central

Bagley, Joshua A.; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill

2014-01-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the “histone code,” in regulating dendrite morphology. PMID:25184680

MicroRNA Profiling as Tool for In Vitro Developmental Neurotoxicity Testing: The Case of Sodium Valproate

PubMed Central

Smirnova, Lena; Block, Katharina; Sittka, Alexandra; Oelgeschläger, Michael; Seiler, Andrea E. M.; Luch, Andreas

2014-01-01

Studying chemical disturbances during neural differentiation of murine embryonic stem cells (mESCs) has been established as an alternative in vitro testing approach for the identification of developmental neurotoxicants. miRNAs represent a class of small non-coding RNA molecules involved in the regulation of neural development and ESC differentiation and specification. Thus, neural differentiation of mESCs in vitro allows investigating the role of miRNAs in chemical-mediated developmental toxicity. We analyzed changes in miRNome and transcriptome during neural differentiation of mESCs exposed to the developmental neurotoxicant sodium valproate (VPA). A total of 110 miRNAs and 377 mRNAs were identified differently expressed in neurally differentiating mESCs upon VPA treatment. Based on miRNA profiling we observed that VPA shifts the lineage specification from neural to myogenic differentiation (upregulation of muscle-abundant miRNAs, mir-206, mir-133a and mir-10a, and downregulation of neural-specific mir-124a, mir-128 and mir-137). These findings were confirmed on the mRNA level and via immunochemistry. Particularly, the expression of myogenic regulatory factors (MRFs) as well as muscle-specific genes (Actc1, calponin, myosin light chain, asporin, decorin) were found elevated, while genes involved in neurogenesis (e.g. Otx1, 2, and Zic3, 4, 5) were repressed. These results were specific for valproate treatment and―based on the following two observations―most likely due to the inhibition of histone deacetylase (HDAC) activity: (i) we did not observe any induction of muscle-specific miRNAs in neurally differentiating mESCs exposed to the unrelated developmental neurotoxicant sodium arsenite; and (ii) the expression of muscle-abundant mir-206 and mir-10a was similarly increased in cells exposed to the structurally different HDAC inhibitor trichostatin A (TSA). Based on our results we conclude that miRNA expression profiling is a suitable molecular endpoint for developmental neurotoxicity. The observed lineage shift into myogenesis, where miRNAs may play an important role, could be one of the developmental neurotoxic mechanisms of VPA. PMID:24896083

MicroRNA-132 dysregulation in schizophrenia has implications for both neurodevelopment and adult brain function

PubMed Central

Miller, Brooke H.; Zeier, Zane; Xi, Li; Lanz, Thomas A.; Deng, Shibing; Strathmann, Julia; Willoughby, David; Kenny, Paul J.; Elsworth, John D.; Lawrence, Matthew S.; Roth, Robert H.; Edbauer, Dieter; Kleiman, Robin J.; Wahlestedt, Claes

2012-01-01

Schizophrenia is characterized by affective, cognitive, neuromorphological, and molecular abnormalities that may have a neurodevelopmental origin. MicroRNAs (miRNAs) are small noncoding RNA sequences critical to neurodevelopment and adult neuronal processes by coordinating the activity of multiple genes within biological networks. We examined the expression of 854 miRNAs in prefrontal cortical tissue from 100 control, schizophrenic, and bipolar subjects. The cyclic AMP-responsive element binding- and NMDA-regulated microRNA miR-132 was significantly down-regulated in both the schizophrenic discovery cohort and a second, independent set of schizophrenic subjects. Analysis of miR-132 target gene expression in schizophrenia gene-expression microarrays identified 26 genes up-regulated in schizophrenia subjects. Consistent with NMDA-mediated hypofunction observed in schizophrenic subjects, administration of an NMDA antagonist to adult mice results in miR-132 down-regulation in the prefrontal cortex. Furthermore, miR-132 expression in the murine prefrontal cortex exhibits significant developmental regulation and overlaps with critical neurodevelopmental processes during adolescence. Adult prefrontal expression of miR-132 can be down-regulated by pharmacologic inhibition of NMDA receptor signaling during a brief postnatal period. Several key genes, including DNMT3A, GATA2, and DPYSL3, are regulated by miR-132 and exhibited altered expression either during normal neurodevelopment or in tissue from adult schizophrenic subjects. Our data suggest miR-132 dysregulation and subsequent abnormal expression of miR-132 target genes contribute to the neurodevelopmental and neuromorphological pathologies present in schizophrenia. PMID:22315408

Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

PubMed Central

2011-01-01

Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes involved in extracellular matrix regulation, cell death/apoptosis, and calcium signaling/muscle function, as well as genes with miscellaneous function was confirmed by qPCR. Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of their protein products. PMID:21385442

Transcriptional signatures of ancient floral developmental genetics in avocado (Persea americana; Lauraceae).

PubMed

Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S

2009-06-02

The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.

Impaired imprinted X chromosome inactivation is responsible for the skewed sex ratio following in vitro fertilization

PubMed Central

Tan, Kun; An, Lei; Miao, Kai; Ren, Likun; Hou, Zhuocheng; Tao, Li; Zhang, Zhenni; Wang, Xiaodong; Xia, Wei; Liu, Jinghao; Wang, Zhuqing; Xi, Guangyin; Gao, Shuai; Sui, Linlin; Zhu, De-Sheng; Wang, Shumin; Wu, Zhonghong; Bach, Ingolf; Chen, Dong-bao; Tian, Jianhui

2016-01-01

Dynamic epigenetic reprogramming occurs during normal embryonic development at the preimplantation stage. Erroneous epigenetic modifications due to environmental perturbations such as manipulation and culture of embryos during in vitro fertilization (IVF) are linked to various short- or long-term consequences. Among these, the skewed sex ratio, an indicator of reproductive hazards, was reported in bovine and porcine embryos and even human IVF newborns. However, since the first case of sex skewing reported in 1991, the underlying mechanisms remain unclear. We reported herein that sex ratio is skewed in mouse IVF offspring, and this was a result of female-biased peri-implantation developmental defects that were originated from impaired imprinted X chromosome inactivation (iXCI) through reduced ring finger protein 12 (Rnf12)/X-inactive specific transcript (Xist) expression. Compensation of impaired iXCI by overexpression of Rnf12 to up-regulate Xist significantly rescued female-biased developmental defects and corrected sex ratio in IVF offspring. Moreover, supplementation of an epigenetic modulator retinoic acid in embryo culture medium up-regulated Rnf12/Xist expression, improved iXCI, and successfully redeemed the skewed sex ratio to nearly 50% in mouse IVF offspring. Thus, our data show that iXCI is one of the major epigenetic barriers for the developmental competence of female embryos during preimplantation stage, and targeting erroneous epigenetic modifications may provide a potential approach for preventing IVF-associated complications. PMID:26951653

MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

PubMed Central

Alsaweed, Mohammed; Hartmann, Peter E.; Geddes, Donna T.; Kakulas, Foteini

2015-01-01

Human milk (HM) is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance. PMID:26529003

Expression of the Hsp23 chaperone during Drosophila embryogenesis: association to distinct neural and glial lineages

PubMed Central

Michaud, Sébastien; Tanguay, Robert M

2003-01-01

Background In addition to their strong induction following stress, small heat shock proteins (Hsp) are also expressed during development in a wide variety of organisms. However, the precise identity of cell(s) expressing these proteins and the functional contribution of small heat shock proteins in such developmental context remain to be determined. The present study provides a detailed description of the Drosophila small heat shock protein Hsp23 expression pattern during embryogenesis and evaluates its functional contribution to central nervous system development. Results Throughout embryogenesis, Hsp23 is expressed in a stage-specific manner by a restricted number of neuronal and glial lineages of the central nervous system. Hsp23 is also detected in the amnioserosa and within a single lateral chordotonal organ. Its expression within the MP2 lineage does not require the presence of a functional midline nor the activity of the Notch signaling pathway. Transactivation assays demonstrate that transcription factors implicated in the differentiation of the midline also regulate hsp23 promoter activity. Phenotypic analysis of a transgenic line exhibiting loss of Hsp23 expression in the central nervous system suggests that Hsp23 is not required for development and function of this tissue. Likewise, its overexpression does not cause deleterious effects, as development remains unaffected. Conclusions Based on the presented data, we suggest that the tightly regulated developmental expression of Hsp23 is not actively involved in cell differentiation and central nervous system development per se but rather reflects a putative role in preventive "pre-stress" neuroprotection or in non-vital process(es) common to the identified cell lineages. PMID:14617383

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Epidermal growth factor receptor expression is related to post-mitotic events in cerebellar development: regulation by thyroid hormone.

PubMed

Carrasco, Emilce; Blum, Mariann; Weickert, Cynthia Shannon; Casper, Diana

2003-01-10

It has been established that thyroid hormone and neurotrophic factors both orchestrate developmental events in the brain. However, it is not clear how these two influences are related. In this study, we investigated the effects of thyroid hormone on cerebellar development and the coincident expression of transforming growth factor-alpha (TGF-alpha), a ligand in the epidermal growth factor (EGF) family, and the epidermal growth factor receptor (EGFR). Profiles of thyroid hormone expression were measured in postnatal animals and were found to peak at postnatal day 15 (P15). These levels dropped below detectable levels when mice were made hypothyroid with propylthiouracil (PTU). TGF-alpha and EGFR expression, as determined by RNAse protection assay, was maximal at P6 in normal animals, but remained low in hypothyroid animals, suggesting that thyroid hormone was responsible for their induction. In situ hybridization and immunohistochemical analysis of EGFR expression revealed that this receptor was present on granule cells within the inner zone of the external granule cell layer (EGL), suggesting that EGFR-ligands were not inducing granule cell proliferation. The persistence of EGFR expression on migrating granule cells and subsequent down-regulation of expression in the internal granule cell layer (IGL) implicates a role for EGFR-ligands in differentiation and/or migration. In hypothyroid animals, we observed a delayed progression of granule cell migration, consistent with the persistence of EGFR labeling in the EGL, and in the 'pile-up' of labeled cells at the interface between the molecular layer and the Purkinje cell layer. Taken together, these results implicate thyroid hormone in the coordinated expression of TGF-alpha and EGFR, which are positioned to play a role in post-mitotic developmental events in the cerebellum.

[Expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain].

PubMed

Zhang, Wei; Fan, Li-mei; Li, Lin-lin; Peng, Zheng-yu

2014-01-01

To investigate the expression of neural salient serine/arginine-rich protein 1 (NSSR1) in the development of mouse brain. Brain samples were collected from mice with different developmental stages: 9, 12, 14 d before birth (E9, E12, E14) and 1 d, 3 weeks and 3 months after birth. The expression of NSSR1 in mouse brain at different developmental stages was detected by Western blot and the distribution of NSSR1 was analyzed by immunohistochemical staining. The expression and distribution of NSSR1 in mouse brain were compared among embryos, neonatal and adult animals. During embryogenesis, the expression of NSSR1 proteins increases significantly from 0.186(E9) to 0.445(E14) and reached a high level after birth. Immunohistochemical analysis showed that in E12 embryos, NSSR1 was specifically distributed in the marginal and mantle layers. The expression of NSSR1 in hippocampus was very low in neonatal animals but stronger in adults. In cerebellar cortex, NSSR1 was widely expressed in purkinje and granule cells of adult animals, but mainly expressed in Purkinje cells in neonates. The expression of NSSR1 is regulated by the development of mouse brain and presents dynamic changes.

FGF-2 deficiency does not influence FGF ligand and receptor expression during development of the nigrostriatal system.

PubMed

Ratzka, Andreas; Baron, Olga; Grothe, Claudia

2011-01-01

Secreted proteins of the fibroblast growth factor (FGF) family play important roles during development of various organ systems. A detailed knowledge of their temporal and spatial expression profiles, especially of closely related FGF family members, are essential to further identification of specific functions in distinct tissues. In the central nervous system dopaminergic neurons of the substantia nigra and their axonal projections into the striatum progressively degenerate in Parkinson's disease. In contrast, FGF-2 deficient mice display increased numbers of dopaminergic neurons. In this study, we determined the expression profiles of all 22 FGF-ligands and 10 FGF-receptor isoforms, in order to clarify, if FGF-2 deficiency leads to compensatory up-regulation of other FGFs in the nigrostriatal system. Three tissues, ventral mesencephalon (VM), striatum (STR) and as reference tissue spinal cord (SC) of wild-type and FGF-2 deficient mice at four developmental stages E14.5, P0, P28, and adult were comparatively analyzed by quantitative RT-PCR. As no differences between the genotypes were observed, a compensatory up-regulation can be excluded. Moreover, this analysis revealed that the majority of FGF-ligands (18/22) and FGF-receptors (9/10) are expressed during normal development of the nigrostriatal system and identified dynamic changes for some family members. By comparing relative expression level changes to SC reference tissue, general alterations in all 3 tissues, such as increased expression of FGF-1, -2, -22, FgfR-2c, -3c and decreased expression of FGF-13 during postnatal development were identified. Further, specific changes affecting only one tissue, such as increased FGF-16 (STR) or decreased FGF-17 (VM) expression, or two tissues, such as decreased expression of FGF-8 (VM, STR) and FGF-15 (SC, VM) were found. Moreover, 3 developmentally down-regulated FGFs (FGF-8b, FGF-15, FGF-17a) were functionally characterized by plasmid-based over-expression in dissociated E11.5 VM cell cultures, however, such a continuous exposure had no influence on the yield of dopaminergic neurons in vitro.

ING2 (inhibitor of growth protein-2) plays a crucial role in preimplantation development.

PubMed

Zhou, Lin; Wang, Pei; Zhang, Juanjuan; Heng, Boon Chin; Tong, Guo Qing

2016-02-01

ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex, ING2 binds to H3K4me3 to regulate chromatin modification and gene expression. Additionally, ING2 recruits histone methyltransferase (HMT) activity for gene repression, which is independent of the HDAC class I or II pathway. However, the physiological function of ING2 in mouse preimplantation embryo development has not yet been characterized previously. The expression, localization and function of ING2 during preimplantation development were investigated in this study. We showed increasing expression of ING2 within the nucleus from the 4-cell embryo stage onwards; and that down-regulation of ING2 expression by endoribonuclease-prepared small interfering RNA (esiRNA) microinjection results in developmental arrest during the morula to blastocyst transition. Embryonic cells microinjected with ING2-specific esiRNA exhibited decreased blastulation rate compared to the negative control. Further investigation of the underlying mechanism indicated that down-regulation of ING2 significantly increased expression of p21, whilst decreasing expression of HDAC1. These results suggest that ING2 may play a crucial role in the process of preimplantation embryo development through chromatin regulation.

The Arabidopsis tandem CCCH zinc finger proteins AtTZF4, 5 and 6 are involved in light-, abscisic acid- and gibberellic acid-mediated regulation of seed germination.

PubMed

Bogamuwa, Srimathi; Jang, Jyan-Chyun

2013-08-01

Tandem CCCH zinc finger proteins (TZFs) are post-transcriptional regulators of gene expression in animals and yeast. Genetic studies indicate that plant TZFs are involved in hormone-mediated developmental and environmental responses. We have demonstrated previously that Arabidopsis AtTZF1 can localize to processing bodies (PBs) and stress granules (SGs), and affects abscisic acid (ABA)- and gibberellic acid (GA)-mediated growth, stress and gene expression responses. Here we show that AtTZF4, 5 and 6 are specifically expressed in seeds. Consistent with the observation that their expression levels decline during seed imbibition, AtTZF4, 5 and 6 are up-regulated by ABA and down-regulated by GA. Mutant analyses indicate that AtTZF4, 5 and 6 act as positive regulators for ABA- and negative regulators for light- and GA-mediated seed germination responses. Results of gene expression analysis indicate that AtTZF4, 5 and 6 affect seed germination by controlling genes critical for ABA and GA response. Furthermore, AtTZF4, 5 and 6 can co-localize with both PB and SG markers in Arabidopsis cells. Specifically, AtTZF6 can be assembled into PBs and SGs in embryos with the induction of stress hormone methyl jasmonate under the control of native AtTZF6 promoter. © 2013 John Wiley & Sons Ltd.

Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain

PubMed Central

Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

2016-01-01

Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies. PMID:27853240

Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain.

PubMed

Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

2016-11-17

Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies.

Monocyte recruitment and expression of monocyte chemoattractant protein-1 are developmentally regulated in remodeling bone in the mouse.

PubMed Central

Volejnikova, S.; Laskari, M.; Marks, S. C.; Graves, D. T.

1997-01-01

Tooth eruption is defined as the movement of a tooth from its site of development within the alveolar bone to its position of function in the oral cavity. It represents an excellent model to examine osseous metabolism as bone resorption and bone formation occur simultaneously and are spatially separated. Bone resorption occurs in the coronal (occlusal) area, whereas bone formation occurs in the basal area. Monocytes are thought to have a significant role in the regulation of osseous metabolism. The goal of this study was to examine the recruitment of monocytes to bone in C57BL/6J mice that are undergoing developmentally regulated bone remodeling. Monocytes were detected by immunohistochemistry and osteoclasts were counted as bone-associated multi-nucleated, tartrate-resistant acid phosphatase (TRAP)-positive cells. Cell numbers were obtained from histological sections of animals sacrificed daily for 14 days after birth; an image analysis system was used for quantification. The results demonstrated that, immediately after birth, there were relatively few monocytic cells. In the area of bone resorption, the number of monocytes increased with time, reaching peaks at 5 and 9 days, and decreased thereafter. A similar pattern was observed for osteoclasts. In the area of bone formation, there was a time-dependent increase in the number of monocytes. In contrast, the number of osteoclasts in this area was highest at the earliest time points and decreased after day 3. To investigate potential mechanisms for the recruitment of monocytes, expression of monocyte chemoattractant protein (MCP)-1 was assessed. The number of MCP-1-positive cells increased with time and was generally proportional to the recruitment of mononuclear phagocytes. Osteoblasts were the principal bone cell type expressing MCP-1. The results demonstrate that the recruitment of mononuclear cells in the occlusal area is associated with bone resorption. In contrast, recruitment of monocytes in the basal area is associated with bone formation and a decrease in the number of osteoclasts. These results suggest that monocytes have different functional roles in areas of bone formation compared with bone resorption. Furthermore, the expression of MCP-1 is developmentally regulated and may provide a mechanistic basis to explain the recruitment of monocytic cells. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9137095

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Effects of the biosynthesis and signaling pathway of ecdysterone on silkworm (Bombyx mori) following exposure to titanium dioxide nanoparticles.

PubMed

Li, Fanchi; Gu, Zhiya; Wang, Binbin; Xie, Yi; Ma, Lie; Xu, Kaizun; Ni, Min; Zhang, Hua; Shen, Weide; Li, Bing

2014-08-01

Silkworm (Bombyx mori), a model Lepidoptera insect, is economically important. Its growth and development are regulated by endogenous hormones. During the process of transition from larvae to pupae, 20-hydroxyecdysone (20E) plays an important role. The recent surge in consumer products and applications using metallic nanoparticles has increased the possibility of human or ecosystem exposure due to their unintentional release into the environment. We investigated the effects of exposure to titanium dioxide nanoparticles (TiO2 NPs) on the action of 20E in B. mori. Titanium dioxide nanoparticle treatment shortened the molting duration by 8 hr and prolonged the molting peak period by 10 %. Solexa sequencing profiled the changes in gene expression in the brain of fifth-instar B. mori in response to TiO2NPS exposure for 72 hr, to address the effects on hormone metabolism and regulation. Thirty one genes were differentially expressed. The transcriptional levels of pi3k and P70S6K, which are involved in the target of the rapamycin (TOR) signaling pathway, were up-regulated. Transcriptional levels of four cytochrome P450 genes, which are involved in 20E biosynthesis, at different developmental stages (48, 96, 144, and 192 hr) at 5th instars of all displayed trends of increasing expression. Simultaneously, the ecdysterone receptors, also displayed increasing trends. The 20E titers at four developmental stages during the 5th instar were 1.26, 1.23, 1.72, and 2.16 fold higher, respectively, than the control group. These results indicate that feeding B. mori with TiO2 NPs stimulates 20E biosynthesis, shortens the developmental progression, and reduces the duration of molting. Thus, application of TiO2 NPs is of high significance for saving the labor force in sericulture, and our research provides a reference for the ecological problems in the field of Lepidoptera exposured to titanium dioxide nanoparticles.

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes

PubMed Central

2010-01-01

Background Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Results Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. Conclusions This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research. PMID:20416061

Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes.

PubMed

Tarver, Matthew R; Zhou, Xuguo; Scharf, Michael E

2010-04-23

Strict regulation of caste differentiation, at the molecular level, is thought to be important to maintain social structure in insect societies. Previously, a number of extrinsic and intrinsic factors have been shown to influence caste composition in termite colonies. One important factor is the influence of nestmates; in particular, soldier termites are known to inhibit hormone-dependent worker-to-soldier differentiation. However, soldier influences on nestmates at the molecular level are virtually unknown. Here, to test the hypothesis that soldiers can influence nestmate gene expression, we investigated the impact of four treatments on whole-body gene expression in totipotent Reticulitermes flavipes workers: (i) juvenile hormone III (JHIII; a morphogenetic hormone), (ii) soldier head extracts (SHE), (iii) JHIII+SHE, and (iv) live soldiers. Using quantitative-real-time PCR we determined the expression patterns of 49 previously identified candidate genes in response to the four treatments at assay days 1, 5, and 10. Thirty-eight total genes from three categories (chemical production/degradation, hemolymph protein, and developmental) showed significant differential expression among treatments. Most importantly, SHE and live soldier treatments had a significant impact on a number of genes from families known to play roles in insect development, supporting previous findings and hypotheses that soldiers regulate nestmate caste differentiation via terpene primer pheromones contained in their heads. This research provides new insights into the impacts that socio-environmental factors (JH, soldiers, primer pheromones) can have on termite gene expression and caste differentiation, and reveals a number of socially-relevant genes for investigation in subsequent caste differentiation research.

Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

PubMed

Abete-Luzi, Patricia; Eisenmann, David M

2018-05-01

The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

DkPK Genes Promote Natural Deastringency in C-PCNA Persimmon by Up-regulating DkPDC and DkADH Expression

PubMed Central

Guan, Changfei; Du, Xiaoyun; Zhang, Qinglin; Ma, Fengwang; Luo, Zhengrong; Yang, Yong

2017-01-01

The astringency of Chinese pollination-constant non-astringent (C-PCNA) persimmon (Diospyros kaki Thunb.) can be naturally removed on the tree. This process is controlled by a single locus and is dominant against other types of persimmons; therefore, this variant is an important candidate for commercial cultivation and the breeding of PCNA cultivars. In our previous study, six full-length coding sequences (CDS) for pyruvate kinase genes (DkPK1-6) were isolated, and DkPK1 is thought to be involved in the natural deastringency of C-PCNA persimmon fruit. Here, we characterize the eight other DkPK genes (DkPK7-14) from C-PCNA persimmon fruit based on transcriptome data. The transcript changes in DkPK7-14 genes and correlations with the proanthocyanidin (PA) content were investigated during different fruit development stages in C-PCNA, J-PCNA, and non-PCNA persimmon; DkPK7 and DkPK8 exhibited up-regulation patterns during the last developmental stage in C-PCNA persimmon that was negatively correlated with the decrease in soluble PAs. Phylogenetic analysis and subcellular localization analysis revealed that DkPK7 and DkPK8 are cytosolic proteins. Notably, DkPK7 and DkPK8 were ubiquitously expressed in various persimmon organs and abundantly up-regulated in seeds. Furthermore, transient over-expression of DkPK7 and DkPK8 in persimmon leaves led to a significant decrease in the content of soluble PAs but a significant increase in the expression levels of the pyruvate decarboxylase (DkPDC) and alcohol dehydrogenase genes (DkADH), which are closely related to acetaldehyde metabolism. The accumulated acetaldehyde that results from the up-regulation of the DkPDC and DkADH genes can combine with soluble PAs to form insoluble PAs, resulting in the removal of astringency from persimmon fruit. Thus, we suggest that both DkPK7 and DkPK8 are likely to be involved in natural deastringency via the up-regulation of DkPDC and DkADH expression during the last developmental stage in C-PCNA persimmon. PMID:28243247

The expression of the cerato-platanin gene is related to hyphal growth and chlamydospores formation in Ceratocystis platani.

PubMed

Baccelli, Ivan; Comparini, Cecilia; Bettini, Priscilla P; Martellini, Federica; Ruocco, Michelina; Pazzagli, Luigia; Bernardi, Rodolfo; Scala, Aniello

2012-02-01

Cerato-platanin (CP) is a protein produced by Ceratocystis platani, the causal agent of canker stain disease of plane trees. CP is the first member of the 'cerato-platanin family', and its role as a pathogen-associated molecular pattern (PAMP), inducing defence responses both in host and nonhost plants, is established. However, the primary role of CP and its homologues in the fungal life remains unknown. In the present work, we investigated the regulation of the cp gene during the in vitro growth of C. platani in different conditions and under the effect of potential stress factors. Fungal growth and conidiogenesis were also analysed. Results showed that cp is a single-copy gene whose expression level is strictly associated with hyphal growth and with chlamydospores formation. The analysis of a 1368 bp 5'-flanking region revealed putative motifs that could be involved in the regulation of gene expression in response to stress and developmental cues. Taking into account the localization of CP in the fungal cell wall and the recently published 3D structure of the protein, our results support a role for CP in growth and developmental processes of C. platani. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

PubMed Central

Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

2014-01-01

Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.

PubMed

Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B

2014-03-01

Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

PubMed

Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

2012-06-01

In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

Deconstructing transcriptional heterogeneity in pluripotent stem cells

PubMed Central

Shalek, Alex K.; Satija, Rahul; DaleyKeyser, AJay; Li, Hu; Zhang, Jin; Pardee, Keith; Gennert, David; Trombetta, John J.; Ferrante, Thomas C.; Regev, Aviv; Daley, George Q.; Collins, James J.

2014-01-01

SUMMARY Pluripotent stem cells (PSCs) are capable of dynamic interconversion between distinct substates, but the regulatory circuits specifying these states and enabling transitions between them are not well understood. We set out to characterize transcriptional heterogeneity in PSCs by single-cell expression profiling under different chemical and genetic perturbations. Signaling factors and developmental regulators show highly variable expression, with expression states for some variable genes heritable through multiple cell divisions. Expression variability and population heterogeneity can be influenced by perturbation of signaling pathways and chromatin regulators. Strikingly, either removal of mature miRNAs or pharmacologic blockage of signaling pathways drives PSCs into a low-noise ground state characterized by a reconfigured pluripotency network, enhanced self-renewal, and a distinct chromatin state, an effect mediated by opposing miRNA families acting on the c-myc / Lin28 / let-7 axis. These data illuminate the nature of transcriptional heterogeneity in PSCs. PMID:25471879

Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities

PubMed Central

Wilber, Andrew; Nienhuis, Arthur W.

2011-01-01

In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359

Netrin-4 regulates thalamocortical axon branching in an activity-dependent fashion.

PubMed

Hayano, Yasufumi; Sasaki, Kensuke; Ohmura, Nami; Takemoto, Makoto; Maeda, Yurie; Yamashita, Toshihide; Hata, Yoshio; Kitada, Kazuhiro; Yamamoto, Nobuhiko

2014-10-21

Axon branching is remodeled by sensory-evoked and spontaneous neuronal activity. However, the underlying molecular mechanism is largely unknown. Here, we demonstrate that the netrin family member netrin-4 (NTN4) contributes to activity-dependent thalamocortical (TC) axon branching. In the postnatal developmental stages of rodents, ntn4 expression was abundant in and around the TC recipient layers of sensory cortices. Neuronal activity dramatically altered the ntn4 expression level in the cortex in vitro and in vivo. TC axon branching was promoted by exogenous NTN4 and suppressed by depletion of the endogenous protein. Moreover, unc-5 homolog B (Unc5B), which strongly bound to NTN4, was expressed in the sensory thalamus, and knockdown of Unc5B in thalamic cells markedly reduced TC axon branching. These results suggest that NTN4 acts as a positive regulator for TC axon branching through activity-dependent expression.

Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

PubMed

Friedmann, Y; Daniel, C W

1996-07-10

The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

Cytochrome c Gene and Protein Expression: Developmental Regulation, Environmental Response, and Pesticide Sensitivity in Aedes aegypti

DTIC Science & Technology

2008-05-01

biological systems. In the mosquito Aedes ae- gypti (L.), a primary vector of dengue and yellow fever viruses, the role of cytochrome c during devel...development of mosquitoes re- quiresmultigene regulation(Seversonet al. 2004,Fon- tenille et al. 2005,Raibaudet al. 2006, Strodeet al. 2006, van den...1.5% RH in an environ- mental chamber (L-C Incubator, Lab-Line Instru- ments, Inc., Melrose Park, IL) for the time course study. Sixty individuals (30

Developmental and Environmental Regulation of Aquaporin Gene Expression across Populus Species: Divergence or Redundancy?

PubMed Central

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected. PMID:23393587

Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

PubMed

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected.

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

PubMed

Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

2017-07-01

The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

Transcription regulation by the Mediator complex.

PubMed

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

Developmental Programming Mediated by Complementary Roles of Imprinted Grb10 in Mother and Pup

PubMed Central

Cowley, Michael; Garfield, Alastair S.; Madon-Simon, Marta; Charalambous, Marika; Clarkson, Richard W.; Smalley, Matthew J.; Kendrick, Howard; Isles, Anthony R.; Parry, Aled J.; Carney, Sara; Oakey, Rebecca J.; Heisler, Lora K.; Moorwood, Kim; Wolf, Jason B.; Ward, Andrew

2014-01-01

Developmental programming links growth in early life with health status in adulthood. Although environmental factors such as maternal diet can influence the growth and adult health status of offspring, the genetic influences on this process are poorly understood. Using the mouse as a model, we identify the imprinted gene Grb10 as a mediator of nutrient supply and demand in the postnatal period. The combined actions of Grb10 expressed in the mother, controlling supply, and Grb10 expressed in the offspring, controlling demand, jointly regulate offspring growth. Furthermore, Grb10 determines the proportions of lean and fat tissue during development, thereby influencing energy homeostasis in the adult. Most strikingly, we show that the development of normal lean/fat proportions depends on the combined effects of Grb10 expressed in the mother, which has the greater effect on offspring adiposity, and Grb10 expressed in the offspring, which influences lean mass. These distinct functions of Grb10 in mother and pup act complementarily, which is consistent with a coadaptation model of imprinting evolution, a model predicted but for which there is limited experimental evidence. In addition, our findings identify Grb10 as a key genetic component of developmental programming, and highlight the need for a better understanding of mother-offspring interactions at the genetic level in predicting adult disease risk. PMID:24586114

The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

PubMed

Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

2013-04-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

PubMed Central

Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

2013-01-01

Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

Developmental Regulation of Mitochondrial Apoptosis by c-Myc Governs Age- and Tissue-Specific Sensitivity to Cancer Therapeutics.

PubMed

Sarosiek, Kristopher A; Fraser, Cameron; Muthalagu, Nathiya; Bhola, Patrick D; Chang, Weiting; McBrayer, Samuel K; Cantlon, Adam; Fisch, Sudeshna; Golomb-Mello, Gail; Ryan, Jeremy A; Deng, Jing; Jian, Brian; Corbett, Chris; Goldenberg, Marti; Madsen, Joseph R; Liao, Ronglih; Walsh, Dominic; Sedivy, John; Murphy, Daniel J; Carrasco, Daniel Ruben; Robinson, Shenandoah; Moslehi, Javid; Letai, Anthony

2017-01-09

It is not understood why healthy tissues can exhibit varying levels of sensitivity to the same toxic stimuli. Using BH3 profiling, we find that mitochondria of many adult somatic tissues, including brain, heart, and kidneys, are profoundly refractory to pro-apoptotic signaling, leading to cellular resistance to cytotoxic chemotherapies and ionizing radiation. In contrast, mitochondria from these tissues in young mice and humans are primed for apoptosis, predisposing them to undergo cell death in response to genotoxic damage. While expression of the apoptotic protein machinery is nearly absent by adulthood, in young tissues its expression is driven by c-Myc, linking developmental growth to cell death. These differences may explain why pediatric cancer patients have a higher risk of developing treatment-associated toxicities. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental Activation of the Proteolipid Protein Promoter Transgene in Neuronal and Oligodendroglial Cells of Neostriatum in Mice

PubMed Central

Fulton, Daniel; Paez, Pablo; Spreur, Vilma; Handley, Vance; Colwell, Christopher S.; Campagnoni, Anthony; Fisher, Robin

2011-01-01

Prior studies suggest that non-canonical proteolipid protein (PLP) gene expression occurs during development in non-myelinating neurons as well as myelinating oligodendroglia in mammalian brain. To assess this possibility in neostriatum, a region of uncertain PLP gene expression in neurons, morphological and electrophysiological tools were used to determine phenotypes of cells with activation of a PLP promoter transgene during the early postnatal period in mice. PLP gene expression is evident in both neuronal and oligodendroglial phenotypes in developing neostriatum, a conclusion based on three novel observations: (1) An enhanced green fluorescent protein (EGFP) reporter of PLP promoter activation was localized in two distinct populations of cells, which exhibit collective, developmental differences of morphological and electrophysiological characteristics in accord with neuronal and oligodendroglial phenotypes of neostriatal cells found during the early postnatal period in both transgenic and wild-type mice. (2) The EGFP reporter of PLP promoter activation was appropriately positioned to serve as a regulator of PLP gene expression. It colocalized with native PLP proteins in both neuronal and oligodendroglial phenotypes; however, only soma-restricted PLP protein isoforms were found in the neuronal phenotype, while classic and soma-restricted PLP protein isoforms were found in the oligodendroglial phenotype. (3) As shown by EGFP reporter, PLP promoter activation was placed to regulate PLP gene expression in only one neuronal phenotype among the several that constitute neostriatum. It was localized in medium spiny neurons, but not large aspiny neurons. These outcomes have significant implications for the non-canonical functional roles of PLP gene expression in addition to myelinogenesis in mammalian brain, and are consistent with potentially independent pathologic loci in neurons during the course of human mutational disorders of PLP gene expression. PMID:21912090

Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

PubMed

Lee, Sang Yoon; Nam, Yoon Kwon

2016-11-01

A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

Methylation and microRNA-mediated epigenetic regulation of SOCS3

PubMed Central

Boosani, Chandra S.; Agrawal, Devendra K.

2017-01-01

Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

Genetic variation and gene expression across multiple tissues and developmental stages in a nonhuman primate.

PubMed

Jasinska, Anna J; Zelaya, Ivette; Service, Susan K; Peterson, Christine B; Cantor, Rita M; Choi, Oi-Wa; DeYoung, Joseph; Eskin, Eleazar; Fairbanks, Lynn A; Fears, Scott; Furterer, Allison E; Huang, Yu S; Ramensky, Vasily; Schmitt, Christopher A; Svardal, Hannes; Jorgensen, Matthew J; Kaplan, Jay R; Villar, Diego; Aken, Bronwen L; Flicek, Paul; Nag, Rishi; Wong, Emily S; Blangero, John; Dyer, Thomas D; Bogomolov, Marina; Benjamini, Yoav; Weinstock, George M; Dewar, Ken; Sabatti, Chiara; Wilson, Richard K; Jentsch, J David; Warren, Wesley; Coppola, Giovanni; Woods, Roger P; Freimer, Nelson B

2017-12-01

By analyzing multitissue gene expression and genome-wide genetic variation data in samples from a vervet monkey pedigree, we generated a transcriptome resource and produced the first catalog of expression quantitative trait loci (eQTLs) in a nonhuman primate model. This catalog contains more genome-wide significant eQTLs per sample than comparable human resources and identifies sex- and age-related expression patterns. Findings include a master regulatory locus that likely has a role in immune function and a locus regulating hippocampal long noncoding RNAs (lncRNAs), whose expression correlates with hippocampal volume. This resource will facilitate genetic investigation of quantitative traits, including brain and behavioral phenotypes relevant to neuropsychiatric disorders.

Genome-wide identification of jasmonate biosynthetic genes and their characterization of their expression profiles during apple (Malus x domestica) fruit maturation

USDA-ARS?s Scientific Manuscript database

The plant hormones regulate many physiological processes including apple fruit ripening by integrating diverse developmental cues and environmental signals. In addition to the well-characterized role of ethylene, jasmonic acid (JA) and its derivatives have also been suggested to play an important ro...

DNA methyltransferase expressions in Japanese rice fish (Oryzias latipes) embryogenesis is developmentally regulated and modulated by ethanol and 5-azacytidine

USDA-ARS?s Scientific Manuscript database

We aimed to investigate the impact of the epigenome in inducting fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish embryogenesis. One of the significant events in epigenome is DNA methylation which is catalyzed by DNA methyl transferase (DNMT) enzymes. We analyzed DNMT enzyme m...

Cajal bodies are developmentally regulated during pollen development abd pollen tube growth in Arabidopsis thaliana

USDA-ARS?s Scientific Manuscript database

Cajal bodies aree structures in the nucleus of cells: they are involved in several aspects of gene expression, such as in processing transcipts. The presence of Cajal bodies can be measured with a flourescent protien of a protien called Colin which is abundant in Cajal bodies. This paper shows that ...

A MICROARRAY ANALYSIS OF GENE EXPRESSION IN THE EMBRYONIC FORELIMB OF THE C57BL/6J MOUSE REVEALS SIGNIFICANT ALTERATIONS METABOLIC AND DEVELOPMENTAL REGULATION FOLLOWING ETHANOL EXPOSURE.

EPA Science Inventory

The observation of transcriptional changes following embryonic ethanol exposure may provide significant insights into the biological response to ethanol exposure. In this study, we used microarray analysis to examine the transcriptional response of the developing limb to a dose ...

Bruton's tyrosine kinase and SLP-65 regulate pre-B cell differentiation and the induction of Ig light chain gene rearrangement.

PubMed

Kersseboom, Rogier; Ta, Van B T; Zijlstra, A J Esther; Middendorp, Sabine; Jumaa, Hassan; van Loo, Pieter Fokko; Hendriks, Rudolf W

2006-04-15

Bruton's tyrosine kinase (Btk) and the adapter protein SLP-65 (Src homology 2 domain-containing leukocyte-specific phosphoprotein of 65 kDa) transmit precursor BCR (pre-BCR) signals that are essential for efficient developmental progression of large cycling into small resting pre-B cells. We show that Btk- and SLP-65-deficient pre-B cells have a specific defect in Ig lambda L chain germline transcription. In Btk/SLP-65 double-deficient pre-B cells, both kappa and lambda germline transcripts are severely reduced. Although these observations point to an important role for Btk and SLP-65 in the initiation of L chain gene rearrangement, the possibility remained that these signaling molecules are only required for termination of pre-B cell proliferation or for pre-B cell survival, whereby differentiation and L chain rearrangement is subsequently initiated in a Btk/SLP-65-independent fashion. Because transgenic expression of the antiapoptotic protein Bcl-2 did not rescue the developmental arrest of Btk/SLP-65 double-deficient pre-B cells, we conclude that defective L chain opening in Btk/SLP-65-deficient small resting pre-B cells is not due to their reduced survival. Next, we analyzed transgenic mice expressing the constitutively active Btk mutant E41K. The expression of E41K-Btk in Ig H chain-negative pro-B cells induced 1) surface marker changes that signify cellular differentiation, including down-regulation of surrogate L chain and up-regulation of CD2, CD25, and MHC class II; and 2) premature rearrangement and expression of kappa and lambda light chains. These findings demonstrate that Btk and SLP-65 transmit signals that induce cellular maturation and Ig L chain rearrangement independently of their role in termination of pre-B cell expansion.

Characterization of the altered gene expression profile in early porcine embryos generated from parthenogenesis and somatic cell chromatin transfer.

PubMed

Zhou, Chi; Dobrinsky, John; Tsoi, Stephen; Foxcroft, George R; Dixon, Walter T; Stothard, Paul; Verstegen, John; Dyck, Michael K

2014-01-01

The in vitro production of early porcine embryos is of particular scientific and economic interest. In general, embryos produced from in vitro Assisted Reproductive Technologies (ART) manipulations, such as somatic cell chromatin transfer (CT) and parthenogenetic activation (PA), are less developmentally competent than in vivo-derived embryos. The mechanisms underlying the deficiencies of embryos generated from PA and CT have not been completely understood. To characterize the altered genes and gene networks in embryos generated from CT and PA, comparative transcriptomic analyses of in vivo (IVV) expanded blastocysts (XB), IVV hatched blastocyst (HB), PA XB, PA HB, and CT HB were performed using a custom microarray platform enriched for genes expressed during early embryonic development. Differential expressions of 1492 and 103 genes were identified in PA and CT HB, respectively, in comparison with IVV HB. The "eIF2 signalling", "mitochondrial dysfunction", "regulation of eIF4 and p70S6K signalling", "protein ubiquitination", and "mTOR signalling" pathways were down-regulated in PA HB. Dysregulation of notch signalling-associated genes were observed in both PA and CT HB. TP53 was predicted to be activated in both PA and CT HB, as 136 and 23 regulation targets of TP53 showed significant differential expression in PA and CT HB, respectively, in comparison with IVV HB. In addition, dysregulations of several critical pluripotency, trophoblast development, and implantation-associated genes (NANOG, GATA2, KRT8, LGMN, and DPP4) were observed in PA HB during the blastocyst hatching process. The critical genes that were observed to be dysregulated in CT and PA embryos could be indicative of underlying developmental deficiencies of embryos produced from these technologies.

Transcriptomic Analysis Reveals Mechanisms of Sterile and Fertile Flower Differentiation and Development in Viburnum macrocephalum f. keteleeri

PubMed Central

Lu, Zhaogeng; Xu, Jing; Li, Weixing; Zhang, Li; Cui, Jiawen; He, Qingsong; Wang, Li; Jin, Biao

2017-01-01

Sterile and fertile flowers are an important evolutionary developmental (evo-devo) phenotype in angiosperm flowers, playing important roles in pollinator attraction and sexual reproductive success. However, the gene regulatory mechanisms underlying fertile and sterile flower differentiation and development remain largely unknown. Viburnum macrocephalum f. keteleeri, which possesses fertile and sterile flowers in a single inflorescence, is a useful candidate species for investigating the regulatory networks in differentiation and development. We developed a de novo-assembled flower reference transcriptome. Using RNA sequencing (RNA-seq), we compared the expression patterns of fertile and sterile flowers isolated from the same inflorescence over its rapid developmental stages. The flower reference transcriptome consisted of 105,683 non-redundant transcripts, of which 5,675 transcripts showed significant differential expression between fertile and sterile flowers. Combined with morphological and cytological changes between fertile and sterile flowers, we identified expression changes of many genes potentially involved in reproductive processes, phytohormone signaling, and cell proliferation and expansion using RNA-seq and qRT-PCR. In particular, many transcription factors (TFs), including MADS-box family members and ABCDE-class genes, were identified, and expression changes in TFs involved in multiple functions were analyzed and highlighted to determine their roles in regulating fertile and sterile flower differentiation and development. Our large-scale transcriptional analysis of fertile and sterile flowers revealed the dynamics of transcriptional networks and potentially key components in regulating differentiation and development of fertile and sterile flowers in Viburnum macrocephalum f. keteleeri. Our data provide a useful resource for Viburnum transcriptional research and offer insights into gene regulation of differentiation of diverse evo-devo processes in flowers. PMID:28298915

Expression and functional analyses of a Kinesin gene GhKIS13A1 from cotton (Gossypium hirsutum) fiber.

PubMed

Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie

2017-06-12

Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.

Regulation of the neurotensin NT1 receptor in the developing rat brain following chronic treatment with the antagonist SR 48692

PubMed Central

Lépée-Lorgeoux, Isabelle; Betancur, Catalina; Souazé, Frédérique; Rostène, William; Bérod, Anne; Pélaprat, Didier

2000-01-01

The aim of the present study was to investigate the role of neurotensin in the regulation of NT1 receptors during postnatal development in the rat brain. Characterization of the ontogeny of neurotensin concentration and [125I]neurotensin binding to NT1 receptors in the brain at different embryonic and postnatal stages showed that neurotensin was highly expressed at birth, reaching peak levels at postnatal day 5 (P5), and decreasing thereafter. The transient rise in neurotensin levels preceded the maximal expression of NT1 receptors, observed at P10, suggesting that neurotensin may influence the developmental profile of NT1 receptors. Using primary cultures of cerebral cortex neurons from fetal rats, we showed that exposure to the neurotensin agonist JMV 449 (1 nM) decreased (−43%) the amount of NT1 receptor mRNA measured by reverse transcription-PCR, an effect that was abolished by the non-peptide NT1 receptor antagonist SR 48692 (1 μM). However, daily injection of SR 48692 to rat pups from birth for 5, 9 or 15 days, did not modify [125I]neurotensin binding in brain membrane homogenates. Moreover, postnatal blockade of neurotensin transmission did not alter the density and distribution of NT1 receptors assessed by quantitative autoradiography nor NT1 receptor mRNA expression measured by in situ hybridization in the cerebral cortex, caudate-putamen and midbrain. These results suggest that although NT1 receptor expression can be regulated in vitro by the agonist at an early developmental stage, neurotensin is not a major factor in the establishment of the ontogenetic pattern of these receptors in the rat brain. PMID:10797539

Neuropeptides: Developmental Signals in Placode Progenitor Formation

PubMed Central

Lleras-Forero, Laura; Tambalo, Monica; Christophorou, Nicolas; Chambers, David; Houart, Corinne; Streit, Andrea

2013-01-01

Summary Few families of signaling factors have been implicated in the control of development. Here, we identify the neuropeptides nociceptin and somatostatin, a neurotransmitter and neuroendocrine hormone, as a class of developmental signals in both chick and zebrafish. We show that signals from the anterior mesendoderm are required for the formation of anterior placode progenitors, with one of the signals being somatostatin. Somatostatin controls ectodermal expression of nociceptin, and both peptides regulate Pax6 in lens and olfactory progenitors. Consequently, loss of somatostatin and nociceptin signaling leads to severe reduction of lens formation. Our findings not only uncover these neuropeptides as developmental signals but also identify a long-sought-after mechanism that initiates Pax6 in placode progenitors and may explain the ancient evolutionary origin of neuropeptides, predating a complex nervous system. PMID:23906067

Transcriptome analysis at four developmental stages of grape berry (Vitis vinifera cv. Shiraz) provides insights into regulated and coordinated gene expression

PubMed Central

2012-01-01

Background Vitis vinifera berry development is characterised by an initial phase where the fruit is small, hard and acidic, followed by a lag phase known as veraison. In the final phase, berries become larger, softer and sweeter and accumulate an array of organoleptic compounds. Since the physiological and biochemical makeup of grape berries at harvest has a profound impact on the characteristics of wine, there is great interest in characterising the molecular and biophysical changes that occur from flowering through veraison and ripening, including the coordination and temporal regulation of metabolic gene pathways. Advances in deep-sequencing technologies, combined with the availability of increasingly accurate V. vinifera genomic and transcriptomic data, have enabled us to carry out RNA-transcript expression analysis on a global scale at key points during berry development. Results A total of 162 million 100-base pair reads were generated from pooled Vitis vinifera (cv. Shiraz) berries sampled at 3-weeks post-anthesis, 10- and 11-weeks post-anthesis (corresponding to early and late veraison) and at 17-weeks post-anthesis (harvest). Mapping reads from each developmental stage (36-45 million) onto the NCBI RefSeq transcriptome of 23,720 V. vinifera mRNAs revealed that at least 75% of these transcripts were detected in each sample. RNA-Seq analysis uncovered 4,185 transcripts that were significantly upregulated at a single developmental stage, including 161 transcription factors. Clustering transcripts according to distinct patterns of transcription revealed coordination in metabolic pathways such as organic acid, stilbene and terpenoid metabolism. From the phenylpropanoid/stilbene biosynthetic pathway at least 46 transcripts were upregulated in ripe berries when compared to veraison and immature berries, and 12 terpene synthases were predominantly detected only in a single sample. Quantitative real-time PCR was used to validate the expression pattern of 12 differentially expressed genes from primary and secondary metabolic pathways. Conclusions In this study we report the global transcriptional profile of Shiraz grapes at key stages of development. We have undertaken a comprehensive analysis of gene families contributing to commercially important berry characteristics and present examples of co-regulation and differential gene expression. The data reported here will provide an invaluable resource for the on-going molecular investigation of wine grapes. PMID:23227855

Drosophila Fragile X Mental Retardation Protein Developmentally Regulates Activity-Dependent Axon Pruning

PubMed Central

Tessier, Charles R.; Broadie, Kendal

2014-01-01

Summary Fragile X Syndrome (FraX) is a broad-spectrum neurological disorder with symptoms ranging from hyperexcitability to mental retardation and autism. Loss of the fragile X mental retardation 1 (fmr1) gene product, the mRNA-binding translational regulator FMRP, causes structural over-elaboration of dendritic and axonal processes as well as functional alterations in synaptic plasticity at maturity. It is unclear, however, whether FraX is primarily a disease of development, a disease of plasticity or both; a distinction vital for engineering intervention strategies. To address this critical issue, we have used the Drosophila FraX model to investigate the developmental roles of Drosophila FMRP (dFMRP). dFMRP expression and regulation of chickadee/profilin coincides with a transient window of late brain development. During this time, dFMRP is positively regulated by sensory input activity, and required to limit axon growth and for efficient activity-dependent pruning of axon branches in the Mushroom Body learning/memory center. These results demonstrate that dFMRP has a primary role in activity-dependent neural circuit refinement in late brain development. PMID:18321984

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TAF-4.

PubMed

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling

2008-10-03

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TFIID component TAF-4

PubMed Central

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M.; Lin, Rueyling

2008-01-01

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1–P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres, but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II following fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wildtype OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators. PMID:18854162

Forkhead Transcription Factor Fd3F Cooperates with Rfx to Regulate a Gene Expression Program for Mechanosensory Cilia Specialization

PubMed Central

Newton, Fay G.; zur Lage, Petra I.; Karak, Somdatta; Moore, Daniel J.; Göpfert, Martin C.; Jarman, Andrew P.

2012-01-01

Summary Cilia have evolved hugely diverse structures and functions to participate in a wide variety of developmental and physiological processes. Ciliary specialization requires differences in gene expression, but few transcription factors are known to regulate this, and their molecular function is unclear. Here, we show that the Drosophila Forkhead box (Fox) gene, fd3F, is required for specialization of the mechanosensory cilium of chordotonal (Ch) neurons. fd3F regulates genes for Ch-specific axonemal dyneins and TRPV ion channels, which are required for sensory transduction, and retrograde transport genes, which are required to differentiate their distinct motile and sensory ciliary zones. fd3F is reminiscent of vertebrate Foxj1, a motile cilia regulator, but fd3F regulates motility genes as part of a broader sensory regulation program. Fd3F cooperates with the pan-ciliary transcription factor, Rfx, to regulate its targets directly. This illuminates pathways involved in ciliary specialization and the molecular mechanism of transcription factors that regulate them. PMID:22698283

45 CFR 1385.2 - Purpose of the regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

Early Developmental Disturbances of Cortical Inhibitory Neurons: Contribution to Cognitive Deficits in Schizophrenia

PubMed Central

Volk, David W.; Lewis, David A.

2014-01-01

Cognitive dysfunction is a disabling and core feature of schizophrenia. Cognitive impairments have been linked to disturbances in inhibitory (gamma-aminobutyric acid [GABA]) neurons in the prefrontal cortex. Cognitive deficits are present well before the onset of psychotic symptoms and have been detected in early childhood with developmental delays reported during the first year of life. These data suggest that the pathogenetic process that produces dysfunction of prefrontal GABA neurons in schizophrenia may be related to altered prenatal development. Interestingly, adult postmortem schizophrenia brain tissue studies have provided evidence consistent with a disease process that affects different stages of prenatal development of specific subpopulations of prefrontal GABA neurons. Prenatal ontogeny (ie, birth, proliferation, migration, and phenotypic specification) of distinct subpopulations of cortical GABA neurons is differentially regulated by a host of transcription factors, chemokine receptors, and other molecular markers. In this review article, we propose a strategy to investigate how alterations in the expression of these developmental regulators of subpopulations of cortical GABA neurons may contribute to the pathogenesis of cortical GABA neuron dysfunction and consequently cognitive impairments in schizophrenia. PMID:25053651

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Developmental effects on ureide levels are mediated by tissue-specific regulation of allantoinase in Phaseolus vulgaris L.

PubMed

Díaz-Leal, Juan Luis; Gálvez-Valdivieso, Gregorio; Fernández, Javier; Pineda, Manuel; Alamillo, Josefa M

2012-06-01

The ureides allantoin and allantoate are key molecules in the transport and storage of nitrogen in ureide legumes. In shoots and leaves from Phaseolus vulgaris plants using symbiotically fixed nitrogen as the sole nitrogen source, ureide levels were roughly equivalent to those of nitrate-supported plants during the whole vegetative stage, but they exhibited a sudden increase at the onset of flowering. This rise in the level of ureides, mainly in the form of allantoate, was accompanied by increases in allantoinase gene expression and enzyme activity, consistent with developmental regulation of ureide levels mainly through the tissue-specific induction of allantoate synthesis catalysed by allantoinase. Moreover, surprisingly high levels of ureides were also found in non-nodulated plants fertilized with nitrate, at both early and late developmental stages. The results suggest that remobilized N from lower leaves is probably involved in the sharp rise in ureides in shoots and leaves during early pod filling in N(2)-fixing plants and in the significant amounts of ureides observed in non-nodulated plants.

Maturation of the growth axis in marsupials occurs gradually during post-natal life and over an equivalent developmental stage relative to eutherian species.

PubMed

Menzies, Brandon R; Shaw, Geoffrey; Fletcher, Terry P; Pask, Andrew J; Renfree, Marilyn B

2012-02-26

The separation of a nutrition-responsive insulin-like growth factor (IGF) system and a growth hormone (GH) responsive IGF system to control pre- and post-natal growth of developing mammals may originate from the constraints imposed by intra-uterine development. In eutherian species that deliver relatively precocial young, maturation of the GH regulatory system is coincident with the time of birth. We measured the hepatic expression of the four key growth axis genes GH-receptor, IGF-1 and -2, and IGFBBP-3, and plasma protein concentrations of IGF-1 from late fetal life through to adult stages of a marsupial, the tammar wallaby. The data clearly show that maturation of GH-regulated growth in marsupials occurs gradually over the course of post-natal life at an equivalent developmental stage to that of precocial eutherian mammals. This suggests that the timing of GH-regulated growth in marsupials is not related to parturition but instead to the relative developmental stage. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus.

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

2017-03-01

To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P<0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48h LD10 and LD50 were 1.35 and 1.84kJ/m 2 , and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5kJ/m 2 ) induced developmental delays, and higher doses (6-18kJ/m 2 ) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12kJ/m 2 ) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.

Melanopsin photoreception in the eye regulates light-induced skin colour changes through the production of α-MSH in the pituitary gland.

PubMed

Bertolesi, Gabriel E; Hehr, Carrie L; McFarlane, Sarah

2015-09-01

How skin colour adjusts to circadian light/dark cycles is poorly understood. Melanopsin (Opn4) is expressed in melanophores, where in vitro studies suggest it regulates skin pigmentation through a 'primary colour response' in which light photosensitivity is translated directly into pigment movement. However, the entrainment of the circadian rhythm is regulated by a population of melanopsin-expressing retinal ganglion cells (mRGCs) in the eye. Therefore, in vivo, melanopsin may trigger a 'secondary colour response' initiated in the eye and controlled by the neuro-endocrine system. We analysed the expression of opn4m and opn4x and melanin aggregation induced by light (background adaptation) in Xenopus laevis embryos. While opn4m and opn4x are expressed at early developmental times, light-induced pigment aggregation requires the eye to become functional. Pharmacological inhibition of melanopsin suggests a model whereby mRGC activation lightens skin pigmentation via a secondary response involving negative regulation of alpha-melanocyte-stimulating hormone (α-MSH) secretion by the pituitary. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

PubMed

Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

2018-04-15

The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs).

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Han, Jeonghoon; Kim, Hui-Su; Hwang, Dae-Sik; Lee, Jae-Seong

2017-02-01

Ecdysteroid hormones are pivotal in the development, growth, and molting of arthropods, and the hormone pathway is triggered by binding ecdysteroid to a heterodimer of the two nuclear receptors; ecdysone receptors (EcR) and ultraspiracle (USP). We have characterized EcR and USP genes, and their 5'-untranslated region (5'-UTR) from the copepod Paracyclopina nana, and studied mRNA transcription levels in post-embryonic stages and in response to water accommodated fractions (WAFs) of crude oil. The open reading frames (ORF) of EcR and USP were 1470 and 1287bp that encoded 490 and 429 amino acids with molecular weight of 121.18 and 105.03kDa, respectively. Also, a well conserved DNA-binding domain (DBD) and ligand-binding domain (LBD) were identified which confirmed by phylogenetic analysis. Messenger RNA transcriptional levels of EcR and USP were developmental stage-specific in early post-embryonic stages (N3-4). However, an evoked expression of USP was observed throughout copepodid stage and in adult females. WAFs (40 and 80%) were acted as an ecdysone agonist in P. nana, and elicited the mRNA transcription levels in adults. Developmental stage-specific transcriptional activation of EcR and USP in response to WAFs was observed. USP gene was down-regulated in the nauplius in response to WAF, whereas up-regulation of USP was observed in the adults. This study represents the first data of molecular elucidation of EcR and USP genes and their regulatory elements from P. nana and the developmental stage specific expression in response to WAFs, which can be used as potential biomarkers for environmental stressors with ecotoxicological evaluations in copepods. Copyright © 2016 Elsevier Inc. All rights reserved.

Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni.

PubMed

Neumann, S; Ziv, E; Lantner, F; Schechter, I

1993-03-01

Analyses of RNA from different developmental stages of Schistosoma mansoni showed stage-specific expression of heat-shock protein 70 (hsp70), which is regulated by a developmental program and by stress. The developmental program, common to hsp70 and other genes (e.g. paramyosin), refers to constitutive expression in miracidia sporocyst and adult worm but not in cercariae, and to the termination of hsp70 gene transcription during sporocyst/cercaria transformation. Stress induction, specific to hsp70, refers to transient accumulation of high levels of hsp70 mRNA during cercariae/schistosomula transformation and in adult worms after heat shock (42 degrees C). Cercariae/schistosomula transformation can be visualized as a physiological stress involving shifts in temperature (23-37 degrees C) and in salt concentration (from water to isotonic medium), as well as removal of tails from cercariae to yield isolated bodies that transform into schistosomula. It was found that temperature is an important factor, but not sufficient for strong induction of the hsp70 genes of schistosomula. Tail removal is an obligatory step for full induction of the hsp70 genes of schistosomula, in response to a temperature shift from 23-37 degrees C. The hsp70 genes in cercariae and isolated tails do not respond to stimuli (salt and temperature increases) that strongly activate the genes in isolated bodies (i.e., schistosomula). We speculate that the hsp70 genes in intact cercariae are not inducible because the tails can produce inhibitory signals that diffuse to the bodies and suppress their hsp70 genes. This hypothesis is useful to explain the termination of hsp70 gene transcription during sporocyst/cercaria transformation by the inhibitory effect of the growing tail.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

PubMed

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.)

PubMed Central

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries (Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm—plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus. These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop. PMID:28659963

Hyper-activation of the TCP4 transcription factor in Arabidopsis thaliana accelerates multiple aspects of plant maturation.

PubMed

Sarvepalli, Kavitha; Nath, Utpal

2011-08-01

Plant organs are initiated as primordial outgrowths, and require controlled cell division and differentiation to achieve their final size and shape. Superimposed on this is another developmental program that orchestrates the switch from vegetative to reproductive to senescence stages in the life cycle. These require sequential function of heterochronic regulators. Little is known regarding the coordination between organ and organismal growth in plants. The TCP gene family encodes transcription factors that control diverse developmental traits, and a subgroup of class II TCP genes regulate leaf morphogenesis. Absence of these genes results in large, crinkly leaves due to excess division, mainly at margins. It has been suggested that these class II TCPs modulate the spatio-temporal control of differentiation in a growing leaf, rather than regulating cell proliferation per se. However, the link between class II TCP action and cell growth has not been established. As loss-of-function mutants of individual TCP genes in Arabidopsis are not very informative due to gene redundancy, we generated a transgenic line that expressed a hyper-activated form of TCP4 in its endogenous expression domain. This resulted in premature onset of maturation and decreased cell proliferation, leading to much smaller leaves, with cup-shaped lamina in extreme cases. Further, the transgenic line initiated leaves faster than wild-type and underwent precocious reproductive maturation due to a shortened adult vegetative phase. Early senescence and severe fertility defects were also observed. Thus, hyper-activation of TCP4 revealed its role in determining the timing of crucial developmental events, both at the organ and organism level. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

PubMed Central

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Hypoxia regulates microRNA expression in the human carotid body

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mkrtchian, Souren, E-mail: souren.mkrtchian@ki.se; Lee, Kian Leong, E-mail: csilkl@nus.edu.sg; Kåhlin, Jessica

The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentiallymore » regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.« less

A quantitative validated model reveals two phases of transcriptional regulation for the gap gene giant in Drosophila.

PubMed

Hoermann, Astrid; Cicin-Sain, Damjan; Jaeger, Johannes

2016-03-15

Understanding eukaryotic transcriptional regulation and its role in development and pattern formation is one of the big challenges in biology today. Most attempts at tackling this problem either focus on the molecular details of transcription factor binding, or aim at genome-wide prediction of expression patterns from sequence through bioinformatics and mathematical modelling. Here we bridge the gap between these two complementary approaches by providing an integrative model of cis-regulatory elements governing the expression of the gap gene giant (gt) in the blastoderm embryo of Drosophila melanogaster. We use a reverse-engineering method, where mathematical models are fit to quantitative spatio-temporal reporter gene expression data to infer the regulatory mechanisms underlying gt expression in its anterior and posterior domains. These models are validated through prediction of gene expression in mutant backgrounds. A detailed analysis of our data and models reveals that gt is regulated by domain-specific CREs at early stages, while a late element drives expression in both the anterior and the posterior domains. Initial gt expression depends exclusively on inputs from maternal factors. Later, gap gene cross-repression and gt auto-activation become increasingly important. We show that auto-regulation creates a positive feedback, which mediates the transition from early to late stages of regulation. We confirm the existence and role of gt auto-activation through targeted mutagenesis of Gt transcription factor binding sites. In summary, our analysis provides a comprehensive picture of spatio-temporal gene regulation by different interacting enhancer elements for an important developmental regulator. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Promoter-Specific Expression and Imprint Status of Marsupial IGF2

PubMed Central

Stringer, Jessica M.; Suzuki, Shunsuke; Pask, Andrew J.; Shaw, Geoff; Renfree, Marilyn B.

2012-01-01

In mice and humans, IGF2 has multiple promoters to maintain its complex tissue- and developmental stage-specific imprinting and expression. IGF2 is also imprinted in marsupials, but little is known about its promoter region. In this study, three IGF2 transcripts were isolated from placental and liver samples of the tammar wallaby, Macropus eugenii. Each transcript contained a unique 5' untranslated region, orthologous to the non-coding exons derived from promoters P1–P3 in the human and mouse IGF2 locus. The expression of tammar IGF2 was predominantly from the P2 promoter, similar to humans. Expression of IGF2 was higher in pouch young than in the adult and imprinting was highly tissue and developmental-stage specific. Interestingly, while IGF2 was expressed throughout the placenta, imprinting seemed to be restricted to the vascular, trilaminar region. In addition, IGF2 was monoallelically expressed in the adult mammary gland while in the liver it switched from monoalleleic expression in the pouch young to biallelic in the adult. These data suggest a complex mode of IGF2 regulation in marsupials as seen in eutherian mammals. The conservation of the IGF2 promoters suggests they originated before the divergence of marsupials and eutherians, and have been selectively maintained for at least 160 million years. PMID:22848567

Gene Expression Data from the Moon Jelly, Aurelia, Provide Insights into the Evolution of the Combinatorial Code Controlling Animal Sense Organ Development.

PubMed

Nakanishi, Nagayasu; Camara, Anthony C; Yuan, David C; Gold, David A; Jacobs, David K

2015-01-01

In Bilateria, Pax6, Six, Eya and Dach families of transcription factors underlie the development and evolution of morphologically and phyletically distinct eyes, including the compound eyes in Drosophila and the camera-type eyes in vertebrates, indicating that bilaterian eyes evolved under the strong influence of ancestral developmental gene regulation. However the conservation in eye developmental genetics deeper in the Eumetazoa, and the origin of the conserved gene regulatory apparatus controlling eye development remain unclear due to limited comparative developmental data from Cnidaria. Here we show in the eye-bearing scyphozoan cnidarian Aurelia that the ectodermal photosensory domain of the developing medusa sensory structure known as the rhopalium expresses sine oculis (so)/six1/2 and eyes absent/eya, but not optix/six3/6 or pax (A&B). In addition, the so and eya co-expression domain encompasses the region of active cell proliferation, neurogenesis, and mechanoreceptor development in rhopalia. Consistent with the role of so and eya in rhopalial development, developmental transcriptome data across Aurelia life cycle stages show upregulation of so and eya, but not optix or pax (A&B), during medusa formation. Moreover, pax6 and dach are absent in the Aurelia genome, and thus are not required for eye development in Aurelia. Our data are consistent with so and eya, but not optix, pax or dach, having conserved functions in sensory structure specification across Eumetazoa. The lability of developmental components including Pax genes relative to so-eya is consistent with a model of sense organ development and evolution that involved the lineage specific modification of a combinatorial code that specifies animal sense organs.

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance.

PubMed

Rath, Martin F; Rohde, Kristian; Klein, David C; Møller, Morten

2013-06-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell.

Transcriptome analyses reveal genotype- and developmental stage-specific molecular responses to drought and salinity stresses in chickpea

PubMed Central

Garg, Rohini; Shankar, Rama; Thakkar, Bijal; Kudapa, Himabindu; Krishnamurthy, Lakshmanan; Mantri, Nitin; Varshney, Rajeev K.; Bhatia, Sabhyata; Jain, Mukesh

2016-01-01

Drought and salinity are the major factors that limit chickpea production worldwide. We performed whole transcriptome analyses of chickpea genotypes to investigate the molecular basis of drought and salinity stress response/adaptation. Phenotypic analyses confirmed the contrasting responses of the chickpea genotypes to drought or salinity stress. RNA-seq of the roots of drought and salinity related genotypes was carried out under control and stress conditions at vegetative and/or reproductive stages. Comparative analysis of the transcriptomes revealed divergent gene expression in the chickpea genotypes at different developmental stages. We identified a total of 4954 and 5545 genes exclusively regulated in drought-tolerant and salinity-tolerant genotypes, respectively. A significant fraction (~47%) of the transcription factor encoding genes showed differential expression under stress. The key enzymes involved in metabolic pathways, such as carbohydrate metabolism, photosynthesis, lipid metabolism, generation of precursor metabolites/energy, protein modification, redox homeostasis and cell wall component biogenesis, were affected by drought and/or salinity stresses. Interestingly, transcript isoforms showed expression specificity across the chickpea genotypes and/or developmental stages as illustrated by the AP2-EREBP family members. Our findings provide insights into the transcriptome dynamics and components of regulatory network associated with drought and salinity stress responses in chickpea. PMID:26759178

Homeobox genes in the rodent pineal gland: roles in development and phenotype maintenance

PubMed Central

Rath, Martin F.; Rohde, Kristian; Klein, David C.; Møller, Morten

2012-01-01

The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function. A working model is proposed for understanding the sequential action of homeobox genes in controlling development and mature circadian function of the mammalian pinealocyte based on knowledge from detailed developmental and daily gene expression analyses in rats, the pineal phenotypes of homebox gene-deficient mice and studies on development of the retinal photoreceptor; the pinealocyte and retinal photoreceptor share features not seen in other tissues and are likely to have evolved from the same ancestral photodetector cell. PMID:23076630

Interspecies modulation of bacterial development through iron competition and siderophore piracy

PubMed Central

Traxler, Matthew F.; Seyedsayamdost, Mohammad R.; Clardy, Jon; Kolter, Roberto

2012-01-01

Summary While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key down-stream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were down-regulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. PMID:22931126

Hormone-dependent control of developmental timing through regulation of chromatin accessibility

PubMed Central

Uyehara, Christopher M.; Nystrom, Spencer L.; Niederhuber, Matthew J.; Leatham-Jensen, Mary; Ma, Yiqin; Buttitta, Laura A.

2017-01-01

Specification of tissue identity during development requires precise coordination of gene expression in both space and time. Spatially, master regulatory transcription factors are required to control tissue-specific gene expression programs. However, the mechanisms controlling how tissue-specific gene expression changes over time are less well understood. Here, we show that hormone-induced transcription factors control temporal gene expression by regulating the accessibility of DNA regulatory elements. Using the Drosophila wing, we demonstrate that temporal changes in gene expression are accompanied by genome-wide changes in chromatin accessibility at temporal-specific enhancers. We also uncover a temporal cascade of transcription factors following a pulse of the steroid hormone ecdysone such that different times in wing development can be defined by distinct combinations of hormone-induced transcription factors. Finally, we show that the ecdysone-induced transcription factor E93 controls temporal identity by directly regulating chromatin accessibility across the genome. Notably, we found that E93 controls enhancer activity through three different modalities, including promoting accessibility of late-acting enhancers and decreasing accessibility of early-acting enhancers. Together, this work supports a model in which an extrinsic signal triggers an intrinsic transcription factor cascade that drives development forward in time through regulation of chromatin accessibility. PMID:28536147

Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

PubMed

Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

2013-03-01

Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

Divergent methylation pattern in adult stage between two forms of Tetranychus urticae (Acari: Tetranychidae).

PubMed

Yang, Si-Xia; Guo, Chao; Zhao, Xiu-Ting; Sun, Jing-Tao; Hong, Xiao-Yue

2017-02-19

The two-spotted spider mite, Tetranychus urticae Koch has two forms: green form and red form. Understanding the molecular basis of how these two forms established without divergent genetic background is an intriguing area. As a well-known epigenetic process, DNA methylation has particularly important roles in gene regulation and developmental variation across diverse organisms that do not alter genetic background. Here, to investigate whether DNA methylation could be associated with different phenotypic consequences in the two forms of T. urticae, we surveyed the genome-wide cytosine methylation status and expression level of DNA methyltransferase 3 (Tudnmt3) throughout their entire life cycle. Methylation-sensitive amplification polymorphism (MSAP) analyses of 585 loci revealed variable methylation patterns in the different developmental stages. In particular, principal coordinates analysis (PCoA) indicates a significant epigenetic differentiation between female adults of the two forms. The gene expression of Tudnmt3 was detected in all examined developmental stages, which was significantly different in the adult stage of the two forms. Together, our results reveal the epigenetic distance between the two forms of T. urticae, suggesting that DNA methylation might be implicated in different developmental demands, and contribute to different phenotypes in the adult stage of these two forms. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Embryo Microinjection of Selenomethionine Reduces Hatchability and Modifies Oxidant Responsive Gene Expression in Zebrafish

NASA Astrophysics Data System (ADS)

Thomas, J. K.; Janz, D. M.

2016-05-01

In previous studies we demonstrated that exposure to selenomethionine (SeMet) causes developmental toxicities in zebrafish (Danio rerio). The objectives of this study were to establish a dose-response relationship for developmental toxicities in zebrafish after embryo microinjection of Se (8, 16 or 32 μg/g dry mass of eggs) in the form of SeMet, and to investigate potential underlying mechanism(s) of SeMet-induced developmental toxicities. A dose-dependent increase in frequencies of mortality and total deformities, and reduced hatchability were observed in zebrafish exposed to excess Se via embryo microinjection. The egg Se concentration causing 20% mortality was then used to investigate transcript abundance of proteins involved in antioxidant protection and methylation. Excess Se exposure modified gene expression of oxidant-responsive transcription factors (nuclear factor erythroid 2-related factor nrf2a and nrf2b), and enzymes involved in cellular methylation (methionine adenosyltransferase mat1a and mat2ab) in zebrafish larvae. Notably, excess Se exposure up-regulated transcript abundance of aryl hydrocarbon receptor 2 (ahr2), a signalling pathway involved in the toxicity of dioxin-related compounds. Our findings suggest that oxidative stress or modification of methylation, or a combination of these mechanisms, might be responsible for Se-induced developmental toxicities in fishes.

A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression

PubMed Central

Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.

2009-01-01

This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256

Differential gene expression related to Nora virus infection of Drosophila melanogaster

PubMed Central

Cordes, Ethan J.; Licking-Murray, Kellie D; Carlson, Kimberly A.

2013-01-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. PMID:23603562

An elt-3/elt-5/elt-6 GATA Transcription Circuit Guides Aging in C. elegans

PubMed Central

Budovskaya, Yelena V.; Wu, Kendall; Southworth, Lucinda K.; Jiang, Min; Tedesco, Patricia; Johnson, Thomas E.; Kim, Stuart K.

2016-01-01

SUMMARY To define the C. elegans aging process at the molecular level, we used DNA microarray experiments to identify a set of 1294 age-regulated genes and found that the GATA transcription factors ELT-3, ELT-5, and ELT-6 are responsible for age regulation of a large fraction of these genes. Expression of elt-5 and elt-6 increases during normal aging, and both of these GATA factors repress expression of elt-3, which shows a corresponding decrease in expression in old worms. elt-3 regulates a large number of downstream genes that change expression in old age, including ugt-9, col-144, and sod-3. elt-5(RNAi) and elt-6(RNAi) worms have extended longevity, indicating that elt-3, elt-5, and elt-6 play an important functional role in the aging process. These results identify a transcriptional circuit that guides the rapid aging process in C. elegans and indicate that this circuit is driven by drift of developmental pathways rather than accumulation of damage. PMID:18662544

Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation

PubMed Central

Ravens, Sarina; Fournier, Marjorie; Ye, Tao; Stierle, Matthieu; Dembele, Doulaye; Chavant, Virginie; Tora, Làszlò

2014-01-01

The histone acetyltransferase (HAT) Mof is essential for mouse embryonic stem cell (mESC) pluripotency and early development. Mof is the enzymatic subunit of two different HAT complexes, MSL and NSL. The individual contribution of MSL and NSL to transcription regulation in mESCs is not well understood. Our genome-wide analysis show that i) MSL and NSL bind to specific and common sets of expressed genes, ii) NSL binds exclusively at promoters, iii) while MSL binds in gene bodies. Nsl1 regulates proliferation and cellular homeostasis of mESCs. MSL is the main HAT acetylating H4K16 in mESCs, is enriched at many mESC-specific and bivalent genes. MSL is important to keep a subset of bivalent genes silent in mESCs, while developmental genes require MSL for expression during differentiation. Thus, NSL and MSL HAT complexes differentially regulate specific sets of expressed genes in mESCs and during differentiation. DOI: http://dx.doi.org/10.7554/eLife.02104.001 PMID:24898753

RNAi Functions in Adaptive Reprogramming of the Genome | Center for Cancer Research

Cancer.gov

The regulation of transcribing DNA into RNA, including the production, processing, and degradation of RNA transcripts, affects the expression and the regulation of the genome in ways that are just beginning to be unraveled. A surprising discovery in recent years is that the vast majority of the genome is transcribed to yield an abundance of RNA transcripts. Many transcripts are regulated by the exosome, a multi-protein complex that degrades RNAs, and may also be targeted, under certain conditions, by the RNA interference (RNAi) pathway. These RNA degrading activities can recruit factors to silence certain regions of the genome by condensing the DNA into tightly-packed heterochromatin. For some chromosomal regions, such as centromeres and telomeres, which lie at the center and ends of chromosomes, respectively, silencing must be stably enforced through each cell generation. For other regions, silencing mechanisms must be easily reversible to activate gene expression in response to changing environmental or developmental conditions. Thus, the regulation of gene silencing is key to maintaining the integrity of the genome and proper cellular expression patterns, which, when disrupted can underlie many diseases, including cancer.

Repression of myoblast proliferation and fibroblast growth factor receptor 1 promoter activity by KLF10 protein.

PubMed

Parakati, Rajini; DiMario, Joseph X

2013-05-10

FGFR1 gene expression regulates myoblast proliferation and differentiation, and its expression is controlled by Krüppel-like transcription factors. KLF10 interacts with the FGFR1 promoter, repressing its activity and cell proliferation. KLF10 represses FGFR1 promoter activity and thereby myoblast proliferation. A model of transcriptional control of chicken FGFR1 gene regulation during myogenesis is presented. Skeletal muscle development is controlled by regulation of myoblast proliferation and differentiation into muscle fibers. Growth factors such as fibroblast growth factors (FGFs) and their receptors (FGFRs) regulate cell proliferation and differentiation in numerous tissues, including skeletal muscle. Transcriptional regulation of FGFR1 gene expression is developmentally regulated by the Sp1 transcription factor, a member of the Krüppel-like factor (KLF) family of transcriptional regulators. Here, we show that another KLF transcription factor, KLF10, also regulates myoblast proliferation and FGFR1 promoter activity. Expression of KLF10 reduced myoblast proliferation by 86%. KLF10 expression also significantly reduced FGFR1 promoter activity in myoblasts and Sp1-mediated FGFR1 promoter activity in Drosophila SL2 cells. Southwestern blot, electromobility shift, and chromatin immunoprecipitation assays demonstrated that KLF10 bound to the proximal Sp factor binding site of the FGFR1 promoter and reduced Sp1 complex formation with the FGFR1 promoter at that site. These results indicate that KLF10 is an effective repressor of myoblast proliferation and represses FGFR1 promoter activity in these cells via an Sp1 binding site.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Seung-Hwan; Kim, Dong-Young; Jing, Feifeng

Developmental endothelial locus-1 (Del-1) is an endogenous anti-inflammatory molecule that is highly expressed in the lung and the brain and limits leukocyte migration to these tissues. We previously reported that the expression of Del-1 is positively regulated by p53 in lung endothelial cells. Although several reports have implicated the altered expression of Del-1 gene in cancer patients, little is known about its role in tumor cells. We here investigated the effect of Del-1 on the features of human lung carcinoma cells. Del-1 mRNA was found to be significantly decreased in the human lung adenocarcinoma cell lines A549 (containing wild typemore » of p53), H1299 (null for p53) and EKVX (mutant p53), compared to in human normal lung epithelial BEAS-2B cells and MRC-5 fibroblasts. The decrease of Del-1 expression was dependent on the p53 activity in the cell lines, but not on the expression of p53. Neither treatment with recombinant human Del-1 protein nor the introduction of adenovirus expressing Del-1 altered the expression of the apoptosis regulators BAX, PUMA and Bcl-2. Unexpectedly, the adenovirus-mediated overexpression of Del-1 gene into the lung carcinoma cell lines promoted proliferation and invasion of the lung carcinoma cells, as revealed by BrdU incorporation and transwell invasion assays, respectively. In addition, overexpression of the Del-1 gene enhanced features of epithelial–mesenchymal transition (EMT), such as increasing vimentin while decreasing E-cadherin in A549 cells, and increases in the level of Slug, an EMT-associated transcription regulator. Our findings demonstrated for the first time that there are deleterious effects of high levels of Del-1 in lung carcinoma cells, and suggest that Del-1 may be used as a diagnostic or prognostic marker for cancer progression, and as a novel therapeutic target for lung carcinoma. - Highlights: • Developmental Endothelial Locus-1 (Del-1) expression is downregulated in human lung cancer cells. • Overexpression of the Del-1 gene potentiates proliferation and invasion of lung carcinoma cells. • Del-1 may be used as a diagnostic or prognostic marker for lung cancer progression.« less

In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

PubMed Central

Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

2014-01-01

Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

Tyrosine pathway regulation is host-mediated in the pea aphid symbiosis during late embryonic and early larval development.

PubMed

Rabatel, Andréane; Febvay, Gérard; Gaget, Karen; Duport, Gabrielle; Baa-Puyoulet, Patrice; Sapountzis, Panagiotis; Bendridi, Nadia; Rey, Marjolaine; Rahbé, Yvan; Charles, Hubert; Calevro, Federica; Colella, Stefano

2013-04-10

Nutritional symbioses play a central role in insects' adaptation to specialized diets and in their evolutionary success. The obligatory symbiosis between the pea aphid, Acyrthosiphon pisum, and the bacterium, Buchnera aphidicola, is no exception as it enables this important agricultural pest insect to develop on a diet exclusively based on plant phloem sap. The symbiotic bacteria provide the host with essential amino acids lacking in its diet but necessary for the rapid embryonic growth seen in the parthenogenetic viviparous reproduction of aphids. The aphid furnishes, in exchange, non-essential amino acids and other important metabolites. Understanding the regulations acting on this integrated metabolic system during the development of this insect is essential in elucidating aphid biology. We used a microarray-based approach to analyse gene expression in the late embryonic and the early larval stages of the pea aphid, characterizing, for the first time, the transcriptional profiles in these developmental phases. Our analyses allowed us to identify key genes in the phenylalanine, tyrosine and dopamine pathways and we identified ACYPI004243, one of the four genes encoding for the aspartate transaminase (E.C. 2.6.1.1), as specifically regulated during development. Indeed, the tyrosine biosynthetic pathway is crucial for the symbiotic metabolism as it is shared between the two partners, all the precursors being produced by B. aphidicola. Our microarray data are supported by HPLC amino acid analyses demonstrating an accumulation of tyrosine at the same developmental stages, with an up-regulation of the tyrosine biosynthetic genes. Tyrosine is also essential for the synthesis of cuticular proteins and it is an important precursor for cuticle maturation: together with the up-regulation of tyrosine biosynthesis, we observed an up-regulation of cuticular genes expression. We were also able to identify some amino acid transporter genes which are essential for the switch over to the late embryonic stages in pea aphid development. Our data show that, in the development of A. pisum, a specific host gene set regulates the biosynthetic pathways of amino acids, demonstrating how the regulation of gene expression enables an insect to control the production of metabolites crucial for its own development and symbiotic metabolism.

Nitric Oxide Mediates the Hormonal Control of Crassulacean Acid Metabolism Expression in Young Pineapple Plants1[W][OA

PubMed Central

Freschi, Luciano; Rodrigues, Maria Aurineide; Domingues, Douglas Silva; Purgatto, Eduardo; Van Sluys, Marie-Anne; Magalhaes, Jose Ronaldo; Kaiser, Werner M.; Mercier, Helenice

2010-01-01

Genotypic, developmental, and environmental factors converge to determine the degree of Crassulacean acid metabolism (CAM) expression. To characterize the signaling events controlling CAM expression in young pineapple (Ananas comosus) plants, this photosynthetic pathway was modulated through manipulations in water availability. Rapid, intense, and completely reversible up-regulation in CAM expression was triggered by water deficit, as indicated by the rise in nocturnal malate accumulation and in the expression and activity of important CAM enzymes. During both up- and down-regulation of CAM, the degree of CAM expression was positively and negatively correlated with the endogenous levels of abscisic acid (ABA) and cytokinins, respectively. When exogenously applied, ABA stimulated and cytokinins repressed the expression of CAM. However, inhibition of water deficit-induced ABA accumulation did not block the up-regulation of CAM, suggesting that a parallel, non-ABA-dependent signaling route was also operating. Moreover, strong evidence revealed that nitric oxide (NO) may fulfill an important role during CAM signaling. Up-regulation of CAM was clearly observed in NO-treated plants, and a conspicuous temporal and spatial correlation was also evident between NO production and CAM expression. Removal of NO from the tissues either by adding NO scavenger or by inhibiting NO production significantly impaired ABA-induced up-regulation of CAM, indicating that NO likely acts as a key downstream component in the ABA-dependent signaling pathway. Finally, tungstate or glutamine inhibition of the NO-generating enzyme nitrate reductase completely blocked NO production during ABA-induced up-regulation of CAM, characterizing this enzyme as responsible for NO synthesis during CAM signaling in pineapple plants. PMID:20147491

HDAC2 deregulation in tumorigenesis is causally connected to repression of immune modulation and defense escape

PubMed Central

Conte, Mariarosaria; Dell'Aversana, Carmela; Benedetti, Rosaria; Petraglia, Francesca; Carissimo, Annamaria; Petrizzi, Valeria Belsito; D'Arco, Alfonso Maria; Abbondanza, Ciro; Nebbioso, Angela; Altucci, Lucia

2015-01-01

Histone deacetylase 2 (HDAC2) is overexpressed or mutated in several disorders such as hematological cancers, and plays a critical role in transcriptional regulation, cell cycle progression and developmental processes. Here, we performed comparative transcriptome analyses in acute myeloid leukemia to investigate the biological implications of HDAC2 silencing versus its enzymatic inhibition using epigenetic-based drug(s). By gene expression analysis of HDAC2-silenced vs wild-type cells, we found that HDAC2 has a specific role in leukemogenesis. Gene expression profiling of U937 cell line with or without treatment of the well-known HDAC inhibitor vorinostat (SAHA) identifies and characterizes several gene clusters where inhibition of HDAC2 ‘mimics’ its silencing, as well as those where HDAC2 is selectively and exclusively regulated by HDAC2 protein expression levels. These findings may represent an important tool for better understanding the mechanisms underpinning immune regulation, particularly in the study of major histocompatibility complex class II genes. PMID:25473896

Developmental regulation of the gene for chimeric calcium/calmodulin-dependent protein kinase in anthers

NASA Technical Reports Server (NTRS)

Poovaiah, B. W.; Xia, M.; Liu, Z.; Wang, W.; Yang, T.; Sathyanarayanan, P. V.; Franceschi, V. R.

1999-01-01

Chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) was cloned from developing anthers of lily (Lilium longiflorum Thumb. cv. Nellie White) and tobacco (Nicotiana tabacum L. cv. Xanthi). Previous biochemical characterization and structure/function studies had revealed that CCaMK has dual modes of regulation by Ca(2+) and Ca(2+)/calmodulin. The unique structural features of CCaMK include a catalytic domain, a calmodulin-binding domain, and a neural visinin-like Ca(2+)-binding domain. The existence of these three features in a single polypeptide distinguishes it from other kinases. Western analysis revealed that CCaMK is expressed in a stage-specific manner in developing anthers. Expression of CCaMK was first detected in pollen mother cells and continued to increase, reaching a peak around the tetrad stage of meiosis. Following microsporogenesis, CCaMK expression rapidly decreased and at later stages of microspore development, no expression was detected. A tobacco genomic clone of CCaMK was isolated and transgenic tobacco plants were produced carrying the CCaMK promoter fused to the beta-glucuronidase reporter gene. Both CCaMK mRNA and protein were detected in the pollen sac and their localizations were restricted to the pollen mother cells and tapetal cells. Consistent results showing a stage-specific expression pattern were obtained by beta-glucuronidase analysis, in-situ hybridization and immunolocalization. The stage- and tissue-specific appearance of CCaMK in anthers suggests that it could play a role in sensing transient changes in free Ca(2+) concentration in target cells, thereby controlling developmental events in the anther.

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development1[OPEN

PubMed Central

2017-01-01

Rice (Oryza sativa) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1, a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. PMID:28500269

Dynamic Cytology and Transcriptional Regulation of Rice Lamina Joint Development.

PubMed

Zhou, Li-Juan; Xiao, Lang-Tao; Xue, Hong-Wei

2017-07-01

Rice ( Oryza sativa ) leaf angle is determined by lamina joint and is an important agricultural trait determining leaf erectness and, hence, the photosynthesis efficiency and grain yield. Genetic studies reveal a complex regulatory network of lamina joint development; however, the morphological changes, cytological transitions, and underlying transcriptional programming remain to be elucidated. A systemic morphological and cytological study reveals a dynamic developmental process and suggests a common but distinct regulation of the lamina joint. Successive and sequential cell division and expansion, cell wall thickening, and programmed cell death at the adaxial or abaxial sides form the cytological basis of the lamina joint, and the increased leaf angle results from the asymmetric cell proliferation and elongation. Analysis of the gene expression profiles at four distinct developmental stages ranging from initiation to senescence showed that genes related to cell division and growth, hormone synthesis and signaling, transcription (transcription factors), and protein phosphorylation (protein kinases) exhibit distinct spatiotemporal patterns during lamina joint development. Phytohormones play crucial roles by promoting cell differentiation and growth at early stages or regulating the maturation and senescence at later stages, which is consistent with the quantitative analysis of hormones at different stages. Further comparison with the gene expression profile of leaf inclination1 , a mutant with decreased auxin and increased leaf angle, indicates the coordinated effects of hormones in regulating lamina joint. These results reveal a dynamic cytology of rice lamina joint that is fine-regulated by multiple factors, providing informative clues for illustrating the regulatory mechanisms of leaf angle and plant architecture. © 2017 American Society of Plant Biologists. All Rights Reserved.

Comparative Analyses between Skeletal Muscle miRNAomes from Large White and Min Pigs Revealed MicroRNAs Associated with Postnatal Muscle Hypertrophy.

PubMed

Sheng, Xihui; Wang, Ligang; Ni, Hemin; Wang, Lixian; Qi, Xiaolong; Xing, Shuhan; Guo, Yong

2016-01-01

The molecular mechanism regulated by microRNAs (miRNAs) that underlies postnatal hypertrophy of skeletal muscle is complex and remains unclear. Here, the miRNAomes of longissimus dorsi muscle collected at five postnatal stages (60, 120, 150, 180, and 210 days after birth) from Large White (commercial breed) and Min pigs (indigenous breed of China) were analyzed by Illumina sequencing. We identified 734 miRNAs comprising 308 annotated miRNAs and 426 novel miRNAs, of which 307 could be considered pig-specific. Comparative analysis between two breeds suggested that 60 and 120 days after birth were important stages for skeletal muscle hypertrophy and intramuscular fat accumulation. A total of 263 miRNAs were significantly differentially expressed between two breeds at one or more developmental stages. In addition, the differentially expressed miRNAs between every two adjacent developmental stages in each breed were determined. Notably, ssc-miR-204 was significantly more highly expressed in Min pig skeletal muscle at all postnatal stages compared with its expression in Large White pig skeletal muscle. Based on gene ontology and KEGG pathway analyses of its predicted target genes, we concluded that ssc-miR-204 may exert an impact on postnatal hypertrophy of skeletal muscle by regulating myoblast proliferation. The results of this study will help in elucidating the mechanism underlying postnatal hypertrophy of skeletal muscle modulated by miRNAs, which could provide valuable information for improvement of pork quality and human myopathy.

Developmentally Regulated Sesquiterpene Production Confers Resistance to Colletotrichum gloeosporioides in Ripe Pepper Fruits

PubMed Central

Im, Soonduk; Han, Yun-Jeong; Lee, Sungbeom; Back, Kyoungwhan; Kim, Jeong-Il; Kim, Young Soon

2014-01-01

Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR) and squalene synthase (SS) genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS), belonging to a sesquiterpene cyclase (STC) family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA), resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits. PMID:25286411

Antagonistic Basic Helix-Loop-Helix/bZIP Transcription Factors Form Transcriptional Modules That Integrate Light and Reactive Oxygen Species Signaling in Arabidopsis[W

PubMed Central

Chen, Dongqin; Xu, Gang; Tang, Weijiang; Jing, Yanjun; Ji, Qiang; Fei, Zhangjun; Lin, Rongcheng

2013-01-01

The critical developmental switch from heterotrophic to autotrophic growth of plants involves light signaling transduction and the production of reactive oxygen species (ROS). ROS function as signaling molecules that regulate multiple developmental processes, including cell death. However, the relationship between light and ROS signaling remains unclear. Here, we identify transcriptional modules composed of the basic helix-loop-helix and bZIP transcription factors PHYTOCHROME-INTERACTING FACTOR1 (PIF1), PIF3, ELONGATED HYPOCOTYL5 (HY5), and HY5 HOMOLOGY (HYH) that bridge light and ROS signaling to regulate cell death and photooxidative response. We show that pif mutants release more singlet oxygen and exhibit more extensive cell death than the wild type during Arabidopsis thaliana deetiolation. Genome-wide expression profiling indicates that PIF1 represses numerous ROS and stress-related genes. Molecular and biochemical analyses reveal that PIF1/PIF3 and HY5/HYH physically interact and coordinately regulate the expression of five ROS-responsive genes by directly binding to their promoters. Furthermore, PIF1/PIF3 and HY5/HYH function antagonistically during the seedling greening process. In addition, phytochromes, cryptochromes, and CONSTITUTIVE PHOTOMORPHOGENIC1 act upstream to regulate ROS signaling. Together, this study reveals that the PIF1/PIF3-HY5/HYH transcriptional modules mediate crosstalk between light and ROS signaling and sheds light on a new mechanism by which plants adapt to the light environments. PMID:23645630

Comparison of a teratogenic transcriptome-based predictive test based on human embryonic versus inducible pluripotent stem cells.

PubMed

Shinde, Vaibhav; Perumal Srinivasan, Sureshkumar; Henry, Margit; Rotshteyn, Tamara; Hescheler, Jürgen; Rahnenführer, Jörg; Grinberg, Marianna; Meisig, Johannes; Blüthgen, Nils; Waldmann, Tanja; Leist, Marcel; Hengstler, Jan Georg; Sachinidis, Agapios

2016-12-30

Human embryonic stem cells (hESCs) partially recapitulate early embryonic three germ layer development, allowing testing of potential teratogenic hazards. Because use of hESCs is ethically debated, we investigated the potential for human induced pluripotent stem cells (hiPSCs) to replace hESCs in such tests. Three cell lines, comprising hiPSCs (foreskin and IMR90) and hESCs (H9) were differentiated for 14 days. Their transcriptome profiles were obtained on day 0 and day 14 and analyzed by comprehensive bioinformatics tools. The transcriptomes on day 14 showed that more than 70% of the "developmental genes" (regulated genes with > 2-fold change on day 14 compared to day 0) exhibited variability among cell lines. The developmental genes belonging to all three cell lines captured biological processes and KEGG pathways related to all three germ layer embryonic development. In addition, transcriptome profiles were obtained after 14 days of exposure to teratogenic valproic acid (VPA) during differentiation. Although the differentially regulated genes between treated and untreated samples showed more than 90% variability among cell lines, VPA clearly antagonized the expression of developmental genes in all cell lines: suppressing upregulated developmental genes, while inducing downregulated ones. To quantify VPA-disturbed development based on developmental genes, we estimated the "developmental potency" (D p ) and "developmental index" (D i ). Despite differences in genes deregulated by VPA, uniform D i values were obtained for all three cell lines. Given that the D i values for VPA were similar for hESCs and hiPSCs, D i can be used for robust hazard identification, irrespective of whether hESCs or hiPSCs are used in the test systems.

Sociogenomics of self vs. non-self cooperation during development of Dictyostelium discoideum.

PubMed

Li, Si I; Buttery, Neil J; Thompson, Christopher R L; Purugganan, Michael D

2014-07-21

Dictyostelium discoideum, a microbial model for social evolution, is known to distinguish self from non-self and show genotype-dependent behavior during chimeric development. Aside from a small number of cell-cell recognition genes, however, little is known about the genetic basis of self/non-self recognition in this species. Based on the key hypothesis that there should be differential expression of genes if D. discoideum cells were interacting with non-clone mates, we performed transcriptomic profiling study in this species during clonal vs. chimeric development. The transcriptomic profiles of D. discoideum cells in clones vs. different chimeras were compared at five different developmental stages using a customized microarray. Effects of chimerism on global transcriptional patterns associated with social interactions were observed. We find 1,759 genes significantly different between chimera and clone, 1,144 genes associated significant strain differences, and 6,586 genes developmentally regulated over time. Principal component analysis showed a small amount of the transcriptional variance to chimerism-related factors (Chimerism: 0.18%, Chimerism × Timepoint: 0.03%). There are 162 genes specifically regulated under chimeric development, with continuous small differences between chimera vs. clone over development. Almost 60% of chimera-associated differential genes were differentially expressed at the 4 h aggregate stage, which corresponds to the initial transition of D. discoideum from solitary life to a multicellular phase. A relatively small proportion of over-all variation in gene expression is explained by differences between chimeric and clonal development. The relatively small modifications in gene expression associated with chimerism is compatible with the high level of cooperation observed among different strains of D. discoideum; cells of distinct genetic backgrounds will co-aggregate indiscriminately and co-develop into fruiting bodies. Chimeric development may involve re-programming of the transcriptome through small modifications of the developmental genetic network, which may also indicate that response to social interaction involves many genes with individually small transcriptional effect.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

PubMed

Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

2008-01-07

Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function.

PubMed

Bagley, Joshua A; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill; Jan, Lily Yeh; Jan, Yuh Nung

2014-09-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the "histone code," in regulating dendrite morphology. © 2014 Bagley et al.; Published by Cold Spring Harbor Laboratory Press.

Cerebellum: links between development, developmental disorders and motor learning

PubMed Central

Manto, Mario U.; Jissendi, Patrice

2012-01-01

The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodeling are being unraveled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signaling between granule cells and Purkinje neurons. The expression profile of sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired developments and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders. PMID:22291620

A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

PubMed

Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

2013-11-06

Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

Sequence and Expression Characteristics of Long Noncoding RNAs in Honey Bee Caste Development – Potential Novel Regulators for Transgressive Ovary Size

PubMed Central

Humann, Fernanda C.; Tiberio, Gustavo J.; Hartfelder, Klaus

2013-01-01

Division of labor in social insect colonies relies on a strong reproductive bias that favors queens. Although the ecological and evolutionary success attained through caste systems is well sketched out in terms of ultimate causes, the molecular and cellular underpinnings driving the development of caste phenotypes are still far from understood. Recent genomics approaches on honey bee developmental biology revealed a set of genes that are differentially expressed genes in larval ovaries and associated with transgressive ovary size in queens and massive cell death in workers. Amongst these, two contigs called special attention, both being over 200 bp in size and lacking apparent coding potential. Herein, we obtained their full cDNA sequences. These and their secondary structure characteristics placed in evidence that they are bona fide long noncoding RNAs (lncRNA) differentially expressed in larval ovaries, thus named lncov1 and lncov2. Genomically, both map within a previously identified QTL on chromosome 11, associated with transgressive ovary size in honey bee workers. As lncov1 was over-expressed in worker ovaries we focused on this gene. Real-time qPCR analysis on larval worker ovaries evidenced an expression peak coinciding with the onset of autophagic cell death. Cellular localization analysis through fluorescence in situ hybridization revealed perinuclear spots resembling omega speckles known to regulate trafficking of RNA-binding proteins. With only four lncRNAs known so far in honey bees, two expressed in the ovaries, these findings open a novel perspective on regulatory factors acting in the fine tuning of developmental processes underlying phenotypic plasticity related to social life histories. PMID:24205350